CN117143806B

CN117143806B - Cell line of garrupa fries, construction method and application thereof

Info

Publication number: CN117143806B
Application number: CN202311344793.4A
Authority: CN
Inventors: 黄晓红; 郑家颖; 黄友华; 秦启伟; 刘梦珂
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2023-10-18
Filing date: 2023-10-18
Publication date: 2024-02-23
Anticipated expiration: 2043-10-18
Also published as: CN117143806A

Abstract

The invention discloses a garrupa larval fish cell line and a construction method and application thereof. The garrupa larval fish cell line (ECFry) is obtained through primary culture and subculture construction, and is preserved in the Guangdong province microorganism strain preservation center (GDMCC) at 24 days of 6 months of 2022, wherein the preservation number is as follows: GDMCC No:62561. the ECFry cell line can be applied to the separation of the grouper virus and the monitoring of environmental pollutants, provides an important cell platform for the separation and identification of the marine fish virus and the preparation of virus vaccines, and lays a foundation for the separation of the grouper virus in the later period, the research of the infection pathogenesis and the application of the cell line as an in vitro toxicology cell model to the monitoring of the environmental pollutants.

Description

Cell line of garrupa fries, construction method and application thereof

Technical Field

The invention belongs to the technical field of marine fish cell culture, and particularly relates to a garrupa larval fish cell line, a construction method and application thereof.

Background

Garrupa with small sizeEpinephelussp.) belongs to the class of teleichthyes (Osteichthyes), perciformes (Perciformes), fingeraceae (Serranidae), epinephelus subfamily (Epinepheline), is warm-water benthic fish, and is the main economic aquaculture marine fish in south and southeast Asian countries of China. Epinephelus akaara (L.) kuntzeEpinephelus akaara) Is a grouper breeding variety introduced in south coastal areas such as Guangdong and Fujian in China in recent years, and has delicious meat taste, high nutritive value, fast growth speed, strong adaptability and the likeAdvantages are achieved. However, as the breeding scale of groupers is increased and the breeding environment is deteriorated, the problem of diseases caused by pathogens such as bacteria, viruses or parasites is becoming a major bottleneck restricting the sustainable development of the grouper breeding industry. Iridovirus and nerve necrosis virus are the main two viral pathogens of groupers, and research on the pathogenesis of viral infection and the interaction of viruses and host cells provides important theoretical information for elucidating pathogen characteristics, and developing high-efficiency vaccines can also provide effective prevention and control strategies for preventing and solving the viral diseases of groupers.

The fish cells are used as a cell model of fish body tissues, are widely applied to the separation and identification of viruses, the research of virus infection pathogenic mechanism and host gene functions, and provide a cell basis for developing virus inactivated vaccines and detecting environmental pollutants. As an in vitro culture system, the fish cell line is gradually applied to the research fields of fish virus etiology, immunology, toxicology, metabonomics and vaccinology due to the advantages of low cost, simple operation, good repeatability, controllable conditions and the like. To date, although more than 200 fish cell lines have been established for virus isolation identification and virology studies, cell lines derived from freshwater fish are much less susceptible to marine fish viruses. Therefore, the establishment of marine fish cell lines sensitive to different viruses is urgently needed for research, prevention and control of marine fish virus diseases. At present, although a plurality of tissue cell lines of the groupers, such as a spleen cell line, a kidney cell line, a brain cell line and the like of the groupers, no report of a larval groupers cell line is seen.

Disclosure of Invention

The first aim of the invention is to provide a cell line of the garrupa friesEpinephelus coioides Fry cell line) ECFry, accession number: GDMCC No:62561.

the second object of the invention is to provide a construction method of the garrupa larval fish cell line, which comprises the following steps:

(1) Primary culture: the method comprises the steps of (1) rinsing the garrupa fries under aseptic condition, cutting, rinsing again, performing tissue blocking, and adding primary cell culture solution for culturing to obtain primary cells;

(2) Subculture: and digesting the primary cells by using pancreatin until the primary cells are rounded, dispersing the cells, adding a passage cell culture solution and a primary cell culture solution or adding a passage cell culture solution for carrying out passage culture, and collecting passage cells to obtain the garrupa cell line.

Preferably, the primary cell culture fluid contains grouper serum.

Preferably, the primary cell culture fluid is: the basal medium L-15 contains 30% of fetal bovine serum, 0.5% of grouper serum, 0.266% of NaCl, 5 mM HEPES, 400 IU/mL penicillin, 400 mug/mL streptomycin and 400 mug/mL nystatin by volume, and the pH value is 7.4; the subculture cell culture solution is as follows: the basal medium L-15 contains fetal bovine serum with the volume ratio of 10-20%, naCl with the mass ratio of 0.266%, HEPES with the mass ratio of 5 mM, penicillin with the volume ratio of 100 IU/mL and streptomycin with the volume ratio of 100 mug/mL, and the pH value is 7.4; the rinsing is performed by using a rinsing liquid culture medium, wherein the rinsing liquid culture medium is as follows: basal medium L-15 was supplemented with 400 IU/mL penicillin, 400. Mu.g/mL streptomycin and 400. Mu.g/mL nystatin at pH 7.4.

Preferably, the garrupa fries are cultured garrupa which is hatched for 4 days, the tissue patch is a culture bottle bottom obtained by coating garrupa fries with fetal calf serum, the primary cells are cells which are primarily cultured until cell monolayers are formed and account for more than 80% of the area of the culture bottle bottom, and the passage cell culture solution and the primary cell culture solution are passage cell culture solution and primary cell culture solution with the volume ratio of 1:1.

The third object of the invention is to provide the application of the garrupa larval fish cell line in expressing exogenous genes.

The fourth object of the invention is to provide the application of the garrupa larval fish cell line in the separation of aquatic animal viruses.

Preferably, the virus is SGIV or RGNNV.

The fifth object of the invention is to provide the application of the garrupa larval fish cell line in environmental pollutant monitoring.

Preferably, the environmental pollutants are microplastic.

The invention has the advantages that:

1. the invention obtains the Epinephelus coioides larva fish cell line ECFry, which has good growth state, stable cell proliferation, stable passage for more than 90 generations, takes a fibroblast as a main form, can be frozen at ultralow temperature, and lays a foundation for related research of conservation of the Epinephelus coioides genetic germplasm resources.

2. The construction method of the garrupa larval fish cell line provided by the invention adopts a tissue blocking method to perform primary cell culture, and a proper amount of garrupa serum is added as exogenous nutrition and growth factors in the primary culture process. And in the process of passage, other growth factors are not required to be added, and the culture conditions are not harsh.

3. The cell line of the garrupa fries provided by the invention is sensitive to two important viral pathogens of garrupa, and provides an important cell platform for separating and identifying marine fish viruses and preparing virus vaccines.

4. The garrupa larval fish cell line can be directly applied to the research on the pathogenic mechanism of virus infection, the interaction of virus and host cells and the function of exogenous genes.

5. The garrupa larval fish cell line can be applied to monitoring of microplastic pollutants in the environment.

Cell line of garrupaEpinephelus coioides Fry cell line) ECFry was deposited at the microbiological bacterial collection center (GDMCC) of Guangdong province, address: guangzhou city first middle road 100 # college 59 # building 5, post code: 510070, accession number: GDMCC No:62561.

drawings

FIG. 1 is a morphology diagram of ECFry cells in example 1 of the present invention, which shows the morphology of the 43 rd generation of ECFry cells.

FIG. 2 is a graph showing the growth of ECFry cells under different culture conditions in example 2 of the present invention; a represents the effect of different temperatures on cell growth; b represents the effect of different fetal bovine serum concentrations on cell growth.

FIG. 3 is a chart showing chromosome karyotyping of the ECFry cell line in example 3 of the present invention; a represents metaphase chromosome number distribution of the 17 th generation ECFry cells; b represents metaphase chromosome division phase of the 17 th generation ECFry cells; c represents metaphase chromosome number distribution of the 43 rd generation ECFry cells; d represents metaphase chromosome division phase of the 43 rd generation ECFry cells.

FIG. 4 is a fluorescent image of transfected pEGFP-N3 by the ECFry cell line of example 4 of the present invention; a represents cell morphology under a phase contrast microscope; b represents the intracellular fluorescence of the transfected cells under a fluorescence microscope.

FIG. 5 shows the sensitivity of ECFry cells to important viruses of groupers in example 5 of the present invention; A. lesion observation of infected cells; B. transcriptional expression of viral genes in infected cells.

FIG. 6 is an electron microscope observation of an ECFry cell infected with an important virus of groupers in example 5 of the present invention; A-D is denoted as ultrastructural observation of RGNNV infected cells, and E-G is denoted as ultrastructural observation of SGIV infected cells.

FIG. 7 shows the morphology of the exposed ECFry cells and the distribution of the nano-microspheres according to the embodiment 6 of the present invention.

Detailed Description

In order to more clearly demonstrate the technical scheme, objects and advantages of the present invention, the present invention is described in further detail below with reference to the specific embodiments and the accompanying drawings.

Example 1: construction of Epinephelus coioides (ECFry) cell line

(1) Selecting fish: and (5) selecting the cultured epinephelus coioides fries hatched for 4 days.

(2) Preparing a rinsing liquid culture medium and a cell culture liquid:

l-15 basal medium: leibovitz's-15 (L-15) medium is Gibco company product. The culture medium is prepared according to the specification of the company product, naCl and HEPES with the mass ratio of 0.266% and 5 mM are additionally added, the pH value is regulated to 7.4, and the culture medium is split-packed after being filtered by a filter membrane with the thickness of 0.22 mu m and is preserved at the temperature of 4 ℃ for standby; when in later use, fetal calf serum, grouper serum or antibiotics (penicillin, streptomycin and nystatin) are added according to the requirement.

Rinsing liquid culture medium: the L-15 basal medium was supplemented with antibiotics, namely penicillin, streptomycin and nystatin, at a final concentration of 400 IU/mL penicillin, 400. Mu.g/mL streptomycin and 400. Mu.g/mL nystatin, and adjusted to a pH of 7.4.

Primary cell culture fluid: the L-15 basal medium was added with 30% fetal bovine serum by volume, 0.5% grouper serum by volume and three antibodies (400 IU/mL penicillin, 400. Mu.g/mL streptomycin and 400. Mu.g/mL nystatin) to adjust the pH to 7.4.

Passaging cell culture fluid: at the time of 1-14 generations, adding 20% fetal bovine serum and double antibody (100 IU/mL penicillin and 100 mug/mL streptomycin) in volume ratio into the L-15 basal medium, and adjusting the pH value to 7.4; after 15 passages, the L-15 basal medium was added with 10% fetal bovine serum and diabody (100 IU/mL penicillin and 100. Mu.g/mL streptomycin) by volume, and the pH was adjusted to 7.4.

Preparation of grouper serum: the pearl gentian grouper with the body length of 20 cm is taken and blood is drawn from the tail vein. Standing at 4deg.C overnight, separating out supernatant, diluting with rinsing culture medium, filtering with 0.22 μm filter membrane, and preserving at low temperature.

(3) Primary culture

Taking the garrupa fries hatched for 4 days, rinsing 3 h in a rinsing culture medium under aseptic condition, transferring into an aseptic culture dish of 10 cm, and repeatedly rinsing 3 times with the rinsing culture medium. The fries were minced with sterile blades and the rinsing medium was repeatedly rinsed 3 times. The bottom of the cell culture flask is pre-coated with fetal bovine serum, and then minced fish tissue blocks are stuck to the bottom of the cell culture flask, and 10-15 blocks are stuck to each flask. The flask was placed upside down in a biochemical incubator at 28℃2. 2 h. Slowly adding 1.5. 1.5 mL primary cell culture solution, placing a culture flask in front, and continuously culturing at 28 ℃. On day 4 of primary culture, cells began to migrate from the edge of the tissue mass, and 2 mL of primary cell culture broth was added. On day 28 of culture, the cells from the tissue mass have been essentially confluent to the bottom of the flask to form a monolayer of cells, and subculture is initiated.

(4) Subculture

At the first subculture, the medium in the primary culture flask was transferred to a sterile flask. The primary cell monolayer was immersed in 0.25% by mass of pancreatin (hereinafter referred to as 0.25% by mass of pancreatin), then a small amount (1. 1 mL) of pancreatin was added to digest the monolayer cells at room temperature, and the cell rounding was observed under a microscope. Gently beating the cell walls to break off and disperse the cells into individual cells. Adding 5 mL fresh passage cell culture solution and 5 mL primary cell culture solution, gently blowing the cell suspension, separating the bottles according to the volume of 1:1, and placing the culture bottles into a biochemical incubator at 28 ℃ for passage culture. And (3) carrying out passage every 3-5 days, and reducing the content of fetal bovine serum in the passage cell culture solution to 10% when the passage cell culture solution passes to the 15 th generation, wherein the grouper serum and nystatin are not added into the culture medium. The antibiotic concentration was the normal use concentration (100 IU/mL penicillin and 100. Mu.g/mL streptomycin).

(5) Cryopreservation and resuscitation ability of ECFry cells

Taking 25-generation monolayer adherent cells in the step 4, obtaining single-cell suspension after 0.25% pancreatin digestion, centrifuging at 1000 rpm for 10 min, and discarding supernatant. The cell pellet was resuspended in 1mL of pre-chilled stock (L-15 medium containing 20% fetal bovine serum and 10% DMSO by volume) at 4deg.C, and the cell suspension transferred to a cryopreservation tube. The freezing and storing procedure is as follows: 4 ℃ for 30 min; -20 ℃,2 h; overnight at-80 ℃, and transferring into liquid nitrogen for long-term storage every other day.

And recovering the frozen cells after 30 days of freezing. A tube of cells was removed from the liquid nitrogen and rapidly thawed in a 37℃water bath. The thawed cell suspension was centrifuged at 1000 rpm for 10 min to collect the cell pellet, which was resuspended in passaged cell culture medium. A small amount of the cell suspension was stained with 0.4% trypan blue for 5 min and the number of dead living cells was counted with a hemocytometer. The remaining cell suspension was transferred to a flask containing 5 mL passage cell culture medium for culturing at 28℃to observe the adherence and growth of cells.

The survival rate of ECFry cells is 75% after 30 days of cryopreservation, and the survival cells can be subjected to adherent growth and division, so that the cell morphology and proliferation capacity are not obviously different from those before cryopreservation. The primary cell migration sites of the garrupa fries constructed in the embodiment are different, the cell morphology is different, part of the migrated cells are epithelial-like, and part of the tissue migrated cells are fibroblast-like. As the passage times increased, the cells were mostly fibroblast-like (FIG. 1). At present transmitThe generation is more than 90 generations, the cell growth state is good, and the cell can be continuously and stably propagated and passaged, and the cell line is named as the garrupa larva fish cell lineEpinephelus coioides fry cell line), abbreviated as ECFry cell line.

Cell line of garrupaEpinephelus coioides Fry cell line) ECFry was deposited at the Cantonese microbiological bacterial collection center (GDMCC) at 24, 6, 2022 under the accession number: GDMCC No:62561.

example 2: effect of different culture temperatures and FBS concentrations on ECFry cell growth

1. Effect of different culture temperatures on the growth of ECFry cells.

Using ECFry cells of passage 43 of this example 1, the growth curves of the cells at different culture temperatures were examined and the specific procedure was as follows: respectively 4×10 ⁴ The individual cells were inoculated into 12-well plates, and the medium (1 mL) was L-15 medium containing 10% fetal bovine serum by volume, and after 2 h of adherent growth in a 28℃incubator, the cells were placed in 16℃and 22℃and 37℃incubators, respectively, and cultured. 3 wells of cells were removed daily from each experimental group, the cells were collected by digestion with 0.25% pancreatin and counted by a hemocytometer. Cells were continuously counted at 6 d and growth curves were plotted at different culture temperatures. The effect of different culture temperatures on cell growth as shown in FIG. 2A, the optimal growth temperature for ECFry cells was 28 ℃. Cells can also grow at 22℃or 37℃but at a significantly lower growth rate than the optimum 28 ℃.

2. Effects of different fetal bovine serum concentrations on cell growth.

Using ECFry cells of passage 43 of example 1, the cells were counted and 4X 10 cells were counted ⁴ The individual cells were inoculated into 12-well plates, each well was supplemented with 1mL different fetal bovine serum concentration media, the fetal bovine serum concentrations in the L-15 medium were set to 5%, 10%, 15% and 20% by volume, respectively, and cultured in a 28℃incubator. 3 wells of cells were removed daily from each experimental group, the cells were collected by digestion with 0.25% pancreatin and counted by a hemocytometer. Cells were continuously counted 6 d and plotted in medium of different fetal bovine serum concentrations. Influence of different fetal bovine serum concentrations on cell growthAs shown in fig. 2B: the cell growth rate has a certain proportional relation with the concentration of the added fetal bovine serum, and when the concentration of the fetal bovine serum is 5%, the cell proliferation is obviously slowed down. The cells can grow normally under the condition of 10% -20% of fetal bovine serum concentration, the growth rate of the cells cultured by 2-4 d of fetal bovine serum and 20% of fetal bovine serum is obviously higher than 10%, and the growth of the cells is not obviously different from that of the cells cultured by 6 d of fetal bovine serum and 10% -20% of fetal bovine serum.

In general, ECFry cells are suitably grown at 28℃and serum is used at a concentration of 10% starting from passage 10 in L-15 medium containing 10% -20% serum for cost savings.

Example 3: chromosome karyotype analysis of ECFry cells obtained according to the invention

Cells of the 17 th and 43 th generation ECFry of example 1 were grown by adherence in an L15 medium containing 10% fetal bovine serum at 28℃incubator for 48 h, colchicine was added to a final concentration of 1. Mu.g/mL for 6 hours, and after 0.25% trypsin digestion, the cells were recovered by centrifugation at 1000 rpm for 10 minutes. 75 The cell pellet was recovered by hypotonic treatment in a water bath at 37℃for 30 min and centrifugation at 1000 rpm for 10 min, and then fixed in 8 mL fixative (methanol: glacial acetic acid=3:1) at room temperature for 30 min, and the fixation step was repeated 2 times. About 150 μl of fixing solution was left in the last fixation, and gently blown up. Sucking the fixing liquid-cell suspension, dripping the fixing liquid-cell suspension on a pre-cooled glass slide with the height of about 0.5 m at the temperature of-20 ℃, rapidly blowing off the liquid drop by force, and airing at room temperature. The dried slide was stained with 1-fold giemsa staining solution (bioeth, cat# RS 3080) for 10 min, washed with purified water, and dried at room temperature. The cell chromosome morphology was observed under an oil microscope, photographed and the chromosome number was calculated.

190 split phases were counted for each of the 17-generation ECFry cells of example 1. As a result, as shown in FIG. 3A, the number of chromosomes in the cell division phase was mostly distributed between 26 and 70, the number of characteristic chromosomes was 48, and the chromosome morphology was mostly telomere chromosomes (FIG. 3B). The number of chromosomes in the 43-generation cell division phase is distributed between 30 and 64, and the number of characteristic chromosomes is 48. Although the chromosome number distribution was uneven, the frequency of occurrence of diploid chromosome number was highest (fig. 3C and 3D).

Example 4: verification of transfection Effect of exogenous Gene of ECFry cell line

The ECFry cells of the 45 th generation of example 1 were inoculated into 24-well cell culture plates and cultured overnight, wherein the cell culture medium was L15 medium containing 10% fetal bovine serum, and the initial cell concentration was about 10 ⁵ Cells, cells confluent with 80% of monolayer, begin transfection. pEGFP-N3 was transfected into cells according to the procedure of Lipofectamine 2000 from Ivitro. After 48 h transfection, the expression of the green fluorescent protein in the cells was observed under a fluorescent microscope.

As shown in FIG. 4, a strong green fluorescent signal was observed in transfected ECFry cells, indicating that pEGFP-N3 was successfully transfected into the cells, and that the CMV promoter was able to efficiently initiate exogenous gene expression in the cells (FIG. 4), suggesting that the ECFry cell line could be used to study exogenous gene function in vitro.

Example 5: virus infection experiments on the ECFry cell lines obtained according to the present invention

1. Cytopathic Effect (cytopathic effect, CPE) observations

The 45-generation ECFry cells of example 1 were inoculated into 24-well plates for culturing (the cell culture medium was L15 medium containing 10% fetal bovine serum, the initial cell concentration was about 2X 10) ⁵ Cells) were subjected to viral infection overnight, the laboratory-preserved SGIV and RGNNV viral suspensions were added to the culture medium, respectively, and the infection index (Multiplicity of infection, MOI) was 2, and the culture was continued after mixing. Cytopathic processes were recorded by phase contrast microscopy and photographed.

Microscopic observations are shown in fig. 5a, sgiv infected cells are typically characterized by cell shrinkage, rounding, rounded cell aggregation, and the appearance of distinct voids in the cell monolayer. More than 70% of cells round after 24 h infection, the whole cell monolayer forms a network, and the network connection of the monolayer part of 36 h infected cells breaks. RGNNV infected cells are typically characterized by the presence of vacuoles of varying sizes in the cytoplasm of the cell, some of which can fuse into large vacuoles. Along with the extension of infection time, the number of cells with vacuoles is increased, the infected cells are necrotic and shed in late infection, and a cavity is formed in a monolayer of cells.

2. Transcriptional expression of viral genes in infected cells

The 45 th generation ECFry cells of example 1 were taken to infect SGIV and RGNNV, respectively, according to the procedure of step 1, and cells were harvested at 12 h, 24 h and 48 h of viral infection, 700×gAnd centrifuging for 10 min to extract total RNA of the cells. Total RNA was extracted using the SV Total RNA Isolation System kit (Promega) according to the protocol. Next, a cDNA template was obtained by reverse transcription using the reverse Trace Ace cube qPCR RT Kit (TOYOBO) Kit. Transcriptional expression of viral genes in infected cells was detected by fluorescent quantitative PCR (qPCR) methods. qPCR was performed using a 2 XSYBR Green Real-time PCR Mix kit (TOYOBO) and the PCR reaction was performed on a Applied Biosystems QuantStudio fluorescent quantitative PCR apparatus (Thermo, USA) under the following conditions: 95 ℃ for 1 min;95 ℃,5 s;60 ℃,15 s;72 ℃,45 s;40 cycles. To be used forβActin was used as an internal reference and data represent the mean ± standard deviation of three replicates. The primers of the internal reference and virus genes are respectively:

Actin-RT-F：TACGAGCTGCCTGACGGACA（SEQ ID NO.1），

Actin-RT-R：GGCTGTGATCTCCTTCTGCA（SEQ ID NO.2）；

SGIV MCP-RT-F: GCACGCTTCTCTCACCTTCA（SEQ ID NO.3），

SGIV MCP-RT-R：AACGGCAACGGGAGCACTA（SEQ ID NO.4）；

SGIV VP019-RT-F：TCCAAGGGAGAAACTGTAAG（SEQ ID NO.5）；

SGIV VP019-RT-R：GGGGTAAGCGTGAAGAC（SEQ ID NO.6）；

RGNNV CP-RT-F：CAACTGACAACGATCACACCTTC（SEQ ID NO.7），

RGNNV CP-RT-R：CAATCGAACACTCCAGCGACA（SEQ ID NO.8）；

RGNNV RdRp-RT-F：GTGTCCGGAGAGGTTAAGGATG（SEQ ID NO.9），

RGNNV RdRp-RT-R：CTTGAATTGATCAACGGTGAACA（SEQ ID NO.10）。

qPCR results As shown in FIG. 5B, in SGIV and RGNNV infected cells, the transcript levels of the viral genes (SGIV MCP, SGIV VP019, RGNNV CP and RGNNV RdRp) all gradually increased with the extension of the infection time, indicating that the virus proliferated in ECFry cells.

3. Electron microscope observation of virus infected cells

ECFry cells of example 1 were individually infected with SGIV and RGNNV as in step 1, scraped at virus-infected 48 h, centrifuged at 2000 rpm for 10 min, and cell pellet fixed at 2.5% glutaraldehyde 4℃for 1 h. Removing the fixed liquid, and rinsing with PBS for three times, each time for 5 min; 1 h by fixing 1% of osmium acid at 4 ℃; then the ethanol gradient is dehydrated step by step (volume ratio 50%, 70%, 80%, 90%, 100%), each gradient is 10 min. Epoxy Epon812 impregnates the embedding. After slicing by an ultrathin microtome, each is dyed by 1 h by 2% uranyl acetate and lead citrate, and finally the slices are observed under 120KV by a transmission electron microscope (Talos L120C, thermo Fisher Scientific) and recorded and photographed by a CCD.

As shown in fig. 6, in SGIV-infected cells, a large number of virus particles scattered or arranged in lattice were observed in the virus assembly region near the nucleus, and mitochondria with damaged distribution structure were aggregated around the assembly region. In RGNNV infected cells, a plurality of vacuoles are visible in cytoplasm, and spherical virus particles with the size of 30 nm are gathered and distributed on the inner membranes of the vacuoles, which indicates that two groupers can be largely replicated and proliferated to assemble in ECFry cells. ECFry is described as useful for in vitro isolation of viruses and for studying the mechanism of viral infection and virus-host cell interactions.

Example 6: influence of microplastic fluorescent nanosphere exposure on ECFry cells

Diluting the micro-plastic fluorescent nano-microsphere (100.54 +/-8.03 nm) to 1 mg/mL by using a high-temperature sterilized PBS solution, vibrating and uniformly mixing, filtering by using a filter membrane with the thickness of 0.22 mu m, and preserving the filtered fluorescent nano-microsphere solution at the temperature of 4 ℃ for later use. The 50 th generation ECFry cells were inoculated into 24-well plates and 96-well plates, respectively, and cultured overnight (the cell culture medium was L15 medium containing 10% fetal bovine serum, and the initial cell concentration was about 2×10) ⁵ Cells). The cells were then treated with different concentrations of fluorescent nanospheres (0. Mu.g/mL, 50. Mu.g/mL, 250. Mu.g/mL, 500. Mu.g/mL, 750. Mu.g/mL, 1000. Mu.g/m)L). After 48 and h treatments, the morphology of the cells and the distribution of fluorescent nanomicrospheres were observed under a phase contrast microscope and a fluorescent microscope, respectively. Meanwhile, the influence of fluorescent nano-microspheres with different concentrations on the cell activity is detected by a CCK8 method.

Microscopic observations are shown in fig. 7A, where cells shrink to some extent as the fluorescent nanoparticle concentration increases. In addition, the black spots in the cells also gradually increase. Fluorescence microscopy observations showed that fluorescent signals appear in the fluorescent nanoparticle-treated cells. And the fluorescence signal in the cells is gradually enhanced along with the increase of the concentration of the fluorescent nano-microspheres. Indicating that the nanoparticle is capable of being endocytosed into the cell. The results of the cell activity experiments showed that the exposure of the nanomicrospheres reduced the activity of the cells and was concentration dependent compared to the control group (fig. 7B).

The embodiment detects the influence of ECFry cells on the growth and the morphology of the exposed micro-plastic nano particles, and the result proves that the cell line can effectively evaluate the toxic effect of the exposure of the micro-plastic, can be used as an experimental material for detecting environmental pollutants, and provides an ideal in-vitro research system for the detection of the environmental pollutants by using the groupers.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that modifications can be made without departing from the spirit of the invention, which are within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. Cell line of garrupa friesEpinephelus coioides Fry cell line) ECFry, characterized by a deposit number of: GDMCC No:62561.

2. the use of the garrupa fries cell line of claim 1 for expressing a foreign gene.

3. Use of the garrupa larval fish cell line of claim 1 in the isolation of aquatic animal virus, said virus being SGIV or RGNNV.

4. The use of the garrupa larval cell line of claim 1 in environmental contaminant monitoring, wherein the environmental contaminant is a microplastic, the microplastic is PSNPs, and the garrupa larval cell line is the 50 th generation garrupa larval cell line ECFry.