CN117126889A

CN117126889A - Human ISG15 reporter gene stable transgenic cell strain and construction method and application thereof

Info

Publication number: CN117126889A
Application number: CN202311377380.6A
Authority: CN
Inventors: 吁亭; 万涛; 陈国友
Original assignee: Shanghai Huidun Yintai Biotechnology Co ltd
Current assignee: Shanghai Huidun Yintai Biotechnology Co ltd
Priority date: 2023-10-24
Filing date: 2023-10-24
Publication date: 2023-11-28
Anticipated expiration: 2043-10-24
Also published as: CN117126889B

Abstract

The application provides a stable transgenic cell strain of a human ISG15 reporter gene, a construction method and application thereof. The reporter gene cell line constructed by the method can be used for measuring the biological activity of the interferon and evaluating the validity of the interferon, screening medicines and other researches.

Description

Human ISG15 reporter gene stable transgenic cell strain and construction method and application thereof

Technical Field

The application belongs to the technical field of biological medicine, and particularly relates to a stable transgenic cell strain of a human ISG15 reporter gene, and a construction method and application thereof.

Background

Interferon (IFN) is part of a family of class II cytokines that includes IL-10-related cytokines (IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26) in addition to IFNs. Three general classes are classified based on sequence homology: type I, type II and type III. In humans, the IFN-I family consists of IFN- α (13 subtypes), IFN- β, IFN- δ, IFN- ε, IFN- κ, IFN- τ, and IFN- ω1-3. IFN-II contains only one member of IFN-gamma, and the IFN-III (also known as IFN-lambda) family, consisting of IFN-lambda 1 (IL-29), IFN-lambda 2 (IL-28A), IFN-lambda 3 (IL-28B) and IFN-lambda 4, was first identified from human genomic sequences in 2003. The IFN-I gene is located on human chromosome 9 and contains only 1 exon; while the IFN-III gene is located on human chromosome 19 and shares 5 conserved exons with other IL-10 family cytokines, but contains additional exons 6 in the IFN- λ2 and IFN- λ3 genes. Alignment of human amino acid sequences revealed that IFN-III has a lower sequence homology with IL-10 and IFN-I, wherein the amino acid homology with IL-10 is 11% -13%; amino acid homology with IFN- α and IL-22 is 15% -19%. Of the 4 human IFN-III, IFN- λ2 and IFN- λ3 have amino acid homology of up to 96%, while IFN- λ1 and IFN- λ2 have amino acid homology of 81%, and IFN- λ4 has low amino acid homology with the above 3 IFN-III, and has only 29%.

Both IFN-I and IFN-III induce downstream signaling by binding to a receptor. All IFN-I signals through the common heterodimer receptor IFNAR (interferon-alpha/beta receptor subunit, IFNAR), where IFNAR consists of IFNAR1 and IFNAR2 subunits. IFN-I binds IFNAR2 with high affinity and then recruits IFNAR1 with low affinity, resulting in IFNAR 1-IFN-I-IFNAR 2 complex with signaling capacity. The heterodimeric receptor used for signaling by IFN-III, unlike IFN-I, consists of an IFNLR1 (interferon lambda receptor, IFNLR 1) chain and an IL-10R2 chain. Wherein IFN-III and other IL-10 family cytokines share an IL-10R2 chain that is part of all IL-10 family heterodimeric receptors. IFN-III is combined with IFNLR1 and IL10R2 at a stoichiometric ratio of 1:1:1, and IL-10 is combined with IL10R1 and IL10R2 at a ratio of 2:1:1. IFN-III binds IFNLR1 with high affinity and then recruits IL-10R2 with low affinity, resulting in IFNLR 1-IFN-III-IL-10R 2 complex with signaling capacity.

IFN-I receptor IFNAR is widely distributed on the surface of each cell, and can produce systemic protection. Unlike IFN-I, IFN-III receptors, while the IL-10R2 chain is present on almost all cell surfaces, the IFNLR1 chain is expressed only in specific tissues or cells, and since the individual chains are not receptor active, only two chains are present at the same time to exert receptor effects, resulting in a tissue or cell specific distribution of IFNLR. IFN-III receptors are predominantly distributed in cells of epithelial origin, including airway, intestinal and genital epithelial cells, lung cells, liver cells, keratinocytes and the like. IFN-III has a particularly pronounced effect on upper Pi Bingzhang (e.g., skin, gastrointestinal, respiratory and genitourinary) and tissue barriers (e.g., blood brain and placenta barriers), suggesting that it contributes to specific immune responses at the epithelial surface. IFN-III can provide more targeted protection at critical barriers without activating systemic pro-inflammatory responses, as epithelial surfaces are constantly exposed to commensal and pathogenic microorganisms.

The interferon has broad-spectrum antiviral activity and has a certain inhibition effect on almost all viruses. Interferon has been widely used clinically in the treatment of various viral infectious diseases. IFN- α is one of the earliest therapeutic biologicals found and is by far the most widely used interferon type in clinical use. At present, 3 subtypes of IFN-alpha are approved as marketed drugs, namely IFN-alpha 1b, IFN-alpha 2a and IFN-alpha 2b, which are all recombinant expression products. IFN-alpha has broad-spectrum antiviral effect, and has been clinically applied to the treatment of various viral infectious diseases, such as viral hepatitis, adult and childhood viral pneumonia, herpes zoster, condyloma acuminatum, epidemic hemorrhagic fever and the like. In addition, IFN-alpha can also be applied to anti-tumor treatment including chronic granulocytic leukemia, melanoma, lymphoma and the like. After the novel coronavirus infects epidemic situation, interferon is always one of the hot directions for researching anti-SARS-CoV-2 medicine. The company Eiger in 2020 developed a clinical study of PegIFNlambda-1 a for the treatment of COVID-19. In the development of the phase iii clinical trial (NCT 04967430) of the polyethylene glycol interferon lambda treatment covd-19 published in 2022, the risk of hospitalization or emergency for new coronavirus infection was reduced by 50% in the treatment group compared to the placebo group in new coronavirus infected patients receiving a single dose of polyethylene glycol interferon lambda injection within 7 days of the first appearance of symptoms (primary endpoint). Notably, higher benefits were observed with polyethylene glycol interferon lambda treatment within 3 days of symptoms appearance, with 60% reduction in hospitalization or mortality.

Interferon does not inactivate viruses directly, but rather induces expression of a series of Interferon-stimulated genes (ISGs) in target cells via paracrine or autocrine pathways to exert antiviral effects, e.g., coronaviruses, a single-stranded RNA virus that, after invasion into the body and entry into cells of the body, induces expression of secreted Interferon after recognition by pattern recognition receptors in the innate immune system. The interferon acts on target cells in an autocrine and paracrine form, and after binding to target cell surface receptors, JAK1 and tyrosine kinase TYK2 are activated, whereby STAT1 and STAT2 are phosphorylated and form a heterodimer, which binds to IRF9 to form interferon-stimulating gene factor 3 (IFN-stimulated gene factor 3, isgf3). ISGF3 translocates to the nucleus and binds to the IFN-stimulated response element ISRES, triggering the expression of a variety of Interferon-stimulated genes (ISGs) having antiviral functions, producing antiviral effects, and thus, the biological activity of Interferon can be directly reflected by only detecting the promoter activity of ISGs.

The in vitro determination method for detecting the validity and biological activity of interferon commonly used at present is a virus replication inhibition method or an RT-PCR determination ISG gene expression method, wherein the former is easy to generate larger error, the repeatability is poor, the accuracy is low, and the latter is complex to operate and takes longer time. Furthermore, most studies focused on type I interferons, such as those of patents CN201810641969, CN112159834A and CN106546747A, et al (Rees, phylis A, and R Joel lowy. "Measuring type I interferon using reporter gene assays based on readily available cell lines." Journal of immunological methods vol. 461 (2018): 63-72.), have been less studied for the biological activity and effectiveness method of human type III interferons, especially IFN- λ1 (IL-29), while, due to the lower sequence homology of IFN-III and IFN-I, and expression only in specific tissues or cells, the method suitable for IFN-I biological activity and effectiveness detection may not be IFN-III. Luciferase reporter gene systems have been widely used for the study of transcription and regulation of a target gene, and are often used for labeling a target gene to be studied so that the expression level of the reporter gene coincides with the expression level of the target gene, whereby expression regulation of the target gene is observed by expression of the reporter gene. Compared with a virus replication inhibition method and an RT-PCR method, the reporter gene method has the advantages of short experimental period, small variability and simple operation. Therefore, the construction of an ISG reporter gene plasmid and a stable transgenic cell strain, and the development of a method for simultaneously evaluating the biological activity and the effectiveness of IFN-III and IFN-I interferon based on the stable transgenic cell strain are of great significance for the development of interferon drugs and the application of the interferon drugs in antiviral treatment.

Disclosure of Invention

The application aims to provide a human ISG15 reporter gene stably transformed cell strain, a method for constructing the stably transformed cell strain and application of the cell strain.

In order to achieve the above object, the present application adopts the following technical scheme:

in a first aspect of the present application, there is provided a method for constructing a stable transgenic cell line of human ISG15 reporter gene, said method comprising the steps of:

(1) Preparation of human ISG15 reporter plasmid: inserting a human ISG15 gene promoter sequence into a reporter gene plasmid, thereby obtaining a human ISG15 reporter gene plasmid with the human ISG15 gene promoter driving the expression of the reporter gene; wherein, the promoter sequence of the human ISG15 gene is shown in SEQ ID NO:1 is shown in the specification;

(2) Transfecting the human ISG15 reporter plasmid prepared in step (1) into human epithelial cells;

(3) According to the resistance gene carried in the plasmid, adopting proper antibiotics to carry out resistance screening on transfected cells, thereby obtaining human ISG15 reporter gene stably transformed cells;

(4) Optionally, the human ISG15 reporter stable transgenic monoclonal cell strain is obtained by screening from the stable transgenic cells in the step (3) through a limiting dilution method.

In another preferred embodiment, the reporter plasmid is a luciferase reporter plasmid.

In another preferred embodiment, the luciferase reporter plasmid is pGL6-TA, and the human ISG15 reporter plasmid obtained by inserting the human ISG15 gene promoter sequence into pGL6-TA is called pGL6-ISG15-luc.

In another preferred embodiment, the luciferase reporter plasmid is pGL6-TA, and wherein the insertion site of the human ISG15 gene promoter sequence is between XhoI and HindIII double cleavage sites.

In another preferred embodiment, the human ISG15 reporter plasmid pGL6-ISG15-luc has an expression cassette of formula I:

E1-P-E2-luc (I)

wherein E1 and E2 are each independently a restriction enzyme site;

p is human ISG15 gene promoter sequence;

luc is the luciferase gene sequence.

In another preferred embodiment, the human epithelial cells are HNEPC cells or Hela cells, preferably HNEPC cells.

In another preferred embodiment, the transfection in step (2) is transient transfection.

In another preferred embodiment, cells transfected with pGL6-ISG15-luc are screened for resistance using geneticin G418.

In a second aspect of the application there is provided a human ISG15 reporter stable transgenic cell line constructed using the method of the first aspect of the application.

In another preferred embodiment, the cell line is for:

(a) A method for detecting the biological activity of interferon;

(b) Validity, mechanism of action and time of action research of interferon; and/or

(c) Related drug screening that induces ISG15 response.

In another preferred embodiment, the cell line is responsive to both type I and type III interferons.

In another preferred embodiment, the cell line is responsive to IFN alpha 1b and IFN lambda 1.

In another preferred embodiment, the cell lines are particularly suitable for IFN alpha-1 b and/or IFN lambda 1 biological activity determination.

In a third aspect of the application there is provided the use of a human ISG15 reporter stable transgenic cell line according to the second aspect of the application in one or more selected from the group consisting of:

(a) A method for detecting the biological activity of interferon;

(b) Validity, mechanism of action and time of action research of interferon;

(c) Related drug screening that induces ISG15 response.

In another preferred embodiment, the interferon comprises type I and type III interferons.

In another preferred embodiment, the interferon includes (but is not limited to) IFN alpha 1b and IFN lambda 1.

In a fourth aspect of the application, there is provided a detection reagent comprising the human ISG15 reporter stably transformed cell strain of the second aspect of the application.

In another preferred embodiment, the detection reagent is for:

(a) Detecting the biological activity of interferon;

(b) Validity, mechanism of action and time of action research of interferon;

(c) Related drug screening that induces ISG15 response.

In a fifth aspect of the application, there is provided a kit comprising:

(C1) A human ISG15 reporter stably transformed cell line according to the second aspect of the present application;

(C2) And (3) a reporter gene detection reagent.

In another preferred embodiment, the kit further comprises a description indicating that the kit is useful for:

(a) A method for detecting the biological activity of interferon;

(c) Related drug screening that induces ISG15 response.

In another preferred embodiment, the kit is an interferon biological activity detection kit.

In another preferred embodiment, the reporter assay reagent is a luciferase assay reagent.

In another preferred embodiment, the luciferase detection reagents include a detection reagent for detecting luciferase activity and a detection reagent for detecting luciferase expression level.

In a sixth aspect of the application there is provided a method for detecting the biological activity of interferon in vitro, said method comprising performing an assay using a human ISG15 reporter stable transgenic cell line according to the second aspect of the application.

In another preferred embodiment, the method comprises the steps of:

(i) Culturing the human ISG15 reporter gene stable transgenic cell strain according to the second aspect of the application to completely adhere to the cell strain;

(ii) Incubating an interferon sample to be detected with the cells which are completely adhered together for 12-24 hours;

(iii) After the incubation is finished, discarding culture supernatant, and measuring the expression or activity of reporter genes in the cell strain by using a reporter gene detection reagent; wherein the expression or activity of the reporter gene reflects the activity of the interferon in the interferon sample to be tested.

In another preferred embodiment, the method further comprises: in step (ii), a control blank is set, i.e. the control blank is incubated with fully adherent cells for 12-24 hours simultaneously; and in step (iii), simultaneously measuring the expression or activity of the reporter gene in the cell strain after the incubation with the blank control sample is completed, wherein the expression or activity of the relative reporter gene compared with the blank control group reflects the activity of the interferon in the interferon sample to be tested.

In another preferred embodiment, the reporter is luciferase.

In a seventh aspect of the application there is provided an in vitro interferon pharmacodynamic assay method comprising assaying using a human ISG15 reporter stable cell strain according to the second aspect of the application.

In another preferred embodiment, the method comprises the steps of:

(ii) Incubating an interferon sample to be tested with the cells which are completely adhered together for a period of time T1;

(iii) After the incubation is finished, discarding culture supernatant, and measuring the expression or activity of reporter genes in the cell strain by using a reporter gene detection reagent; wherein the expression or activity of the reporter gene reflects the pharmacodynamic properties of the interferon in the interferon sample to be tested.

In another preferred embodiment, in step (ii), said T1 is 0.5-2 hours, preferably 1 hour.

In another preferred embodiment, in step (iii), the expression or activity of the reporter gene in the cell line is measured at a plurality of time intervals (e.g., 1, 6, 12, 24, 36, 48 hours) after the end of incubation, respectively, to reflect the time of pharmacodynamic action of the interferon in the interferon sample to be tested.

In another preferred embodiment, the reporter is luciferase.

It is understood that within the scope of the present application, the above-described technical features of the present application and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows the response to stimulation by IFN alpha-1 b and IFN lambda 1 following transient transfection of human ISG15 reporter plasmids into different epithelial cells.

FIG. 2 shows the results of screening of stable transgenic monoclonal cell lines for human ISG15 reporter gene.

FIG. 3 shows the application of human ISG15 reporter stable transgenic cell line HNEPC-ISG15-luc to the detection of IFN alpha-1 b and IFN lambda 1 biological activities.

FIG. 4 shows duration of efficacy of human ISG15 reporter stable transgenic cell line HNEPC-ISG15-luc after single administration of IFN-. Lambda.1 was studied.

Detailed Description

Through extensive and intensive studies, the inventors of the present application construct a luciferase reporter gene stable transgenic cell strain (abbreviated as a human ISG15 reporter gene stable transgenic cell strain) based on a human ISG15 gene promoter sequence for the first time. The human ISG15 reporter gene stable transgenic cell strain constructed by the application has strong response to IFN-III and IFN-I interferon, so that the human ISG15 reporter gene stable transgenic cell strain can be used for simultaneously evaluating the biological activity and pharmacodynamics research of the IFN-III and the IFN-I interferon.

On this basis, the present application has been completed.

Terminology

In order that the application may be more readily understood, certain technical and scientific terms are defined below. Unless defined otherwise herein, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

ISG15

ISG15 (ISG 15) is one of The most strongly Interferon-induced ISG, has a molecular weight of about 15kDa, has a broad antiviral activity, and is a nonstructural protein 1 (NS 1B) to which ISG15 binds, thereby inhibiting replication of influenza virus, which can inhibit replication of various viruses (DNA and RNA viruses), including type I herpes simplex virus, human papilloma virus, influenza A/B virus, encephalitis B virus, influenza B virus, etc. (Yuan, W, and R M Krug. "Influenza B virus NS protein inhibits conjugation of The Interferon (IFN) -induced ubiquitin-like ISG15 protein." The EMBO journ vol. 20,3 (2001): 362-71). ISG15 is used as one of the ISGs with strongest induction expression of interferon, and can be used for detecting the biological activity of the interferon, researching the action mechanism and pharmacokinetics, and providing basis for rapidly detecting the biological activity of the interferon and clinically dosing interval. In addition, ISG15 is one of the strongest ISGs induced and expressed by interferon, is an important defense molecule for resisting the invasion links of viruses such as SARS-CoV-2, and the action effect of drugs such as interferon can be reflected by up-regulating the expression of ISG15, as shown in patent WO 2008/070137 A2, ISG15 is an important marker of IFN- α pharmacodynamics.

The application relates to a construction method of a stable transgenic cell strain of a human ISG15 reporter gene

In one aspect of the application, a method for constructing a stable transgenic cell line of a human ISG15 reporter gene is provided. In one embodiment of the application, the method comprises the steps of:

(1) The human ISG15 reporter gene plasmid is prepared by the following preparation method: the human ISG15 gene promoter sequence was inserted into PGL6-TA plasmid (Biyundian D2105) to obtain a luciferase reporter plasmid driven by the human ISG15 gene promoter. According to the published gene sequence of human ISG protein in Genebank, selecting a-1000 to +20bp promoter region containing ISRE response elements, wherein the specific sequence is shown as SEQ ID NO: 1. Further, the insertion site of the promoter sequence of the human ISG15 gene is between XhoI and HindIII double cleavage sites.

(2) By transient transfection, cell lines Hela cells or HNEPC cells were determined for stable transfection: the human ISG15 reporter plasmid in step (1) was transiently transfected with Calu-3 cells (human lung adenocarcinoma cells, ATCC No. HTB-55), hela cells (human cervical carcinoma cells, ATCC No. CRM-CCL-2), A549 (human alveolar adenocarcinoma basal epithelial cells ATCC No. CRM-CCL-185), HNEPC cells (human nasal mucosa epithelial cells, yubo organism, no. C304) respectively by Lipofectamine 2000 (invitrogen, cat No. 11668-027). After 5ng/ml IFN alpha-1 b and IFN-lambda 1 are respectively added into the transiently transformed cells for 16-24 hours, the cells are detected by a firefly luciferase reporter gene detection kit (Biyun, product number: RG 005), and Hela cells or HNEPC cells which simultaneously have good responses to the IFN alpha-1 b and the IFN-lambda 1 are determined and screened according to the response condition of fluorescence intensity and are used for stably transforming cell lines of human ISG15 reporter genes.

More preferably, HNEPC cells are selected for use in a human ISG15 reporter stable transgenic cell line.

(3) Preparation of human ISG15 reporter stable transgenic cell line: the human ISG15 reporter plasmid described in step (1) was transfected with HNEPC cells selected in (2) by liposome transfection technique, and positive cell clones were selected using geneticin G418 (ThermoFisher, cat# 10131035). Finally, obtaining a monoclonal cell strain which stably expresses ISG15-luc through a limiting dilution method, and after identification, freezing and preserving the strain, namely HNEPC-ISG15-luc.

Application of human ISG15 reporter gene stable transgenic cell strain

The application also aims to provide the application of the human ISG15 reporter gene stable transgenic cell strain:

(i) For determining type I and type III interferon biological activity, including but not limited to IFN alpha 1b and IFN lambda 1.

(ii) Pharmacodynamic studies for the study of interferon drugs, and

(iii) Screening for related drugs that induce an ISG15 response.

In the embodiment provided by the application, HNEPC cells are transfected by using a reporter gene plasmid with a human ISG15 gene promoter as a promoter for promoting expression of luciferase (Luc), stably transfected cell strains are screened, after the human IFN alpha-1 b and IFN-lambda 1 standards and samples which are subjected to gradient dilution are respectively incubated with the cells, luminescence values of the Luc are detected, and biological activities of the IFN alpha-1 b and IFN-lambda 1 in the sample to be detected are detected by using a standard curve prepared by the standards. Compared with the traditional virus inhibition detection method, the detection method has the advantages that the detection time is greatly shortened (shortened to 6-10 hours from the traditional 3-7 days), the virus culture and cell virus attack time is saved, the possible biological safety hazard is avoided, and the experimental accuracy and repeatability are improved. Furthermore, the method can be used to determine the biological activity of both human type I and type III interferons, including but not limited to IFN alpha-1 b and IFN lambda 1.

In addition, in the embodiment of the application, the human ISG15 reporter gene stable transgenic cell strain is utilized to carry out IFN-lambda 1 pharmacodynamics research, and the quantitative effect relationship and pharmacokinetics of IFN-lambda 1 can be researched according to the variation trend of the luminescence value of Luc at different time points after administration and multiple times of administration, so that data support is provided for clinical research. Compared with the conventional method for detecting interferon-induced ISGs gene change by RT-PCR, the method is more convenient to operate and higher in experimental accuracy.

The beneficial effects of the application include:

(1) The human ISG15 reporter gene stable transgenic cell strain constructed by the application has strong response to IFN-III and IFN-I interferon, so that the human ISG15 reporter gene stable transgenic cell strain can be used for simultaneously evaluating the biological activity and pharmacodynamics research of the IFN-III and the IFN-I interferon.

(2) Compared with the traditional virus inhibition detection method, the method for detecting the biological activity of the interferon by using the human ISG15 reporter gene stably transformed cell strain provided by the application has the advantages that the detection time is greatly shortened (shortened to 6-10 hours from the traditional 3-7 days), the virus culture and cell attack time is saved, the possible biological safety hazard is avoided, and the experimental accuracy and repeatability are improved.

(3) Compared with the conventional method for detecting interferon-induced ISGs gene change by RT-PCR, the method for carrying out interferon pharmacodynamics research by using the human ISG15 reporter gene stable transgenic cell strain provided by the application has the advantages of more convenient operation and higher experimental accuracy.

The present application is explained in further detail below with reference to the drawings and the description of specific embodiments, but the following description of the embodiments is included only to enable one of ordinary skill in the art to which the present application pertains to more clearly understand the principle and spirit of the present application, and is not meant to limit the present application in any way. The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, are commercially available.

The materials used in the following examples of the application are as follows:

PGL6-TA plasmid was purchased from Biyundian corporation under the accession number D2105; various restriction enzymes, EX-Taq enzyme, T4DNA ligase and plasmid extraction kits were purchased from Takara corporation; transfection reagent Lipofectamine 2000 was purchased from Invitrogen Inc., cat: 11668-027; calu-3 cells, A549 cells, hela cells were purchased from ATCC, HNEPC cells were purchased from Yubo Biolabs, cat: c304; the firefly luciferase reporter gene detection kit was purchased from Biyun, cat: RG005.

The human IFN-lambda 1 standard is recombinant human IFN-lambda 1 prepared by a preparation method of recombinant human interferon lambda 1 stock solution shown in patent example 1 of publication No. CN 115531315A. IFN-. Lambda.1 test samples were purchased from pbl assay science company under the trade designation: 11725-1. Recombinant human type I interferon IFN alpha-1 b is purchased from Shenzhencao pharmaceutical Co., ltd., national medicine standard size: s20033039.

Example 1: construction of pGL6-ISG15-luc plasmid

The PGL6-TA plasmid (product number: D2105 of Biyundian Co., ltd.) is digested with XhoI and HindIII, and then subjected to electrophoresis, gel cutting and recovery to obtain target fragment DNA; according to the published gene sequence of human ISG protein in Genebank, selecting a-1000 to +20bp promoter region containing ISRE response elements, wherein the specific sequence is shown as SEQ ID NO: 1. Synthesizing a near-end promoter (-1000 to +20 bp) sequence of the human ISG15 gene, and cloning the sequence between XhoI and HindIII double cleavage sites of a PGL6-TA plasmid; adding DNA ligase to connect and transform into competent DH5 alpha bacteria, inoculating to a solid culture plate containing ampicillin Amp for culturing, and selecting monoclonal bacteria for expanding culture in a culture medium containing the antimicrobial in the next day; the plasmid was extracted using the plasmid extraction kit and sequencing verified that the pGL6-ISG15-luc plasmid was correct in sequence.

Human ISG15 gene near-end promoter sequence (SEQ ID NO: 1):

TTGGAGAAATGTCTATTGAAGTCTTTTGGCCATTTGAAAATTGAGTTGCC

TTTTTTTTTTATTTTTATTTTTTATTGAGTTGTAAGAGTTCTCTATATGT

CCTGGATGCTATGCCCTCATCAGATAGATAATTTGCAAATATTTCTTCCC

ATTCTATGGATTGTCTTTTCACTTTCTCAATAGTGTCCCAGAGTTCATTT

TTGTAGAAAATAAAAGATAGGTCTCTTTTATTAAAAAACAATCTGAGGCT

CCGGGTGCAGTGGCTCACGCCTGTAATCCCAGCAGTTTCAGAGGCCGAGG

CAGGTGGATCACTTGAGCCCAGGAGTTCGAGATCAGCCTGGGCGACATGG

CGAGACCCCCATCTCTACTAAAAATACAAAAAATTAGCCGGGCCTGGTGG

TGCACCCCTGTGGTCCCAGCTACGTGGGAGGCTGAGGTGAGAGGATCGCT

TTAGCCTGGCAGGCGGAGGTTGCAATGAGATGAGATCGTGCCTCTGCACT

CCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAA

CAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGT

TATCTCTGGGTAGTTTGGAGTTCTTGTTTCTCAATTAACCATGGGGATGT

TTTCCAAGTTTACTAATTTTGCAAGTTGGTAAATGGAAAATGAAACCATT

AGTCCATGTGATGACAGCTTTAGTGCATCCTGTGAAGGATCTGGAATGCG

CGATATTTAGGTGTTTCCAGGGTGTTGGGTGGGGGTGGGGATGCCGTCCG

CTGTCCGGAGTCCCCGCCACTTTTGCTTTTCCCTGTCTTTCGGTCATTCG

GTTTTGTTTCTTCCGCTCACTCTGGGGCATGCCTCGGGAAAGGGAAACCG

AAACTGAAGCCAAATTTGGCCACCAGCGCAGGCTCGGCGGCACGCCCCCT

GACGTGTGTGCCTCAGGCTTATAATAGGGCCGGTGCTGCCTGCCGAAGCC

TGGCCGCCTCTGTGTCTGTG

example 2: screening of stably transformed cell lines

To determine a cell line with high transfection efficiency and high expression level of the reporter gene, the human ISG15 reporter gene plasmid described in example 1 was transiently transfected into a conventional epithelial cell line for the study of interferon availability by using Lipofectamine 2000 (Invitrogen, cat# 11668-027), comprising: calu-3 cells (human lung adenocarcinoma cells, ATCC number: HTB-55), hela cells (human cervical carcinoma cells, ATCC number: CRM-CCL-2), A549 (human alveolar adenocarcinoma basal epithelial cells ATCC number: CRM-CCL-185), HNEPC cells (human nasal mucosa epithelial cells, yubo organism, cat# C304). And (3) respectively adding 5ng/ml of IFN alpha-1 b and IFN-lambda 1 into the cells after transient transformation to act for 16-24 hours, and then detecting by using a firefly luciferase reporter gene detection kit (Biyun days, product number: RG 005). The specific experimental steps are as follows:

(1) Cell inoculation: culturing cells to logarithmic phase, digesting Calu-3 cells, hela cells, A549 cells, HNEPC cells with pancreatin digestive juice, centrifuging to collect cells, and resuspending cells with anti-biological serum-free DMEM (MEM) medium at a cell concentration of 1×10 ⁶ Four cells per ml were inoculated into 24-well plates, cultured for 24 hours, and the wall was intact, and 500. Mu.l/well of the antibiotic-free serum-containing DMEN (MEM) medium was replaced.

(2) Transfection procedure:

configuration of human ISG15 reporter plasmid and Lipofectamine 2000 (24 well plate)

And (3) solution A: mu.l of DMEM medium stock solution was added with 1.0. Mu.g of ISG15-luc plasmid, and gently mixed

And (2) liquid B: lipofectamine 2000 was gently swirled before use, and then 2.0. Mu.l Lipofectamine 2000 was incubated in 50. Mu.l DMEM medium stock solution for 5 minutes at room temperature.

Mixing solution A and solution B, standing for 20min, preparing to obtain plasmid and liposome mixture, adding the prepared mixture into transfection well (100 μl/well), and adding 5% CO at 37deg.C ₂ Culturing for 4-6 hours under the condition, and changing fresh resistanceA biotin culture solution.

(3) Induction expression of reporter gene: and (2) adding 50ng/ml of IFN alpha-1 b (Shenzhenzhen Xingzhixing pharmaceutical Co., ltd., national standard code number: S20033039) and IFN-lambda 1 (pbl assay science Co., ltd., code number: 11725-1) into the cells in the step (2) to culture for 16-24 hours, and then detecting the activity of luc according to the specification of a firefly luciferase reporter gene detection kit (Biyun Tian, code number: RG 005). This experiment was repeated three times with plasmid pGL6-TA as a blank.

The experimental results are shown in fig. 1: in A549 cells, neither IFN- λ1 nor IFN- α -1b was able to induce expression of the reporter gene; in Calu-3 cells, IFN alpha-1 b can induce the expression of a reporter gene, but IFN lambda 1 induces the expression rate of the reporter gene to be very low; in HNEPC cells and Hela cells, IFN alpha-1 b and IFN lambda 1 can induce high expression of reporter genes. Therefore, HNEPC cells and Hela cells are preferred as stable transgenic cell lines for human ISG15 reporter genes. In addition, considering that the human ISG15 reporter gene stably transformed cell line is mainly applied to biological activity detection and pharmacodynamics research of interferon, as recombinant human interferon lambda 1 nasal spray in the patent description of publication No. CN115531315A is mainly applied to nasal cavity local administration, antiviral effect is exerted, and response cells are mainly human nasal mucosa cells. Therefore, more preferably, HNEPC cells are selected as stable transgenic cell lines of human ISG15 reporter gene for subsequent use.

Comparative example 1: comparison of responsiveness of different interferon-stimulated genes to interferon λ1 induction

Notably, interferons do not inactivate viruses directly, but rather exert antiviral effects by inducing expression of a series of Interferon-stimulated genes (ISGs) in target cells in either an autocrine or paracrine fashion. The proteins expressed by ISGs are widely covered and of a wide variety, have a variety of biological activities and can act on various stages of the viral replication cycle, with the most typical ISGs proteins including: anti-myxoviral protein (Mx), IFIT protein family, interferon stimulating gene 15 (ISG 15), and the like. Thus, in this comparative example, the responsiveness of various ISGs to induction by interferon λ1 was compared.

The constructed reporter gene plasmids containing Mx1, IFIT1 and ISG15 promoter sequences are respectively and transiently transferred into HNEPC cells, 5ng/ml IFN-lambda 1 is respectively added to act for 16-24 hours, and then the reporter gene plasmids are detected by using a firefly luciferase reporter gene detection kit, and the specific operation is the same as that of example 1 and example 2, and the results are shown in the following table 1: the constructed human ISG15 reporter gene HNEPC cell strain has higher response intensity and is more stable than Mx1 and IFIT 1. This also demonstrates that ISG15 is more suitable as a reporter gene for detecting IFN- λ1 activity.

TABLE 1

Example 3: construction of monoclonal cell line HNEPC-ISG15-luc stably expressing human ISG15 reporter Gene

After successful construction of recombinant plasmid of human ISG15 promoter reporter gene, liposome transfection technique was used to construct a stable transfected human ISG15 promoter fluorescent reporter gene HNEPC cell line, and geneticin G418 (ThermoFisher, cat# 10131035) was used to screen out positive cell clones.

(1) HNEPC cells in logarithmic phase were digested with pancreatin, 1×10 ⁵ 6-well plates are paved on the holes, and the mixture is cultured for 16-24 hours overnight, wherein the culture medium is DMEM (DMEM) culture medium containing 10% FBS and free of any antimicrobial.

(2) pGL6-ISG15-luc plasmid to be transfected was gently mixed with Opti-MEM medium in a proportion of 1. Mu.g:250. Mu.l and left at room temperature.

(3) The transfection reagent Lipofectamine 2000 was gently mixed with Opti-MEM medium at a 1:100 volume ratio and incubated for 5min at room temperature.

(4) Mix diluted plasmid to be transferred with diluted Lipofectamine 2000 gently mix and incubate for 20min at room temperature.

(5) Old medium in 6-well plates was discarded and 0.5ml of a mixture of plasmid and transfection reagent was added to each well. After gentle mixing, the mixture was placed in an incubator for 4-6 hours and then replaced with DMEM cell culture medium containing 10% fbs but no antibiotics.

(6) After 24h of transfection, the cells were transferred to a plurality of six well plates containing fresh DMEM medium at a ratio of 1:5. After 24h incubation, the culture was changed to selection medium containing G418 at a final concentration of 100. Mu.g/ml, and G418 selection medium containing 10% FBS was changed every 2-3 days, during which time passage was determined depending on the cell growth.

(7) Cells that survived the 2-week selection at G418 were stably transfected cells.

(8) After digestion of the obtained stably transfected cells, dilution to 1/. Mu.l was performed by limiting dilution, followed by inoculation into 96-well plates at 100. Mu.l/well, after incubation for a period of time, microscopic observation was performed, wells of individual cloned cells were labeled and the cells were expanded, frozen and identified.

(9) In this example, 6 single-cell clones were selected, and after the 6 single-cell clones were subjected to expansion culture, 0ng/ml (blank control group) or 50ng/ml IFN-. Lamda.1 (experimental group) was added to the cells, and the cells were cultured for 16 to 24 hours, and then the corresponding luminescence values of luciferin were detected according to the specification of a firefly luciferase reporter gene detection kit (Biyun, cat# RG 005). Relative luciferase activity = experimental group cell luciferase activity/placebo group luciferase activity, the placebo group relative luciferase activity was set to 1.

As shown in FIG. 2, only 2 monoclonal cells (2 # and 4 #) among the 6 monoclonal cells significantly expressed the luciferase reporter gene under IFN- λ1 stimulation, and the luciferase activity was increased by 25-fold and 12-fold (P < 0.05) compared with the control group. The strain 2# is preferably frozen for seed preservation and designated HNEPC-ISG15-luc.

Example 4: application of HNEPC-ISG15-luc stable cell strain in interferon activity detection

The HNEPC-ISG15-luc stably transformed cell line constructed in example 3 can be used for simultaneously measuring the biological activity of human type I and type III interferons. Compared with the traditional virus inhibition detection method, the detection method has the advantages that the detection time is greatly shortened (shortened to about 1 day from 3-7 days in the traditional method), the virus culture and cell attack time is saved, the possible biological safety hazard is avoided, and the experimental accuracy and repeatability are improved. The method comprises the following specific steps:

(1) HNEPC-ISG15-luc cells were resuspended to 2X 10 with complete medium ⁵ Mu.l/well of each well was plated into 96-well plates, 100. Mu.l/well, and IFN alpha-1 b and IFN-lambda 1 (0, 3.2, 16, 80, 400, 2000, 10000, 100000, pg/ml) were added at different dilutions, 100. Mu.l/well, and incubated in an incubator overnight for 12-24 hours.

(2) After the incubation, the supernatant was discarded, the cells were washed 1 time with PBS, and the residual solution was discarded as much as possible, and the cell lysate was added to 100. Mu.l/well of the firefly luciferase reporter assay kit (Biyun, cat# RG 005) and incubated for about 15min. After the cells were sufficiently lysed, 10000-15000 Xg were centrifuged for 3-5 minutes and 50. Mu.l/well supernatant was taken for detection.

(3) 50 μl of firefly luciferase detection reagent was added to each well, and after mixing for 3s, the RLU was detected with an ELISA reader. Relative luciferase activity (RA) =cell luciferase activity of experimental group/luciferase activity of blank control group, and relative luciferase activity of blank control group was set to 1. The protein concentration of the test sample (pg/ml) is plotted on the abscissa and the relative luciferase activity (RA) is plotted on the ordinate, and a four-parameter curve fit is performed. And the median effective concentration EC50 (ng/ml) of the test samples was calculated separately.

As shown in the experimental results A and B of FIG. 3, the activity of IFN-lambda 1 and IFN alpha-1B can be simultaneously measured by adopting HNEPC-ISG15-luc stable cell strain, the four-parameter curve fitting degree is high, and R ² Can reach more than 0.99.

And referring to the first cytopathic effect inhibition method of interferon biological activity assay of Sanzhu Jiuzhu Jiuzhi 3523 in Chinese pharmacopoeia, the method is based on the fact that interferon can protect human amniotic cells (WISH) from being damaged by Vesicular Stomatitis Virus (VSV), surviving WISH cells are stained by crystal violet, absorbance is measured at a wavelength of 570nm, and a protective effect curve of interferon on the WISH cells can be obtained, so that the biological activity of type I interferon can be measured. However, this method is only applicable to type I interferon, and even if IFN-. Lamda.1 is added at a high concentration, it does not exert a protective effect on WISH cells (see C and D in FIG. 3).

Example 5: HNEPC-ISG15-luc steady transfer cell strain and research on pharmacodynamics of interferon

Interferons do not inactivate viruses directly, but rather exert antiviral effects by inducing expression of a series of interferon-stimulated genes (ISGs) within target cells via paracrine or autocrine pathways. Thus, upregulation of ISGs gene transcription levels or protein expression is a major target molecule reflecting interferon potency. The HNEPC-ISG15-luc stable transgenic cell strain is a human ISG15 luciferase reporter gene detection system, and can study the action mechanism and pharmacodynamics of interferon or ISG15 gene induction related drugs by detecting the activation level of human ISG15 genes. As in example 4, the dose-dependent profile of interferon and relative luciferase activities may provide a theoretical basis for non-clinical safety assessment and dose selection in clinical studies. In addition, a time correlation curve of the activities of interferon and relative luciferase can provide theoretical basis for the non-clinical safety evaluation and the administration flow in clinical research, and the specific implementation steps are as follows:

(1) HNEPC-ISG15-luc cells were resuspended to 1X 10 with complete medium ⁵ Each ml was plated into 96-well plates at 100. Mu.l/well and placed in an incubator overnight for complete cell attachment.

(2) The medium was discarded, replaced with 200. Mu.l/well IFN-. Lamda.1 in a final concentration of 0 (control) and 50ng/ml (experimental) in the maintenance medium, and incubated for 1h (1 h after basal metabolism) for nasal topical administration of recombinant human interferon-. Lamda.1 in the description of the model publication No. CN115531315A patent.

(3) After the incubation, the supernatant was discarded, and the medium was changed to a maintenance medium, and RLU was detected by an enzyme-labeled instrument 1, 6, 12, 24, 36, and 48 hours after the completion of the interferon incubation. Relative luciferase activity (RA) =experimental/placebo group luciferase activity at each time point, the placebo group relative luciferase activity was set to 1.

The results of the experiment are shown in FIG. 4, and the luciferase activity in HNEPC-ISG15-luc cells is increased by 3, 13, 16, 15, 8 and 3 times respectively relative to the control cells 1, 6, 12, 24, 36 and 48 hours after IFN- λ1 administration, and the results suggest that: the IFN- λ1 was induced to up-regulate higher levels of ISG15 transcription in nasal mucosal epithelial cells 6 hours after a single dose and continued for 24 hours after the dose followed by down-regulation to 48 hours after the single dose, and the results suggested that IFN- λ1 should be given up-dosing 24 hours after the first dose interval to maintain higher levels of ISG15 protein expression.

Meanwhile, the RT-PCR method is adopted to detect the transcription change of the ISG15 gene after single administration of HNEPC cell IFN-lambda 1, and the specific steps are as follows:

(1) HNEPC cells were resuspended to 2×10 with DMEM medium containing 10% fbs ⁵ Per ml, plated into 24-well plates, 1 ml/well, placed in an incubator overnight for culture, and cells were allowed to adhere completely.

(2) The medium was discarded, replaced with 200. Mu.l/well of IFN-. Lamda.1 at a final concentration of 0 (control) and 50ng/ml (experimental) in the maintenance medium, and incubated for 1h.

(3) After the incubation, the supernatant was discarded and the maintenance medium was changed to 0, 6, 12, 24, 48h after the interferon incubation was completed, and cells were collected at each time point after pancreatin digestion. Each group of cells was collected for total RNA extraction.

(4) RNA preparation: 700. Mu.l of the lysate was previously added to a 1.5mL centrifuge tube, followed by grinding with a low temperature tissue grinder, incubation at room temperature for 5 minutes, and then 140. Mu.l of chloroform was added to the lysate, followed by mixing upside down, incubation at room temperature for 10 minutes, 12000 g.times.10 minutes. Transferring 300-400 microliters of supernatant to a 96-well reagent plate of a MagaBio plus total RNA purification kit II after centrifugation, placing the 96-well plate into an NPA-32P nucleic acid extraction and purification instrument, installing a magnetic bar sheath, carrying out an automatic extraction experiment according to a specification setting program, transferring an eluent to a clean nuclease-free centrifuge tube after the automatic extraction program is finished, and carrying out reverse transcription after measuring the nucleic acid concentration.

(5) Reverse transcription: the amount of RNA required was calculated from the concentration of RNA, and the RT reaction solution was prepared according to the instructions of PrimeScript ™ RT Master Mix (Perfect Real Time) (the reaction solution was prepared on ice), and after shaking and mixing, the reverse transcription reaction was performed in a PCR apparatus.

(6) qPCR: the qPCR reaction solution was prepared according to TB Green cube Ex Taq ™ (Tli RNaseH Plus), bulk instructions, and the primers were shown in Table 1. Setting Applied Biosystems 7500 Real-Time PCR System two-step PCR amplification standard program, selecting beta-actin as reference gene, repeating three times for each sample, and calculating relative expression of gene by delta CT method. Result analysis method (RQ calculation method):

Δct (drug group) =ct (drug group target gene) -CT (reference gene within drug group);

Δct (control) =ct (control target gene) -CT (control internal reference gene);

ΔΔct= Δct (drug group) - Δct (control group);

RQ=2 ^-△△CT ；

it is noted that, the RT-PCR method is basically consistent with the experimental trend detected by the HNEPC-ISG15-luc method (see FIG. 4), but compared with the HNEPC-ISG15-luc method, the RT-PCR method needs to collect samples at each time point and uniformly extract total RNA, and cannot detect the total RNA in real time as the HNEPC-ISG15-luc method, so that the operation is complex and the deviation is larger.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Claims

1. A method for constructing a stable transgenic cell line of a human ISG15 reporter gene, which is characterized by comprising the following steps:

(2) Transfecting the human ISG15 reporter plasmid prepared in step (1) into human epithelial cells, wherein the human epithelial cells are HNEPC cells;

(3) And (3) carrying out resistance screening on transfected cells by adopting proper antibiotics according to the resistance genes carried in the plasmids, so as to obtain the human ISG15 reporter gene stably transfected cells.

2. The method of claim 1, wherein the method further comprises the step of:

(4) And (3) screening the stable transgenic cells obtained in the step (3) by a limiting dilution method to obtain the human ISG15 reporter gene stable transgenic monoclonal cell strain.

3. The method of claim 1, wherein the reporter plasmid is a luciferase reporter plasmid.

4. The method of claim 3, wherein the luciferase reporter plasmid is pGL6-TA, and the human ISG15 reporter plasmid obtained by inserting the human ISG15 gene promoter sequence into pGL6-TA is called pGL6-ISG15-luc.

5. A human ISG15 reporter stably transfected cell strain constructed using the method of any of claims 1-4.

6. The use of the human ISG15 reporter stable transgenic cell line of claim 5, in one or more selected from the group consisting of:

(a) A method for detecting the biological activity of interferon;

(b) Validity, mechanism of action and time of action research of interferon;

(c) Screening for related drugs that induce an ISG15 response;

wherein the interferon is a type I or type III interferon.

7. A test agent comprising the human ISG15 reporter stably transfected cell strain of claim 5.

8. A kit, comprising:

(C1) The human ISG15 reporter stable transgenic cell line of claim 5;

(C2) And (3) a reporter gene detection reagent.

9. An in vitro method for detecting interferon biological activity, comprising assaying using the human ISG15 reporter stable transgenic cell line of claim 5; wherein the interferon is a type I or type III interferon.

10. An in vitro interferon pharmacodynamic assay method comprising assaying using the human ISG15 reporter stable transgenic cell strain of claim 5; wherein the interferon is a type I or type III interferon.