CN117126849A

CN117126849A - DNA sequence, expression vector and application

Info

Publication number: CN117126849A
Application number: CN202210557424.2A
Authority: CN
Inventors: 王东芳
Original assignee: Hangzhou Fangyun Biotechnology Co ltd
Current assignee: Hangzhou Fangyun Biotechnology Co ltd
Priority date: 2022-05-19
Filing date: 2022-05-19
Publication date: 2023-11-28

Abstract

The invention discloses a DNA sequence, an expression vector and application thereof as a terminator in target gene expression, wherein the DNA sequence has the nucleotide sequence shown as SEQ ID NO.1 or the complementary sequence thereof with more than 90 percent of identity. The present invention provides a novel DNA sequence which has an effect of enhancing the expression of a target gene, and the expression level of the target gene is improved by more than 50% compared with the conventional terminator T-nos. The DNA sequence has great potential application value as a terminator in the aspect of target gene overexpression.

Description

DNA sequence, expression vector and application

Field of the art

The invention relates to a DNA sequence, an expression vector and application thereof.

(II) background art

In plant transgenic technology, the expression of foreign genes is subjected to a series of steps such as transcription, post-transcriptional processing, translation and post-translational processing, and specific amino acid sequences are produced at specific times and spaces. The expression pattern and the expression level of the gene can be controlled by controlling different stages of gene expression. In these control modes, in addition to the characteristics of the gene itself, the expression control sequences at both ends thereof, particularly the promoter sequence at the 5 'end and the non-coding sequence at the 3' end (terminator sequence) of the gene tend to have a strong influence on the expression of the gene.

The transcription terminator is located downstream of the gene or operon and is responsible for the dissociation of the RNA polymerase and release of transcribed RNA to thereby serve as a segment of RNA sequence that terminates transcription. In eukaryotic cells, the Pre-mRNA (Pre-mRNA) is transcribed and further processed to form a translationally active mRNA, and the 3 '-end of the mRNA is usually terminated with a tail consisting of 25-250 nucleotide residues poly (A), which is predominantly determined by the nucleotide sequence of the non-coding region of the 3' -end of the gene, which is called the 3 '-end processing signal (3' -processing signal) or Terminator.

Previously, studies on terminators have focused mainly on prediction and identification, and the role of terminators in regulating gene expression or genetic circuits have been attracting attention in recent years. Terminators not only prevent transcription readthrough, but also contribute significantly to the improvement of the stability of upstream mRNA. However, to date, most terminator regulatory element studies have focused mainly on microorganisms, and only a small part of the literature mentions applications in plants.

Although the terminator does not function as an enhancer, plant terminators of different sources have very different effects on exogenous expression. The literature reports indicate that the 3' end sequences from different sources have a strong influence on the expression level of the Npt-II enzyme in transformed tobacco cells, which can be up to 60 times different.

The most commonly used terminators in the conventional transgenic engineering are the nopaline synthase (NOS) terminator (T-Nos), the 35S terminator of CaMV and the like, but when a polygene overexpression vector is constructed, the number of alternative terminators is too small, and the efficiency of the terminator is also required to be improved, so that the development of a novel efficient terminator is very important.

(III) summary of the invention

The invention aims to provide a DNA sequence, an expression vector and application, wherein the DNA sequence can be used as a terminator to remarkably improve the expression quantity of a target gene, particularly a cp4 gene, in plants, and has a high potential application value.

The technical scheme adopted by the invention is as follows:

the invention provides a DNA sequence, which has the nucleotide sequence shown in SEQ ID NO.1 or the complementary sequence thereof with more than 90 percent of identity, and the nucleotide sequence of the preferred DNA sequence is shown in SEQ ID NO. 1.

Because of the specificity of the nucleotide sequence, nucleotide sequences in which one or more bases are deleted, substituted or added to the nucleotide sequence of SEQ ID NO.1 and which have more than 90% identity to any region of the nucleotide sequence shown in SEQ ID NO.1 consisting of 319 or more bases are within the scope of the present invention. The one or more base deletions, substitutions or additions refers to no more than 10% of the base deletions, substitutions or additions.

The DNA sequence of the present invention also includes a nucleotide sequence which hybridizes with the DNA sequence shown in SEQ ID NO.1 under high stringency conditions. The high stringency conditions described above can be hybridization in hybridization solution at 60℃and washing the membrane in a solution of 0.5 XSSC, 0.1% SDS at 60 ℃.

The invention also provides an expression vector containing the DNA sequence, wherein the expression vector comprises a target gene and the DNA sequence, the expression vector takes pCambia1300 (purchased from VWR company, NCBI serial number: AF 234296) as a basic vector, and the DNA sequence is connected at the 3' end of the target gene.

The invention also provides an artificially introduced cell line, host bacteria or plant cells containing the expression vector.

The invention also provides an application of the DNA sequence as a terminator in improving the expression efficiency of a target gene. The application is that the DNA sequence is used as a terminator to construct an expression vector containing a target gene, then the expression vector is transformed into cells or tissues of a plant host, and the transformed tissues are cultivated into plants, so that the expression efficiency of the target gene is improved.

When the DNA sequence is used as a terminator to construct an expression vector, any one of a promoter sequence and a target gene sequence can be added before the sequence; the target genes comprise glyphosate resistance genes cp4, insect resistance genes cry1Ab, herbicide resistance genes bar, editing genes cas9 and the like; the promoter of the target gene comprises a 35S promoter of cauliflower mosaic virus CaMV, a corn UBI promoter, a rice Act1 promoter and the like. The expression vector can be used to transform plant cells or tissues by using Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium-mediated and other conventional biological methods.

The plant host can be monocotyledonous plants or dicotyledonous plants, wherein the monocotyledonous plants can be turf grass, wheat, barley, oat, sorghum, rice or maize, etc., and the dicotyledonous plants can be potatoes, tobacco, cotton, lettuce, tomatoes, melons, soybeans, rape, mulberry, cowpea, cucumber, peas, beets or sunflowers, etc.

Compared with the prior art, the invention has the beneficial effects that: the present invention provides a novel DNA sequence which has an effect of enhancing the expression of a target gene, and the expression level of the target gene is improved by more than 50% compared with the conventional terminator T-nos. The DNA sequence has great potential application value as a terminator in the aspect of target gene overexpression.

(IV) description of the drawings

Fig. 1: the DNA sequence of the present invention is used as a novel terminator TOsHSPI18.1 to construct the expression cassette.

Wherein, the promoter represents any promoter sequence capable of mediating the expression of a target gene, the gene represents any target gene, and TOsHSPI18.1 represents a novel terminator in the present invention.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

both molecular biology and biochemistry methods used in the following examples of the invention are known techniques. The details of these documents are shown in Current Protocols in Molecular Biology published by the company John Wiley and Sons in Ausubel and Molecular Cloning: A Labortory Manual,3rd ED. Et al published by J.Sambrook et al, in Cold Spring Harbor Laboratory Press (2001).

Example 1 cloning of DNA sequences

A DNA sequence fragment of about 0.3kb was obtained by PCR using the genome of the indica inbred line (9311) as a template and TF1 and TR1 as primers. The DNA fragment obtained by PCR was cloned into pMD-18-T-Vector (TaKaRa), and the sequence was determined, and the nucleotide sequence was shown in SEQ ID NO. 1.

TF1：5’TAAGAAACTTCGGGTGTGACATGCACGGTG)

TR1：5’CTCTCAATTTCCGAAATGAACTCTCCAGTCTCG)。

SEQ ID NO.1

taagaaacttcgggtgtgacatgcacggtggagagcttcgattcgagccttcggtttgtgatcaattgcagtaaataaaagcgtcaaatctggtcctcagtgtttatgctgtgaaaaagttcaaagctatgttggaagtgagcaataaagacttttcttgttttgtgaacgaacctgagattatactagtcctacacttgtttgtttaatctaatctccggtatattctgccatttttatctcgatgtttcagtacttttagcctttggttcttgaatccttctgtcgagactggagagttcatttcggaaattgagag.

Example 2 construction of plant expression vectors

The CP4 gene and Cry1Ab gene can respectively endow plants with glyphosate-resistant and lepidopteran pest-resistant properties, commercial CP4 protein and Cry1Ab protease-linked immunosorbent assay (ELASA) kits can be conveniently purchased in the market, and the kits can be very conveniently used for quantifying the CP4 protein and Cry1Ab protein, so that the expression analysis of the CP4 gene and Cry1Ab is convenient. We selected cp4 and cry1ab as the genes of interest. The 35S promoter p35S of cauliflower mosaic virus (CaMV) is one of the most commonly used promoters in current plant gene expression, and we use p35S as a promoter to mediate expression of genes of interest cp4 and cry1 ab. As a control, we constructed expression vectors using the DNA sequence of example 1 (designated as novel terminator TOsHSPI18.1) and the conventional terminator Tnos as terminators, respectively.

In order to construct the vector, a cp4 gene, a Tnos terminator (Shanghai biological organism) and a cry1ab gene are artificially synthesized, wherein nucleotide sequences of the cp4 gene, the Tnos terminator and the cry1ab gene are respectively shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4. pCambia1300 (available from VWR Co., ltd.) was used as a base vector (NCBI sequence No. AF 234296), hereinafter referred to as 1300.

cp4 gene (SEQ ID NO. 2)

atggcggcgaccatggcgtccaacgctgcggctgcggctgcggtgtccctggaccaggccgtggctgcgtcggcagcgttctcgtcgcggaagcagctgcggctgcctgccgcagcgcgcggagggatgcgggtgcgggtgcgggcgcggggtcggcgggaggcggtggtggtggcgtccgcgtcgtcgtcgtcggtggcagcgccggcggcgaaggctgagatgctacacggtgcaagcagccggccggcaaccgctcgcaaatcttccggcctttcgggaacggtcaggattccgggcgataagtccatatcccaccggtcgttcatgttcggcggtcttgccagcggtgagacgcgcatcacgggcctgcttgaaggtgaggacgtgatcaataccgggaaggccatgcaggctatgggagcgcgtatccgcaaggaaggtgacacatggatcattgacggcgttgggaatggcggtctgctcgcccctgaggcccctctcgacttcggcaatgcggcgacgggctgcaggctcactatgggactggtcggggtgtacgacttcgatagcacgttcatcggagacgcctcgctcacaaagcgcccaatgggccgcgttctgaacccgttgcgcgagatgggcgtacaggtcaaatccgaggatggtgaccgtttgcccgttacgctgcgcgggccgaagacgcctaccccgattacctaccgcgtgccaatggcatccgcccaggtcaagtcagccgtgctcctcgccggactgaacactccgggcatcaccacggtgatcgagcccatcatgaccagggatcataccgaaaagatgcttcaggggtttggcgccaacctgacggtcgagacggacgctgacggcgtcaggaccatccgccttgagggcaggggtaaactgactggccaagtcatcgatgttccgggagacccgtcgtccacggccttcccgttggttgcggcgctgctcgtgccggggagtgacgtgaccatcctgaacgtcctcatgaacccgaccaggaccggcctgatcctcacgcttcaggagatgggagccgacatcgaggtgatcaacccgcgcctggcaggcggtgaagacgttgcggatctgcgcgtgcgctcctctaccctgaagggcgtgacggtcccggaagatcgcgcgccgtccatgatagacgagtatcctattctggccgtcgccgctgcgttcgccgaaggggccacggtcatgaacggtcttgaggaactccgcgtgaaggaatcggatcgcctgtcggcggtggccaatggcctgaagctcaacggtgttgactgcgacgagggtgagacctcactcgtggtccgtggccggcctgatggcaagggcctcggcaacgccagtggagcggccgtcgccacgcacctcgatcatcgcatcgcgatgtccttcttggtgatgggtctcgtctcagagaacccggtgaccgtcgatgacgccacgatgatagcgacgagcttcccagagttcatggatctgatggcgggcctcggggccaagatcgaactgtctgacacgaaggccgct.Tnos(SEQ ID NO.3)：

cccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatc.

cry1ab gene (SEQ ID NO. 4):

atggacaacaacccgaacatcaacgagtgcatcccgtacaactgcctctccaacccggaggtggaggtgctcggcggcgagcgcatcgagaccggctacaccccgatcgacatctccctctccctcacccagttcctcctctccgagttcgtgccgggcgccggcttcgtgctcggcctcgtggacatcatctggggcatcttcggcccgtcccagtgggacgccttcctcgtgcagatcgagcagctcatcaaccagcgcatcgaggagttcgcccgcaaccaggccatctcccgcctggagggcctctccaacctctaccagatctacgccgagtccttccgcgagtgggaggccgacccgaccaacccggccctccgcgaggagatgcgcatccagttcaacgacatgaactccgccctcaccaccgccatcccgctcttcgccgtgcagaactaccaggtgccgctcctctccgtgtacgtgcaggccgccaacctccacctctccgtgctccgcgacgtgtccgtgttcggccagcgctggggcttcgacgccgccaccatcaactcccgctacaacgacctcacccgcctcatcggcaactacaccgaccacgccgtgcgctggtacaacaccggcctggagcgcgtgtggggcccggactcccgcgactggatcaggtacaaccagttccgccgcgagctcaccctcaccgtgctcgacatcgtgtccctcttcccgaactacgactcccgcacctacccgatccgcaccgtgtcccagctcacccgcgagatctacaccaacccggtgctggagaacttcgacggctccttccgcggctccgcccagggcatcgagggctccatccgctccccgcacctcatggacatcctcaactccatcaccatctacaccgacgcccaccgcggcgagtactactggtccggccaccagatcatggcctccccggtgggcttctccggcccggagttcaccttcccgctctacggcacgatgggcaacgccgccccgcagcagcgcatcgtggcccagctcggccagggcgtgtaccgcaccctctcctccaccctctaccgccgcccgttcaacatcggcatcaacaaccagcagctctccgtgctcgacggcaccgagttcgcctacggcacctcctccaacctcccgtccgccgtgtaccgcaagtccggcaccgtggactccctcgacgagatcccgccgcagaacaacaacgtgccgccgcgccagggcttctcccaccgcctctcccacgtgtccatgttccgctccggcttctccaactcctccgtgtccatcatccgcgccccgatgttctcctggattcaccgctccgccgagttcaacaacatcatcccgtcctcccagatcacccagatcccgctcaccaagtccaccaacctcggctccggcacctccgtggtgaagggcccgggcttcaccggcggcgacatcctccgccgcacctccccgggccagatctccaccctccgcgtgaacatcaccgccccgctctcccagcgctaccgcgtgcgcatccgctacgcctccaccaccaacctccagttccacacctccatcgacggccgcccgatcaaccagggcaacttctccgccaccatgtcctccggctccaacctccagtccggctccttccgcaccgtgggcttcaccaccccgttcaacttctccaacggctcctccgtgttcaccctctccgcccacgtgttcaactccggcaacgaggtgtacatcgaccgcatcgagttcgtgccggccgaggtgaccttcgaggccgagtacgacctggagcgcgcccagaaggccgtgaacgagctcttcacctcctccaaccagatcggcctcaagaccgacgtgaccgactaccacatcgaccaggtgtccaacctcgtggagtgcctctccgacgag.

1. construction of cp4 Gene expression binary vector 1300-p35S-cp4-TOsHSP18.1

And (3) carrying out PCR amplification by taking the 1300 carrier as a template and 1300-F1/R1 as a primer to obtain a1300 carrier fragment. And (3) PCR amplification is carried out by taking a nucleotide sequence (SEQ ID NO. 2) of the CP4 gene as a template and CP4-F1/R1 as a primer to obtain a CP4 gene fragment. The DNA sequence (SEQ ID NO. 1) obtained by cloning in example 1 was used as a template, and TOs18.1-F1/R1 was used as a primer, and a TOsHSPIP 18.1 terminator fragment was obtained by PCR amplification.

By means of recombinant enzymes (Mona organisms: monClone) ^TM Hi-Fusion Cloning Mix V2) subjecting the three fragments to homologous recombination to obtain the binary vector 1300-P35S-cp4-TOsHSP18.1, namely the T-DNA plasmid.

1300-F1:5’GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG；

1300-R1:5’CTCGAGATTCGGCGTTAATTCAGTACATTAAAAACGTC；

cp4-F1:5’AAATCTATCTCTGGACCACCATGGCGGCGACCATGGCGTCC；

cp4-R1:5’GAAGTTTCTTATCAAGCGGCCTTCGTGTCAGACAGTTCGATCTTGG；

TOs18.1-F1:5’CCGCTTGATAAGAAACTTCGGGTGTGACATGCACGGTGGAG；

TOs18.1-R1:5’GAATTAACGCCGAATCTCGAGCTCTCAATTTCCGAAATGAAC.

2. Construction of cry1ab Gene expression binary vector 1300-p35S-cry1ab-TOsHSP18.1

And (3) carrying out PCR amplification by taking the 1300 carrier as a template and 1300-F1/R1 as a primer to obtain a1300 carrier fragment. PCR amplification is carried out by taking cry1ab gene nucleotide sequence (SEQ ID NO. 4) as a template and taking 1ab-F1/R1 as a primer to obtain cry1ab gene fragment. The DNA sequence (SEQ ID NO. 1) obtained by cloning in example 1 was used as a template, and TOs18.1-F2/R2 was used as a primer, and a TOsHSPIP 18.1 terminator fragment was obtained by PCR amplification.

By means of recombinant enzymes (Mona organisms: monClone) ^TM Hi-Fusion Cloning Mix V2) will be described aboveThe three fragments undergo homologous recombination to obtain a binary vector 1300-P35S-cry1ab-TOsHSP18.1, i.e., a T-DNA plasmid.

1300-F1:5’GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG；

1300-R1:5’CTCGAGATTCGGCGTTAATTCAGTACATTAAAAACGTC；

1ab-F1:5’AAATCTATCTCTGGACCACCATGGACAACAACCCGAACATCAAC；

1ab-R1:5’GAAGTTTCTTATCACTCGTCGGAGAGGCACTCCACGAGGTTGGAC；

TOs18.1-F2:5’GACGAGTGATAAGAAACTTCGGGTGTGACATGCACGGTGGAG；

TOs18.1-R2:5’GAATTAACGCCGAATCTCGAGCTCTCAATTTCCGAAATGAAC.

3. Construction of cp4 Gene expression binary vector 1300-p35S-cp4-Tnos

And (3) carrying out PCR amplification by taking the 1300 carrier as a template and 1300-F1/R1 as a primer to obtain a1300 carrier fragment. And (3) taking a nucleotide sequence (SEQ ID NO. 2) of the cp4 gene as a template, and taking cp4-F2/R2 as a primer, and carrying out PCR amplification to obtain the cp4 gene fragment. The Tnos terminator fragment was obtained by PCR amplification using the nucleotide sequence of the Tnos terminator (SEQ ID NO. 3) as a template and nosF1/R1 as a primer.

By means of recombinant enzymes (Mono-organisms ^TM Hi-Fusion Cloning Mix V2) subjecting the above three fragments to homologous recombination to obtain binary vector 1300-P35S-cp4-Tnos.

1300-F1:5’GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG；

1300-R1:5’CTCGAGATTCGGCGTTAATTCAGTACATTAAAAACGTC；

cp4-F2:5’AAATCTATCTCTGGACCACCATGGCGGCGACCATGGCGTCC；

cp4-R2:5’GTTTGAACGATCGGGTTATCAAGCGGCCTTCGTGTCAGACAGTTC；

nosF1:5’GCTTGATAACCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAG；

nosR1:5’GAATTAACGCCGAATCTCGAGATCTAGTAACATAGATGACACCGC

4. Construction of cry1ab Gene expression binary vector 1300-p35S-cry1ab-Tnos

And (3) carrying out PCR amplification by taking the 1300 carrier as a template and 1300-F1/R1 as a primer to obtain a1300 carrier fragment. PCR amplification is carried out by taking cry1ab gene nucleotide sequence (SEQ ID NO. 4) as a template and taking 1ab-F2/R2 as a primer to obtain cry1ab gene fragment. The Tnos terminator fragment was obtained by PCR amplification using the nucleotide sequence of the Tnos terminator (SEQ ID NO. 3) as a template and nosF2/R2 as a primer.

By means of recombinant enzymes (Mono-organisms ^TM Hi-Fusion Cloning Mix V2) carrying out homologous recombination on the three fragments to obtain the binary vector 1300-P35S-cry1ab-Tnos, namely the control T-DNA plasmid.

1300-F1:5’GGTGGTCCAGAGATAGATTTGTAGAGAGAGACTGGTG；

1300-R1:5’CTCGAGATTCGGCGTTAATTCAGTACATTAAAAACGTC；

1ab-F2:5’AAATCTATCTCTGGACCACCATGGACAACAACCCGAACATCAAC；

1ab-R2:5’GTTTGAACGATCGGGTTATCACTCGTCGGAGAGGCACTCCACGAG；

nosF2:5’GATAACCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTG；

nosR2:5’GAATTAACGCCGAATCTCGAGATCTAGTAACATAGATGACACCGC.

5. Transformation of Agrobacterium

Finally, the 4T-DNA plasmids were transferred into Agrobacterium EHA105 by electrotransformation, positive clones were selected by YEP solid medium containing 15. Mu.g/mL tetracycline and 50. Mu.g/mL kanamycin, and monoclonal 1300-P35S-cp4-TOsHSP18.1, 1300-P35S-cry1ab-TOsHSP18.1,

1300-P35S-cp4-Tnos, 1300-P35S-cry1ab-Tnos, and were maintained for subsequent plant transformation.

Example 3 transient expression analysis of tobacco

The 1300-P35S-cp4-TOsHSP18.1, 1300-P35S-cry1ab-TOsHSP18.1, 1300-P35S-cp4-Tnos, 1300-P35S-cry1ab-Tnos obtained in example 2 were individually picked up and individually cloned in 5mL LB liquid culture containing 100. Mu.g/mL tetracycline and 50. Mu.g/mL kanamycin, and shake-cultured at 28-30℃overnight. 1mL of the overnight cultured agrobacterium liquid is transferred into 25mL of LB liquid medium containing 100 mug/mL of tetracycline, 50 mug/mL of kanamycin and 150 mug/L of sterilized acetosyringone, and cultured overnight at the temperature of 28-30 ℃, and the OD600 value of the bacteria measuring liquid is measured.5000g was centrifuged for 15 min and the cells were collected with a heavy suspension (0.2 mM AS (acetosyringone), 10mM MgCl) ₂ The cells were resuspended to an OD600 of 0.4 in 10mM MES solution pH5.6 (KOH-adjusted), which is the invading solution.

After the invaded solution is placed for 2-3 hours at room temperature, the invaded solution is filled into a 5mL syringe, and the syringe reverse plate is pressed by thumb to inject the solution into the tobacco leaf from the lower epidermis of the tobacco leaf (without using cotyledons). After injection, tobacco leaves may become wet. 2 days after injection, different infection solutions with the same quality are taken for infection of the rear leaf blades for detection of the expression level of the target protein cp4 or cry1 ab.

Method for detecting expression level of cp4 gene in tobacco: cutting 0.1g leaf into pieces, adding 1-1.5mL PBS, adding into a homogenizer, grinding, and strictly operating according to the instruction of CP4 EPSPS transgene detection kit (AP 010 enviroLogix). Specifically, the sample extract was diluted 500-fold with 1×pbs. The same tissue extracts of non-transgenic rice plants containing the same dilution fold were used as controls to detect background signals due to the test tissue. Each ELISA plate contained a CP4 standard of known concentration produced by the microorganism (Liu SP et al 2012.Journal of Agricultural Science and technology 14 (1): 97-103) for generating a standard curve (curve equation Y=1.794X+0.605). Each ELISA plate contains a blank buffer for detecting the background signal of the extraction buffer. Envirologix QualiPlate ^TM ELISA kit (cat. AP 010) was used to detect the CP4 content. Samples, controls and standards were added to the elisa plate and incubated for 30 minutes at room temperature. Then, the elisa plates were washed, an antibody conjugate solution was added to each of the elisa plates, and incubated at room temperature for 30 minutes. After antibody conjugation incubation, the elisa plate was washed. The substrate solution was added to the elisa plate and incubated at room temperature for 30 minutes. After incubation, the reaction stopped solution was added to the ELISA plate, OD values were read at 450nm, and the reaction stopped solution was converted into expression levels according to the standard curve equation (Table 1).

TABLE 1 average content of cp4 Gene in different tobacco leaves (. Mu.g/g.+ -. SD)

Note that: fresh weight mean, standard deviation and measurement ranges are based on all readings for each tissue type (n=10 different leaves). Student-t test analysis was performed on the mean values of each group, with differences in letters indicating the presence of a significant difference (p < 0.05) between the two groups of data.

As can be seen from Table 1, the average expression level of the cp4 gene in the leaf of vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of vector 1300-P35S-cp4-Tnos. Thus, compared with the conventional Tnos terminator, the TOsHSPI18.1 terminator can significantly increase the expression level of the target protein CP4 in transient expression of tobacco.

The method for detecting the cry1ab gene expression in tobacco comprises the following steps: cutting 0.1g of leaf, adding 1-1.5mL of PBS, grinding in a homogenizer, and operating according to the specification of Cry1Ab/Ac enzyme-linked immunosorbent assay kit transgene assay kit (AA 0342 Shanghai Youlong). Specifically, the sample extract was diluted 500-fold with 1×pbs. The same tissue extracts of non-transgenic rice plants containing the same dilution fold were used as controls to detect background signals due to the test tissue. Each elisa plate contained a Cry1Ab standard of known concentration produced by the microorganism for generating a standard curve (curve equation y=1.302x+0.163). Each ELISA plate contains a blank buffer for detecting the background signal of the extraction buffer. Samples, controls and standards were added to the elisa plate and incubated for 30 minutes at room temperature. Then, the elisa plates were washed, an antibody conjugate solution was added to each of the elisa plates, and incubated at room temperature for 30 minutes. After antibody conjugation incubation, the elisa plate was washed. The substrate solution was added to the elisa plate and incubated at room temperature for 30 minutes. After incubation, the reaction stopped solution was added to the ELISA plate, OD values were read at 450nm, and the reaction stopped solution was converted into expression levels according to the standard curve equation (Table 2).

TABLE 2 average content of cry1ab genes in different tobacco leaves (. Mu.g/g.+ -. SD)

As can be seen from Table 2, the average expression level of cry1ab gene in the leaf of vector 1300-P35S-cry1ab-TOsHSP18.1 was significantly higher than that of vector 1300-P35S-cry1 ab-Tnos. Thus, compared with the conventional Tnos terminator, the TOsHSPI18.1 terminator can significantly increase the expression level of the target protein Cry1Ab in transient expression of tobacco.

Example 4 Agrobacterium-mediated corn transformation assay

Transformation techniques for maize have been relatively mature. Reference is made, for example, to Vladimir Sidorov&David Duncan(in M.Paul Scott(ed.),Methods in MolecularBiology:TransgenicMaize,vol:526；Yuji Ishida,Yukoh Hiei&Toshihiko Komari (2007) Agrobacterium-mediated transformation of mail. Nature Protocols 2:1614-1622. The basic method is as follows: hi-II ears 8-10 days after pollination were taken and all immature embryos (1.0-1.5 mm in size) were collected. The dip-dye solutions containing the T-DNA vector (1300-P35S-cp 4-TOsHSPC 18.1 and 1300-P35S-cp 4-Tnos) prepared in example 3 were co-cultured with immature embryos on a co-culture medium (MS+2 mg/L2, 4-D+30g/L sucrose+3 g/L agar (sigma 7921) +40mg/L acetosyringone) for 2-3 days (22 ℃). Transferring immature embryos to callus induction medium (MS+2 mg/L2, 4-D+30g/L sucrose+2.5 g/L plant gel (gelrite) +5mg/L AgNO) ₃ +200mg/L acetosyringone), and dark-cultured at 28℃for 10-14 days. All calli were transferred to screening medium (same as callus induction medium) with 2mM glyphosate and dark cultured at 28℃for 2-3 weeks. All tissues were transferred to fresh screening medium containing 2mM glyphosate and dark cultured at 28℃for 2-3 weeks. All the screened viable embryogenic tissue was then transferred to regeneration medium (MS+30 g/L sucrose+0.5 mg/L6-furfuryl amino purine (kinetin) +2.5g/L gelrite+200mg/L acetosyringone) and dark cultured at 28℃for 10-14 days, one strain per dish. Transferring the embryogenic tissue onto fresh regeneration medium at 26 DEG CCulturing under light for 10-14 days. Transfer all developed plants to rooting medium (1/2MS+20 g/L sucrose+2.5 g/L gelrite+200mg/L acetosyringone), light culture at 26℃until root development is complete. Transgenic maize plants containing the transformation vectors 1300-P35S-cp4-TOsHSP18.1 and 1300-P35S-cp4-Tnos were obtained, respectively.

Referring to the examination method in example 3, the expression levels of the cp4 gene in the leaves of the transgenic maize line 4-5 leaf stage and the early-maturing leaf stage obtained by the above-described method were examined, respectively.

Table 3: average content of cp4 in different corn tissues (μg/g.+ -. SD)

Note that: fresh weight mean, standard deviation and measurement ranges are based on all reads for each tissue type (n=10 different lines). Student-t test analysis was performed on the mean values of each group, with differences in letters indicating the presence of a significant difference (p < 0.05) between the two groups of data.

As can be seen from Table 3, the average expression level of cp4 gene in leaf blades of maize transformant with vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of maize transformant with vector 1300-P35S-cp4-Tnos. From this, it was found that the novel terminator TOsHSPI18.1 can significantly increase the expression level of the target protein cp4 in maize as compared with the control terminator Tnos.

Example 5 Agrobacterium-mediated transformation analysis of soybeans

The procedure used here to obtain transgenic soybeans is from the prior art (Deng et al, 1998,Plant Physiology Communications 34:381-387; ma et al, 2008,Scientia Agricultura Sinica 41:661-668; zhou et al, 2001,Journal of Northeast Agricultural University 32:313-319). Healthy, full, ripe soybeans were selected, sterilized with 80% ethanol for 2 minutes, rinsed with sterile water, and then placed in a desiccator filled with chlorine gas (generated by reacting 50ml NaClO with 2ml concentrated HCl) for sterilization for 4-6 hours. The sterilized soybeans are sown in a B5 culture medium in an ultra-clean workbench, cultured for 5 days at 25 ℃,at the same time, the optical density is 90-150 mu mol photon/m ² Horizontal. When the cotyledons turn green and burst the seed coats, sterile bean sprouts grow. The bean sprouts from which the hypocotyls were removed were cut into five to five lengths so that both pieces of explants had cotyledons and epicotyls. The explants were cut approximately 7-8mm at the node of cotyledons and epicotyls and used as the affected target tissue.

The prepared explants were immersed in the immersion dye solutions containing the vectors 1300-P35S-cp4-TOsHSP18.1 and 1300-P35S-cp4-Tnos prepared in the method of example 3 for co-cultivation at 26℃for 30 minutes. Then, the superfluous dye solution on the infected tissue is absorbed by absorbent paper and transferred to 1/10B5 co-culture medium for dark culture at 25 ℃ for 3-5 days. The co-cultivated plant tissue was washed with B5 liquid medium to remove excess agrobacterium, and then placed in B5 solid medium for 5 days at 25 ℃ until it germinated. The induced germ tissue was transferred to B5 screening medium containing 0.1-0.5mM glyphosate and incubated at 25℃for 4 weeks with medium changes every two weeks. Transferring the selected embryo tissue into B5 solid culture medium, and culturing at 25deg.C until it grows into young seedling. Subsequently, the transgenic plant seedlings were transferred to 1/2B5 medium for rooting induction. Finally, the grown plantlets are planted in a greenhouse after agar is removed by washing.

Referring to the examination method in example 3, the expression level of cp4 gene of V2-stage leaf blades in the transgenic soybean line obtained by the above-described method was examined, respectively.

Table 4: average content of cp4 in different soybean tissues (μg/g.+ -. SD)

As can be seen from Table 4, the average expression level of the cp4 gene in the leaf of the soybean transformant of vector 1300-P35S-cp4-TOsHSP18.1 was significantly higher than that of the soybean transformant of vector 1300-P35S-cp4-Tnos. From this, it was found that the novel terminator TOsHSPI18.1 can significantly increase the expression level of the target protein cp4 in soybean, compared with the control terminator Tnos.

Finally, it should also be noted that the above list is merely a specific example of the invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.

Sequence listing

<110> Hangzhou aromatic rhyme Biotechnology Co., ltd

<120> a DNA sequence, expression vector and use

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 319

<212> DNA

<213> Unknown (Unknown)

<400> 1

taagaaactt cgggtgtgac atgcacggtg gagagcttcg attcgagcct tcggtttgtg 60

atcaattgca gtaaataaaa gcgtcaaatc tggtcctcag tgtttatgct gtgaaaaagt 120

tcaaagctat gttggaagtg agcaataaag acttttcttg ttttgtgaac gaacctgaga 180

ttatactagt cctacacttg tttgtttaat ctaatctccg gtatattctg ccatttttat 240

ctcgatgttt cagtactttt agcctttggt tcttgaatcc ttctgtcgag actggagagt 300

tcatttcgga aattgagag 319

<210> 2

<211> 1846

<212> DNA

<213> Unknown (Unknown)

<400> 2

atggcggcga ccatggcgtc caacgctgcg gctgcggctg cggtgtccct ggaccaggcc 60

gtggctgcgt cggcagcgtt ctcgtcgcgg aagcagctgc ggctgcctgc cgcagcgcgc 120

ggagggatgc gggtgcgggt gcgggcgcgg ggtcggcggg aggcggtggt ggtggcgtcc 180

gcgtcgtcgt cgtcggtggc agcgccggcg gcgaaggctg agatgctaca cggtgcaagc 240

agccggccgg caaccgctcg caaatcttcc ggcctttcgg gaacggtcag gattccgggc 300

gataagtcca tatcccaccg gtcgttcatg ttcggcggtc ttgccagcgg tgagacgcgc 360

atcacgggcc tgcttgaagg tgaggacgtg atcaataccg ggaaggccat gcaggctatg 420

ggagcgcgta tccgcaagga aggtgacaca tggatcattg acggcgttgg gaatggcggt 480

ctgctcgccc ctgaggcccc tctcgacttc ggcaatgcgg cgacgggctg caggctcact 540

atgggactgg tcggggtgta cgacttcgat agcacgttca tcggagacgc ctcgctcaca 600

aagcgcccaa tgggccgcgt tctgaacccg ttgcgcgaga tgggcgtaca ggtcaaatcc 660

gaggatggtg accgtttgcc cgttacgctg cgcgggccga agacgcctac cccgattacc 720

taccgcgtgc caatggcatc cgcccaggtc aagtcagccg tgctcctcgc cggactgaac 780

actccgggca tcaccacggt gatcgagccc atcatgacca gggatcatac cgaaaagatg 840

cttcaggggt ttggcgccaa cctgacggtc gagacggacg ctgacggcgt caggaccatc 900

cgccttgagg gcaggggtaa actgactggc caagtcatcg atgttccggg agacccgtcg 960

tccacggcct tcccgttggt tgcggcgctg ctcgtgccgg ggagtgacgt gaccatcctg 1020

aacgtcctca tgaacccgac caggaccggc ctgatcctca cgcttcagga gatgggagcc 1080

gacatcgagg tgatcaaccc gcgcctggca ggcggtgaag acgttgcgga tctgcgcgtg 1140

cgctcctcta ccctgaaggg cgtgacggtc ccggaagatc gcgcgccgtc catgatagac 1200

gagtatccta ttctggccgt cgccgctgcg ttcgccgaag gggccacggt catgaacggt 1260

cttgaggaac tccgcgtgaa ggaatcggat cgcctgtcgg cggtggccaa tggcctgaag 1320

ctcaacggtg ttgactgcga cgagggtgag acctcactcg tggtccgtgg ccggcctgat 1380

ggcaagggcc tcggcaacgc cagtggagcg gccgtcgcca cgcacctcga tcatcgcatc 1440

gcgatgtcct tcttggtgat gggtctcgtc tcagagaacc cggtgaccgt cgatgacgcc 1500

acgatgatag cgacgagctt cccagagttc atggatctga tggcgggcct cggggccaag 1560

atcgaactgt ctgacacgaa ggccgcttga cccgatcgtt caaacatttg gcaataaagt 1620

ttcttaagat tgaatcctgt tgccggtctt gcgatgatta tcatataatt tctgttgaat 1680

tacgttaagc atgtaataat taacatgtaa tgcatgacgt tatttatgag atgggttttt 1740

atgattagag tcccgcaatt atacatttaa tacgcgatag aaaacaaaat atagcgcgca 1800

aactaggata aattatcgcg cgcggtgtca tctatgttac tagatc 1846

<210> 3

<211> 256

<212> DNA

<213> Unknown (Unknown)

<400> 3

cccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 60

gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 120

tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 180

tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 240

tctatgttac tagatc 256

<210> 4

<211> 1974

<212> DNA

<213> Unknown (Unknown)

<400> 4

atggacaaca acccgaacat caacgagtgc atcccgtaca actgcctctc caacccggag 60

gtggaggtgc tcggcggcga gcgcatcgag accggctaca ccccgatcga catctccctc 120

tccctcaccc agttcctcct ctccgagttc gtgccgggcg ccggcttcgt gctcggcctc 180

gtggacatca tctggggcat cttcggcccg tcccagtggg acgccttcct cgtgcagatc 240

gagcagctca tcaaccagcg catcgaggag ttcgcccgca accaggccat ctcccgcctg 300

gagggcctct ccaacctcta ccagatctac gccgagtcct tccgcgagtg ggaggccgac 360

ccgaccaacc cggccctccg cgaggagatg cgcatccagt tcaacgacat gaactccgcc 420

ctcaccaccg ccatcccgct cttcgccgtg cagaactacc aggtgccgct cctctccgtg 480

tacgtgcagg ccgccaacct ccacctctcc gtgctccgcg acgtgtccgt gttcggccag 540

cgctggggct tcgacgccgc caccatcaac tcccgctaca acgacctcac ccgcctcatc 600

ggcaactaca ccgaccacgc cgtgcgctgg tacaacaccg gcctggagcg cgtgtggggc 660

ccggactccc gcgactggat caggtacaac cagttccgcc gcgagctcac cctcaccgtg 720

ctcgacatcg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccagctca cccgcgagat ctacaccaac ccggtgctgg agaacttcga cggctccttc 840

cgcggctccg cccagggcat cgagggctcc atccgctccc cgcacctcat ggacatcctc 900

aactccatca ccatctacac cgacgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtggg cttctccggc ccggagttca ccttcccgct ctacggcacg 1020

atgggcaacg ccgccccgca gcagcgcatc gtggcccagc tcggccaggg cgtgtaccgc 1080

accctctcct ccaccctcta ccgccgcccg ttcaacatcg gcatcaacaa ccagcagctc 1140

tccgtgctcg acggcaccga gttcgcctac ggcacctcct ccaacctccc gtccgccgtg 1200

taccgcaagt ccggcaccgt ggactccctc gacgagatcc cgccgcagaa caacaacgtg 1260

ccgccgcgcc agggcttctc ccaccgcctc tcccacgtgt ccatgttccg ctccggcttc 1320

tccaactcct ccgtgtccat catccgcgcc ccgatgttct cctggattca ccgctccgcc 1380

gagttcaaca acatcatccc gtcctcccag atcacccaga tcccgctcac caagtccacc 1440

aacctcggct ccggcacctc cgtggtgaag ggcccgggct tcaccggcgg cgacatcctc 1500

cgccgcacct ccccgggcca gatctccacc ctccgcgtga acatcaccgc cccgctctcc 1560

cagcgctacc gcgtgcgcat ccgctacgcc tccaccacca acctccagtt ccacacctcc 1620

atcgacggcc gcccgatcaa ccagggcaac ttctccgcca ccatgtcctc cggctccaac 1680

ctccagtccg gctccttccg caccgtgggc ttcaccaccc cgttcaactt ctccaacggc 1740

tcctccgtgt tcaccctctc cgcccacgtg ttcaactccg gcaacgaggt gtacatcgac 1800

cgcatcgagt tcgtgccggc cgaggtgacc ttcgaggccg agtacgacct ggagcgcgcc 1860

cagaaggccg tgaacgagct cttcacctcc tccaaccaga tcggcctcaa gaccgacgtg 1920

accgactacc acatcgacca ggtgtccaac ctcgtggagt gcctctccga cgag 1974

Claims

1. A DNA sequence characterized in that the DNA sequence has more than 90% identity to the nucleotide sequence shown in SEQ ID No.1 or the complement thereof.

2. The DNA sequence of claim 1, wherein the nucleotide sequence of said DNA sequence is set forth in SEQ ID No. 1.

3. An expression vector comprising the DNA sequence of claim 1.

4. The expression vector of claim 3, wherein the expression vector comprises a gene of interest, the DNA sequence; the expression vector takes pCambia1300 as a basic vector, and the DNA sequence is connected at the 3' end of the target gene.

5. A plant cell comprising the expression vector of claim 3.

6. Use of a DNA sequence according to claim 1 as a terminator for increasing the efficiency of expression of a gene of interest.

7. The use according to claim 6, wherein the use is to construct an expression vector containing the target gene using the DNA sequence as a terminator, transform the expression vector into cells or tissues of a plant host, and culture the transformed tissues into plants to increase the expression efficiency of the target gene.

8. The use according to claim 7, wherein the target gene comprises a glyphosate resistance gene cp4, an insect resistance gene cry1Ab, an herbicide resistance gene bar or an editing gene cas9; the promoter of the target gene comprises a 35S promoter of cauliflower mosaic virus CaMV, a corn UBI promoter or a rice Act1 promoter.

9. The use according to claim 7, wherein the plant comprises tobacco, corn or soybean.