CN117106837A

CN117106837A - Method for synthesizing 2-amino-arabinoside by enzyme method

Info

Publication number: CN117106837A
Application number: CN202311111414.7A
Authority: CN
Inventors: 侯伟宏; 薛洪泽; 刘焱华; 袁素霞; 马向辉
Original assignee: Tianjin Famoxi Biomedical Technology Co ltd
Current assignee: Tianjin Famoxi Biomedical Technology Co ltd
Priority date: 2023-08-30
Filing date: 2023-08-30
Publication date: 2023-11-24

Abstract

The invention provides a method for synthesizing 2-amino-arabinoside by an enzymatic method, which belongs to the technical field of bioconversion, and takes the arabinoside and 2-amino-adenine as raw materials to complete the following two reactions in the same reaction system: firstly, enabling the pyrimidine nucleoside phosphorylase catalyzed arabinoside to react with phosphoric acid to generate arabinose-1-phosphoric acid and uracil; and reacting the arabinose-1-phosphate and 2-amino adenine catalyzed by purine nucleoside phosphorylase to generate 2-amino arabinoside. According to the invention, raw materials and enzyme are dissolved in the same reaction system, pyrimidine nucleoside phosphorylase mutants with good activity and high temperature resistance are utilized to catalyze substrate conversion, and then the synergistic effect of purine nucleoside phosphorylase is utilized to enable reversible reaction to be carried out in forward direction, so that the occurrence of the reverse reaction is eliminated, and the conversion rate of 2-amino-arabinoside can reach more than 90%.

Description

Method for synthesizing 2-amino-arabinoside by enzyme method

Technical Field

The invention belongs to the technical field of bioconversion, and particularly relates to a method for synthesizing 2-amino-arabinoside by an enzyme method.

Background

2-amino arabinoside is a nucleoside analogue formed by the linkage of arabinose with 2-amino adenine, which is an important intermediate of the anti-leukemia drug Fludarabine (Fludarabine). Fludarabine has remarkable therapeutic effects on B-cell Chronic Lymphocytic Leukemia (CLL), particularly in patients who have failed conventional treatment regimens. In addition, the 2-amino arabinoside can also be used as a medical intermediate for synthesizing medicines such as nelarabine and the like. The 2-amino arabinoside has important significance for medical research, biological research and medicine synthesis research, and has larger demand at home and abroad.

At present, the preparation methods of 2-amino arabinoside mainly comprise the following two types:

the first class is synthesized by chemical methods. In the patent application No. 201510355848.0, a method for preparing 2-amino arabinoside is reported. The method takes the arabinoside as a main raw material, uses benzoyl chloride to protect 6-amino groups of adenine (the yield is about 90%), uses trifluoroacetic anhydride to protect 2,3, 5-hydroxyl groups of arabinose, and carries out 2-nitrosation of adenine (the yield is about 80%), and finally completes the synthesis of 2-amino arabinoside in ammonia saturated methanol solution (the yield is about 80%). The method requires three steps of reaction, bar products are extracted and refined after each reaction is finished, then the next reaction can be carried out, the process is more complex, the three wastes yield is higher, and the comprehensive yield of the three steps of reaction is only 57.6 percent. In U.S. Pat. No. 4210745, it is reported that 2-aminoarabinoadenosine is obtained by using acetyl-protected 2, 6-diaminopurine and 1-chloro-2, 3, 5-tri-O-benzyl arabinose as main raw materials, and performing reactions such as catalytic condensation, palladium-carbon catalytic debenzylation, isomer separation and the like. The preparation process of the 1-chloro-2, 3, 5-tri-O-benzyl arabinose used by the method is complex, unstable in property and high in price, in addition, in order to obtain a final product with high chiral purity, the step of isomer separation is required to be added, and the yield is low and the cost is high. Hansske et al (Hansske F.et al tetrahedron 1984,40,125-135) protected 2' -carbonyl nucleosides with 3',5' -silyl ether and then reduced with sodium borohydride to give the target product. However, this method uses 1, 3-dichloro-1, 3-tetraisopropyl disilane as a protective agent, which is expensive. Muraoka et al (Muraoka M.et al chem Pharm Bull,1986,34,2609-2613;Muraoka M.Chem Pharm Bull 1981,29,3449-3454) obtained 2-aminoadenosine in a yield of 1.8% by 9 steps using 2-aminoadenosine as the main starting material. The method for preparing 2-amino arabinoside by the chemical synthesis method has the defects of long route, long reaction time, high raw material price, isomer generation, difficult separation, low yield, harsh reaction conditions, large organic solvent consumption and the like.

The second type of method is the biosynthesis method. The production of 2-aminoalkanoic acid by this method is less in cases, but the synthesis of 2-aminoalkanoic acid by microbial conversion is reported by Krinitsky et al (Krinitsky T A et al carbohydrate Res,1981,97,139-146), but the reaction uses wild microorganisms for fermentation, the productivity of the product is unstable, the fermentation period is long, the catalytic period is longer than 70 hours, and the conversion rate of the product is only 70%. Although the biosynthesis of vidarabine is more frequently used, these reactions have the following drawbacks: 1. the product yield is between 70 and 85 percent; 2.2-Aminoadenine is not a naturally occurring base nor is it a natural substrate for enzymes, and therefore the efficiency of enzymatic synthesis of 2-Aminoarabinoside is low.

Disclosure of Invention

Aiming at the technical problems existing in the prior art, the invention provides a method for synthesizing 2-amino-arabinoside by an enzyme method, which comprises the steps of dissolving raw materials and enzyme in the same reaction system, catalyzing substrate conversion by using pyrimidine nucleoside phosphorylase mutants with good activity and high temperature resistance, and then enabling reversible reaction to be carried out forward by the synergistic effect of purine nucleoside phosphorylase, so that the occurrence of the reverse reaction is eliminated, and the conversion rate of the 2-amino-arabinoside can reach more than 90%.

The technical scheme adopted by the invention is as follows: a method for synthesizing 2-amino-arabinoside by an enzymatic method uses the antidiabetic glycoside and 2-amino-adenine as raw materials, and the following two reactions are completed in the same reaction system: firstly, pyrimidine nucleoside phosphorylase (PyNP) catalyzed reaction of the arabinoside and phosphoric acid to generate arabinose-1-phosphoric acid and uracil; reaction two, purine Nucleoside Phosphorylase (PNP) catalyzed reaction of arabinose-1-phosphate and 2-amino adenine to produce 2-amino arabinoside.

The reaction formulas of the first reaction and the second reaction are respectively as follows:

furthermore, pyrimidine nucleoside phosphorylase is derived from Shewanella oneidensis, or a mutant with high temperature resistance and stronger catalytic activity, and the amino acid sequence of the pyrimidine nucleoside phosphorylase is shown as SEQ ID NO 31;

purine nucleoside phosphorylase is derived from microorganism of Thermoclostridium genus or Thermoclostridium caenicola isolated from soil, has high temperature resistance and strong catalytic activity on 2-amino adenine, and has amino acid sequence shown as SEQ ID NO 32 and SEQ ID NO 29.

Furthermore, when other uridine phosphorylases are adopted as pyrimidine nucleoside phosphorylase, 2-amino arabinoside with different yields can be obtained, and the amino acid sequences of other uridine phosphorylases are shown as SEQ ID NO 1, SEQ ID NO2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 and SEQ ID NO 11.

Furthermore, when other purine nucleoside phosphorylases are adopted as the purine nucleoside phosphorylase, 2-amino arabinoside with different yields can be obtained, and the amino acid sequences of other purine nucleoside phosphorylases are shown as SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28 and SEQ ID NO 30.

TABLE 1 pyrimidine nucleoside phosphorylase and substrate residual ratio Table for catalytic reaction thereof

Sources of species	Sequence numbering	Substrate remainder
			Parageobacillus thermoglucosidasius	SEQ ID NO.1	51.3％
Geobacillus stearothermophilus	SEQ ID NO.2	63.2％
			Brevibacillus borstelensis LK01	SEQ ID NO.3	78.8％
Geobacillus thermoglucosidasius	SEQ ID NO.4	86.2％
			Klebsiella aerogenes	SEQ ID NO.5	71.1％
Aeropyrum pernix	SEQ ID NO.6	58.4％
			Streptococcus pyogenes	SEQ ID NO.7	51.7％
Thermus thermophilus	SEQ ID NO.8	86.3％
			Thermus sp.	SEQ ID NO.9	75.5％
Shewanella oneidensis	SEQ ID NO.10	43.5％
			Thermus thermophilus	SEQ ID NO.11	75.3％
SEQ ID NO.10 mutant	SEQ ID NO.31	21.9％

From among the different pyrimidine phosphorylases shown in Table 1, an enzyme having a higher thermostability and a higher efficiency of catalyzing the phosphorylation of allose is selected. When these pyrimidine phosphorylases are used to catalyze the phosphorylation of alloxan as shown, the substrate remains intact. Pyrimidine phosphorylase substrates derived from Parageobacillus thermoglucosidasius, streptococcus pyogenes and Shewanella oneidensis remained less. Among them, shewanella oneidensis has a better catalytic effect of pyrimidine phosphorylase and has no other documents or patent reports.

Pyrimidine phosphorylase from Shewanella oneidensis obtains a mutant with high catalytic activity on the allose through the rational design and transformation of the enzyme and a directed evolution method, and the sequence of the mutant is shown as SEQ ID NO. 31. The mutation sites are I32A, R89K, M195S, E196V and L200S, and the thermal stability of the mutant is still higher. In the phosphorylation of the acibenzolar-s-a shown reaction using this mutant, the substrate remaining was 21.9%, much lower than 53.5% of the wild-type catalyzed reaction shown in SEQ ID No. 10.

The purine nucleoside phosphorylase sequence of the microorganism of the genus Thermoclostridium obtained from the soil is shown as SEQ ID NO. 32; thermoclostridium caenicola the purine nucleoside phosphorylase has the sequence shown in SEQ ID NO. 29.

TABLE 2 purine nucleoside phosphorylase and catalytic substrate remaining ratio Table

Sources of species	Sequence numbering	Substrate remainder
			Aeropyrum pernix	SEQ ID NO.12	16.8％
Aeropyrum pernix	SEQ ID NO.13	17.9％
			Alkalihalobacillus halodurans	SEQ ID NO.14	28.4％
Aneurinibacillus migulanus	SEQ ID NO.15	24.8％
			Antarctobacter heliothermus	SEQ ID NO.16	49.8％
Anoxybacillus thermarum	SEQ ID NO.17	46.5％
			Aeromonas hydrophyla	SEQ ID NO.18	59.1％
Bacillus anthracis	SEQ ID NO.19	53.5％
			Bacillus subtilis ATCC21616	SEQ ID NO.20	43.7％
Bacillus subtilis	SEQ ID NO.21	54.5％
			Thermoanaerobacter tengcongensis	SEQ ID NO.22	57.7％
Citrobacter koseri	SEQ ID NO.23	15.3％
			Citrobacter koseri	SEQ ID NO.24	23.8％
Deinococcus geothermalis	SEQ ID NO.25	35.9％
			Deinococcus geothermalis	SEQ ID NO.26	31.6％
Pseudoalteromonas sp.	SEQ ID NO.27	15.4％
			Streptococcus thermophilus	SEQ ID NO.28	31.3％
Thermoclostridium caenicola	SEQ ID NO.29	9.2％
			Thermoanaerobacter pseudethanolicus	SEQ ID NO.30	41.9％
Thermoclostrinium (soil)	SEQ ID NO.32	5.8％

The 2-amino-arabinoside can be obtained by using different purine nucleoside phosphorylases shown in Table 2 and pyrimidine nucleoside phosphorylase mutants and using the arabinoside and the 2-amino-adenine as substrates, but the yield is lower.

The invention obtains a strain of thermotolerant bacteria from soil culture, the cell extract of which can be matched with pyrimidine phosphorylase mutant to synthesize 2-amino arabinoside with higher yield, and the yield can reach 94.2 percent calculated by the arabinoside. After sequencing the 16S rDNA of the above microorganism, the microorganism was identified as belonging to the genus Thermoclostridium. The extract of the microbial culture is subjected to proteomics sequencing by using HPLC-MASS, purine nucleoside phosphorylase of the microorganism Thermoclostridium caenicola of the same genus is used as a template, related peptide fragments are fished from polypeptide obtained by sequencing, and the sequences are spliced to obtain a protein sequence with the coverage rate of 95%. The complete purine nucleoside phosphorylase amino acid sequence was obtained by substituting 5% of the undetectable amino acids with the amino acids at the corresponding positions of Thermoclostridium caenicola. The purine nucleoside phosphorylase of Thermoclostridium caenicola is matched with the pyrimidine nucleoside phosphorylase mutant, so that the 2-amino arabinoside can be obtained in a high yield, and the yield can reach 90.8 percent calculated by the arabinoside.

The technical scheme adopted by the invention is as follows: the recombinant vector containing the pyrimidine nucleoside phosphorylase and the mutant gene of the purine nucleoside phosphorylase takes pET series plasmid as a starting vector.

Further, in order to ensure the enzyme activity ratio of the two, the sequence on the pET vector is as follows: the pyrimidine nucleoside phosphorylase mutant is positioned at the upstream of the purine nucleoside phosphorylase mutant gene, and the DNA interval sequence between the genes is as follows: TAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT.

The technical scheme adopted by the invention is as follows: a genetically engineered bacterium for producing the pyrimidine nucleoside phosphorylase and the mutant of the purine nucleoside phosphorylase, wherein the genetically engineered bacterium comprises the recombinant vector, and the host cell is escherichia coli.

Compared with the prior art, the invention has the following beneficial effects:

1. the preparation process of the 2-amino arabinoside has the advantages of easily available raw materials, short reaction route, high total yield, no need of isomer separation and no need of intermediate product separation.

2. The five carbon sugar in natural nucleosides is ribose rather than arabinose, and 2-aminoadenine is not a natural base. Therefore, the catalytic activity of the enzyme is lower when the enzyme catalyzes 2-amino-arabinoside, and the pyrimidine nucleoside phosphorylase mutant with high catalytic activity and good thermal stability is obtained by modifying the enzyme protein by combining the rational design and directed evolution of the enzyme and a high-throughput screening technology;

3. the inventor separates a thermo-resistant microorganism of thermo-closing fungus genus from soil, and when the cell extract is combined with pyrimidine nucleoside phosphorylase, the yield can reach 94.2% when catalyzing the production of the 2-amino-arabinoside from the arabinoside and the 2-amino-adenine. The inventor initially identifies the purine nucleoside phosphorylase sequence, and combines the purine nucleoside phosphorylase which is highly homologous and is derived from Thermoclostridium caenicola with pyrimidine nucleoside phosphorylase mutant, and the yield can reach 90.8% when catalyzing the acibenzolar-s-amine and 2-amino adenine to prepare 2-amino acibenzolar-amine.

Drawings

FIG. 1 is an H1 NMR spectrum of 2-aminoalkanoic acid obtained by purification in accordance with the examples of the present invention (using DMSO as a solvent);

FIG. 2 is an HPLC chart of 2-aminoalkanoic acid obtained by purification in accordance with the examples of the present invention.

Detailed Description

The present invention will be described in detail below with reference to the drawings and the specific embodiments, so that those skilled in the art can better understand the technical solutions of the present invention.

Example 1: acquisition of thermostable pyrimidine nucleoside phosphorylase

The pyrimidine nucleoside phosphorylase gene wild type gene sequence shown in table 1 was sequence optimized, then a whole gene fragment was artificially synthesized by a gene synthesis company, and the gene was inserted into NdeI and BamHI sites of pET-24a plasmid, and the ligated vector was transferred into escherichia coli BL21 (DE 3) to establish a pyrimidine nucleoside phosphorylase gene engineering bacterium.

Example 2: acquisition of purine nucleoside phosphorylase

The wild-type gene sequence of the purine nucleoside phosphorylase gene shown in Table 2 was sequence-optimized, then a whole gene fragment was artificially synthesized by a gene synthesis company, and the gene was inserted into NdeI and BamHI sites of pET-24a plasmid, and the ligated vector was transferred into E.coli BL21 (DE 3) to establish a purine nucleoside phosphorylase gene engineering bacterium.

Example 3: obtaining of thermostable and highly efficient purine nucleoside phosphorylase

The following components were dissolved in purified water: naHCO 3.0 g/L, tryptone 2.0g/L, K2HPO 4.5 g/L, glucose 1.0g/L, yeast extract 1.0g/L, NH4Cl 0.9g/L, naCl 0.9g/L, KH2PO 4.75 g/L, L-cysteine hydrochloride 0.5g/L, mgCl 26H2O 0.4g/L, HCl 0.0025g/L, feCl3 6H2O 0.0025g/L, feCl2 4H2O 0.0015g/L, resazurin sodium salt 0.0005g/L, coCl26H2O 0.00019g/L, mnCl2 4H2O 0.0001g/L, znCl2 0.00007g/L, na2MoO 4H2O 0.000036g/L, niCl 2H2O 0.000024g/L, H3.000006 g/L, cuCl 2H2O 0.02 g/L, pH 3.000006 g/L, and a silk filter is added to a filter flask for sterilization. 5g of soil is taken from surface soil, 20cm deep soil and 50cm deep soil respectively, resuspended with sterilized normal saline, and shaken in a shaker at 220rpm and 30 ℃ for 30 minutes, 5ml of the suspension is taken and inoculated into a silk mouth bottle, and cultured in a shaker at 50 ℃ and 100rpm for 7 days.

The bacterial solution was centrifuged at 12000rpm for 2min, the pellet was resuspended to 200g/L with pH7.0, 100mM phosphate buffer, then crushed with an ultrasonic cell crusher, centrifuged at 12000rpm for 10min, and the supernatant was collected.

Example 4: pyrimidine nucleoside phosphorylase mutant acquisition

The three-dimensional structure of pyrimidine nucleoside phosphorylase derived from Shewanella oneidensis has not been revealed yet. However, the present invention has found that it is highly homologous to Yersinia pseudotuberculosis-derived uracil nucleoside phosphorylase (PDB ID:4NY 1) by constructing a three-dimensional MODEL of a wild-type gene sequence using SWISS-MODEL. Thus, by reference to the three-dimensional structure of the enzyme, the binding simulation of the reaction substrate to the protein is performed by molecular docking software, and finally by Pymol analysis, the amino acid which is likely to be associated with the substrate binding is selected as the mutant amino acid.

In addition to the rational design, the invention utilizes an error-prone PCR random mutation method to carry out protein engineering on pyrimidine nucleoside phosphorylase. In general, error-prone PCR can be used to amplify a target gene by using a DNA polymerase, and the reaction conditions are adjusted to change the mutation frequency in the amplification process, such as increasing the concentration of magnesium ions, adding manganese ions, changing the concentration of dNTPs in the system, or applying a low-fidelity DNA polymerase, so that mutations are randomly introduced into the target gene at a certain frequency to obtain random mutants of protein molecules.

The invention adopts Taq polymerase with lower fidelity, and simultaneously utilizes Mn < 2+ > to replace a natural auxiliary factor Mg < 2+ > to increase error probability.

The 50. Mu.L PCR system was as follows:

sterilized double distilled water was added to 50. Mu.L.

Wherein: the pyrimidine nucleoside phosphorylase template gene is a recombinant plasmid constructed by inserting a gene of SEQ ID NO.10 into a pET-24a plasmid; the invention designs the primer according to the upstream and downstream sequences of the target gene in the recombinant plasmid.

The PCR reaction conditions were: pre-denaturation at 95℃for 2.5min; denaturation at 94℃for 15s, annealing at 53℃for 30s, extension at 72℃for 60s for 35 cycles; the extension was continued at 72℃for 10min and cooled to 4 ℃.

The PCR amplified product was ligated to pET-24a vector and transferred into E.coli BL21 (DE 3) to create pyrimidine nucleoside phosphorylase gene mutation library.

The pyrimidine nucleoside phosphorylase was expressed using E.coli BL21 (DE 3) as host and pET-24a plasmid as vector, and the high-activity mutant was screened with high throughput using the enzyme activity detection method described in example 7. And identifying the mutated high-activity pyrimidine nucleoside phosphorylase gene. The amino acid sequence of the screened high-activity pyrimidine nucleoside phosphorylase mutant gene is shown as SEQ ID NO 31.

Example 5: co-expression of pyrimidine nucleoside phosphorylase and purine nucleoside phosphorylase

The series sequence of the pyrimidine nucleoside phosphorylase mutant and SEQ ID NO.31 or SEQ ID NO.32 purine nucleoside phosphorylase is synthesized, and the intermediate sequence is

TAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT, ligating the ligated DNA to pET24a between NdeI and BamHI cleavage sites; or respectively synthesizing a pyrimidine nucleoside phosphorylase mutant with SEQ ID NO.31 and a purine nucleoside phosphate gene sequence with SEQ ID NO.32, and sequentially connecting to NcoI and NotI sites and NdeI and XhoI sites of pETDuet-1; or respectively synthesizing a pyrimidine nucleoside phosphorylase mutant with SEQ ID NO.31 and a purine nucleoside phosphate gene sequence with SEQ ID NO.29, and respectively connecting the pyrimidine nucleoside phosphorylase mutant with NcoI and NotI sites and NdeI and XhoI sites of pETDuet-1.

Example 6: small-scale production of pyrimidine nucleoside phosphorylase and purine nucleoside phosphorylase in shake flask

Coli containing the recombinant plasmids constructed in examples 1,2, 3, 4 and 5 was inoculated into 50mL of LB medium (peptone 10g/L, yeast extract 5g/L, naCl 10g/L, pH 7.2) containing kanamycin (50. Mu.g/mL). Shake-culturing at 37℃and 210rpm for 16 hours. Then, the cells were inoculated at a ratio of 1:100, cultured in 100mL of LB medium containing kanamycin at 37℃under shaking at 210rpm, and absorbance (OD 600) of the bacterial liquid at 600nm was measured at regular time to monitor the cell growth density. When the OD600 = 0.6-0.8 of the culture, isopropyl beta-D-thiogalactoside (IPTG) with a final concentration of 0.2mM was added to induce the expression of the target enzyme gene, and the culture was induced overnight (. Gtoreq.16 hours). Centrifugation at 10000rpm at 4℃for 10min, discarding the supernatant, and after re-suspending the cell pellet at 200g/L with pre-chilled 100mM phosphate buffer (pH 7.0), ultrasonication, centrifugation at 13000rpm at 4℃for 30min, collecting the supernatant, i.e., crude enzyme solution, and storing at-20 ℃.

Example 7: determination of pyrimidine nucleoside phosphorylase Activity

The pyrimidine nucleoside phosphorylase activity assay system is as follows:

100mM potassium dihydrogen phosphate-dipotassium hydrogen phosphate buffer solution containing substrate (allo-diabetes) with final concentration of 7.33g/L, 350ml/L enzyme solution, adjusting pH to 7.2, mixing, placing at 60deg.C for reaction for 5h, diluting sample with pure water 40 times, and detecting raw material residue and product generation by the method shown in example 10.

Example 8: detection of purine nucleoside phosphorylase Activity

The purine nucleoside phosphorylase activity assay system is as follows:

100mM potassium dihydrogen phosphate-dipotassium hydrogen phosphate buffer solution containing the substrate shown in reaction one (A-diabetes mellitus) with a final concentration of 7.33g/L and the substrate shown in reaction two (2-amino adenine) with a final concentration of 13g/L, 150ml/L pyrimidine nucleoside phosphorylase solution, 150ml/L purine nucleoside phosphorylase solution, pH7.2 were adjusted, mixed and then placed at 60℃for reaction for 5 hours, and the sample was diluted 40 times with pure water, and the raw material surplus and the product formation were detected in the manner shown in example 10.

Example 9: fermentative production of enzymes

Fermentation scheme: the recombinant E.coli constructed in example 5 (containing mutated pyrimidine nucleoside phosphorylase gene and purine nucleoside phosphorylase gene) was inoculated with a single microbial colony in 120mL LB medium containing 50. Mu.g/mL kanamycin (plasmid with pET24a as the female parent) or 50. Mu.g/mL ampicillin (plasmid with pETDuet1 as the female parent), shake-cultured overnight (not less than 10 hours) at 37℃at 220rpm, and then fermented in a 15L fermenter: the seed liquid is inoculated into 6L fermentation culture medium according to the inoculation amount of 2 percent, the pH value of the fermentation liquid is maintained to be 7.0-7.2 by adding ammonia water, the temperature of the fermentation liquid is 37 ℃, the stirring rotation speed is 300-900rpm, the dissolved oxygen is controlled to be about 30 percent in the process, and the air flow is 1:1-2 vvm. After 8 hours of cultivation, IPTG (final concentration 0.2 mmol/L) was added, the pot temperature was adjusted to 22℃and fermentation was continued for 12-16 hours. During the fermentation process, a feed solution (200 g/L glucose, 100g/L yeast extract, pH 7.2) is added to maintain the growth of the culture. After fermentation, the culture is directly homogenized and crushed by a high-pressure homogenizer. The crushed fermentation broth is added with polyethyleneimine with the final concentration of 2g/L and diatomite with the final concentration of 150g/L, and stirred for 30 minutes. After flocculation sedimentation is finished, filtering by using filter cloth. Filtering and concentrating the filtered enzyme solution by using an ultrafiltration membrane to prepare a crude enzyme solution, and preserving the crude enzyme solution at the temperature of minus 20 ℃.

Example 10 analytical method

The measurement is carried out by high performance liquid chromatography (China pharmacopoeia 2020 edition, four-part rule 0512).

Solvent: water-methanol (85:15).

Test solution: the product is taken to be dissolved by adding a solvent and quantitatively diluted to prepare a solution with the concentration of about 0.4mg in each 1 ml.

Chromatographic conditions: octadecylsilane chemically bonded silica (4.6X105 mm,5 μm or column with equivalent performance) is used as filler; water (0.1% phosphoric acid) is used as a mobile phase A, acetonitrile is used as a mobile phase B, and linear gradient elution is carried out; the flow rate is 1.0ml per minute; the column temperature is 35 ℃; the detection wavelength is 254nm; the sample volume was 5. Mu.l.

TABLE 3 variation of mobile phase ratio in HPLC detection method

Time (minutes)	Mobile phase a (%)	Mobile phase B (%)
			0	70	30
6	70	30
			10	10	90
10.1	70	30
			15	70	30

Assay: precisely measuring the solution of the sample, injecting into a liquid chromatograph, and recording the chromatogram.

The nuclear magnetic resonance spectrum of the pyrimidine nucleoside phosphorylase mutant and the 2-amino arabinoside synthesized by the purine nucleoside phosphorylase is shown in figure 1, and the HPLC detection purity spectrum of the purified pyrimidine nucleoside phosphorylase mutant and the purine nucleoside phosphorylase is shown in figure 2.

The present invention has been described in detail by way of examples, but the description is merely exemplary of the invention and should not be construed as limiting the scope of the invention. The scope of the invention is defined by the claims. In the technical scheme of the invention, or under the inspired by the technical scheme of the invention, similar technical schemes are designed to achieve the technical effects, or equivalent changes and improvements to the application scope are still included in the protection scope of the patent coverage of the invention.

Claims

1. A method for synthesizing 2-amino arabinoside by an enzymatic method is characterized in that: the method uses the antidiabetic glycoside and the 2-amino adenine as raw materials, and completes the following two reactions in the same reaction system: firstly, enabling the pyrimidine nucleoside phosphorylase catalyzed arabinoside to react with phosphoric acid to generate arabinose-1-phosphoric acid and uracil; and reacting the arabinose-1-phosphate and 2-amino adenine catalyzed by purine nucleoside phosphorylase to generate 2-amino arabinoside.

2. The method for synthesizing 2-amino-arabinoside by using an enzymatic method as claimed in claim 1, wherein the method comprises the following steps: pyrimidine nucleoside phosphorylase is derived from Shewanella oneidensis or a mutant with high temperature resistance and stronger catalytic activity, and the amino acid sequence of the pyrimidine nucleoside phosphorylase is shown as SEQ ID NO 31;

purine nucleoside phosphorylase is derived from microorganism of genus Thermoclostridium or Thermoclostridium caenicola isolated from soil, and its amino acid sequence is shown in SEQ ID NO 32 and SEQ ID NO 29.

3. The method for synthesizing 2-amino-arabinoside by using an enzymatic method as claimed in claim 1, wherein the method comprises the following steps: the pyrimidine nucleoside phosphorylase adopts other uridine phosphorylases, and the amino acid sequences of the other uridine phosphorylases are shown as SEQ ID NO 1, SEQ ID NO2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 and SEQ ID NO 11.

4. The method for synthesizing 2-amino-arabinoside by using an enzymatic method as claimed in claim 1, wherein the method comprises the following steps: other purine nucleoside phosphorylases are adopted as the purine nucleoside phosphorylase, and the amino acid sequences of the other purine nucleoside phosphorylases are shown as SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28 and SEQ ID NO 30.

5. A recombinant vector comprising the pyrimidine nucleoside phosphorylase and purine nucleoside phosphorylase mutant gene according to claim 1 or 2, wherein: pET series plasmid is taken as an initial vector.

6. The recombinant vector of claim 5, wherein: the sequence on the pET vector is: the pyrimidine nucleoside phosphorylase mutant is positioned at the upstream of the purine nucleoside phosphorylase mutant gene, and the DNA interval sequence between the genes is as follows: TAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT.

7. A genetically engineered bacterium for producing pyrimidine nucleoside phosphorylase and mutants of purine nucleoside phosphorylase, characterized in that: the genetically engineered bacterium comprises the recombinant vector of claim 5 or 6, and the host cell is escherichia coli.