CN1170943C - Method of estalishing ApoAI target cell screening medicine system and screening HDL raising medicine - Google Patents

Abstract

The present invention discloses a method for establishing an ApoAI cell target medicine screening system and screening raising HDL medicines. The ApoAI cell target established by the present invention uses the molecule clone technique for cloning the Promoter gene part of key protein ApoAI for controlling atherosclerosis into liver cell strains so as to obtain the gene level expressed medicine screening cell target. Atherosclerosis resistance and raising HDL medicines are screened by determining the excitation degree of the ApoAI Promoter by screened compounds.

Description

Set up the method for apolipoprotein A-1 cell target to screen medicine system and screening high density lipoprotein increasing medicine

Technical field

The present invention relates to cell target to screen medicine system, be specifically related to the method for a kind of ApoAI of foundation cell target to screen medicine system and screening high density lipoprotein increasing medicine.

Background technology

Atherosclerosis cardiovascular and cerebrovascular diseases (as coronary heart disease, apoplexy) is the main killer in the deadly disease of China and western countries.Its main diseases is because of being high serum total cholesterol (Gordonet al.1981; Stamler et al.1986; Pooling Project Research Group1978; Anderson etal.1987).Epidemiology survey discloses, the every increase by 1% of serum total cholesterol, and coronary risk factor increases by 2% (NCEPR 1991).Clinical study is found, reduces serum cholesterol level and can reduce evidence of coronary heart diseases, and (LPCP 1984 for the retardance development of atherosclerosis; Frick 1987).Cholesterol is water insoluble, can not transport in blood.They must combine with lipoprotein and could turn round in blood.There are four kinds of lipoprotein to be responsible for the delivery of cholesterol in the human blood.They are low-density lipoprotein (LDL), high-density lipoprotein (HDL) (HDL), vldl (VLDL) and intermediated-density lipoprotein (IDL).In the normal people, 2/3rds total cholesterol is delivered by LDL.LDL carries endogenous or the external source cholesterol, passes vessel wall, in entering subcutaneous (subendothelium).Interior subcutaneous, the LDL cholesterol is oxidized to the oxidized ldl cholesterol, and by scavenger receptor by scavenger cell with the form of cholesteryl ester in the cell inner accumulated.A large amount of cholesteryl esters accumulate in and have formed foam cell in the scavenger cell.The foam cell that has gathered a large amount of cholesteryl esters is deposited under the blood vessel endothelium, has formed the atherosclerotic plaque core.Data shows that the cholesterol that is delivered by LDL is the main root (Goldstein1989 that causes atherosclerosis coronary heart disease; Vega 1986; Innerarity 1990; Rauth 1992).So the LDL cholesterol is called as bad cholesterol.The atherosclerosis that cholesterol causes is the main root of coronary heart disease still not, also is cerebrovascular disease simultaneously, as cerebral thrombosis, and the important cause of disease of apoplexy.The hypercholesterolemia ester of people's brain cell inner accumulated also may be relevant with the formation of senile dementia in addition.Body inner cholesterol source has endogenous and external source.The external source cholesterol comes from diet, and endogenous cholesterol is from body synthetic result.Endogenous cholesterol is synthetic hyperfunction and familial hypercholesterolemia is comparatively general in western countries.This disease must be controlled by medicine.In the U.S., adult LDL cholesterol (bad cholesterol) content more than 40% surpasses normal level.Because the vital role of cholesterol in forming cardiovascular and cerebrovascular diseases, closely during the last ten years, the U.S. and European pharmaceutical factory all are put into the research and development of its antiatherosclerotic and reduce on serum total cholesterol and the LDL cholesterol.The Lipitor that the most significant Zocor that the Merck pharmaceutical factory arranged of curative effect and Warner-Lambert/Parke-Davis went on the market last year in these medicines.The mechanism of action of these medicines all is to suppress body's cholesterol synthetic key enzyme HMG-COA-reductase enzyme.Though the HMG-COA-HMG-CoA Reductase Inhibitor HMG-CoA can reduce serum total cholesterol significantly, prevent, stop and reduce atherosclerosis and incidence of coronary heart disease, development and dead, endogenous cholesterol synthesizes and the development or the deterioration of the coronary heart disease that the reduction familial hypercholesterolemia causes but it can only reduce.Increase the atherosclerosis that causes for the exogenous cholesterol of treatment, form for the atherosclerosis of eliminating the cholesterol that has entered in the scavenger cell and suppress to cause thus, for removing the cholesterol of gathering in the atherosclerotic plaque, it is normal that atherosclerotic blood vessel is replied, and then acts on little or powerless.In other words, the inhibition endogenous cholesterol of present American-European market popularity generates medicine and can not fundamentally treat generalized atherosclerosis cardiovascular and cerebrovascular diseases.

Medical research proves, macrophage phagocytic and gather cholesterol converts foam cell to, and being deposited on subcutaneous in the vessel wall is the basis that atherosclerotic plaque forms.Removing accumulates in the cholesterol in vessel wall scavenger cell/foam cell, it is transported to liver decomposes, be that the simple serum cholesterol-lowering of treatment institute is inaccessiable, the up-to-date effective means of radical cure atherosclerosis cardiovascular and cerebrovascular diseases, unique effective weapon of removing scavenger cell/foam cell and atherosclerotic plaque inner cholesterol is HDL.In recent years, west Cardiovascular Disease Study personnel and drugmaker begin research direction is put into the new class antiatherosclerotic, come on high density lipoprotein increasing (HDL) medicine.High-density lipoprotein (HDL) (HDL) is an important cholesterol carrier, and it is completely contradicted at function and the LDL aspect the delivery cholesterol.HDL can stimulate scavenger cell inner cholesterol ester hydrolysis under the blood vessel endothelium, and the NEC of hydrolysis is transported to the liver decomposition in scavenger cell.What is more important, HDL can stimulate and is deposited on scavenger cell in vessel wall and the vessel wall atherosclerotic plaque/foam cell inner cholesterol ester hydrolysis.NEC is transported to liver by HDL from foam cell and decomposes (Alan et al.1996).Thereby removed the basis that atherosclerosis is rely and formed.So the critical function of HDL is called as cholesterol anti-phase transhipment (Reverse CholesterolTransportation).1. the result of cholesterol anti-phase transhipment suppresses cholesteryl ester to accumulate in scavenger cell, stops it to be converted into foam cell, thereby has prevented atherosclerotic formation; 2. have the effect that cholesterol is decomposed to liver in unique transhipment atherosclerotic plaque inner foam cell because of HDL, thereby the atherosclerotic blood vessel wall is progressively replied normally.This binomial function of HDL is the effect that western medicine circle is dreamed of in the treatment Atheromatosis always.In addition, HDL contains paraoxonase, can suppress LDL oxidation, prevents LDL by macrophage phagocytic, produces foam cell.HDL can also stimulating endothelial cell delivery of prostacyclin (PI) increases the cholesteryl ester hydrolysis and cholesterol transport goes out cell.The effective object of HDL is regardless of endogenous or the external source cholesterol.Basis and clinical research confirmation, every increase 1mg/dl HDL cholesterol, coronary heart disease death danger 2.5% (the Alan et al.1996) that promptly descend.Low blood plasma HDL is the risk factor (Alan et al.1996) than prior atherogenicity of high plasma cholesterol and coronary heart disease.

What is the mechanism that improves blood plasma HDL content? briefly be the gene that activates relevant enzyme in the related gene of synthetic HDL active ingredient and the HDL building-up process, make its expression and synthetic HDL, suppress the activity of unfavorable HDL synthetic factor simultaneously.Active ingredient and enzyme synthetic with HDL and that transhipment cholesterol function is relevant closely have apolipoprotein A-1 (ApoAI), Yelkin TTS: acetyl cholesterol transferring enzyme (LCAT), lipoprotein lipase (LPL), cholesteryl ester transfer protein (CETP), apoC-III (apoC-III).The major function of ApoAI is 1. to form the most important structure component of HDL (Chapman et al.1980; Sastry et al.1988); 2. activate the synthetic key enzyme of HDL, LCAT (Fielding et al.1972; Soutar et al.1975); 3. promote cell inner cholesterol outflow (Glomset et al.1968; Scampfer et al.1991).Think that from the research of people ApoAI turnover rate and primates HDL level the synthesis rate of ApoAI has determined blood plasma HDL level (Schaefer et al.1978,1982; Sorci-Thomas et al.1988).The function of LPL is catalysis blood plasma VLDL and chylomicron steatolysis, produces cholesterol and the phosphatide center composition for the synthetic HDL of key enzyme LCAT of synthetic HDL, and cholesteryl ester is used.ApoC-III can suppress the LPL vigor, causes the feedback of HDL synthesis material weary.CETP then catalysis cholesteryl ester transfers to VLDL from HDL, and triglyceride is gone to HDL from VLDL, and HDL is decomposed, and causes ApoAI to run off in transfer simultaneously.ApoC-III and CETP are two Negative Factor of HDL in synthetic, so will improve blood plasma HDL content, 2. the 1. ApoAI that must raise activates LPL and 3. LCAT, 4. reduces apoC-III and 5. suppresses the CETP vigor.More than in five factors, most important one is the ApoAI level.

Prevailing disease and transgenic animal experimental studies results confirm that plasma A poAI can suppress atherosclerotic formation and development (Castelli et al.1977; Rutin et al.1991).ApoAI content reduces, incidence of atherosclerosis rate rising (Castelli etal.1986; Rutin et al.1991).Rising ApoAI itself is to eliminating atherosclerotic plaque, and the effect of treatment atherosclerosis is remarkable.So ApoAI becomes an important sieve medicine target.

Summary of the invention

ApoAI cell target to screen medicine system is the core technology instrument in screening atherosclerosis cardiovascular and cerebrovascular disease high density lipoprotein increasing of new generation (HDL) medicine, the objective of the invention is to set up cell target technology and target sieve prescription method.The ApoAI cell target that the present invention sets up is the utilization molecule clone technology, and the Promoter Gene Partial of control atherosclerosis key protein ApoAI is cloned into liver cell line, obtains the sieve medicine cell target of expressing on gene level.Screen atherosclerosis high density lipoprotein increasing medicine of new generation by measuring the degree that screened compound excites ApoAI Promoter.

The invention provides the technical scheme of setting up ApoAI Promoter cell target, this scheme comprises the following steps:

I human gene group DNA's extraction

1) gets anticoagulation 2ml, with 2 times physiological saline dilution mixing.

2) in centrifuge tube, add the 2ml lymphocyte separation medium, on liquid level, add the blood that 4ml has diluted mixing gently, centrifugal 200g 20 minutes (annotate: this moment, red corpuscle was sunken to the pipe end, the interface that the lymphocyte of white and other karyocyte are distributed in upper plasma and lower floor's lymphocyte separation medium) under the room temperature.

3) supernatant is abandoned in suction, karyocyte layer in the middle of the careful sucking-off.Change in the 1.5ml Eppendorf pipe, with physiological saline washing 1 time.

4) with cell suspension in the TE damping fluid, adding SDS is 0.5% to final concentration, Proteinase K to final concentration is 200 μ g/ml, 50 ℃ of water-baths 3 hours, jolting therebetween 2-3 time.

5) add equal-volume balance phenol mixing, room temperature is centrifugal, centrifugal 5 minutes of 10000g.

6) carefully draw supernatant, and be transferred to another Eppendorf pipe, not with the egg white layer sucking-off.

7) add the equal-volume chloroform: primary isoamyl alcohol (24: 1), mixing, centrifugal 10000g, 5 minutes.

8) shift supernatant to another Eppendorf pipe, add the dehydrated alcohol of 1/10 volumes of acetic acid sodium (PH5.2) and 2.5 times of volumes, mixing was placed 30 minutes for-80 ℃.

9) centrifugal 12000g, 15 minutes, abandon supernatant, add the cold 75% ethanol fine laundering tube wall of 1ml, 10000g5 minute, abandon most supernatant, 37 ℃ of standing and drying 10 minutes.

10) with 100 μ lTE (pH8.0) dissolving genomic dna.

II is that template is duplicated with round pcr and obtained Apo AI Promoter dna sequence dna with human gene group DNA

Primer: upstream: 5 ' GACTCGAGAGGGGAAGGGGATGAGTG 3 '

Downstream: 5 ' ATAGATCTCCTGAACCTTGAGCTGGG 3 '

Each 1 μ l concentration of upstream and downstream primer is 10 μ mol/L

10 * PCR reaction buffer, 5 μ l

DNTP (2mmol/L) 5 μ l concentration are 200 μ mol/L

Genomic dna template 1 μ l total amount 1 μ g

Deionized water is mended to 50 μ l

Behind the mixing centrifugal 15 seconds, add paraffin oil 30 μ l in reaction surface.

97 ℃ of sex change 10 minutes, the ice bath cooling adds Taq enzyme (5U/ μ l) 1 μ l, and is of short duration centrifugal.

Begin circulation:

Sex change: 95 ℃ 30 seconds

Annealing: 60 ℃ 45 seconds

Extend: 72 ℃ 90 seconds

Repeat 30 circulations.

After the last circulation, extended again 10 minutes at 72 ℃.

III Agarose (1%) gel electrophoresis is identified the PCR product

Agarose DNA reclaims (Gibco BRL, Concert Gel Extraction System) fast and prepares: a.50 ℃ water-bath device b. preheating TE damping fluid is to 65-70 ℃

1) cuts glue: downcut the Agarose glue that contains dna fragmentation with clean, sharp cutter, repair clean edge.

2) weigh: gum concentration is less than 2%, and weight is less than 400mg person, and in the 1.5ml Eppendorf pipe of packing into, every 10mg glue adds 30ul L1 (Gel.Solubilization Buffer sees Gibco company operational manual).

3) dissolving: 50 ℃ of water-baths are more than 15 minutes, and every 3 minutes mixings once, water-bath 5 minutes is continued in the dissolving back.

4) dress post: get a wash-out post and put into a 2ml sluicing pipe, the miscellany in " 3 " is poured in the wash-out post, centrifugal 12000g 1 minute discards liquid in the sluicing pipe.

5) washing (optional): the wash-out post is put back in the 2ml sluicing pipe, adds 500 μ l L1, and room temperature was placed 1 minute, and centrifugal 12000g 1 minute discards liquid in the sluicing pipe.

6) washing: the wash-out post is put back in the 2ml sluicing pipe, adds 700 μ l L2 (Wash Buffer contains ethanol, sees Gibco company operational manual), and room temperature was placed 5 minutes, and centrifugal 12000g 1 minute discards liquid in the sluicing pipe, and repeated centrifugation 1 minute discards sluicing pipe.

7) DNA reclaims: the wash-out post is put into a new 1.5ml Eppendorf pipe, add the TE damping fluid of 50 μ l preheatings, room temperature was placed 1 minute, and centrifugal 12000g 2 minutes can reclaim DNA.

The IV goal gene is cloned into pGEM-T Easy Vectors (Promega company)

In a new 0.5ml Eppendorf pipe, successively add following reagent:

2×Rapid?Ligation?Buffer 5μl

pGEM-T?Vector(50ng/ul) 1μl

PCR product (glue recovery product) 3 μ l

T4DNA?Ligase(3U/μl) 1μl

Cumulative volume 10 μ l, 4 ℃ of ligations are spent the night.

The V bacterium transforms

Get JM109 competence bacteria liquid 200 μ l in the Eppendorf pipe

Add above-mentioned T carrier (pGEM-T/apo) the 4 μ l that connected goal gene, mixing was placed 30 minutes on ice gently.

42 ℃ of water-baths, heat-shocked 90 seconds is not shaken test tube.

Add the LB substratum 800 μ l of antibiotic-free in the pipe, 37 ℃ of gentlenesses were shaken (150rpm) 45 minutes.

Centrifugal 30 seconds of 5000g, honest and upright and thrifty 800 μ l are removed in suction, add X-gal (5-bromo-4-chloro-3-indoly--D-galactopyranoside) IPTG (behind (Promega) mixing of isopropyl-β-thiogalactopyranoside), with aseptic spreader bacterium liquid all is laid on the agar plate surface that contains penbritin, 37 ℃ keep flat 10-14 hour (spending the night) of inversion cultivation after 20 minutes.

The picking white colony was inoculated in 3ml and contained in the liquid LB substratum of penbritin next day, and 37 ℃ of shaking tables shook bacterium (180rpm) 12 hours.

The VI plasmid extracts

Get bacterium liquid, be added in the Eppendorf pipe, centrifugal 10 minutes of 4 ℃ of 4000g abandon supernatant, are inverted test tube, drip remaining liquid to the greatest extent.

Add 100 μ l SI, complete resuspended thalline after the vortex oscillation.

Add 200 μ l SII, put upside down the Eppendorf pipe 4 times.

Add 150 μ l SIII, centrifugal 10 minutes of 12000g.

Attached: 1. SI:50mm glucose, 25mmol Tris-Hcl (pH8.0), 10mmolEDTA (pH8.0), preparation 200ml.

2. SII:0.2mol NaOH, 1%SDS, preparation 100ml.

3. SIII:5mol potassium acetate 60ml, glacial acetic acid 11.5ml, two ionized water 28.5ml that boil off.

Supernatant is moved on in another Eppendorf pipe, add equal-volume (450 μ l) phenol chloroform isoamyl alcohol, behind the mixing, centrifugal 10 minutes of 12000g.

The careful upper strata water of drawing adds the ice dehydrated alcohol, places centrifugal 15 minutes of 12000g 30 minutes for-70 ℃ behind the mixing.

Abandon supernatant, add the cold 75% ethanol fine laundering tube wall of 500 μ l, 10000g5 minute, abandon most supernatant, 37 ℃ of standing and drying 10 minutes.

With 50 μ lTER (PH7.4) (50 μ lTE pH8.0 add RnaseA 10mg/ml, 5 μ l) dissolving plasmid.

The VII enzyme is cut evaluation

In new Eppendorf (EP) pipe, add following reactant and reagent successively:

ddH ₂O 6μl

10 * damping fluid, 2 μ l

Each 1 μ l of restriction enzyme (BglII and XhoI)

Plasmid DNA 10 μ l

Cumulative volume 20 μ l, centrifugal mixing.

37 ℃ water-bath 1-1.5 hour.

The Agarose gel electrophoresis, the target gene fragment of the about 380bp of visible size.Reclaim this fragment with the described quick glue absorption method of Step II I.

The pGEM-T/apo plasmid vector of clone's goal gene is stored in the glycerol stock, and send the order-checking of Genecore company, result and original design consensus dna sequence, and the result is as follows:

5’

GA CTCGAGAGGGGAAGGGGATGAGTGCAGGGAACCCCGACCCCACCCGGGAGACCTGCAAGCCTGCAGA

CACTCCCCTCCCGCCCCCACTGAACCCTTGACCCCTGCCCTGCAGCCCCCGCAGCTTGCTGTTTGCCCA

CTCTATTTGCCCAGCCCCAGGGACAGAGCTGATCCTTGAACTCTTAAGTTCCACATTGCCAGGACCAGT

GAGCAGCAACAGGGCCGGGGCTGGGCTTATCAGCCTCCCAGCCCAGACCCTGCCTGCAGACATAAATAG

GCCCTGCAAGAGCTGGCTGCTTAGAG ⁺¹ACTGCGAGAAGGAGGTGCGTCCTGCTGCCTGCCCCGGTCACT

CTGGCTCCCCAGCTCAAGGTTCAGG AGATCTAT 3’

The neo gene of the anti-antibiotic G418 of VIII and goal gene are cloned into, and pGL3-B (pGL3-BasicDNA Vector) is used to screen stable cell line:

1) pGK neo+ plasmid is cut the dna fragmentation that contains neo that can obtain about 2Kb with the XhoI enzyme.

2) cut the neo gene fragment clone that obtains with the XhoI enzyme and go in the SalI restriction enzyme site of PGL3-B above-mentioned:

The pGL3-B plasmid is cut with the SalI enzyme:

PGL3-B 10 μ l, 10 * CIP (calf intestines alkaline phosphatase) Buffer, 2 μ l, CIP 1 μ l, deionized water is supplied 20 μ l.37 ℃ of water-baths 30 minutes.

The DNA purifying: with a phenol/chloroform (1: 1) extracting, a chloroform extracting, ethanol sedimentation dries.

3) the neo fragment is connected in the 0.5ml Eppendorf pipe with linearizing PGL3-B after the SalI enzyme is cut and adds

Target gene fragment 0.5 μ g

Carrier DNA (pGL3-B) 0.1 μ g

10 * connection Buffer, 2 μ l

T ₄Dna ligase 1 μ l

Add the deionization distilled water and mend to 20 μ l, 16 ℃ water-bath 12-16 hour.

4) with the recombinant plasmid transformed intestinal bacteria.Preparation contains the pGL3-B plasmid (pGL3-B/neo) of neo resistant gene.

Apo AI promoter is cloned into the pGL3-B/neo plasmid:

1. with pGL3-B/neo with XhoI endonuclease reaction (0.1-0.2 μ g electrophoresis is identified for 5-10 μ g DNA, 10-20U enzyme);

2. make an endonuclease reaction with BglII again.

3. Agarose electrophoresis and reclaim endonuclease bamhi.

PGL3-B/neo behind the double digestion and * place are reclaimed the ApoAI promoterDNA that obtains connect reaction.Enzyme is cut the pGL3-B/neo (Apo-pGL3-B/neo) that identifies and obtain to have cloned ApoAI promoter DNA.The Apo-pGL3-B/neo plasmid is used for transfection human HepG2 cell strain (ATCC company)

IXPGL3B/Apo-neo plasmid transfection people HepG ₂Cell strain (the transfectional cell LipofectAmine medicine box of Gibco company)

Reagent preparation work before the transgenosis:

1) gets aseptic Eppendorf pipe (1.5ml) ready.

2) solution A: 2 μ g DNA plasmids are added the MEM substratum that 100 μ l do not contain serum and antibiotic.

3) solution B: 12 μ l lipofectamine are added 100 μ l do not contain serum and antibiotic MEM substratum.

4) A liquid and B liquid carefully mix, and shelve 40 minutes in room temperature.It is cotton-shaped that mixture may form mist, and this does not hinder cell transfecting.

X transgeneic procedure step:

1) transfectional cell the day before yesterday, HepG ₂Cell is with 3 * 10 ⁵Number enters each hole in 6 well culture plates.Adding 1ml contains the MEM complete culture solution of 10% foetal calf serum.

2) during transfection, wash HepG with 2ml MEM earlier ₂Cell once.

3) add 0.8ml MEM nutrient solution and go into the A+B mixed solution, mixed, mixed solution is added on the cell.The mixed solution of this moment does not comprise foetal calf serum.

4) cell and plasmid in incubator in 5%CO ₂With transfection under 37 ℃ of conditions 24 hours.

5) cultivate after 24 hours, change nutrient solution into normal nutrient solution, promptly comprise the nutrient solution of 1 * foetal calf serum and microbiotic (final concentration: penicillin 100u/ml, Streptomycin sulphate 100 μ g/ml), other cultivated 48 hours, formed the wink transfectional cell.

6) will change cell wink and advance culture dish with the cell distribution density branch hole of 2000 cells/100mm plate, in the MEM nutrient solution that contains 800 μ g/ml G418 (nutrient solution composition be same as above the 5th step) in 37 ℃, 5%CO ₂Cultivate in the incubator, carry out monoclonal cell strain screening.

Changed liquid once in per two days.

7) after three weeks, the visible cell colony forms, and goes into 24 orifice plate amplification cultivation with the single colony of tip picking of 10 μ l sizes.

8) treat monoclonal cell cover with cultivate plate hole after, cultivations that continue to go down to posterity of a part of cell, a part of raji cell assay Raji luciferase expression, luciferase reaches 1000/1 * 10 ⁵The above person of cell then stays and is back menu clone.

9) the back menu clone cell of Huo Deing went down to posterity more than 10 generations, and the luciferase reporter gene expression does not have reduction person, is the stable transfected cells strain.

XI stablizes transgenosis cell strain luciferase reporter-gene assays method (all detection reagent purchase in Promega company)

A preparation Luciferase measures reagent

Luciferase Assay Substrate lyophilized powder all is dissolved in 10ml LuciferaseAssay Buffer II, and mixing gets final product.The LAR multigelation is tired reduction, can preserve 1 year for-70 ℃.So answer packing frozen.

Each reaction needs 100 μ l.Must put equilibrium at room temperature before using.

B preparation PBS damping fluid

C prepares 1 * CCLR (Cell Culture Lysis Reagent)

Distilled water dilution 5 * CCLR with 4 times of volumes promptly gets 1 * CCLR.Must put equilibrium at room temperature before using.

Operation steps:

1) cell culture fluid is removed in suction, washes 2 times with PBS Buffer (1ml), notes not migratory cell.

2) add 1 * CCLR and cover cell.

Porous plate 1 * PLB

6 orifice plates, 500 μ l

12 orifice plates, 250 μ l

24 orifice plates, 100 μ l

48 orifice plates, 65 μ l

96 orifice plates, 20 μ l

3) fully blow and beat cell, change cell debris and liquid over to centrifuge tube, centrifugal 5 seconds of 12,000 * g changes supernatant in the new pipe over to.As there isn't enough time, need it to be stored in-70 ℃.

4) with the Luciferase Assay Reagent (equilibrium at room temperature) of 20 μ l extraction liquid of cell and 100 μ l with rifle head mixing.

5) be provided with Luminometer (model: Turner Designs-2010, Turner DesignsInstrument company, Sunnyvale, CA): the STD pattern, 2 seconds delay detected in 10 seconds.

6) pipe is put into Luminometer, begin to detect (detecting needs carry out, overlong time, optical density(OD) can decay) in 10 seconds by Go.

Another object of the present invention provides the method for the ApoAI Promoter cell strain screening atherosclerosis high density lipoprotein increasing medicine of using stable transfection, and this method comprises the following steps:

1) uses the stable transfected cells strain: get 1 * 10 ⁴Cell inoculation is in 48 well culture plates, and every hole contains the 0.5ml composition and is same as wink transfectional cell culture condition cultivation 24 hours.

2) add screened material (compound of different sources or mixture) in cell culture fluid and cell cultures 24 hours.

3) nutrient solution that inclines, with PBS damping fluid washed cell secondary, to be determined.Following measuring method is same as transgenic cell Luciferase reporter-gene assays method one joint.

4) selection of selecting compound in is expressed to compare by the luciferase that excites after cultivating with 40 μ g/ml Gemfibrozil and is reached.Expressed by its luciferase of sieve compound and to surpass Gemfibrozil and excite and express that the person selects compound in then being more than one times.

Description of drawings

The ApoAI promoter DNA sequence of Fig. 2, bibliographical information.

Fig. 3, PGL ₃-Basic Vector plasmid figure.

Fig. 4, cloned the PGL of neo gene ₃-Basic Vector plasmid figure.

Fig. 5, cloned the PGL of neo and ApoAI promotor ₃-Basic Vector plasmid figure.

Fig. 6, contain the PRL-TL Vector plasmid figure of Renilla Luciferase gene.

Fig. 7, set up ApoAI promotor cell target and measure the Luciferase route map.

Fig. 8, the ApoAI promotor agarose electrophoresis of duplicating acquisition with PCR method are identified collection of illustrative plates.

The collection of illustrative plates left column is the DNA length mark, and ApoAI promotor electrophoretic band is classified on the right side as.This stripe size is 380bp, is same as the DNA length of our design.

The common clone of Fig. 9, ApoAI promotor and neo gene advances PGL ₃Back agarose electrophoresis is identified collection of illustrative plates.A left side is played first and is classified dna marker as, and the secondary series band shows neo gene (1.5kb), and the 3rd row band shows neo gene (1.5kb) and the ApoAI promotor (380bp) in the same plasmid.

Figure 10, PGL ₃/ Apo-neo carrier stable transfection HepG ₂Cell strain and PGL ₃/ neo carrier luciferase expression activity.Post 1 shows PGL ₃/ Apo-neo carrier stability transfection HepG ₂Cell luciferase expression activity.Post 2 demonstrations do not contain ApoAI, only contain the PGL of neo ₃Empty plasmid transfectional cell luciferase expression activity.Post 3 shows the HepG that does not have the transfection plasmid ₂Cell luciferase expression activity.

Figure 11, obtain to express the highest HepG ₂The stable transfected cells strain is the luciferase expression activity after the heredity of 10 generations.

The known activator Gemfibrozil of Figure 12, ApoAI stimulates ApoAI promotor stability transfection HepG ₂The HepG of cell (black solid circles representative) and untransfected plasmid ₂The activity that cell luciferase expresses.

The influence that Figure 13, Gemfibrozil concentration and cell cultures time pair cell target luciferase express.

Figure 14, Fenofibrate stimulate stable transfection target cell to express the ApoAI promotor.

Embodiment

Example 1

Exercise question: Fenofibrate stimulates the expression of stable transfection target cell ApoAI promotor

Principle: Fenofibrate falls the plasma triglyceride level medicine and gemfibrozil belongs to fibrate class medicine together.The both is a PPAR γ exciting agent.The ApoAI promotor is the target gene of PPAR γ, and known gemfibrozil can stimulate the ApoAI promoter expression, and we infer that belonging to fibraete together also can stimulate the ApoAI promoter expression.This experiment is observed its influence to the ApoAI promoter expression with the ApoAI target cell co-cultivation of the Fenofibrate and the stable transfection of different concns.

Method:

(1) 1 * 10 ⁴Cell inoculation is in 48 well culture plates, every hole contains 0.5ml and contains 10% foetal calf serum and microbiotic (final concentration: penicillin 100 μ/ml, Streptomycin sulphate 100 μ g/ml) MEM complete culture solution, add and be dissolved in DMSO, concentration is 10,40,70, the Fenofibrate of 100 μ g in cell culture fluid and cell in incubator in 5%CO ₂With cultivation under 37 ℃ of conditions 24 hours.

(2) nutrient solution that inclines, with PBS damping fluid washed cell secondary, to be determined.

(3) add 65 μ l, 1 * CCLR and cover every porocyte.

(4) fully blow and beat cell, change cell debris and liquid over to centrifuge tube, centrifugal 5 seconds of 12000 * g changes supernatant in the new pipe over to.As there isn't enough time, need it to be stored in-70 ℃.

(5) with the Luciferase Assay Reagent (equilibrium at room temperature) of 20 μ l extraction liquid of cell and 100 μ l with rifle head mixing.

(6) be provided with Luminometer (model: Turner Designs-2010, Turner DesignsInstrument company, Sunnyvale, CA): the STD pattern, 2 seconds delay detected in 10 seconds.

(7) pipe is put into Luminometer, begin to detect (detecting needs carry out, overlong time, optical density(OD) can decay) in 10 seconds by Go.

Result: Figure 14 shows, Fenofibrate is in that 10 μ g/ml can (its expression intensity changes with Fenofibrate concentration for P＜0.05, n=3) rising ApoAI Promoter expression significantly.This experimental result has confirmed our supposition, and promptly Fenofibrate can stimulate ApoAIPromoter to express.

Documents and materials show that researchist ApoAI Promoter also of no use cell target screens the high density lipoprotein increasing medicine at present.The present invention is used for this purposes with the cell strain of stable transfection in the world first.Cell target of the present invention can be used for screening the single or complex chemical compound of synthetic, the individualized compound or the mixture of screening plant extract, thus the material that screens the rising ApoAI in the various microbial metabolites reaches the purpose of high density lipoprotein increasing.

Claims (2)

1, a kind of method of setting up apolipoprotein A-1 cell target to screen medicine system is characterized in that this method comprises the following steps:

I human gene group DNA's extraction

1) get anticoagulation 2ml, with 2 times physiological saline dilution mixing,

2) in centrifuge tube, add the 2ml lymphocyte separation medium, add the blood that 4ml has diluted mixing on liquid level gently, 200g is centrifugal 20 minutes under the room temperature, and this moment, red corpuscle was sunken to the pipe end, the interface that the lymphocyte of white and other karyocyte are distributed in upper plasma and lower floor's lymphocyte separation medium

3) supernatant is abandoned in suction, and karyocyte layer in the middle of the careful sucking-off changes in the 1.5ml centrifuge tube, with physiological saline washing 1 time,

4) with cell suspension in trishydroxymethyl ammonia methane-disodium EDTA damping fluid, adding sodium laurylsulfonate to final concentration is 0.5%, Proteinase K to final concentration is 200 μ g/ml, 50 ℃ of water-baths 3 hours, jolting therebetween 2-3 time,

5) add equal-volume balance phenol mixing, room temperature is centrifugal, centrifugal 5 minutes of 10000g,

6) carefully draw supernatant, and be transferred to another centrifuge tube, not with the egg white layer sucking-off,

7) add the equal-volume chloroform: primary isoamyl alcohol is 24: 1, mixing, and centrifugal 10000g, 5 minutes,

8) shift supernatant to another centrifuge tube, add 1/10 volume PH and be 5.2 the sodium acetate and the dehydrated alcohol of 2.5 times of volumes, mixing was placed 30 minutes for-80 ℃,

9) 12000g is centrifugal 15 minutes, abandons supernatant, adds 1ml 75% ethanol fine laundering tube wall, and centrifugal 10000g 5 minutes abandons most supernatant, 37 ℃ of standing and drying 10 minutes,

10) with 100 μ l pH=8.0 trishydroxymethyl ammonia methane-disodium EDTA damping fluid dissolving genomic dna;

II is that template is duplicated the promoter DNA sequence of obtaining apolipoprotein A-1 with round pcr with human gene group DNA

Primer: upstream: 5 ' GACTCGAGAGGGGAAGGGGATGAGTG 3 '

Downstream: 5 ' ATAGATCTCCTGAACCTTGAGCTGGG 3 '

Each 1 μ l concentration of upstream and downstream primer is 10 μ mol/L

10 * PCR reaction buffer, 5 μ l

DNTP 2mmol/L 5 μ l concentration are 200 μ mol/L

Genomic dna template 1 μ l total amount 1 μ g

Deionized water was mended to the 50 μ l mixings centrifugal 15 seconds, added paraffin oil 30 μ l in the reaction solution surface, 97 ℃ of sex change 10 minutes, and the ice bath cooling adds Taq enzyme 1 μ l, and the Taq enzyme concn is 5U/ μ l, and is of short duration centrifugal,

Begin circulation:

Sex change: 95 ℃ 30 seconds

Annealing: 60 ℃ 45 seconds

Extend: 72 ℃ 90 seconds

Repeat 30 circulations, after the last circulation, extended again 10 minutes at 72 ℃;

III 1% agarose gel carries out gel electrophoresis and identifies the PCR product

Agarose gel DNA reclaims fast: prepare: a.50 ℃ water-bath device b. preheating trishydroxymethyl ammonia methane-disodium EDTA damping fluid is to 65-70 ℃

1) cut glue: downcut the agarose gel that contains dna fragmentation with clean, sharp cutter, repair clean edge,

2) weigh: gum concentration is less than 2%, and weight is less than 400mg person, and in the 1.5ml centrifuge tube of packing into, every 10mg glue adds the 30ul peptization and separates damping fluid,

3) dissolving: 50 ℃ of water-baths are more than 15 minutes, and every 3 minutes mixings once, water-bath 5 minutes is continued in the dissolving back,

4) dress post: get a wash-out post and put into a 2ml sluicing pipe, the miscellany in the step (3) is poured in the wash-out post, centrifugal 1 minute of 12000g discards liquid in the sluicing pipe,

5) washing, optional doing of this step: the wash-out post is put back in the 2ml sluicing pipe, adds 500 μ l peptizations and separates damping fluid, and room temperature was placed 1 minute, and centrifugal 1 minute of 12000g discards liquid in the sluicing pipe,

6) washing: the wash-out post is put back in the 2ml sluicing pipe, adds 700 μ l lavation buffer solutions, and room temperature was placed 5 minutes, and centrifugal 1 minute of 12000g discards liquid in the sluicing pipe, and repeated centrifugation 1 minute discards sluicing pipe,

7) DNA reclaims: the wash-out post is put into a new 1.5ml centrifuge tube, add the trishydroxymethyl ammonia methane-disodium EDTA damping fluid of 50 μ l preheatings, room temperature was placed 1 minute, and centrifugal 2 minutes of 12000g can reclaim DNA;

The IV goal gene is cloned among the pGEM-T Easy Vectors

In a new 0.5ml centrifuge tube, successively add following reagent:

2 * fast connect damping fluid 5 μ l

pGEM-T?Easy?Vectors?50ng/ul 1μl

The DNA 3 μ l that the PCR product reclaims through glue

T4 dna ligase, concentration are 3U/ μ l 1 μ l

Cumulative volume 10 μ l, 4 ℃ of ligations are spent the night;

The V bacterium transforms

Get JM109 competence bacteria 200 μ l in centrifuge tube

Add the above-mentioned T carrier pGEM-T/apo 4 μ l that connected goal gene, mixing was placed 30 minutes on ice gently,

42 ℃ of water-baths, heat-shocked 90 seconds is not shaken test tube,

Add the LB substratum 800 μ l of antibiotic-free in the pipe, 37 ℃ of following 150rpm gentlenesses were shaken 45 minutes,

Centrifugal 30 seconds of 5000g, honest and upright and thrifty 800 μ l are removed in suction, add 5 one bromo-4-chloro-3-indoles-β-D-galactosides, isopropyl-, behind the mixing, bacterium liquid all is laid on the agar plate surface that contains penbritin with aseptic spreader, 37 ℃ keep flat after 20 minutes to be inverted and cultivated 10-14 hour

The picking white colony was inoculated in 3ml and contained in the liquid LB substratum of penbritin next day, and 37 ℃ of shaking tables shake bacterium, shake 12 hours with 180rpm;

The VI plasmid extracts

Get bacterium liquid, be added in the centrifuge tube, in 4 ℃, centrifugal 10 minutes of 4000g abandons supernatant, is inverted test tube, drips remaining liquid to the greatest extent,

Add 100 μ l solution I, complete resuspended thalline after the vortex oscillation,

Add 200 μ l solution II, put upside down centrifuge tube 4 times,

Add 150 μ l solution III, centrifugal 10 minutes of 12000g,

Supernatant is moved on in another centrifuge tube, add equal-volume 450 μ l phenol chloroform isoamyl alcohols, behind the mixing, centrifugal 10 minutes of 12000g,

The careful upper strata water of drawing adds the ice dehydrated alcohol, placed 30 minutes for-70 ℃ behind the mixing, and centrifugal 15 minutes of 12000g,

Abandon supernatant, add the cold 75% ethanol fine laundering tube wall of 500 μ l, centrifugal 5 minutes of 10000g abandons most supernatant, 37 ℃ of standing and drying 10 minutes,

With 50 μ l PH is trishydroxymethyl ammonia methane-disodium EDTA of 7.4-RNA enzyme dissolving plasmid;

The VII enzyme is cut evaluation

In a new centrifuge tube, add following reactant and reagent successively:

ddH ₂O 6μl

10 * enzyme cutting buffering liquid, 2 μ l

Each 1 μ l of restriction enzyme Bgl II and Xho I

Plasmid DNA 10 μ l

Cumulative volume 20 μ l, centrifugal mixing,

37 ℃ water-bath 1-1.5 hour,

The agarose gel gel electrophoresis, the target gene fragment of the about 380bp of visible size reclaims this fragment with the described quick glue absorption method of Step II I,

The pGEM-T/apo plasmid vector of clone's goal gene is stored in the glycerol stock, and send the order-checking of gene center company, result and original design consensus dna sequence, and the result is as follows: 5 ' GA AGGGGAAGGGGATGAGTGCAGGGAACCCCGACCCCACCCGGGAGACCTGCAAGCCTGCAGACACTCCCCTCCCGCCCCCACTGAACCCTTGACCCCTGCCCTGCAGCCCCCGCAGCTTGCTGTTTGCCCACTCTATTTGCCCAGCCCCAGGGACAGAGCTGATCCTTGAACTCTTAAGTTCCACATTGCCAGGACCAGTGAGCAGCAACAGGGCCGGGGCTGGGCTTATCAGCCTCCCAGCCCAGACCCTGCCTGCAGACATAAATAGGCCCTGCAAGAGCTGGCTGCTTAGAG+1ACTGCGAGAAGGAGGTGCGTCCTGCTGCCTGCCCCGGTCACTCTGGCTCCCCAGCTCAAGGTTCAGG The neo gene of AT 3 ' VIII antibiotic G418 and goal gene are cloned into, and the pGL3-B plasmid is used to screen stable cell line

1) the pGKneo+ plasmid is cut the dna fragmentation that contains neo that can obtain about 2Kb with Xho I enzyme,

2) cut the neo gene fragment clone that obtains with Xho I enzyme and go in the SalI restriction enzyme site of PGL3-B above-mentioned:

The pGL3-B plasmid is cut with Sal I enzyme,

PGL3-B 10 μ l, 10 * CIP Buffer, 2 μ l, CIP 1 μ l, deionized water mend to 20 μ l,

37 ℃ of water-baths 30 minutes,

The DNA purifying: with the extracting in 1: 1 of a phenol/chloroform, a chloroform extracting, ethanol sedimentation dries,

3) the neo fragment with cut through Sal I enzyme after linearizing PGL3-B be connected

In the 0.5ml centrifuge tube

Target gene fragment 0.5 μ g

Carrier DNA pGL3-B 0.1 μ g

10 * connection Buffer, 2 μ l

T ₄Dna ligase 1 μ l

Add the deionization distilled water and mend to 20 μ l, 16 ℃ water-bath 12-16 hour,

4) with the recombinant plasmid transformed intestinal bacteria, preparation contains the pGL3-B plasmid pGL3-B/neo of neo resistant gene,

Apo AI promotor is cloned into the pGL3-B/neo plasmid

1. with pGL3-B/neo with Xho I endonuclease reaction: 5-10 μ g DNA, the 10-20U enzyme,

0.1-0.2 μ g electrophoresis is identified;

2. make an endonuclease reaction with BglII again;

3. agarose gel electrophoresis and reclaim endonuclease bamhi,

PGL3-B/neo behind the double digestion and step VII place are reclaimed the ApoAI startup that obtains

Sub-DNA connects reaction, and enzyme is cut and identified and obtain to have cloned the ApoAI promotor

The pGL3-B/neo plasmid vector Apo-pGL3-B/neo of DNA, this plasmid are used for changeing

Dye human HepG2 cell's strain,

IXPGL ₃B/Apo-neo plasmid transfection people HepG ₂Reagent preparation work before the cell strain, transgenosis:

1) get the centrifuge tube of aseptic 1.5ml ready,

2) solution A: 2 μ g DNA plasmids are added the MEM substratum that 100 μ l do not contain serum and antibiotic,

3) solution B: 12 μ l liposomes are added 100 μ l do not contain serum and antibiotic MEM substratum,

4) A liquid and B liquid carefully mix, and shelve 40 minutes in room temperature, and it is cotton-shaped that mixture may form mist, and this does not hinder cell transfecting;

X transgeneic procedure step:

1) transfectional cell the day before yesterday, HepG ₂Cell is with 3 * 10 ⁵Individual number is put each hole in 96 well culture plates into, adds the MEM nutrient solution that 1ml contains 10% foetal calf serum,

2) during transfection, wash HepG with the 2mlMEM substratum earlier ₂Cell once,

3) add the 0.8mlMEM nutrient solution and go into the A+B mixed solution, mixed, mixed solution is added on the cell, the mixed solution of this moment does not comprise foetal calf serum,

4) cell and plasmid in incubator in 5%CO ₂With transfection under 37 ℃ of conditions 24 hours,

5) cultivate after 24 hours, change nutrient solution into normal nutrient solution, promptly comprise 1 * foetal calf serum and antibiotic nutrient solution, the microbiotic final concentration: penicillin 100u/ml, Streptomycin sulphate 100 μ g/ml, other cultivated 48 hours, formed the wink transfectional cell,

6) will change cell wink and advance culture dish with the cell distribution density branch hole of 2000 cells/100m plate, at the MEM nutrient solution that contains 800 μ g/ml G418, the nutrient solution composition is same as the above the 5th) in the step, in 37 ℃, 5%CO ₂Cultivate in the incubator, carry out monoclonal cell strain screening, changed liquid once in per two days,

7) after three weeks, the visible cell colony forms, and get single colony with the rifle choicest of 10 μ l sizes and go into 24 orifice plate amplification cultivation,

8) treat monoclonal cell cover with cultivate plate hole after, the cultivation that continues to go down to posterity of a part of cell, a part of raji cell assay Raji luciferase expression, luciferase expression reaches 1000/1 * 10 ⁵The above person of cell then stays the mono-clonal into the candidate,

9) candidate's monoclonal cell of Huo Deing went down to posterity more than 10 generations, and luciferase reporter gene is expressed no reduction person, is the stable transfected cells strain;

XI stablizes transgenosis cell strain luciferase reporter gene measuring method,

A preparation luciferase assay reagent

Luciferase is detected the substrate lyophilized powder all be dissolved in 10ml luciferase detection damping fluid II, mixing gets final product, and luciferase detects the substrate multigelation reduction is tired, and can preserve 1 year for-70 ℃, answers packing frozen,

Each reaction needs 100 μ l, must put equilibrium at room temperature before using,

B system PBS damping fluid

C preparation 1 * cell cultures lytic reagent

Distilled water dilution 5 * cell cultures lytic reagent with 4 times of volumes promptly gets 1 * cell cultures lytic reagent, must put equilibrium at room temperature before using,

Operation steps:

1) cell culture fluid is removed in suction, washes 2 times with PBS damping fluid 1ml, notes not migratory cell,

2) add 1 * cell cultures lytic reagent and cover cell,

Porous plate 1 * PLB

6 orifice plates, 500 μ l

12 orifice plates, 250 μ l

24 orifice plates, 100 μ l

48 orifice plates, 65 μ l

96 orifice plates, 20 μ l

3) fully blow and beat cell, change cell debris and liquid over to centrifuge tube, centrifugal 5 seconds of 12,000 * g changes supernatant in the new pipe over to,

4) with 20 μ l extraction liquid of cell and the luciferase detection reagent of 100 μ l of process equilibrium at room temperature rifle head mixing,

5) photometer is set: the STD pattern, postpone 2 seconds, detected in 10 seconds,

6) pipe is put into photometer, detecting needs to carry out in 10 seconds, overlong time, and optical density(OD) can decay.

2, a kind of method of using apolipoprotein A-1 cell target sieving atherosclerosis high density lipoprotein increasing medicine is characterized in that this method comprises the following steps:

1) gets the stable transfected cells strain: 1 * 10 ⁴Cell inoculation is in 48 well culture plates, and every hole contains 0.5ml and contains 10% foetal calf serum and antibiotic MEM complete culture solution, this cell in incubator in 5%CO ₂With cultivation under 37 ℃ of conditions 24 hours;

2) add screened material, in cell culture fluid and cell cultures 24 hours;

3) nutrient solution that inclines, to be determined with phosphoric acid buffer washed cell secondary,

4) selection of selecting compound in compares and reaches by cultivating the plain expression of enzymes of back excited fluorescent with 40 μ g/ml Gemfibrozil, sieve its luciferase expression of compound surpass Gemfibrozil excite expression more than one times the person select compound in then being.

Images