CN117083383A - Modified TREM compositions and uses thereof - Google Patents

Modified TREM compositions and uses thereof Download PDF

Info

Publication number
CN117083383A
CN117083383A CN202180094267.XA CN202180094267A CN117083383A CN 117083383 A CN117083383 A CN 117083383A CN 202180094267 A CN202180094267 A CN 202180094267A CN 117083383 A CN117083383 A CN 117083383A
Authority
CN
China
Prior art keywords
trem
asgpr
independently
binding moiety
domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180094267.XA
Other languages
Chinese (zh)
Inventor
T·阿纳斯塔西亚迪斯
D·C·D·巴特勒
N·库比卡
Q·李
A·G·恩古诺乌维蒂
G·王
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Flagship Pioneering Innovations VI Inc
Original Assignee
Flagship Pioneering Innovations VI Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Flagship Pioneering Innovations VI Inc filed Critical Flagship Pioneering Innovations VI Inc
Priority claimed from PCT/US2021/065159 external-priority patent/WO2022140702A1/en
Publication of CN117083383A publication Critical patent/CN117083383A/en
Pending legal-status Critical Current

Links

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present application relates generally to tRNA-based effector molecules (TREM) comprising asialoglycoprotein receptor (ASGPR) binding moieties and related compositions and methods.

Description

Modified TREM compositions and uses thereof
Cross Reference to Related Applications
The present application claims priority from U.S. provisional application number 63/130,373, U.S. provisional application number 63/130,374, U.S. provisional application number 63/130,375, U.S. provisional application number 63/130,377, U.S. provisional application number 63/130,381, and U.S. provisional application number 63/130,387, each of which was filed on day 23 of 12 months 2020. The entire contents of each of the foregoing applications are hereby incorporated by reference.
Background
tRNA is a complex RNA molecule that has many functions, including the ability to initiate and extend proteins.
Disclosure of Invention
The disclosure features, inter alia, tRNA-based effector molecule (TREM) entities comprising asialoglycoprotein receptor (ASGPR) binding moieties, and compositions and methods of use thereof. The ASGPR binding moiety can be conjugated to a nucleobase within the TREM entity, or within an internucleotide linkage of the TREM entity, or at the end (e.g., 5 'or 3' end) of the TREM entity. In one embodiment, the TREM entity comprises TREM, TREM core fragments, or TREM fragments. In one embodiment, the nucleobase comprises adenine, thymine, cytosine, guanosine, or uracil, or a variant or modified form thereof.
In one aspect, a TREM entity (e.g., TREM) described herein comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2] (a), wherein, independently, the TREM comprises an ASGPR binding moiety. In one embodiment, the ASGPR-binding moiety comprises an ASGPR carbohydrate and an ASGPR linker. In one embodiment, the ASGPR binding moiety comprises a galactose (Gal) and/or N-acetylgalactosamine (GalNAc) moiety. In one embodiment, the ASGPR binding moiety comprises a plurality of Gal and/or GalNAc moieties (e.g., 2, 3, 4, 5, 6, 7, 8, or more Gal and/or GalNAc moieties). In one embodiment, the ASGPR binding moiety comprises a triple antenna GalNAc moiety. In one embodiment, the TREM further comprises a chemical modification (e.g., phosphorothioate internucleotide linkages within the TREM or a 2' -modification on the ribose moiety).
In one embodiment, the ASGPR binding moiety is present on a nucleobase within a nucleotide in TREM. In one embodiment, the ASGPR-binding moiety is present on the 5' end of TREM. In one embodiment, the ASGPR-binding moiety is present on the 3' end of TREM.
In one embodiment, the ASGPR binding moiety is present in a TREM domain selected from the group consisting of: l1, ASt domain 1, L2, DH domain, L3, ACH domain, VL domain, TH domain, L4, and ASt domain 2. In one embodiment, the ASGPR binding moiety is present in the L1 region. In one embodiment, the ASGPR binding moiety is present in AST domain 1. In one embodiment, the ASGPR binding moiety is present in the L2 region. In one embodiment, the ASGPR binding moiety is present in the DH domain. In one embodiment, the ASGPR-binding moiety is present in the L3 region. In one embodiment, the ASGPR binding moiety is present in an ACH domain. In one embodiment, the ASGPR-binding moiety is present in the VL domain. In one embodiment, the ASGPR binding moiety is present in the TH domain. In one embodiment, the ASGPR binding moiety is present in the L4 region. In one embodiment, the ASGPR binding moiety is present in AST domain 2.
In one embodiment, TREM comprising ASGPR binding moieties retains the following capabilities: support protein synthesis, loading by synthetases, binding by extension factors, introducing amino acids into peptide chains, support extension, and/or support initiation. In one embodiment, the TREM comprising an ASGPR binding moiety comprises at least X consecutive nucleotides without chemical modification, wherein X is greater than 10. In one embodiment, a TREM comprising an ASGPR binding moiety comprises no more than 5, 10 or 15 nucleotides of one type (e.g., A, T, C, G or U) that do not comprise chemical modification. In one embodiment, a TREM comprising an ASGPR binding moiety comprises no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, or 80 nucleotides of one type (e.g., A, T, C, G or U) that do not comprise a chemical modification. In one embodiment, the TREM comprising an ASGPR binding moiety comprises at least X consecutive nucleotides comprising a chemical modification, wherein X is greater than 10. In one embodiment, TREM comprising an ASGPR binding moiety comprises more than 5, 10 or 15 nucleotides comprising a chemical modification of one type (e.g. A, T, C, G or U). In one embodiment, a TREM comprising an ASGPR binding moiety comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, or 80 nucleotides comprising a chemical modification of one type (e.g., A, T, C, G or U). In one embodiment, the chemical modification is a naturally occurring chemical modification or a non-naturally occurring chemical modification (e.g., phosphorothioate internucleotide linkages within TREM or a 2' -modification on a ribose moiety). In one embodiment, the chemical modification comprises a fluorophore.
In another aspect, TREMs described herein comprising ASGPR binding moieties or compositions thereof can be used to modulate production parameters (e.g., expression parameters and/or signaling parameters) corresponding to or of polypeptides encoded by: a nucleic acid sequence comprising an endogenous Open Reading Frame (ORF) having a premature stop codon (PTC).
In another aspect, a TREM or a composition thereof comprising an ASGPR binding moiety as described herein can be used in a method of modulating a production parameter of an mRNA corresponding to or a polypeptide encoded by an endogenous Open Reading Frame (ORF) in a subject, the ORF comprising a premature stop codon (PTC), the method comprising contacting the subject with a TREM or a composition thereof comprising an ASGPR binding moiety in an amount and/or for a time sufficient to modulate the production parameter of the mRNA or polypeptide, wherein the TREM comprising an ASGPR binding moiety has an anti-codon paired with a codon having a first sequence, thereby modulating the production parameter in the subject. In one embodiment, the production parameters include signaling parameters and/or expression parameters, e.g., as described herein.
In another aspect, a TREM comprising an ASGPR binding moiety or a composition thereof described herein can be used in a method of treating a subject having an endogenous Open Reading Frame (ORF) comprising a premature stop codon (PTC), the method comprising providing a TREM comprising an ASGPR binding moiety or a composition thereof, wherein the TREM comprising an ASGPR binding moiety comprises an anti-codon paired with the PTC in the ORF; the subject is contacted with TREM or a composition thereof comprising an ASGPR-binding moiety in an amount and/or for a time sufficient to treat the subject, thereby treating the subject. In one embodiment, the PTC comprises UAA, UGA, or UAG.
In another aspect, a TREM or composition thereof comprising an ASGPR binding moiety as described herein can be used in a method of treating a subject suffering from a disease or disorder associated with a premature stop codon (PTC), the method comprising providing a TREM or composition comprising an ASGPR binding moiety as described herein; the subject is contacted with TREM or a composition thereof comprising an ASGPR-binding moiety in an amount and/or for a time sufficient to treat the subject, thereby treating the subject. In one embodiment, the PTC comprises UAA, UGA, or UAG. In one embodiment, the disease or disorder associated with PTC is a disease or disorder described herein, e.g., cancer or monogenic disease.
Additional features of any of the foregoing TREM entities (e.g., TREM core fragments, TREM fragments), TREM compositions, formulations, methods of making TREM compositions and formulations, and methods of using TREM compositions and formulations, include one or more of the embodiments listed below.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalent embodiments are intended to be encompassed by the embodiments listed below.
Drawings
Fig. 1A-1J are images depicting ASGPR expressing U2OS cells transfected with exemplary TREMs comprising ASGPR binding moieties described herein. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.650 (with ASGPR binding moieties at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy.
Fig. 2 is a graphical representation of the fluorescence microscopy results of fig. 1A to 1J. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
Fig. 3A-3H are images depicting ASGPR expressing U2OS cells transfected with exemplary TREMs comprising ASGPR binding moieties described herein. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.650 (with ASGPR binding moieties at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy.
Fig. 4 is a graphical representation of the fluorescence microscopy results of fig. 3A to 3H. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
Fig. 5A-5J are images depicting ASGPR expressing U2OS cells transfected with exemplary TREMs comprising ASGPR binding moieties described herein. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.622 (with ASGPR binding moieties at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy.
Fig. 6 is a graphical representation of the fluorescence microscopy results of fig. 5A to 5J. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
Fig. 7A-7J are images depicting uptake of an exemplary TREM comprising an ASGPR binding moiety as described herein by primary human hepatocytes. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.650 (with ASGPR binding moieties at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy. Fig. 8 is a graphical representation of the fluorescence microscopy results of fig. 7A to 7J. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
Fig. 9A-9H are images depicting uptake of an exemplary TREM comprising an ASGPR binding moiety as described herein by primary human hepatocytes. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.653 (with ASGPR binding moiety at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy.
Fig. 10 is a graphical representation of the fluorescence microscopy results of fig. 9A to 9H. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
Fig. 11A-11J are images depicting uptake of an exemplary TREM comprising an ASGPR binding moiety as described herein by primary human hepatocytes. In this experiment, uptake of TREM comprising the backbone of SEQ ID No.622 (with ASGPR binding moieties at different positions along the sequence) conjugated to Cy3 was monitored and visualized by fluorescence microscopy.
Fig. 12 is a graphical representation of the fluorescence microscopy results of fig. 11A to 11J. The results are plotted as the mean intensity relative to the concentration of oligonucleotide (nM) administered to the cells.
FIG. 13 is a graph depicting the results of uptake of exemplary TREM by ASGPR expressing U2OS cells transfected with an nLUC-premature stop codon (PTC) reporter gene. Exemplary TREMs comprising the backbone of SEQ ID No.650 (containing ASGPR binding moieties at positions along the sequence) were transfected with RNAiMAX transfection reagents. The results are shown as fold change relative to the simulated (no TREM) samples.
FIG. 14 is a graph depicting the results of uptake of exemplary TREM by ASGPR expressing U2OS cells transfected with an nLUC-premature stop codon (PTC) reporter gene. Exemplary TREMs comprising the backbone of SEQ ID No.653 (containing ASGPR binding moieties at positions along the sequence) were transfected with RNAiMAX transfection reagents. The results are shown as fold change relative to the simulated (no TREM) samples.
FIG. 15 is a graph depicting the results of uptake of exemplary TREM by ASGPR expressing U2OS cells transfected with an nLUC-premature stop codon (PTC) reporter gene. Exemplary TREMs comprising the backbone of SEQ ID No.622 (containing ASGPR binding moieties at positions along the sequence) were transfected with RNAiMAX transfection reagents. The results are shown as fold change relative to the simulated (no TREM) samples.
Detailed Description
The disclosure features tRNA-based effector molecule (TREM) entities (e.g., TREM core fragments, and TREM fragments) comprising asialoglycoprotein receptor (ASGPR) binding moieties, and compositions and methods of use thereof. As disclosed herein, a TREM entity (e.g., TREM) is a complex molecule that can mediate a variety of cellular processes. The pharmaceutical TREM composition (e.g., TREM comprising an ASGPR binding moiety) can be administered to cells, tissues, or subjects to modulate these functions.
Definition of the definition
The term "acceptor stem domain (AStD)" as used herein refers to a domain that binds an amino acid. In one embodiment, the AStD comprises ASt domain 1 and ASt domain 2. For example, ASt domain 1 is at or near the 5 'end of TREM and ASt domain 2 is at or near the 3' end of TREM. AStD comprises sufficient RNA sequence to mediate, for example, the transport of a receptive amino acid, e.g., a homologous or non-homologous amino acid thereof, and an Amino Acid (AA) during initiation or extension of a polypeptide chain when present in an otherwise wild-type tRNA. Typically, AStD comprises a 3' -end adenosine (CCA) for receiving stem loads, which are part of synthetase recognition. In one embodiment, the AStD has at least 75%, 80%, 85%, 90%, 95% or 100% identity with a naturally occurring AStD (e.g., an AStD encoded by a nucleic acid in table 1). In one embodiment, the TREM may comprise a fragment or analog of an AStD (e.g., an AStD encoded by a nucleic acid in table 1) that has an AStD activity in one embodiment and no AStD activity in other embodiments. The relevant corresponding sequences for any of the domains, stems, loops or other sequence features mentioned herein can be determined by the skilled artisan from the sequences encoded by the nucleic acids in table 1. For example, one of ordinary skill can determine the sequence corresponding to AStD from the tRNA sequences encoded by the nucleic acids in Table 1. In one embodiment, the ASGPR-binding moiety is present within AStD. In one embodiment, the ASGPR binding moiety binds to a nucleobase within a nucleotide in AStD. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage in AStD. In one embodiment, the ASGPR-binding moiety is present at a terminus (e.g., the 5 'or 3' terminus) within the AStD.
In one embodiment, ASt domain 1 comprises positions 1-9 within the TREM sequence. In one embodiment, the ASGPR binding moiety is present within domain 1 of ASt (e.g., positions 1-9) within the TREM sequence. In one embodiment, ASt domain 2 comprises positions 65-76 within the TREM sequence. In one embodiment, the ASPGR binding moiety is present within domain 1 of ASt (e.g., positions 65-76) within the TREM sequence.
In one embodiment, the AStD belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" portion, or does not differ from the consensus sequence by more than 1, 2, 5, or 10 positions. In one embodiment, the ASPGR binding moiety is present in an AStD that belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" portion, or differs from the consensus sequence by no more than 1, 2, 5, or 10 positions.
In one embodiment, the AStD comprises formula I ZZZ Residue R of (2) 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 (exemplary ASt domain 2) and residue R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 (exemplary ASt domain 2), wherein ZZZ represents any of the twenty amino acids. In some embodiments, formula I ZZZ Refers to all species.
In one embodiment, the AStD comprises formula II ZZZ Residue R of (2) 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 And residue R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 Wherein ZZZ represents any one of twenty amino acids.
In some embodiments, formula II ZZZ Refers to mammals.
In one embodiment, the AStD comprises formula III ZZZ Residue R of (2) 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 And residue R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula III ZZZ Refers to a human.
In one embodiment, ZZZ represents any one of the following amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.
The term "anticodon hairpin domain (ACHD)" as used herein refers to a domain that comprises an anticodon that binds to a corresponding codon in an mRNA, and that comprises sufficient sequence, e.g., an anticodon triplet, to mediate pairing (with or without wobble) with a codon, e.g., when present in an otherwise wild-type tRNA. In one embodiment, the ACHD has at least 75%, 80%, 85%, 90%, 95% or 100% identity with a naturally occurring ACHD (e.g., an ACHD encoded by a nucleic acid in table 1). In one embodiment, TREM may comprise a fragment or analog of ACHD (e.g., ACHD encoded by a nucleic acid in table 1), which fragment has ACHD activity in embodiments and no ACHD activity in other embodiments. In one embodiment, the ASGPR-binding moiety is present within ACHD. In one embodiment, the ASGPR binding moiety binds to a nucleobase within a nucleotide in ACHD.
In one embodiment, ACHD contains positions 27-43 within the TREM sequence. In one embodiment, the ASGPR binding moiety is present within ACHD (e.g., positions 27-43) within the TREM sequence.
In one embodiment, the ACHD belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" section, or differs from the consensus sequence by no more than 1, 2, 5, or 10 positions. In one embodiment, the ASGPR binding portion is present within the corresponding sequence of the consensus sequence provided in the "consensus sequence" portion or within a sequence that differs from the consensus sequence by no more than 1, 2, 5, or 10 positions.
In one embodiment, the ACHD comprises formula I ZZZ residue-R of (2) 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula I ZZZ Refers to all species.
In one embodiment, the ACHD comprises formula II ZZZ residue-R of (2) 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula II ZZZ Refers to mammals.
In one embodiment, the ACHD comprises formula III ZZZ residue-R of (2) 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula III ZZZ Refers to a human.
In one embodiment, ZZZ represents any one of the following amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.
In one embodiment, the anticodon of the TREM entity comprises three nucleotide residues and is paired with three nucleotide codons. In one embodiment, the anticodon of the TREM entity consists of three nucleotide residues and is paired with an anticodon consisting of three nucleotide residues. In one embodiment, the anticodon of the TREM entity is not paired with a codon having four, five or more nucleotide residues, but only with a codon having three nucleotide residues.
In one embodiment, the TREM entity does not change the reading frame of the mRNA. In one embodiment, the anticodon of the TREM entity is paired with a triplet codon of the mRNA, but not with an adjacent nucleotide.
In one embodiment, the TREM entity is used without changing the length of the polypeptide transcribed from the mRNA, e.g., it does not suppress a stop codon, e.g., a premature stop codon. In one embodiment, TREM does not alter the length of the ORF of mRNA.
The term "asialoglycoprotein receptor (ASGPR) binding moiety" as used herein refers to a moiety that binds an asialoglycoprotein receptor. In one embodiment, an ASGPR-binding moiety as described herein refers to a structure comprising: (i) ASGPR carbohydrate and (ii) ASGPR linker (e.g., a linker linking carbohydrate and TREM). Exemplary ASGPR moieties include galactose (Gal), galactosamine (GalNH) 2 ) Or an N-acetylgalactosamine (GalNAc) moiety, e.g., gal, galNH 2 Or GalNAc, or an analog thereof. The ASGPR binding moiety can comprise a functional group (e.g., a hydroxyl group, a carboxylic acid group, an amine) that can be protected by a chemical protecting group (e.g., an acetyl group or a methyl group). In one embodiment, the ASGPR binding moiety comprises a triple antenna GalNAc moiety. In one embodiment, the ASGPR-binding moiety can be an ASGPR-binding moiety as described in further detail herein.
The term "cognate adaptor-function TREM" as used herein refers to TREM that mediates the initiation or extension of AA (cognate AA) naturally associated with the anticodon of TREM.
The term "reduced expression" as used herein refers to a reduction in comparison to a reference, e.g., where the addition of an altered control region or agent results in a reduction in the expression of the subject product, relative to an otherwise similar cell without the alteration or addition.
The term Dihydrouridine Hairpin Domain (DHD) as used herein refers to a domain comprising sufficient RNA sequence to mediate, for example, recognition of an aminoacyl-tRNA synthetase when present in an otherwise wild-type tRNA, e.g., to act as a recognition site for the aminoacyl-tRNA synthetase for amino acid charging of TREM. In an embodiment, DHD mediates stabilization of TREM tertiary structure. In one embodiment, the DHD has at least 75%, 80%, 85%, 90%, 95% or 100% identity with a naturally occurring DHD (e.g., a DHD encoded by a nucleic acid in table 1). In one embodiment, the TREM may comprise a fragment or analog of DHD (e.g., DHD encoded by a nucleic acid in table 1), which fragment has DHD activity in embodiments and does not have DHD activity in other embodiments. In one embodiment, the ASGPR binding moiety is present within a DHD. In one embodiment, the ASGPR binding moiety binds to a nucleobase within a nucleotide in DHD.
In one embodiment, the DHD comprises locations 10-26 within the TREM sequence. In one embodiment, the ASGPR binding moiety is present within DHD within the TREM sequence (e.g., positions 10-26).
In one embodiment, the DHD belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" section, or differs from the consensus sequence by no more than 1, 2, 5, or 10 positions. In one embodiment, the ASGPR binding portion is present within the corresponding sequence of the consensus sequence provided in the "consensus sequence" portion or within a sequence that differs from the consensus sequence by no more than 1, 2, 5, or 10 positions.
In one embodiment, the DHD comprises formula I ZZZ Residue R of (2) 10 -R 11 -R 12 -R 13 -R 14 R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula I ZZZ Refers to all species.
In one embodiment, the DHD comprises formula II ZZZ Residue R of (2) 10 -R 11 -R 12 -R 13 -R 14 R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula II ZZZ Refers to mammals.
In one embodiment, the DHD comprises formula III ZZZ Residue R of (2) 10 -R 11 -R 12 -R 13 -R 14 R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula III ZZZ Refers to a human.
In one embodiment, ZZZ represents any one of the following amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.
The term "exogenous nucleic acid" as used herein refers to a nucleic acid sequence that is not present in or differs by at least one nucleotide from the closest sequence in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced. In one embodiment, the exogenous nucleic acid comprises a nucleic acid encoding TREM.
The term "exogenous TREM" as used herein refers to a TREM having the following TREM:
(a) At least one nucleotide or one post-transcriptional modification that differs from the closest sequence tRNA in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced;
(b) Cells that have been introduced into cells other than the cells into which they were transcribed;
(c) In cells other than the cells in which they naturally occur; or alternatively
(d) Has a non-wild type expression profile, e.g., a level or profile, e.g., its expression level is higher than that of the wild type. In one embodiment, the expression profile may be mediated by introducing changes into a nucleic acid that modulates expression or by adding agents that modulate the expression of an RNA molecule. In one embodiment, the exogenous TREM comprises 1, 2, 3, or 4 of characteristics (a) - (d).
The term "GMP grade composition" as used herein refers to a composition that meets current good manufacturing practice (cGMP) guidelines or other similar requirements. In one embodiment, the GMP grade composition may be used as a pharmaceutical product.
As used herein, the terms "increase" and "decrease" refer to modulating a greater or lesser amount of function, expression or activity, respectively, that produces a particular index relative to a reference. For example, after administration of a TREM described herein to a cell, tissue, or subject, the amount of a marker of an index (e.g., protein translation, mRNA stability, protein folding) as described herein can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%, 2X, 3X, 5X, 10X, or more relative to the amount of the marker prior to administration or relative to the effect of a negative control agent. The index after administration is measured at a time when the effect has been reached by administration, for example, at least 12 hours, 24 hours, one week, one month, 3 months, or 6 months after initiation of treatment.
The term "increased expression" as used herein refers to an increase in comparison to a reference, e.g., where the addition of an altered control region or agent results in an increase in the expression of the subject product, relative to an otherwise similar cell without the alteration or addition.
The term linker 2 region (L2) as used herein is meant to encompass "Residues R of the consensus sequence provided in the "part of the consensus sequence 8 -R 9 Is a joint of a metal wire.
The term linker 3 region (L3) as used herein refers to residue R comprising the consensus sequence provided in the "consensus sequence" section 29 Is a joint of a metal wire.
The term "linker 4 region (L4)" as used herein refers to a residue R comprising a consensus sequence provided in the "consensus sequence" portion 72 Is a domain of (a).
The term "modification" as used herein refers to modification of a nucleotide, refers to modification of the chemical structure of the subject nucleotide, e.g., covalent modification. In one embodiment, the modification is present within a nucleobase, nucleotide sugar, or internucleotide linkage of a nucleotide of the TREM. Modifications may be naturally occurring or non-naturally occurring. In one embodiment, the modification is non-naturally occurring. In one embodiment, the modification is naturally occurring. In one embodiment, the modification is a synthetic modification. In one embodiment, the modification is a modification provided in table 5, 6, 7, 8, or 9.
The term "naturally occurring nucleotide" as used herein refers to a nucleotide that does not comprise non-naturally occurring modifications. In one embodiment, it includes naturally occurring modifications.
The term "nucleotide" as used herein is meant to include sugar (typically pentameric sugar); a nucleobase; and a phosphate linking group (e.g., internucleotide linkages). In one embodiment, the nucleotide comprises a naturally occurring nucleotide, e.g., naturally occurring in a human cell, e.g., an adenine, thymine, guanine, cytosine, or uracil nucleotide.
The term "Thymine Hairpin Domain (THD)" as used herein refers to a domain comprising sufficient RNA sequence to mediate recognition of a ribosome, e.g., acting as a recognition site for a ribosome, when present in an otherwise wild-type tRNA, for example, to form a TREM-ribosome complex during translation. In one embodiment, THD has at least 75%, 80%, 85%, 90%, 95% or 100% identity with naturally occurring THD (e.g., THD encoded by a nucleic acid in table 1). In one embodiment, the TREM may comprise a fragment or analog of THD (e.g., THD encoded by a nucleic acid in table 1) that has THD activity in embodiments and no THD activity in other embodiments. In one embodiment, the ASPGR binding moiety is present within THD. In one embodiment, the ASGPR binding moiety binds to a nucleobase within a nucleotide in THD.
In one embodiment, THD comprises positions 50-64 within the TREM sequence. In one embodiment, the ASPGR binding moiety is present within THD (e.g., positions 50-64) within the TREM sequence.
In one embodiment, THD belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" portion, or differs from the consensus sequence by no more than 1, 2, 5, or 10 positions.
In one embodiment, THD comprises formula I ZZZ residue-R of (2) 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula I ZZZ Refers to all species.
In one embodiment, THD comprises formula II ZZZ residue-R of (2) 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 Wherein ZZZ represents any one of twenty amino acids. In some embodiments, formula II ZZZ Refers to mammals.
In one embodiment, THD comprises formula II ZZZ residue-R of (2) 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 WhereinZZZ represents any of the twenty amino acids. In some embodiments, formula III ZZZ Refers to a human.
In one embodiment, ZZZ represents any one of the following amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.
The term "tRNA-based effector molecule" or "TREM" as used herein refers to an RNA molecule that comprises a structure or characteristic from (a) - (v) below, and that is recombinant TREM, synthetic TREM, or TREM expressed from a heterologous cell. TREM described in the present invention is a synthetic molecule and is for example prepared in a cell-free reaction, for example in a solid or liquid phase synthesis reaction. TREMs are chemically different, for example, in terms of the modified primary sequence, type, or position from an endogenous tRNA molecule produced in a cell (e.g., a mammalian cell, such as a human cell). TREMs may have multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9) structures and functions of (a) - (v).
In one embodiment, TREM is non-natural, as assessed by its structure or manner of preparation.
In one embodiment, the TREM comprises one or more of the following structures or characteristics:
(a') an optional linker region of the consensus sequence provided in the "consensus sequence" section, e.g., linker 1 region;
(a) A stem-receiving domain (AStD) typically comprising ASt domain 1 and ASt domain 2;
(a' -1) linker 2 region (L2) comprising residues R of the consensus sequence provided in the "consensus sequence" section 8 -R 9 For example, linker 2 region;
(b) DHD or a Dihydrouridine Hairpin Domain (DHD);
(b' -1) linker 3 region or L3;
(c) ACHD or anticodon hairpin domain;
(d) VLD or Variable Loop Domain (VLD);
(e) THD or Thymine Hairpin Domain (THD);
(e' 1) residues R comprising the consensus sequence provided in the "consensus sequence" section 72 L4 linker of (2);
(f) Under physiological conditions, it comprises a stem structure and one or more loop structures, e.g., 1, 2 or 3 loops. The loop may comprise a domain described herein, e.g., a domain selected from (a) - (e). A loop may comprise one or more domains. In one embodiment, the stem or loop structure has at least 75%, 80%, 85%, 90%, 95% or 100% identity to a naturally occurring stem or loop structure (e.g., a stem or loop structure encoded by a nucleic acid in table 1). In one embodiment, the TREM may comprise a fragment or analog of a stem or loop structure (e.g., a stem or loop structure encoded by a nucleic acid in table 1), which fragment has activity of a stem or loop structure in embodiments and does not have activity of a stem or loop structure in other embodiments;
(g) Tertiary structure, e.g., L-shaped tertiary structure;
(h) Adaptor function, i.e., TREM mediates acceptance of amino acids (e.g., homologous amino acids thereof) and transport of AA in the initiation or extension of polypeptide chains;
(i) Homologous adapter function, wherein the TREM mediates the acceptance and incorporation of amino acids naturally associated with the anticodon of TREM (e.g., homologous amino acids) to initiate or extend a polypeptide chain;
(j) A non-cognate adaptor function, wherein the TREM mediates acceptance and incorporation of an amino acid (e.g., a non-cognate amino acid) other than an amino acid naturally associated with an anticodon of the TREM in the initiation or extension of a polypeptide chain;
(k) Regulatory functions, such as epigenetic functions (e.g., gene silencing functions or signaling pathway regulation functions), cell fate regulation functions, mRNA stability regulation functions, protein transduction regulation functions, or protein compartmentalization functions;
(l) A structure that allows ribosome binding;
(m) post-transcriptional modifications, such as naturally occurring post-transcriptional modifications;
(n) an ability to inhibit a functional property of the tRNA, e.g., any one of properties (h) - (k) that the tRNA has;
(o) the ability to regulate cell fate;
(p) the ability to modulate ribosome occupancy;
(q) the ability to modulate protein translation;
(r) the ability to modulate mRNA stability;
(s) the ability to modulate protein folding and structure;
(t) the ability to modulate protein transduction or compartmentalization;
(u) the ability to modulate protein stability; or alternatively
(v) The ability to modulate signaling pathways, e.g., cell signaling pathways.
In one embodiment, the TREM comprises a full length tRNA molecule or fragment thereof.
In one embodiment, TREM comprises the following characteristics: (a) - (e).
In one embodiment, TREM comprises the following characteristics: (a) and (c).
In one embodiment, TREM comprises the following characteristics: (a), (c) and (h).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h) and (b).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h) and (e).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h), (b) and (e).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h), (b), (e) and (g).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h) and (m).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h), (m) and (g).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h), (m) and (b).
In one embodiment, TREM comprises the following characteristics: (a), (c), (h), (m) and (e).
In one embodiment, TREM comprises the following characteristics: (a) (c), (h), (m), (g), (b) and (e).
In one embodiment, TREM comprises the following characteristics: (a) (c), (h), (m), (g), (b), (e) and (q).
In one embodiment, the TREM comprises:
(i) Amino acid-binding amino acid-attachment domains (e.g., an AStD as described in (a) herein); and
(ii) An anticodon that binds to a corresponding codon in mRNA (e.g., ACHD, as described in (c) herein).
In one embodiment, the TREM comprises a flexible RNA linker that provides covalent attachment of (i) to (ii).
In one embodiment, the TREM mediates protein translation.
In one embodiment, the TREM comprises a linker, e.g., an RNA linker, e.g., a flexible RNA linker, that provides a covalent linkage between the first and second structures or domains. In one embodiment, the RNA linker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 ribonucleotides. The TREM may comprise one or more linkers, for example, in embodiments, a TREM comprising (a), (b), (c), (d) and (e) may have a first linker between the first and second domains, and a second linker between the third domain and the other domain.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2].
In one embodiment, the TREM comprises an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or differs by no more than 1, 2, 3, 4, 5, 10, 15, 20, 25 or 30 ribonucleotides from an RNA sequence encoded by a DNA sequence set forth in table 1, or a fragment or functional fragment thereof. In one embodiment, the TREM comprises an RNA sequence encoded by a DNA sequence listed in table 1, or a fragment or functional fragment thereof. In one embodiment, the TREM comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence set forth in table 1, or a fragment or functional fragment thereof. In one embodiment, the TREM comprises a TREM domain, e.g., a domain described herein, that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical or differs by no more than 1, 2, 3, 4, 5, 10, or 15 ribonucleotides, or a fragment or functional fragment thereof, from an RNA encoded by a DNA sequence set forth in table 1. In one embodiment, the TREM comprises a TREM domain, e.g., a domain described herein, comprising an RNA sequence encoded by a DNA sequence set forth in table 1, or a fragment or functional fragment thereof. In one embodiment, the TREM comprises a TREM domain, e.g., a domain described herein, comprising an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence listed in table 1, or a fragment or functional fragment thereof.
In one embodiment, TREM is 76-90 nucleotides in length. In an embodiment, the TREM or fragment or functional fragment thereof is between 10-90 nucleotides, between 10-80 nucleotides, between 10-70 nucleotides, between 10-60 nucleotides, between 10-50 nucleotides, between 10-40 nucleotides, between 10-30 nucleotides, between 10-20 nucleotides, between 20-90 nucleotides, between 20-80 nucleotides, between 20-70 nucleotides, between 20-60 nucleotides, between 20-50 nucleotides, between 20-40 nucleotides, between 30-90 nucleotides, between 30-80 nucleotides, between 30-70 nucleotides, between 30-60 nucleotides, or between 30-50 nucleotides.
In one embodiment, the TREM is aminoacylated, for example, by aminoacyl tRNA synthetase loading the amino acid.
In one embodiment, the TREM is not loaded with amino acids, e.g., no load TREM (uptem).
In one embodiment, the TREM comprises less than full length tRNA. In embodiments, TREM can correspond to a naturally occurring fragment of a tRNA, or to a non-naturally occurring fragment. Exemplary fragments include: TREM halves (e.g., from cleavage in ACHD, e.g., in anticodon sequences, e.g., 5 'half or 3' half); a 5 'fragment (e.g., a fragment comprising a 5' end, e.g., from a cleavage in DHD or ACHD); a 3 'fragment (e.g., a fragment comprising a 3' end, e.g., from a cleavage in THD); or internal fragments (e.g., cleavage from one or more of ACHD, DHD, or THD).
The term "TREM core fragment" as used herein refers to a portion of the sequence of formula B: [ L1]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1.
As used herein, "TREM fragment" refers to a portion of TREM, wherein the TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2].
The term "non-cognate adaptor-functional TREM" as used herein refers to TREM that mediates the initiation or extension of AA (non-cognate AA) other than AA naturally associated with the anticodon of TREM. In one embodiment, the non-cognate adaptor function TREM is also referred to as a non-loaded TREM (mTREM).
The term "non-naturally occurring sequence" as used herein refers to a sequence in which adenine is replaced with a residue other than an adenine analog, cytosine is replaced with a residue other than a cytosine analog, guanine is replaced with a residue other than a guanine analog, and uracil is replaced with a residue other than a uracil analog. An analogue refers to any possible derivative of ribonucleotides A, G, C or U. In one embodiment, the sequence having a derivative of either ribonucleotide A, G, C or U is a non-naturally occurring sequence.
The term "pharmaceutical TREM composition" as used herein refers to TREM compositions suitable for pharmaceutical use. Typically, the pharmaceutical TREM composition comprises a pharmaceutical excipient. In one embodiment, TREM will be the only active ingredient in the pharmaceutical TREM composition. In embodiments, the pharmaceutical TREM composition is free, substantially free, or has less than a pharmaceutically acceptable amount of host cell proteins, DNA, such as host cell DNA, endotoxins, and bacteria.
With respect to a subject molecule, e.g., TREM, RNA, or tRNA, the term "post-transcriptional processing" as used herein refers to covalent modification of the subject molecule. In one embodiment, the covalent modification occurs post-transcriptionally. In one embodiment, the covalent modification occurs co-transcriptionally. In one embodiment, the modification is performed in vivo, e.g., in a cell used to produce TREM. In one embodiment, the modification is performed ex vivo, e.g., it is performed on TREMs isolated or obtained from TREM producing cells. In one embodiment, the post-transcriptional modification is selected from the post-transcriptional modifications listed in table 2.
As used herein, the term "subject" includes any organism, such as a human or other animal. In embodiments, the subject is a vertebrate (e.g., a mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a mammal, e.g., a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., monkey, ape), ungulate (e.g., cow, buffalo, sheep, goat, pig, camel, llama, alpaca, deer, horse, donkey), carnivorous (e.g., dog, cat), rodent (e.g., rat, mouse), or lagomorph (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the avian herd galliformes (e.g., chicken, turkey, pheasant, quail), anseriformes (e.g., duck, goose), gullet (e.g., ostrich, emu), pigeon (e.g., pigeon, pheasant), or psittacosis (e.g., parrot). The subject may be a male or female of any age group, e.g., a pediatric subject (e.g., infant, child, adolescent) or an adult subject (e.g., young adult, middle aged adult, or elderly adult). The non-human subject may be a transgenic animal.
The term "synthetic TREM" as used herein refers to TREMs other than TREM in or synthesized by a cell having endogenous nucleic acid encoding TREM, e.g., synthetic TREM is synthesized by cell-free solid phase synthesis. The synthetic TREM can have the same or different sequence or tertiary structure as the natural tRNA.
The term "recombinant TREM" as used herein refers to TREM expressed in a cell modified by human intervention with a modification that mediates TREM production, e.g., the cell contains an exogenous sequence encoding TREM, or a modification that mediates expression, e.g., transcriptional expression or post-transcriptional modification of TREM. Recombinant TREM can have the same or different sequence, post-transcriptional modification group, or tertiary structure as the reference tRNA, e.g., the natural tRNA.
The term "tRNA" as used herein refers to a naturally occurring transport ribonucleic acid in its natural state.
The term "TREM composition" as used herein refers to a composition comprising a plurality of TREMs, a plurality of TREM core fragments and/or a plurality of TREM fragments. The TREM composition may comprise one or more TREMs, TREM core fragments or TREM fragments. In one embodiment, the composition comprises only a single species of TREM, TREM core fragment, or TREM fragment. In one embodiment, the TREM composition comprises a first TREM, TREM core fragment, or TREM fragment species; and a second TREM, TREM core fragment or TREM fragment species. In one embodiment, the TREM composition comprises X TREMs, TREM core fragments or TREM fragment categories, wherein X = 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one embodiment, the TREM, TREM core fragment, or TREM fragment has at least 70%, 75%, 80%, 85%, 90% or 95%, or 100% identity to a sequence encoded by a nucleic acid in table 1. The TREM composition may comprise one or more TREMs, TREM core fragments or TREM fragments. In one embodiment, the TREM composition is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% dry weight TREM (for liquid compositions, dry weight refers to the weight after removal of substantially all liquid, e.g., lyophilization). In one embodiment, the composition is a liquid. In one embodiment, the composition is a dry, e.g., lyophilized, material. In one embodiment, the composition is a frozen composition. In one embodiment, the composition is sterile. In one embodiment, the composition comprises at least 0.5g, 1.0g, 5.0g, 10g, 15g, 25g, 50g, 100g, 200g, 400g, or 500g TREM (e.g., determined by dry weight).
In one embodiment, at least X% of the TREMs in the TREM composition comprise chemical modifications at selected positions, and X is 80, 90, 95, 96, 97, 98, 99 or 99.5.
In one embodiment, at least X% of the TREMs in the TREM composition comprise chemical modifications at a first location and chemical modifications at a second location, and X is independently 80, 90, 95, 96, 97, 98, 99 or 99.5. In an embodiment, the modifications at the first and second positions are the same. In an embodiment, the modifications at the first and second locations are different. In embodiments, the nucleotides at the first and second positions are identical, e.g., both are adenine. In embodiments, the nucleotides at the first and second positions are different, e.g., one is adenine and one is thymine.
In one embodiment, at least X% of the TREMs in the TREM composition comprise chemical modifications at a first location and less than Y% have chemical modifications at a second location, wherein X is 80, 90, 95, 96, 97, 98, 99 or 99.5 and Y is 20, 5, 2, 1 or.01. In embodiments, the nucleotides at the first and second positions are identical, e.g., both are adenine. In embodiments, the nucleotides at the first and second positions are different, e.g., one is adenine and one is thymine.
The term "Variable Loop Domain (VLD)" as used herein refers to a domain comprising sufficient RNA sequence to mediate, for example, recognition of an aminoacyl-tRNA synthetase when present in an otherwise wild-type tRNA, e.g., to act as a recognition site for the aminoacyl-tRNA synthetase for amino acid charging of TREM. In an embodiment, VLD mediates stabilization of TREM tertiary structure. In one embodiment, the VLD modulates (e.g., increases) the specificity of TREM (e.g., for its cognate amino acids), e.g., the VLD modulates the cognate adapter function of TREM. In one embodiment, the VLD has at least 75%, 80%, 85%, 90%, 95% or 100% identity with a naturally occurring VLD (e.g., a VLD encoded by a nucleic acid in table 1). In one embodiment, the TREM may comprise a fragment or analog of a VLD (e.g., a VLD encoded by a nucleic acid in table 1), which fragment has VLD activity in embodiments and no VLD activity in other embodiments. In one embodiment, the ASGPR-binding moiety is present within a VLD. In one embodiment, the ASGPR binding moiety binds to a nucleobase within a nucleotide in VLD.
In one embodiment, the VLD contains positions 44-49 within the TREM sequence. In one embodiment, the ASGPR-binding moiety is present within a VLD (e.g., positions 44-49) within a TREM sequence.
In one embodiment, the VLD belongs to the corresponding sequence of the consensus sequence provided in the "consensus sequence" section.
In one embodiment, the VLD comprises residues of the consensus sequence provided in the "consensus sequence" section- [ R 47 ] x Where x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16) x=1-15, x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x=8, x=150-271, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=6 0. x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271).
TREM entity
Described herein are TREM entities (e.g., TREMs, TREM core fragments, or TREM fragments) modified with asialoglycoprotein receptor (ASGPR) binding moieties, and compositions and methods of use thereof. A TREM entity (e.g., TREM) refers to an RNA molecule comprising one or more of the properties described herein. The ASGPR binding moiety can be conjugated to a nucleobase within the TREM entity, or within an internucleotide linkage of the TREM entity, or at the end (e.g., 5 'or 3' end) of the TREM entity. The TREM entity (e.g., TREM) can comprise chemical modifications, e.g., as provided in tables 4, 5, 6, or 7.
In one embodiment, the TREM entity comprises a TREM comprising a sequence of formula a; a TREM core fragment comprising a sequence of formula B; or a TREM fragment comprising a portion of TREM, the TREM comprising a sequence of formula a.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within ASt domain 1 (e.g., on a nucleobase of ASt domain 1, at a terminal end (e.g., 5' terminal end) of ASt domain 1, or within an internucleotide linkage of ASt domain 1). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within domain 1 of ASt. In one embodiment, the ASGPR binding moiety is present at the 5' end within ASt domain 1 or at [ L1 ]. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of ASt domain 1. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within ASt domain 2 (e.g., on a nucleobase of ASt domain 2, at a terminal end (e.g., 3' terminal end) of ASt domain 2, or within an internucleotide linkage of ASt domain 2). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within domain 2 of ASt. In one embodiment, the ASGPR binding moiety is present at the 3' end within ASt domain 2. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of ASt domain 2. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within one or both of ASt domain 1 and ASt domain 2 (e.g., on a nucleobase of ASt domain 1 or ASt domain 2, at a terminal end (e.g., 5 'or 3' terminal end) of ASt domain 1 or ASt domain 2, or within an internucleotide linkage of ASt domain 1 or ASt domain 2). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within domain 1 or ASt of ASt. In one embodiment, the ASGPR binding moiety is present at the 5 'end within ASt domain 1 or [ L1] or at the 3' end within ASt domain 2. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of ASt domain 1 or ASt domain 2. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within the DH domain (e.g., on a nucleobase of the DH domain or within an internucleotide linkage of the DH domain). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within the DH domain. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of the DH domain. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is within the ACH domain (e.g., on a nucleobase of the ACH domain or within an internucleotide linkage of the ACH domain). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within the ACH domain. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of the ACH domain. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within the VL domain (e.g., on a nucleobase of the VL domain or within an internucleotide linkage of the VL domain). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within the VL domain. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of the VL domain. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety is present within the TH domain (e.g., on a nucleobase of the TH domain or within an internucleotide linkage of the TH domain). In one embodiment, the ASGPR binding moiety is present on a nucleobase of a nucleotide within the TH domain. In one embodiment, the ASGPR binding moiety is present within an internucleotide linkage of the TH domain. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety binds to a nucleobase within one or more domains selected from the group consisting of: [ ASt domain 1], [ DH domain ], [ ACH domain ], [ TH domain ], and/or [ ASt domain 2]. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], wherein the ASGPR binding moiety binds to an internucleotide linkage within one or more domains selected from the group consisting of: [ ASt domain 1], [ DH domain ], [ ACH domain ], [ TH domain ], and/or [ ASt domain 2]. In one embodiment, [ VL domain ] is optional. In one embodiment, [ L1] is optional.
In one embodiment, the TREM core fragment comprises the sequence of formula B: [ L1]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain ] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1, and the ASGPR binding moiety binds to nucleobases within nucleotides within one or both of ASt domain 1 and ASt domain 2. In one embodiment, y=0. In one embodiment, y=1.
In one embodiment, the TREM core fragment comprises the sequence of formula B: [ L1 ]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1, and the ASGPR binding moiety binds to a nucleobase within a nucleotide within the DH domain. In one embodiment, y=0. In one embodiment, y=1.
In one embodiment, the TREM core fragment comprises the sequence of formula B: [ L1 ]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1, and the ASGPR binding moiety binds to a nucleobase within a nucleotide within the ACH domain. In one embodiment, y=0. In one embodiment, y=1.
In one embodiment, the TREM core fragment comprises the sequence of formula B: [ L1 ]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain ] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1, and the ASGPR binding moiety binds to a nucleobase within a nucleotide within the TH domain. In one embodiment, y=0. In one embodiment, y=1.
In one embodiment, the TREM core fragment comprises the sequence of formula B: [ L1]] y - [ ASt domain 1] x -[L2] y - [ DH domain] y -[L3] y - [ ACH Domain] x - [ VL domain] y - [ TH domain] y -[L4] y - [ ASt domain 2] x Wherein: x=1 and y=0 or 1, and the ASGPR binding moiety binds to a nucleobase within one or more domains selected from the group consisting of: [ ASt Domain 1]][ DH domain][ ACH Domain ]][ TH domain]And/or [ ASt domain 2]. In one embodiment, y=0. In one embodiment, y=1.
In one embodiment, the TREM fragment comprises a portion of TREM, wherein the TREM comprises a sequence of formula a: [ L1] - [ ASt domain 1] - [ L2] - [ DH domain ] - [ L3] - [ ACH domain ] - [ VL domain ] - [ TH domain ] - [ L4] - [ ASt domain 2], and wherein the TREM fragment comprises: one, two, three or any combination of the following: half TREM (e.g., from a cut in the ACH domain, e.g., a cut in the anticodon sequence, e.g., 5 'half or 3' half); a 5 'fragment (e.g., a fragment comprising a 5' end, e.g., from cleavage in a DH domain or the ACH domain); a 3 'fragment (e.g., a fragment comprising a 3' end, e.g., from cleavage in the TH domain); or internal fragments (e.g., from cleavage of any of the ACH domain, DH domain, or TH domain). Exemplary TREM fragments include TREM halves (e.g., from a cut in ACHD, e.g., a 5'TREM half or a 3' TREM half), 5 'fragments (e.g., fragments comprising a 5' end, e.g., from a cut in DHD or ACHD), 3 'fragments (e.g., fragments comprising a 3' end of TREM, e.g., from a cut in THD), or internal fragments (e.g., from a cut in one or more of ACHD, DHD, or THD).
In one embodiment, the TREM, TREM core fragment, or TREM fragment can be loaded with amino acids (e.g., homologous amino acids); loading a non-homologous amino acid (e.g., erroneously loaded TREM (mTREM), or unloading an amino acid (e.g., unloaded TREM (urtrem)). In one embodiment, a TREM, TREM core fragment, or TREM fragment may be loaded with an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine.
In one embodiment, the TREM, TREM core fragment, or TREM fragment is a homologous TREM. In one embodiment, the TREM, TREM core fragment, or TREM fragment is a non-homologous TREM. In one embodiment, the TREM, TREM core fragment, or TREM fragment recognizes the codons provided in table 2 or table 3.
Table 2: codon list
Table 3: amino acids and corresponding codons
/>
In one embodiment, the TREM comprises a ribonucleic acid (RNA) sequence encoded by a deoxyribonucleic acid (DNA) sequence disclosed in Table 1 (e.g., any one of SEQ ID NOS: 1-451 disclosed in Table 1). In one embodiment, the TREM comprises an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM, TREM core fragment or TREM fragment comprises at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence disclosed in table 1, e.g., at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence encoded by any one of SEQ ID NOs 1-451 disclosed in table 1. In one embodiment, the TREM, TREM core fragment, or TREM fragment comprises at least 5, 10, 15, 20, 25, or 30 consecutive nucleotides of an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM, TREM core fragment, or TREM fragment comprises at least 5, 10, 15, 20, 25, or 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM core fragment or TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the RNA sequence encoded by the DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM core fragment or TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical RNA sequence to the RNA sequence encoded by the DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM core fragment or TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the RNA sequence encoded by a DNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM core fragment or TREM fragment comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence disclosed in table 1 (e.g., any one of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM core fragment or TREM fragment comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM core fragment or TREM fragment comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence having at least 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identity to a DNA sequence provided in table 1 (e.g., any one of SEQ ID NOs 1-451 disclosed in table 1).
In one embodiment, the TREM core fragment or TREM fragment comprises a sequence of ribonucleotides (rnt) between 10-90, rnt between 10-80, rnt between 10-70, rnt between 10-60, rnt between 10-50, rnt between 10-40, rnt between 10-30, rnt between 10-20, rnt between 20-90, rnt between 20-80, rnt between 20-70, rnt between 20-60, rnt between 20-50, rnt between 20-40, rnt between 30-90, rnt between 30-80, rnt between 30-70, rnt between 30-60, or between 30-50rnt in length between 10-90, between rnt between 10-60, between 20-80.
In any and all embodiments, a TREM described herein comprises formula I ZZZ Is a sequence of the sequence,
R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x1 -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein (i) ZZZ Represents any one of twenty amino acids; (ii) formula I corresponds to all species; (iii) x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27,x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15, x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271 x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=21, x=30, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271); and (iv) ASGPR binding moiety and R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 Nucleobase binding within one or more of (v) ASGPR binding moiety to R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72 Nucleobase binding within one or more of (a) is disclosed.
In any and all embodiments, a TREM described herein comprises formula II ZZZ Is a sequence of the sequence,
R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x1 -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein (i) ZZZ Represents any one of twenty amino acids; (II) formula II corresponds to a mammal; (iii) x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16) x=1-15, x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271); and (iv) ASGPR binding moiety and R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 Nucleobase binding within one or more of (v) ASGPR binding moiety to R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72 Nucleobase binding within one or more of (a) is disclosed.
At any pointAnd in all embodiments, the TREM described herein comprises formula IIII ZZZ Is a sequence of the sequence,
R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x1 -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein (i) ZZZ Represents any one of twenty amino acids; (ii) formula III corresponds to a human; (iii) x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16) x=1-15, x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17X=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271); and (iv) ASGPR binding moiety and R 0 -R 1- R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 Nucleobase binding within one or more of (v) ASGPR binding moiety to R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72 Nucleobase binding within one or more of (a) is disclosed.
Table 1.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
Asialoglycoprotein receptor binding moieties
The disclosure features TREMs comprising an asialoglycoprotein receptor (ASGPR) binding moiety. ASGPR is a C-type lectin expressed primarily on the sinusoidal surface of hepatocytes and includes a primary (48 kDa, ASGPR-1) subunit and a secondary (40 kDa, ASGPR-2) subunit. ASGPR is involved in the binding, internalization and subsequent clearance from the circulation of glycoproteins (e.g., antibodies) containing N-terminal galactose (Gal) residues or N-terminal N-acetylgalactosamine (GalNAc) residues. ASGPR has also been shown to be involved in the clearance of low density lipoproteins, fibronectin and certain immune cells, and certain viruses may utilize them to enter hepatocytes (see, e.g., yang J., et al (2006) J Viral hepatitis J.13:158-165 and Guy, CS et al (2011) Nat Rev immunol.S. 8:874-887).
ASGPR-binding moiety as described herein may refer to a structure comprising: (i) ASGPR carbohydrate and (ii) ASGPR linker (e.g., a linker linking carbohydrate and TREM). The term "carbohydrate" as used herein refers to a compound comprising one or more monosaccharide moieties, the monosaccharide moieties comprising at least 3 carbon atoms (e.g., arranged in a linear, branched, or cyclic structure), and oxygen, nitrogen, or sulfur atoms, or a fragment or variant of a monosaccharide moiety comprising at least 3 carbon atoms (e.g., arranged in a linear, branched, or cyclic structure), and oxygen, nitrogen, or sulfur atoms. Each monosaccharide moiety, or fragment or variant thereof, may be a tetraose, pentose, hexose, or heptose. Each monosaccharide moiety, or fragment or variant thereof, may be present in the form of an aldose, ketose, sugar alcohol, and where appropriate in the L or D form. Exemplary monosaccharide moieties may be amino sugars, N-acetyl amino sugars, imino sugars, deoxy sugars, or sugar acids. The carbohydrate may comprise an individual monosaccharide moiety, or may further comprise a disaccharide, oligosaccharide (e.g., trisaccharide, tetrasaccharide, pentose, hexasaccharide, heptasaccharide, octasaccharide), polysaccharide, or a combination thereof. Exemplary carbohydrates include ribose, arabinose, lyxose, xylose, deoxyribose, ribulose, xylulose, glucose, galactose, mannose, gulose, idose, talose, allose, altrose, allose, fructose, sorbose, tagatose, rhamnose, pneumase, isorhamnose, fucose, mannoheptulose, sedoheptulose, galactosamine, mannosamine, glucosamine, N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine, glucuronic acid, galacturonic acid, mannuronic acid, guluronic acid, tagatonic acid, fructonic acid, galactosamine acid, mannosamine acid, glucuronic acid, N-acetylglucosamine acid, N-acetylgalactonic acid, N-acetylmannosamine acid, maltose, lactose, sucrose, trehalose, gentiobiose, cellobiose, chitobiose, kojic acid, aspergillus niger, dextran, starch, dextran, and the like.
The carbohydrate may comprise one or more monosaccharide moieties linked by glycosidic linkages. In some embodiments, the glycosidic linkage comprises a 1- >2 glycosidic linkage, a 1- >3 glycosidic linkage, a 1- >4 glycosidic linkage, or a 1- >6 glycosidic linkage. In some embodiments, each glycosidic linkage may exist in an alpha or beta configuration. In one embodiment, one or more monosaccharide moieties are directly linked by glycosidic linkages or are separated by linkers.
In some embodiments, the ASGPR-binding moiety comprises galactose (Gal), galactosamine (GalNH) 2 ) Or an N-acetylgalactosamine (GalNAc) moiety, e.g., gal, galNH 2 Or GalNAc, or an analog thereof. In one embodiment, the ASGPR binding moiety comprises a GalNAc moiety (e.g., galNAc) A. The invention relates to a method for producing a fibre-reinforced plastic composite In one embodiment, the ASGPR binding moiety comprises a plurality of GalNAc moieties (e.g., galNAc), e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more GalNAc moieties (e.g., galNAc). In one embodiment, the ASGPR binding moiety comprises between 2 and 20 GalNAc moieties (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 GalNAc moieties). In one embodiment, the ASGPR binding moiety comprises between 2 and 10 GalNAc moieties (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 GalNAc moieties). In one embodiment, the ASGPR binding moiety comprises between 2 and 5 GalNAc moieties (e.g., 2, 3, 4, or 5 GalNAc moieties). In one embodiment, the ASGPR binding moiety comprises 2 GalNAc moieties. In one embodiment, the ASGPR binding moiety comprises 3 GalNAc moieties. In one embodiment, the ASGPR binding moiety comprises 4 GalNAc moieties. In one embodiment, the ASGPR portion comprises 5 GalNAc portions.
In some embodiments, the GalNAc moiety comprises a structure of formula (I):
or a salt thereof, wherein each of X and Y is independently O, N (R 7 ) Or S; r is R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution; or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring; r is R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution; r is R 7 Is hydrogen, alkyl, or C (O) -alkyl; r is R 8 And R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; r is R A Is hydrogen, or alkyl, alkenyl, alkynyl, and n is an integer between 0 and 6, wherein the structure of formula (I) may be attached to a linker or nucleobase within ASt of TREM.
In some embodiments, X is O. In some embodiments, Y is O. In some embodiments, R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ). In some embodiments, R 2a Is hydrogen. In some embodiments, R 2b Is C (O) CH 3 . In some embodiments, R 6a And R is 6b Is hydrogen. In some embodiments, n is 0, 1, 2, or 3. In some embodiments, n is 1, 2, or 3. In some embodiments, n is 1. In some embodiments, the GalNAc moiety is at R 2a Is connected to a linker or TREM. In some embodiments, the GalNAc moiety is at R 2b Is connected to a linker or TREM. In some embodiments, the GalNAc moiety is at R 3 Is connected to a linker or TREM. In some embodiments, the GalNAc moiety is at R 4 Is connected to a linker or TREM. In some embodiments, the GalNAc moiety is at R 5 Is connected to a linker or TREM. In some embodiments, the GalNAc moiety is at R 6a Or R is 6b Is connected to a linker or TREM. In some embodiments, galNAc moieties are present at multiple positions (e.g., R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a And R 6b At least two of (c) are attached to a linker or TREM.
In some embodiments, the GalNAc moiety comprises a structure of formula (I-a)
Or a salt thereof, wherein R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 3 、R 4 And R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution; or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring; and R is 8 Is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl, where "" "means a bond in any configuration and" "" means an attachment point to a TREM (e.g., a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence).
In some embodiments, R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ). In some embodiments, R 2a Is hydrogen. In some embodiments, R 2b Is C (O) CH 3 。
In some embodiments, the GalNAc moiety comprises a structure of formula (II):
or a salt thereof, wherein X is O, N (R 7 ) Or S; each of W or Y is independently O or C (R 10a )(R 10b ) Wherein one of W and Y is O; r is R 1 、R 3 、R 4 And R 5 Each of which is independentlyIs hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution; or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring; r is R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution; r is R 7 Is hydrogen, alkyl, or C (O) -alkyl; r is R 8 And R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; r is R 10a And R is 10b Independently is hydrogen, heteroalkyl, haloalkyl, or halo; and R is A Is hydrogen, or alkyl, alkenyl, alkynyl, wherein the structure of formula (I) can be attached to a TREM, e.g., a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence.
In some embodiments, the GalNAc moiety comprises a structure of formula (II-a):
or a salt thereof, wherein X is O, N (R 7 ) Or S; r is R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkyneA group, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution; or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring; r is R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution; r is R 7 Is hydrogen, alkyl, or C (O) -alkyl; r is R 8 And R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; and R is A Is hydrogen, or alkyl, alkenyl, alkynyl, wherein the structure of formula (I) can be attached to a TREM, e.g., a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence.
In some embodiments, the GalNAc moiety comprises a structure of formula (II-b):
or a salt thereof, wherein X is O, N (R 7 ) Or S; r is R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R is a number of 8 Substitution; or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring; r is R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution; r is R 7 Is hydrogen, alkyl, or C (O) -alkyl; r is R 8 And R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; and R is A Is hydrogen, or alkyl, alkenyl, alkynyl, wherein the structure of formula (I) can be attached to a TREM, e.g., a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence.
In some embodiments, the ASGPR-binding moiety comprises a structure of formula (III):
or a salt thereof, wherein R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a And R 6b Wherein "" "represents an attachment point to a branching point, another linker or TREM, such as a linker within a TREM sequence, a nucleobase, an internucleotide linkage or a terminal, and its sub-variables are as defined in formula (I), L is a linker, and n is an integer between 1 and 100.
In some embodiments, X is O. In some embodiments, R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ). In some embodiments, R 2a Is hydrogen. In some embodiments, R 2b Is C (O) CH 3 . In some embodiments, R 6a And R is 6b Is hydrogen. In some embodiments, n is an integer between 1 and 50. In some embodiments, n is an integer between 1 and 25. In some embodiments, n is an integer between 1 and 10. In some embodiments, n is an integer between 1 and 5. In some embodiments, n is 1, 2, 3, 4, or 5. In some embodiments, n is 1.
In one embodiment, L comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, L comprises an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, L is cleavable or non-cleavable.
The term "linker" as used herein refers to an organic moiety that connects two or more portions of a compound, for example, by covalent bonds. The linker may be linear or branched. In some embodiments, the linker comprises a heteroatom, such as a nitrogen, sulfur, oxygen, phosphorus, silicon, or boron atom. In some embodiments, the linker comprises a cyclic group (e.g., an aryl, heteroaryl, cycloalkyl, or heterocyclyl group). In some embodiments, the linker comprises an amide, ketone, ester, ether, thioester, thioether, thiol, hydroxyl, amine, cyano, nitro, azide, triazole, pyrroline, p-nitrophenyl, alkene, or alkyne group, among other functional groups. Any atom within the linker may be substituted or unsubstituted. In some embodiments, the linker comprises an arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclylalkyl, cycloalkyl, cycloalkenyl, alkylaryl alkyl, alkylaryl alkenyl, alkylaryl alkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylalkyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, or alkynylheteroaryl group. In some embodiments, the linker comprises a polyethylene glycol group (e.g., PEG1, PEG2, PEG3, PEG4, PEG5, PEG6, PEG7, PEG8, PEG10, PEG12, PEG14, PEG16, PEG18, PEG20, PEG24, PEG28, PEG32, PEG100, PEG200, PEG250, PEG500, PEG600, PEG700, PEG750, PEG800, PEG900, PEG1000, PEG2000, or PEG 3000). In some embodiments, L comprises a PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 group. In some embodiments, L comprises a plurality of PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups (e.g., 2, 3, 4, or 5 PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups). In some embodiments, L comprises a PEG2 group. In some embodiments, L comprises a plurality of PEG2 groups. In some embodiments, L comprises a PEG3 group. In some embodiments, L comprises a plurality of PEG3 groups. In some embodiments, L comprises a PEG4 group. In some embodiments, L comprises a plurality of PEG4 groups.
In some embodiments, the linker comprises between 1 and 1000 atoms (e.g., between 1 and 750 atoms, between 1 and 500 atoms, between 1 and 250 atoms, between 1 and 100 atoms, between 1 and 75 atoms, between 1 and 50 atoms, between 1 and 25 atoms, and between 1 and 10 atoms). In some embodiments, the linker comprises between 1 and 100 atoms. In some embodiments, the linker comprises between 1 and 50 atoms. In some embodiments, the linker comprises between 1 and 25 atoms.
In some embodiments, the linker is linear and comprises between 1 and 1000 atoms (e.g., between 1 and 750 atoms, between 1 and 500 atoms, between 1 and 250 atoms, between 1 and 100 atoms, between 1 and 75 atoms, between 1 and 50 atoms, between 1 and 25 atoms, and between 1 and 10 atoms). In some embodiments, the linker is linear and comprises between 1 and 100 atoms. In some embodiments, the linker is linear and comprises between 1 and 50 atoms. In some embodiments, the linker is linear and comprises between 1 and 25 atoms.
In some embodiments, the linker is branched and each branch contains between 1 and 1000 atoms (e.g., between 1 and 750 atoms, between 1 and 500 atoms, between 1 and 250 atoms, between 1 and 100 atoms, between 1 and 75 atoms, between 1 and 50 atoms, between 1 and 25 atoms, and between 1 and 10 atoms). In some embodiments, the linker is branched and each branch contains between 1 and 100 atoms. In some embodiments, the linker is branched and each branch contains between 1 and 50 atoms. In some embodiments, the linker is branched and each branch contains between 1 and 25 atoms.
In some embodiments, the ASGPR-binding moiety comprises a structure of formula (III-a):
or a salt thereof, wherein R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a And R 6b Each of which and its sub-variables are as defined in formula (I), L 1 And L 2 Each of M and n is independently an integer between 1 and 100, and M is a linker, wherein "" "represents the attachment point to a branching point, another linker or TREM, such as a linker, nucleobase, internucleotide linkage or terminal within a TREM sequence.
In some embodiments, X is O (e.g., X in each of a and B is O). In some embodiments, R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ) (e.g., R in each of A and B) 1 、R 3 、R 4 And R 5 Independently hydrogen or alkyl). In some embodiments, R 2a Is hydrogen (e.g., R in each of A and B 2a Hydrogen). In some embodiments, R 2b Is C (O) CH 3 (e.g., R in each of A and B) 2b Is C (O) CH 3 ). In some embodiments, R 6a And R is 6b Is hydrogen (e.g., R in each of A and B 6a And R is 6b Hydrogen). In some embodiments, each of m and n is independently an integer between 1 and 50. In some embodiments, each of m and n is independently an integer between 1 and 25. In some embodiments, each of m and n is independently an integer between 1 and 10. In some embodiments, each of m and n is independently an integer between 1 and 5. In some embodiments, each of m and n is independently 1, 2, 3, 4, or 5. In some embodiments, each of m and n is independently 1.
In one embodiment, L 1 And L 2 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, L 1 And L 2 Independently comprise an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, L 1 And L 2 Independently being cleavable or non-cleavable. In some embodiments, L 1 And L 2 Independently comprises a polyethylene glycol group (e.g., PEG1, PEG2, PEG3, PEG4, PEG5, PEG6, PEG7, PEG8, PEG10, PEG12, PEG14, PEG16, PEG18, PEG20, PEG24, PEG28, PEG32, PEG100, PEG200, PEG250, PEG500, PEG600, PEG700, PEG750, PEG800, PEG900, PEG1000, PEG2000, or PEG 3000). In some embodiments, L 1 And L 2 Independently comprising a PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 group. In some embodiments, L 1 And L 2 Independently comprising a plurality of PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups (e.g., 2, 3, 4, or 5 PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups). In some embodiments, L 1 And L 2 Each of (3)Comprising in situ a PEG2 group. In some embodiments, L 1 And L 2 Independently comprising a plurality of PEG2 groups. In some embodiments, L 1 And L 2 Independently comprising a PEG3 group. In some embodiments, L 1 And L 2 Independently comprising a plurality of PEG3 groups. In some embodiments, L 1 And L 2 Independently comprising a PEG4 group. In some embodiments, L 1 And L 2 Independently comprising a plurality of PEG4 groups.
In some embodiments, M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, M comprises an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, M is cleavable or non-cleavable.
In some embodiments, the ASGPR-binding moiety comprises a structure of formula (III-b):
or a salt thereof, wherein R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a And R 6b Each of which and its sub-variables are as defined in formula (I), L 1 、L 2 And L 3 Each of M, n, and o is independently a linker, each of M, n, and o is independently an integer between 1 and 100, and M is a linker, wherein "" "represents an attachment point to a branching point, another linker, or TREM, such as a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence.
In some embodiments, X is O (e.g., X in each of A, B, and C is O). In some embodiments, R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ) (e.g., A, B, and R in each of C) 1 、R 3 、R 4 And R 5 Independently hydrogen or alkyl). In some embodiments, R 2a Is hydrogen (e.g., R in each of A, B, and C) 2a Hydrogen). In some embodiments, R 2b Is C (O) CH 3 (e.g., A, B, and R in each of C) 2b Is C (O) CH 3 ). In some embodiments, R 6a And R is 6b Is hydrogen (e.g., A, B, and R in each of C) 6a And R is 6b Hydrogen). In some embodiments, each of m, n, and o is independently an integer between 1 and 50. In some embodiments, each of m, n, and o is independently an integer between 1 and 25. In some embodiments, each of m, n, and o is independently an integer between 1 and 10. In some embodiments, each of m, n, and o is independently an integer between 1 and 5. In some embodiments, each of m, n, and o is independently 1, 2, 3, 4, or 5. In some embodiments, each of m, n, and o is independently 1.
In one embodiment, L 1 、L 2 And L 3 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, L 1 、L 2 And L 3 Independently comprising an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, L 1 、L 2 And L 3 Independently being cleavable or non-cleavable. In one embodiment, L 1 And L 2 Independently being cleavable or non-cleavable. In some embodiments, L 1 、L 2 And L 3 Independently comprises a polyethylene glycol group (e.g., PEG1, PEG2, PEG3, PEG4, PEG5, PEG6, PEG7, PEG8, PEG10, PEG12, PEG14, PEG16, PEG18, PEG20, PEG24, PEG28, PEG32, PEG100, PEG200, PEG250, PEG500, PEG600, PEG700, PEG750, PEG800, PEG900, PEG1000, PEG2000, or PEG 3000). In some embodiments, L 1 、L 2 And L 3 Each of (a) is independent ofThe stand comprises a PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups (e.g., 2, 3, 4, or 5 PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups). In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG2 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG2 groups. In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG3 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG3 groups. In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG4 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG4 groups.
In some embodiments, M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, M comprises an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, M is cleavable or non-cleavable.
In some embodiments, the ASGPR-binding moiety comprises a structure of formula (III-c):
or a salt thereof, wherein R 2a 、R 2b 、R 3 、R 4 、R 5 Each of which and its sub-variables are as defined in formula (I), L 1 、L 2 And L 3 Each of (a) is independently a linker, and M is a linker, wherein +.>The representation and branching point are defined by a first point,additional linkers or TREMs, such as linkers within TREM sequences, nucleobases, internucleotide linkages or attachment points at the ends.
In some embodiments, R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 ). In some embodiments, R 2a Is hydrogen. In some embodiments, R 2b Is C (O) CH 3 。
In one embodiment, L 1 、L 2 And L 3 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, L 1 、L 2 And L 3 Independently comprising an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, L 1 、L 2 And L 3 Independently being cleavable or non-cleavable. In one embodiment, L 1 And L 2 Independently being cleavable or non-cleavable. In some embodiments, L 1 、L 2 And L 3 Independently comprises a polyethylene glycol group (e.g., PEG1, PEG2, PEG3, PEG4, PEG5, PEG6, PEG7, PEG8, PEG10, PEG12, PEG14, PEG16, PEG18, PEG20, PEG24, PEG28, PEG32, PEG100, PEG200, PEG250, PEG500, PEG600, PEG700, PEG750, PEG800, PEG900, PEG1000, PEG2000, or PEG 3000). In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups (e.g., 2, 3, 4, or 5 PEG1, PEG2, PEG3, PEG4, PEG5, or PEG6 groups). In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG2 group. In some embodiments, L 1 、L 2 And L 3 Each of which independently comprises a plurality of PEG2 groups. In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG3 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG3 groups. In some embodiments, L 1 、L 2 And L 3 Independently comprising a PEG4 group. In some embodiments, L 1 、L 2 And L 3 Independently comprising a plurality of PEG4 groups.
In some embodiments, M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group. In one embodiment, M comprises an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group. In one embodiment, M is cleavable or non-cleavable.
In some embodiments, the ASGPR-binding moiety comprises a compound selected from the group consisting of:
/>
/>
/>
/>
In some embodiments, the ASGPR binding moiety is compound (X-i). In some embodiments, the ASGPR binding moiety is compound (X-ii). In some embodiments, the ASGPR-binding moiety is compound (X-iii). In some embodiments, the ASGPR binding moiety is compound (X-iv). In some embodiments, the ASGPR binding moiety is compound (X-v). In some embodiments, the ASGPR binding moiety is compound (X-vi). In some embodiments, the ASGPR binding moiety is compound (X-vii). In some embodiments, the ASGPR binding moiety is compound (X-viii). In some embodiments, the ASGPR binding moiety is compound (X-ix). In some embodiments, the ASGPR binding moiety is compound (X-X). In some embodiments, the ASGPR binding moiety is a compound (X-xi). In some embodiments, the ASGPR binding moiety is a compound (X-xii). In some embodiments, the ASGPR binding moiety is a compound (X-xiii). In some embodiments, the ASGPR binding moiety is a compound (X-xiv). In some embodiments, the ASGPR binding moiety is a compound (X-xv). In some embodiments, the ASGPR binding moiety is a compound (X-xvi). In some embodiments, the ASGPR binding moiety is compound (X-xvii). In some embodiments, the ASGPR binding moiety is compound (X-xviii). In some embodiments, the ASGPR binding moiety is a compound (X-xix). In some embodiments, the ASGPR binding moiety is compound (X-xx). In some embodiments, the ASGPR binding moiety is compound (X-xxi). In some embodiments, the ASGPR binding moiety is compound (X-xxii). In some embodiments, the ASGPR binding moiety is compound (X-xxiii). In some embodiments, the ASGPR binding moiety is a compound selected from the group consisting of compounds (X-i), (X-xxii), and (X-xxii).
In some embodiments, the ASGPR binding moiety comprises a linker comprising a cyclic moiety, such as a pyrroline ring. In one embodiment, the ASGPR-binding moiety comprises a structure of formula (CII):
or a salt thereof, wherein E is absent or is C (O), C (O) O, C (O) NH, C (S) NH, SO 2 Or SO 2 NH；R 11 、R 12 、R 13 、R 14 、R 15 、R 16 、R 17 And R 18 At each timeEach occurrence is independently H, -CH 2 OR a OR b ；R a And R is b Each occurrence is independently hydrogen, a hydroxy protecting group, an optionally substituted alkyl group, an optionally substituted aryl group, an optionally substituted cycloalkyl group, an optionally substituted aralkyl group, an optionally substituted alkenyl group, an optionally substituted heteroaryl group, polyethylene glycol (PEG), a phosphate, a diphosphate, a triphosphate, a phosphonate, a thiophosphonate, a dithiophosphonate, a thiophosphate, a dithiophosphate, a thiophosphate, a phosphodiester, a phosphotriester, an activated phosphate group, an activated phosphite group, a phosphoramidite, a solid support, P (Z 1 )(Z 2 ) -O-nucleosides, -P (Z) 1 )(Z 2 ) -O-oligonucleotide, -P (Z) 1 ) (O-linker-R) L ) -O-nucleosides, or-P (Z) 1 ) (O-linker-R) L ) -O-oligonucleotides; r is R 30 At each occurrence independently is-linker-R L Or R is 31 ；R L Is hydrogen or a ligand; r is R 31 is-C (O) CH (N (R) 32 ) 2 )(CH 2 ) h N(R 32 ) 2 ；R 32 At each occurrence independently H, -R L -linker-R L Or R is 31 ；Z 1 Independently at each occurrence is O or S; z is Z 2 Each occurrence is independently O, S, N (alkyl) or optionally substituted alkyl; and h is independently at each occurrence 1-20.
In some embodiments, the compound having formula (CII) is selected from:
/>
in some embodiments, the ASGPR-binding moiety is a compound or substructure disclosed in U.S. patent No. 8,106,022, which is incorporated herein by reference in its entirety.
In some embodiments, the ASGPR binding moiety is a compound (CII-i). In some embodiments, the ASGPR binding moiety is a compound (CII-ii). In some embodiments, the ASGPR binding moiety is a compound (CII-iii). In some embodiments, the ASGPR binding moiety is a compound (CII-iv). In some embodiments, the ASGPR binding moiety is a compound (CII-v). In some embodiments, the ASGPR binding moiety is a compound (CII-vi).
In some embodiments, the ASGPR binding moiety is a compound having the formula (C-1), (C-2), (C-3), or (C4):
or a pharmaceutically acceptable salt thereof, wherein: n is 1, 2, or 3; w is absent or is a peptide; l is- (T-Q-T-Q) m -, wherein each T is independently absent or (C 1 -C 10 ) Alkylene group (C) 2 -C 10 ) Alkenylene, or (C) 2 -C 10 ) Alkynylene wherein one or more carbon groups of said T may each independently be selected from the group consisting of-O-, -S-, and-N (R 4 ) -heteroatom groups substituted, wherein the heteroatom groups are separated by at least 2 carbon atoms, and wherein alkylene, alkenylene, and alkynylene groups may each be independently substituted with one or more halo atoms; each Q is independently absent or is C (O), C (O) -NR 4 ，NR 4 -C(O)，O-C(O)-NR 4 ，NR 4 -C(O)-O，-CH 2 -, heteroaryl, or selected from O, S, S-S, S (O), S (O) 2 And NR 4 Wherein at least two carbon atoms form a heteroatom group O, S, S-S, S (O), S (O) 2 And NR 4 Separate from any other heteroatom groups; each R 4 independently-H, - (C) 1 -C 20 ) Alkyl, or (C) 3 -C 8 ) Cycloalkyl, wherein one to six-CH's of alkyl or cycloalkyl groups separated by at least two carbon atoms 2 The radical may be replaced by-O-, -S-, or-N (R 4 ) -substitution, and alkylOf (C) CH 3 Can each independently be selected from the group consisting of-N (R 4 ) 2 、-OR 4 and-S (R) 4 ) Wherein the heteroatom groups are separated by at least 2 carbon atoms; and wherein alkyl and cycloalkyl groups may be substituted with halogen atoms; and m is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40.
In some embodiments, the ASGPR binding moiety is compound (C-1). In some embodiments, the ASGPR binding moiety is compound (C-2). In some embodiments, the ASGPR binding moiety is compound (C-3). In some embodiments, the ASGPR binding moiety is compound (C-4).
In some embodiments, the compound having formula (C-1), (C-2), (C-3), or (C4) comprises:
wherein n' is 1 or 2 or a pharmaceutically acceptable salt thereof.
In some embodiments, the ASGPR binding moiety is a compound having formula (E):
or a pharmaceutically acceptable salt thereof, wherein: n is i, 2 or 3; w is absent or is a peptide; l is- (T-Q-T-Q) m -, wherein each T is independently absent or (C 1 -C 10 ) Alkylene group (C) 2 -C 10 ) Alkenylene, or (C) 2 -C 10 ) Alkynylene wherein one or more carbon groups of said T may each independently be selected from the group consisting of-O-, -S-, and-N (R 4 ) -heteroatom groups substituted wherein these heteroatom groups are separated by at least 2 carbon atoms, wherein the alkylene, alkenylene, alkynylene groups may each independently be substituted by one or moreHalo atom substitution; each Q is independently absent or C (O), C (O) -R 4 ，R 4 -C(O)，O-C(O)-R 4 ，R 4 -C(O)-O，-CH 2 -, heteroaryl, or selected from O, S, S-S, S (O), S (O) 2 And NR 4 Wherein at least two carbon atoms form a heteroatom group O, S, S-S, S (O), S (O) 2 And NR 4 Separate from any other heteroatom groups; each R 4 independently-H, - (C) 1 -C 20 ) Alkyl, - (C) 1 -C 20 ) Alkenyl, - (C) 2 -C 20 ) Alkynyl, or (C) 3 -C 6 ) Cycloalkyl, wherein one to six-CH's of alkyl or cycloalkyl groups separated by at least two carbon atoms 2 The radical may be replaced by-O-, -S-, or-N (R 4 ) -substitution, and-CH of alkyl 3 Can be selected from-N (R) 4 ) 2 、-OR 4 and-S (R) 4 ) Wherein the heteroatom groups are separated by at least 2 carbon atoms; and wherein alkyl, alkenyl, alkynyl, and cycloalkyl groups may be substituted with halo atoms; each m is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40.
In some embodiments, the compound having formula (E) is selected from:
or a pharmaceutically acceptable salt thereof, and Y is as defined in formula (E).
In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.
In some embodiments of the compounds having formula (E), the compounds are:
/>
Or a pharmaceutically acceptable salt thereof.
In some embodiments, the ASGPR binding moiety is a compound or substructure disclosed in WO 2017/083368, which is incorporated herein by reference in its entirety.
In other embodiments, the ASGPR binding moiety is selected from the group consisting of:
/>
wherein one of X or Y is a branching point, a linker or a TREM, such as a linker, a nucleobase, an internucleotide linkage or a terminal within a TREM sequence, and the other of X and Y is hydrogen.
In one embodiment, the ASGPR-binding moiety comprises a structure of formula (XII-a):
in one embodiment, the ASGPR binding moiety is disclosed in Nucleic Acids](2016) 5:e317 or compounds or substructures in WO 2015/042447, each of which is incorporated by reference in its entiretyIncorporated herein.
In some embodiments, the ASGPR-binding moiety comprises a structure of formula (V-a):
wherein n is an integer from 1 to 20. In some embodiments, the compound having formula (V-a) is selected from: />
Wherein Z is an oligomeric compound, e.g., a linker or nucleobase within ASt of TREM.
In another embodiment, the ASGPR-binding moiety comprises a structure of formula (V-b):
where a is O or S, a' is O, S, or NH, and Z is an oligomeric compound, e.g., a linker or TREM, e.g., a linker, nucleobase, internucleotide linkage, or terminal within a TREM sequence.
In some embodiments, the ASGPR-binding portion comprises
In some embodiments, the ASGPR binding moiety is selected from the group consisting of:
in one embodiment, the ASGPR binding moiety is a compound or substructure disclosed in WO 2017/156012, which is incorporated herein by reference in its entirety.
In some embodiments, the hydroxyl groups within the ASGPR binding moiety are protected, e.g., by an acetyl or acetonate moiety. In some embodiments, the hydroxyl groups within the ASGPR binding moiety are protected by acetyl groups. In some embodiments, the hydroxyl groups within the ASGPR binding moiety are protected by acetonide groups. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more hydroxyl groups within the ASGPR binding moiety may be protected, e.g., by an acetyl group or an acetone group. In some embodiments, all hydroxyl groups in the ASGPR binding moiety are protected.
Exemplary TREMs comprising ASGPR binding moieties may have a binding affinity for ASGPR between 0.01nM and 100 mM. In some embodiments, TREM comprising an ASGPR binding moiety has a binding affinity of less than 10mM, e.g., 7.5mM, 5mM, 2.5mM, 1mM, 0.75mM, 0.5mM, 0.25mM, 0.1mM, 75nM, 50nM, 25nM, 10nM, 5nM, or less.
Exemplary TREMs comprising ASGPR binding moieties can be internalized by cells (e.g., hepatocytes). In some embodiments, a TREM comprising an ASGPR binding moiety has increased cellular uptake compared to a TREM comprising no ASGPR binding moiety. For example, a TREM comprising an ASGPR binding moiety can be internalized by a cell that is more than 1.1, 1.2, 1.3, 1.4, 1.5, 1.75, 2, 3, 4, 5, 6, 7,8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100-fold or more internalized by a TREM that does not comprise an ASGPR binding moiety.
Additional exemplary ASGPR sections are described in further detail below: U.S. patent No. 8,828,956;9,867,882;10,450,568;10,808,246; U.S. patent publication No. 2015/0243133; 2015/0203843; and 2012/0095200; and PCT publication nos. WO 2013/166155, 2012/030683, and 2013/166121, each of which is incorporated herein by reference in its entirety.
ASGPR joint
The ASGPR binding portion comprises at least one linker linking the carbohydrate to TREM. In some embodiments, TREM is linked to one or more carbohydrates (e.g., galNAc moieties, e.g., galNAc moieties having formula (I)) through a linker as described herein. The linker may be monovalent or multivalent, e.g., divalent, trivalent, tetravalent, or pentavalent. In some embodiments, the linker comprises a structure selected from the group consisting of:
Wherein q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C independently represent from 0 to 20 at each occurrence, and wherein the repeating units may be the same or different; p (P) 2A 、P 2B 、P 3A 、P 3B 、P 4A 、P 4B 、P 5A 、P 5B 、P 5C 、T 2A 、T 2B 、T 3A 、T 3B 、T 4A 、T 4B 、T 4A 、T 5B 、T 5C Each occurrence is independently: absence, CO, NH, O, S, OC (O), NHC (O), CH 2 、CH 2 NH or CH 2 O；Q 2A 、Q 2B 、Q 3A 、Q 3B 、Q 4A 、Q 4B 、Q 5A 、Q 5B 、Q 5C Independently at each occurrence is: non-existent, alkylene, substituted alkylene, wherein one or more methylene groups may be replaced by O, S, S (O), SO 2 、N(R N ) One or more of C (R')=c (R), c≡c, or C (O) are spaced or capped; r is R 2A 、R 2B 、R 3A 、R 3B 、R 4A 、R 4B 、R 5A 、R 5B 、R 5C Each occurrence is independently: absence of NH, O, S, CH 2 、C(O)O、C(O)NH、NHCH(R a )C(O)、-C(O)-CH(R a )-NH-、CO、CH＝N-O、/>Or a heterocyclic group;
L 2A 、L 2B 、L 3A 、L 3B 、L 4A 、L 4B 、L 5A 、L 5B and L 5C Represents a ligand; that is, each occurrence is independently a monosaccharide (e.g., galNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R is a Is H or an amino acid side chain.
In some embodiments, the linker comprises:
wherein L is 5A 、L 5B And L 5C Represents a monosaccharide, such as a GalNAc derivative, for example, as described herein.
The cleavable linking group is a group that is sufficiently stable extracellular but is cleaved upon entry into the target cell to release the two moieties held together by the linker. In preferred embodiments, the cleavable linking group cleaves at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold or more, or at least about 100-fold faster in a target cell or under a first reference condition (e.g., a mimetic or representative of an intracellular condition may be selected) than in a subject's blood or under a second reference condition (e.g., a mimetic or representative of a condition found in blood or serum).
Cleavable linking groups are susceptible to cleavage by a cleavage agent (e.g., pH, redox potential, or the presence of a degrading molecule). Generally, cleavage agents are more prevalent in cells than in serum or blood, or are found at higher levels or activities. Examples of such degradation agents include: redox agents selected for a particular substrate or not, including, for example, oxidases or reductases or reducing agents present in cells that can degrade redox cleavable linkers by reduction, e.g., thiols; an esterase; endosomes or agents that can create an acidic environment, for example, those that result in a pH of 5 or less; enzymes that hydrolyze or degrade acid-cleavable linkers can be used as general acids, peptidases (which may be substrate specific) and phosphatases.
Cleavable linking groups (e.g., disulfide bonds) may be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a higher acidic pH in the range of 5.5-6.0, whereas lysosomes have an even higher acidic pH, around 5.0. Some linkers will have cleavable linking groups that are cleaved at a preferred pH to release the cationic lipid from the intracellular ligand or into a desired compartment of the cell.
The linker may include a cleavable linking group that may be cleaved by a specific enzyme. The type of cleavable linking group incorporated into the linker may depend on the cell to be targeted. For example, a liver-targeting ligand may be linked to a cationic lipid through a linker comprising an ester group. Hepatocytes are rich in esterases and therefore the efficiency of cleavage of the linker in hepatocytes will be higher than in cell types not rich in esterases. Other esterase-enriched cell types include lung cells, kidney cortical cells and testis cells. When targeting peptidase-rich cell types (such as hepatocytes and synovial cells), linkers containing peptide bonds can be used.
In general, the suitability of a candidate cleavable linking group can be assessed by testing the ability of the degrading agent (or condition) to cleave the candidate linking group. It is also desirable to test candidate cleavable linkers for their ability to resist cleavage in blood or upon contact with other non-target tissues. Thus, the relative sensitivity to cleavage between the first and second conditions may be determined, wherein the first condition is selected to indicate cleavage in a target cell and the second condition is selected to indicate cleavage in other tissue or biological fluid (e.g., blood or serum). The assessment can be performed in a cell-free system, cells, cell cultures, organ or tissue cultures, or whole animals. It may be useful to perform a preliminary assessment under cell-free or culture conditions and to confirm by further assessment in whole animals. In preferred embodiments, the useful candidate compound cleaves at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or in an in vitro condition selected to mimic an intracellular condition) as compared to in blood or serum (or in an in vitro condition selected to mimic an extracellular condition).
In one embodiment, the cleavable linking group is a redox cleavable linking group that cleaves upon reduction or oxidation. An example of a reducible cleavable linking group is a disulfide linking group (-S-S-). To determine whether a candidate cleavable linking group is a suitable "reducible cleavable linking group," or whether it is suitable for use with a particular TREM moiety and a particular targeting agent, for example, reference may be made to the methods described herein. For example, candidates may be evaluated by incubation with Dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rates observed in cells (e.g., target cells). Candidates may also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, the candidate compound cleaves up to about 10% in blood. In other embodiments, the useful candidate compound degrades at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or in an in vitro condition selected to mimic an intracellular condition) as compared to in the blood (or in an in vitro condition selected to mimic an extracellular condition). The cleavage rate of the candidate compound can be determined using standard enzymatic kinetic assays under conditions selected to mimic the intracellular media and compared to conditions selected to mimic the extracellular media.
In another embodiment, the cleavable linker comprises a phosphate-based cleavable linking group. The phosphate-based cleavable linking group is cleaved by an agent that degrades or hydrolyzes the phosphate group. Examples of agents that cleave phosphate groups in cells are enzymes in cells, such as phosphatases. -O-P (S) (SRk) -O-, O-and S-groups-S-P (O) (ORk) -O-, -O-P (S) (SRk) -O-, -S-P (O) (ORk) -O-, and-O-P (O) (ORk) -S-, -S-P (O) (ORk) -S-, S-and S-groups-O-P (S) (ORk) -S-, -S-P (S) (ORk) -O-, -O-P (O) (Rk) -O-, -O-P (S) (Rk) -O-, -S-P (O) (Rk) -O-, -S-P (S) (Rk) -O-, -S-P (O) (Rk) -S-, -O-P (S) (Rk) -S-. -S-P (O) (OH) -O- -O-P (O) (OH) -S-, -S-P (O) (OH) -O-, -O-P (O) (OH) -S-, and-S-P (O) (OH) -S-, -O-P (S) (OH) -S-, -S-P (S) (OH) -O-, -O-P (O) (H) -O-, -O-P (S) (H) -O-, -S-P (O) (H) -O, -S-P (S) (H) -O-, -S-P (O) (H) -S-, -O-P (S) (H) -S-. A preferred embodiment is-O-P (O) (OH) -O-. These candidates can be evaluated using methods similar to those described above.
In another embodiment, the cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that cleaves under acidic conditions. In preferred embodiments, the acid-cleavable linking group is cleaved, or cleaved by an agent (e.g., an enzyme that can act as a general acid), in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or less). In cells, specific low pH organelles (such as endosomes and lysosomes) can provide a cleavage environment for acid cleavable linkers. Examples of acid cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid cleavable group may have the general formula-c=nn-, C (O) O, or-OC (O). Preferred examples are when the carbon attached to the oxygen of the ester (alkoxy) is an aryl group, a substituted alkyl group or a tertiary alkyl group such as dimethylpentyl or tertiary butyl. These candidates can be evaluated using methods similar to those described above.
In another embodiment, the cleavable linker comprises an ester-based cleavable linking group. The ester-based cleavable linking group is cleaved by enzymes in the cell (e.g., esterases and amidases). Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. The ester cleavable linking group has the general formula-C (O) O-, or-OC (O) -. These candidates can be evaluated using methods similar to those described above.
In yet another embodiment, the cleavable linker comprises a peptide-based cleavable linking group. The peptide-based cleavable linking group is cleaved by enzymes (e.g., peptidases and proteases) in the cell. The peptide-based cleavable linking group is a peptide bond formed between amino acids to produce oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not include an amide group (-C (O) NH-). The amide groups may be formed between any alkylene, alkenylene or alkynylene groups. Peptide bonds are the specific type of amide bond formed between amino acids to produce peptides and proteins. The peptide-based cleavage groups are generally limited to creating peptide bonds (i.e., amide bonds) between the amino acids of the peptide and protein, and do not include the entire amide functionality. The peptide-based cleavable linking group has the general formula-NHCHRAC (O) NHCHRBC (O) - (SEQ ID NO: 13) wherein RA and RB are R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.
The ASGPR binding portion can bind to any nucleotide position within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2). In one embodiment, the ASGPR moiety binds to a nucleobase, terminal, or internucleotide linkage within TREM. In one embodiment, the ASGPR moiety binds to a nucleobase within TREM. In one embodiment, the ASGPR binding moiety binds to any adenine nucleobase within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2). In one embodiment, the ASGPR binding moiety binds to any cytosine nucleobase within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2). In one embodiment, it binds to any guanosine nucleobase within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2). In one embodiment, it binds to any uracil nucleobase within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2). In one embodiment, it binds to any thymine nucleobase within the domain of TREM (ASt domain 1, DH domain, ACH domain, VL domain, TH domain, and/or ASt domain 2).
In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 1 (e.g., within a nucleobase present at TREM position 1). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 2 (e.g., within a nucleobase present at TREM position 2). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 3 (e.g., within a nucleobase present at TREM position 3). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 4 (e.g., within a nucleobase present at TREM position 4). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 5 (e.g., within a nucleobase present at TREM position 5). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 6 (e.g., within a nucleobase present at TREM position 6). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 7 (e.g., within a nucleobase present at TREM position 7). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 8 (e.g., within a nucleobase present at TREM position 8). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 9 (e.g., within a nucleobase present at TREM position 9).
In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 10 (e.g., within a nucleobase present at TREM position 10). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 11 (e.g., within a nucleobase present at TREM position 11). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 12 (e.g., within a nucleobase present at TREM position 12). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 13 (e.g., within a nucleobase present at TREM position 13). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 14 (e.g., within a nucleobase present at TREM position 14). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 15 (e.g., within a nucleobase present at TREM position 15). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 16 (e.g., within a nucleobase present at TREM position 16). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 17 (e.g., within a nucleobase present at TREM position 17). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 18 (e.g., within a nucleobase present at TREM position 18). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 19 (e.g., within a nucleobase present at TREM position 19). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 20 (e.g., within a nucleobase present at TREM position 20). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 21 (e.g., within a nucleobase present at TREM position 21). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 22 (e.g., within a nucleobase present at TREM position 22). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 23 (e.g., within a nucleobase present at TREM position 23). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 24 (e.g., within a nucleobase present at TREM position 24). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 25 (e.g., within a nucleobase present at TREM position 25). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 26 (e.g., within a nucleobase present at TREM position 26).
In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 27 (e.g., within a nucleobase present at TREM position 27). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 28 (e.g., within a nucleobase present at TREM position 28). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 29 (e.g., within a nucleobase present at TREM position 29). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 30 (e.g., within a nucleobase present at TREM position 30). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 31 (e.g., within a nucleobase present at TREM position 31). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 32 (e.g., within a nucleobase present at TREM position 32). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 33 (e.g., within a nucleobase present at TREM position 33). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 34 (e.g., within a nucleobase present at TREM position 34). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 35 (e.g., within a nucleobase present at TREM position 35). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 36 (e.g., within a nucleobase present at TREM position 36). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 37 (e.g., within a nucleobase present at TREM position 37). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM location 38 (e.g., within a nucleobase present at TREM location 38). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 39 (e.g., within a nucleobase present at TREM position 39). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 40 (e.g., within a nucleobase present at TREM position 40). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 41 (e.g., within a nucleobase present at TREM position 41). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 42 (e.g., within a nucleobase present at TREM position 42). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 43 (e.g., within a nucleobase present at TREM position 43).
In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 44 (e.g., within a nucleobase present at TREM position 44). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 45 (e.g., within a nucleobase present at TREM position 45). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 46 (e.g., within a nucleobase present at TREM position 46). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 47 (e.g., within a nucleobase present at TREM position 47). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 48 (e.g., within a nucleobase present at TREM position 48). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 49 (e.g., within a nucleobase present at TREM position 49).
In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 50 (e.g., within a nucleobase present at TREM position 50). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 51 (e.g., within a nucleobase present at TREM position 51). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 52 (e.g., within a nucleobase present at TREM position 52). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 53 (e.g., within a nucleobase present at TREM position 53). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 54 (e.g., within a nucleobase present at TREM position 54). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 55 (e.g., within a nucleobase present at TREM position 55). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 56 (e.g., within a nucleobase present at TREM position 56). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 57 (e.g., within a nucleobase present at TREM position 57). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 58 (e.g., within a nucleobase present at TREM position 58). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 59 (e.g., within a nucleobase present at TREM position 59). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 60 (e.g., within a nucleobase present at TREM position 60). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 61 (e.g., within a nucleobase present at TREM position 61). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 62 (e.g., within a nucleobase present at TREM position 62). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 63 (e.g., within a nucleobase present at TREM position 63). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 64 (e.g., within a nucleobase present at TREM position 64).
In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 65 (e.g., within a nucleobase present at TREM position 65). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 66 (e.g., within a nucleobase present at TREM position 66). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 67 (e.g., within a nucleobase present at TREM position 67). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 68 (e.g., within a nucleobase present at TREM position 68). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 69 (e.g., within a nucleobase present at TREM position 69). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 70 (e.g., within a nucleobase present at TREM position 70). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 71 (e.g., within a nucleobase present at TREM position 71). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 72 (e.g., within a nucleobase present at TREM position 72). In one embodiment, the ASGPR binding moiety is present within a TREM at TREM position 73 (e.g., within a nucleobase present at TREM position 73). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 74 (e.g., within a nucleobase present at TREM position 74). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 75 (e.g., within a nucleobase present at TREM position 75). In one embodiment, the ASGPR binding moiety is present within the TREM at TREM position 76 (e.g., within a nucleobase present at TREM position 76).
In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 1. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 2. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 3. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 4. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 5. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 6. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 7. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 8. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 9.
In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 10. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 11. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 12. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 13. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 14. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 15. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 16. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 17. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 18. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 19. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 20. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 21. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 22. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 23. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 24. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 25. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 26.
In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 27. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 28. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 29. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 30. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 31. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 32. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 33. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 34. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 35. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 36. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 37. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 38. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 39. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 40. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 41. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 42. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 43.
In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 44. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 45. In one embodiment, the ASGPR binding moiety binds to a nucleobase (G) at TREM position 46. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 47. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 48. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 49.
In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 50. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 51. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 52. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 53. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 54. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 55. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 56. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 57. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 58. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 59. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 60. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 61. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 62. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 63. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 64.
In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 76. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 75. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 74. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 73. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 72. In one embodiment, the ASGPR binding moiety binds to a nucleobase (U) at TREM position 71. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 70. In one embodiment, the ASGPR binding moiety binds to nucleobase (a) at TREM position 69. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 68. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 67. In one embodiment, the ASGPR binding moiety binds to nucleobase (C) at TREM position 66. In one embodiment, the ASGPR binding moiety binds to nucleobase (G) at TREM position 65.
In one embodiment, the TREM comprising an ASGPR binding portion comprises a ribonucleic acid (RNA) sequence encoded by a deoxyribonucleic acid (DNA) sequence disclosed in Table 1 (e.g., any one of SEQ ID NOS: 1-451 as disclosed in Table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence disclosed in table 1, e.g., at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence encoded by any one of SEQ ID NOs 1-451 disclosed in table 1. In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the RNA sequence encoded by the DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical RNA sequence to the RNA sequence encoded by the DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of an RNA sequence encoded by a DNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1).
In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence disclosed in table 1 (e.g., any one of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an RNA sequence encoded by a DNA sequence provided in table 1 (e.g., any of SEQ ID NOs: 1-451 disclosed in table 1). In one embodiment, a TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence having at least 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a DNA sequence provided in table 1 (e.g., any one of SEQ ID NOs 1-451 disclosed in table 1).
In one embodiment, the TREM comprising an ASGPR binding portion comprises a ribonucleic acid (RNA) sequence encoded by a deoxyribonucleic acid (DNA) sequence disclosed in Table 4 (e.g., any one of SEQ ID NOS: 452-561 as disclosed in Table 4). In one embodiment, the TREM comprising an ASGPR binding portion comprises an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to an RNA sequence encoded by a DNA sequence provided in table 4 (e.g., any of SEQ ID NOs 452-561 disclosed in table 4). In one embodiment, a TREM comprising an ASGPR binding portion comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in table 4 (e.g., any of SEQ ID NOs 452-561 disclosed in table 4).
In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence provided in table 4 (e.g., any one of SEQ ID NOs: 452-561 disclosed in table 4). In one embodiment, the TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of an RNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an RNA sequence encoded by a DNA sequence provided in table 4 (e.g., any of SEQ ID NOs 452-561 disclosed in table 4). In one embodiment, a TREM comprising an ASGPR binding portion comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of an RNA sequence encoded by a DNA sequence having at least 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a DNA sequence provided in table 4 (e.g., any one of SEQ ID NOs 452-561 disclosed in table 4).
In one embodiment, the TREM comprising an ASGPR binding moiety is a compound provided in table 12, e.g., any of compound numbers 99-131. In one embodiment, TREM comprising an ASGPR binding moiety is compound 99. In one embodiment, TREM comprising an ASGPR binding moiety is compound 100. In one embodiment, TREM comprising an ASGPR binding moiety is compound 101. In one embodiment, TREM comprising an ASGPR binding moiety is compound 102. In one embodiment, TREM comprising an ASGPR binding moiety is compound 103. In one embodiment, TREM comprising an ASGPR binding moiety is compound 104. In one embodiment, TREM comprising an ASGPR binding moiety is compound 105. In one embodiment, TREM comprising an ASGPR binding moiety is compound 106. In one embodiment, TREM comprising an ASGPR binding moiety is compound 107. In one embodiment, TREM comprising an ASGPR binding moiety is compound 108. In one embodiment, TREM comprising an ASGPR binding moiety is compound 109. In one embodiment, TREM comprising an ASGPR binding moiety is compound 110. In one embodiment, TREM comprising an ASGPR binding moiety is compound 111. In one embodiment, TREM comprising an ASGPR binding moiety is compound 112. In one embodiment, TREM comprising an ASGPR binding moiety is compound 113. In one embodiment, TREM comprising an ASGPR binding moiety is compound 114. In one embodiment, TREM comprising an ASGPR binding moiety is compound 115. In one embodiment, TREM comprising an ASGPR binding moiety is compound 116. In one embodiment, TREM comprising an ASGPR binding moiety is compound 117. In one embodiment, TREM comprising an ASGPR binding moiety is compound 118. In one embodiment, TREM comprising an ASGPR binding moiety is compound 119. In one embodiment, TREM comprising an ASGPR binding moiety is compound 120. In one embodiment, TREM comprising an ASGPR binding moiety is compound 121. In one embodiment, TREM comprising an ASGPR binding moiety is compound 122. In one embodiment, TREM comprising an ASGPR binding moiety is compound 123. In one embodiment, TREM comprising an ASGPR binding moiety is compound 124. In one embodiment, TREM comprising an ASGPR binding moiety is compound 125. In one embodiment, TREM comprising an ASGPR binding moiety is compound 126. In one embodiment, TREM comprising an ASGPR binding moiety is compound 127. In one embodiment, TREM comprising an ASGPR binding moiety is compound 128. In one embodiment, TREM comprising an ASGPR binding moiety is compound 129. In one embodiment, TREM comprising an ASGPR binding moiety is compound 130. In one embodiment, TREM comprising an ASGPR binding moiety is compound 131.
In one embodiment, a TREM comprising an ASGPR binding moiety comprises a compound having an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence of a TREM provided in table 12 (e.g., any of compounds 100-131 provided in table 12). In one embodiment, a TREM comprising an ASGPR binding moiety comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of a TREM provided in table 12 (e.g., any of compounds 100-131 disclosed in table 12). In one embodiment, a TREM comprising an ASGPR binding moiety comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of a TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a TREM provided in table 12 (e.g., any of compounds 100-131 disclosed in table 12).
In one embodiment, the TREM comprising an ASGPR binding portion comprises the sequences provided in Table 12, e.g., any one of SEQ ID NOS 622-654. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.622. In one embodiment, TREM comprising ASGPR binding moiety comprises SEQ ID No.623. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.624. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.625. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.626. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.627. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.628. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.629. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.630. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.631. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.632. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.633. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.634. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.635. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.636. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.637. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.638. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.639. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.640. In one embodiment, TREM comprising ASGPR binding moiety comprises SEQ ID No.641. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.642. In one embodiment, TREM comprising ASGPR binding moiety comprises SEQ ID No.643. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.644. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.645. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.646. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.647. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.648. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.649. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.650. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.651. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.652. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.653. In one embodiment, TREM comprising an ASGPR binding moiety comprises SEQ ID No.654.
In one embodiment, the TREM comprising an ASGPR binding portion comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the sequence of TREM provided in table 12 (e.g., any of SEQ ID nos. 622-654 provided in table 12). In one embodiment, a TREM comprising an ASGPR binding moiety comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of a TREM provided in table 12 (e.g., any of SEQ ID nos. 622-654 disclosed in table 12). In one embodiment, a TREM comprising an ASGPR binding moiety comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, or 60nt (but less than full length) of TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to TREM provided in table 12 (e.g., any of SEQ ID nos. 622-654 disclosed in table 12).
In one embodiment, the TREM comprising an ASGPR binding moiety comprises a sequence that differs from the TREM provided in table 12 (e.g., any of SEQ ID nos. 622-652 provided in table 12) by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt.
In one embodiment, TREM comprising an ASGPR binding moiety is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 622. In one embodiment, TREM comprising an ASGPR binding moiety is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 650. In one embodiment, TREM comprising an ASGPR binding moiety is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 653.
In one embodiment, the TREM comprising the ASGPR binding portion comprises a sequence that differs from SEQ ID No.622 by at least 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, 20nt, 25nt, 30nt, 40nt, 45nt, 50nt, 55nt or more. In one embodiment, the TREM comprising the ASGPR binding portion comprises a sequence that differs from SEQ ID No.622 by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt. In one embodiment, the TREM comprising an ASGPR binding moiety comprises a sequence that differs from SEQ ID No.650 by at least 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, 20nt, 25nt, 30nt, 40nt, 45nt, 50nt, 55nt or more. In one embodiment, the TREM comprising the ASGPR binding portion comprises a sequence that differs from SEQ ID No.650 by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt. In one embodiment, the TREM comprising the ASGPR binding portion comprises a sequence that differs from SEQ ID No.653 by at least 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, 20nt, 25nt, 30nt, 40nt, 45nt, 50nt, 55nt or more. In one embodiment, the TREM comprising the ASGPR binding portion comprises a sequence that differs from SEQ ID No.653 by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt.
Chemically modified TREM
In some embodiments, a TREM entity (e.g., TREM core fragment, or TREM fragment described herein) further comprises a chemical modification, e.g., a modification described in any of tables 5-9, in addition to the ASGPR binding moiety. The chemical modification may be performed according to methods known in the art. In one embodiment, the chemical modification is a modification that the cell, e.g., a human cell, does not make to the endogenous tRNA.
In one embodiment, the chemical modification is a modification that a cell (e.g., a human cell) can make on the endogenous tRNA, but where such modification does not occur on the native tRNA. In one embodiment, the chemical modification is in a domain, linker or arm that does not naturally have such modification. In one embodiment, the chemical modification is at a position within a domain, linker, or arm that does not naturally have such modification. In one embodiment, the chemical modification is on a nucleotide that does not naturally have such a modification. In one embodiment, the chemical modification is on a nucleotide at a position within a domain, linker or arm that does not naturally have such modification.
Any of the nucleic acids that are characteristic of the present disclosure may be synthesized and/or modified by methods well known in the art, such as those described in "Current protocols in nucleic acid chemistry [ current protocols for nucleic acid chemistry ]," Beaucage, s.l., et al (eds.), john Wiley & Sons, inc. [ John wili father company ], new york city, new york state, united states (which is hereby incorporated by reference). Modifications include, for example, terminal modifications, e.g., 5 '-terminal modifications (phosphorylation, conjugation, reverse ligation) or 3' -terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.); base modification (e.g., substitution with a stable base, an unstable base, or a base that base pairs with an extended pool of partners), base removal (abasic nucleotides), or base conjugation; sugar modification (e.g., at the 2 'position or the 4' position) or sugar substitution; and/or backbone modifications, including modifications or substitutions of phosphodiester bonds. Specific examples of TREM compounds that can be used in the embodiments described herein include, but are not limited to TREM that contain modified backbones or no natural internucleoside linkages. TREMs having modified backbones include, inter alia, those that do not have phosphorus atoms in the backbone. For the purposes of this specification, and as sometimes referred to in the art, modified RNAs that do not have phosphorus atoms in their internucleoside backbones can also be considered oligonucleotides. In some embodiments, the modified TREM will have a phosphorus atom in its internucleoside backbone.
Modified TREM backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methylphosphonates and other alkylphosphonates (including 3 '-alkylene phosphonates and chiral phosphonates), phosphonites, phosphoramidites (including 3' -phosphoramidates and aminoalkyl phosphoramidates), thiocarbonylphosphoramidates (thiophosphoramamidates), thionoalkylphosphonates, thionoalkylphosphotriesters, and borane phosphates with normal 3'-5' linkages, 2'-5' linked analogs of these, and those with opposite polarity, wherein adjacent nucleoside units are linked to 3'-5' to 5'-3' or 2'-5' to 5 '-2'. Also included are various salts, mixed salts and free acid forms.
Representative U.S. patents disclosing the preparation of the above phosphorus-containing bonds include, but are not limited to, U.S. patent nos. 3,687,808;4,469,863;4,476,301;5,023,243;5,177,195;5,188,897;5,264,423;5,276,019;5,278,302;5,286,717;5,321,131;5,399,676;5,405,939;5,453,496;5,455,233;5,466,677;5,476,925;5,519,126;5,536,821;5,541,316;5,550,111;5,563,253;5,571,799;5,587,361;5,625,050;6,028,188;6,124,445;6,160,109;6,169,170;6,172,209;6,239,265;6,277,603;6,326,199;6,346,614;6,444,423;6,531,590;6,534,639;6,608,035;6,683,167;6,858,715;6,867,294;6,878,805;7,015,315;7,041,816;7,273,933;7,321,029; and U.S. patent RE39464, the entire contents of each of which are hereby incorporated by reference.
Wherein the modified TREM backbone excluding phosphorus atoms has a backbone formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom internucleoside linkages or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar moiety of a nucleoside); a siloxane backbone; sulfide, sulfoxide, and sulfone backbones; formyl and thiocarboxyyl backbones; methylene formyl and thioformyl backbones; an olefin-containing backbone; a sulfamate backbone; methylene imino and methylene hydrazino backbones;sulfonate and sulfonamide backbones; an amide backbone; with mixtures N, O, S and CH 2 Other backbones of the component parts. Representative U.S. patents teaching the preparation of the above oligonucleotides include, but are not limited to, U.S. patent nos. 5,034,506;5,166,315;5,185,444;5,214,134;5,216,141;5,235,033;5,64,562;5,264,564;5,405,938;5,434,257;5,466,677;5,470,967;5,489,677;5,541,307;5,561,225;5,596,086;5,602,240;5,608,046;5,610,289;5,618,704;5,623,070;5,663,312;5,633,360;5,677,437; and 5,677,439, each of which is hereby incorporated by reference in its entirety.
In other embodiments, suitable RNA mimics are contemplated for use in TREM, wherein both the sugar and internucleoside linkages (i.e., backbones) of the nucleotide units are replaced with new groups. The base unit is maintained to hybridize to the appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is known as a Peptide Nucleic Acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are held and bound directly or indirectly to the aza nitrogen atoms of the amide moiety of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. patent nos. 5,539,082;5,714,331; and 5,719,262, each of which is hereby incorporated by reference in its entirety. Additional PNA compounds suitable for use in TREM of the present disclosure are described, for example, in Nielsen et al, science [ Science ],1991,254,1497-1500.
Some examples specific for the present disclosure include TREMs with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular the-CH of the above-mentioned U.S. Pat. No. 5,489,677 2 —NH—CH 2 -、-CH 2 -N(CH 3 )-0-CH 2 - [ known as methylene (methylimino) or MMI backbone ]]、-CH 2 -0-N(CH 3 )-CH 2 -、-CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -and-N (CH) 3 )-CH 2 -CH 2 - [ wherein the natural phosphodiester backbone is represented by-O-P-O-CH 2 —]And the amide backbone of U.S. Pat. No. 5,602,240 mentioned above. In some embodiments, the TREMs specific herein have a morpholino backbone structure of the above-mentioned U.S. patent No. 5,034,506.
TREMs specific for this document may include one of the following at the 2' position: OH; f, performing the process; 0-, S-, or N-alkyl; o-, S-, or N-alkenyl; o-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted Ci to C 10 Alkyl or C 2 To C 10 Alkenyl and alkynyl groups. Exemplary suitable modifications include O [ (CH) 2 ) n O] m CH 3 、O(CH 2 ). n OCH 3 、O(CH 2 ) n NH 2 、O(CH 2 ) n CH 3 、O(CH 2 ) n ONH 2 And 0 (CH) 2 ) n ON[(CH 2 ) n CH 3 )] 2 Wherein n and m are from 1 to about 10. In other embodiments, the TREM may include one of the following at the 2' position: ci to C 10 Lower alkyl, substituted lower alkyl, alkylaryl, arylalkyl, O-alkylaryl or O-arylalkyl, SH, SCH 3 、OCN、Cl、Br、CN、CF 3 、OCF 3 、SOCH 3 、SO 2 CH 3 、ON0 2 、N0 2 、N3、NH 2 A heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleavage group, a reporter group, an intercalator, a group that improves the pharmacokinetic properties of TREM, or a group that improves the pharmacodynamic properties of TREM, and other substituents having similar properties.
In some embodiments, the modification comprises 2 '-methoxyethoxy (2' -O-CH) 2 CH 2 OCH 3 Also known as 2'-O- (2-methoxyethyl) or 2' -MOE) (Martin et al, helv.Chim. Acta, swiss chemistry report]1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2' -dimethylaminooxyethoxy, i.e., O (CH) as described in the examples below 2 ) 2 ON(CH3) 2 Groups (also known as 2' -DMAEE), and 2' -dimethylaminoethoxyethoxy (also known in the art as 2' -O-dimethylaminoethoxyethyl or 2' -DMAEE), i.e., 2' -O-CH 2 -O-CH 2 -N(CH 2 ) 2 。
Other modifications include 2 '-methoxy (2' -OCH) 3 ) 2 '-aminopropoxy (2' -OCH) 2 CH 2 CH 2 NH 2 ) And 2 '-fluoro (2' -F). Similar modifications can also be made at other positions within the TREM, particularly at the 3 'position of the sugar on the 3' terminal nucleotide or within the 2'-5' linked TREM, and at the 5 'position of the 5' terminal nucleotide. TREM may also have a glycomimetic such as a cyclobutyl moiety in place of the pentofuranosyl saccharide. Representative U.S. patents teaching the preparation of such modified sugar structures include, but are not limited to, U.S. patent No. 4,981,957;5,118,800;5,319,080;5,359,044;5,393,878;5,446,137;5,466,786;5,514,785;5,519,134;5,567,811;5,576,427;5,591,722;5,597,909;5,610,300;5,627,053;5,639,873;5,646,265;5,658,873;5,670,633; and 5,700,920, some of which are commonly owned with the present application. The entire contents of each of the foregoing are hereby incorporated by reference.
TREM may also include nucleobase (commonly referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (a) and guanine (G), as well as the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxy-thymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl and other 8-substituted adenine and guanine, 5-halo, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-aza and 8-aza-guanine, 7-aza-adenine and 7-aza-3-aza-adenine and 3-aza-adenine. Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808, modified nucleosides in Modified Nucleosides in Biochemistry, biotechnology and Medicine [ biochemistry, biotechnology, and medicine ], herdywijn, p. Editorial Wiley-VCH [ wili-VCH press ], 2008; those disclosed in The Concise Encyclopedia of Polymer Science And Engineering [ encyclopedia of Polymer science and engineering conciseness ], pages 858-859, kroschwitz, J.L. editions, john Wiley & Sons [ John Willi parent, inc. ],1990, englisch et al, angewandte Chemie [ applied chemistry ], international edition, 1991,30,613, and those disclosed in Sanghvi, Y.S., chapter 15, dsRNA Research and Applications [ dsRNA research and application ], pages 289-302, crooke, S.T. and Lebleu, B.editions, CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of oligomeric compounds that are characteristic of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ℃ (Sanghvi, y.s., rooke, s.t., and Lebleu, b. editions, dsRNA Research and Applications [ dsRNA research and applications ], CRC press, bocarton, 1993, pages 276-278), and are exemplary base substitutions, especially when combined with 2' -0-methoxyethyl sugar modifications.
Representative U.S. patents teaching the preparation of certain of the above-described modified nucleobases and other modified nucleobases include, but are not limited to, U.S. patent No. 3,687,808,4,845,205, described above; 5,130,30;5,134,066;5,175,273;5,367,066;5,432,272;5,457,187;5,459,255;5,484,908;5,502,177;5,525,711;5,552,540;5,587,469;5,594,121,5,596,091;5,614,617;5,681,941;5,750,692;6,015,886;6,147,200;6,166,197;6,222,025;6,235,887;6,380,368;6,528,640;6,639,062;6,617,438;7,045,610;7,427,672; and 7,495,088, each of which is hereby incorporated by reference in its entirety.
TREM may also be modified to include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by bridging of two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4 '-carbon and the 2' -carbon of the sugar ring. Thus, in some embodiments, the agents of the invention may include TREM's RNA, and may also be modified to include one or more Locked Nucleic Acids (LNAs). Locked nucleic acids are nucleotides with modified ribose moieties, where the ribose moiety contains an additional bridge linking the 2 'and 4' carbons. In other words, LNA is a nucleotide comprising a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3' endo structural conformation. The addition of locked nucleic acids to oligonucleotide sequences has been shown to increase the stability of oligonucleotide sequences in serum and reduce off-target effects (Elmen, J. Et al, (2005) Nucleic Acids Research [ nucleic acids Ind. 33 (l): 439-447; mook, OR. Et al, (2007) Mol Cane Ther [ molecular cancer therapeutics ]6 (3): 833-843; grunwiller, A et al, (2003) Nucleic Acids Research [ nucleic acids Ind. 31 (12): 3185-3193).
In one embodiment, a TREM, TREM core fragment, or TREM fragment described herein comprises the chemical modifications provided in table 5, or a combination thereof.
Table 5: exemplary modifications
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
In one embodiment, a TREM, TREM core fragment, or TREM fragment described herein comprises the modifications provided in table 6, or a combination thereof. The modifications provided in table 6 occur naturally in RNA and are used herein at positions on the synthesized TREM, TREM core fragment or TREM fragment that do not occur naturally.
Table 6: additional exemplary modifications
/>
/>
/>
In one embodiment, a TREM, TREM core fragment, or TREM fragment described herein comprises the chemical modifications provided in table 7, or a combination thereof.
Table 7: additional exemplary chemical modifications
/>
/>
In one embodiment, a TREM, TREM core fragment, or TREM fragment described herein comprises the chemical modifications provided in table 8, or a combination thereof.
Table 8: exemplary backbone modifications
/>
In one embodiment, a TREM, TREM core fragment, or TREM fragment described herein comprises the non-naturally occurring modifications provided in table 9, or a combination thereof.
Table 9: exemplary non-naturally occurring backbone modifications
Names of synthetic backbone modifications
Phosphorothioate esters
Restriction nucleic acid (CNA)
2'O' methylation
2' -O-methoxyethyl ribose (MOE)
2' fluoro
Lock Nucleic Acid (LNA)
(S) -restricted ethyl (cEt)
Fluorohexitol nucleic acid (FHNA)
5' phosphorothioate esters
Phosphorodiamidate Morpholino Oligomers (PMO)
Tricyclic DNA (tcDNA)
(S) 5' -C-methyl
(E) Vinyl phosphonates
Phosphonic acid methyl ester
(S) 5' -C-methyl and phosphate
TREM, TREM core fragment and TREM fragment fusion
In one embodiment, a TREM, TREM core fragment, or TREM fragment disclosed herein comprises an additional moiety, e.g., a fusion moiety. In one embodiment, the fusion moiety can be used for purification to alter the folding of the TREM, TREM core fragment, or TREM fragment or as a targeting moiety. In one embodiment, the fusion moiety may comprise a tag, a linker, may be cleavable, or may comprise a binding site for an enzyme. In one embodiment, the fusion moiety may be located at the N-terminus of TREM or at the C-terminus of TREM, TREM core fragment or TREM fragment. In one embodiment, the fusion moiety may be encoded by the same or different nucleic acid molecules encoding TREM, TREM core fragments, or TREM fragments.
TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises a consensus sequence provided herein.
In one embodiment, a TREM disclosed herein comprises formula I ZZZ Wherein ZZZ Represents any of the twenty amino acids and formula I corresponds to all species.
In one embodiment, a TREM disclosed herein comprises formula II ZZZ Wherein ZZZ Represents any of the twenty amino acids and formula II corresponds to a mammal.
In one embodiment, a TREM disclosed herein comprises formula III ZZZ Wherein ZZZ Representation twentyAny one of the amino acids and formula III corresponds to a human.
In one embodiment of the present invention, in one embodiment, ZZZ represents any one of twenty amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.
In one embodiment, the TREM disclosed herein includes characteristics selected from the group consisting of:
a) Under physiological conditions, residue R 0 Forming a linker region, e.g., linker 1 region;
b) Under physiological conditions, residue R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 And residue R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 Forming a stem region, e.g., an AStD stem region;
c) Under physiological conditions, residue R 8 -R 9 Forming a linker region, e.g., linker 2 region;
d) Under physiological conditions, residue-R 10 -R 11 -R 12 -R 13 -R 14 R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 Forming a stem-loop region, e.g., a D-arm region;
e) Under physiological conditions, residue-R 29 Forming a linker region, e.g., linker 3 region;
f) Under physiological conditions, residue-R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 Forming a stem-loop region, e.g., an AC arm region;
g) Residues- [ R under physiological conditions 47 ] x Comprising a variable region, e.g., as described herein;
h) Under physiological conditions, residue-R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 Forming a stem-loop region, e.g., a T-arm region; or alternatively
i) Under physiological conditions, residue R 72 A linker region, e.g., linker 4 region, is formed.
Alanine TREM consensus sequence
In one embodiment, a TREM disclosed herein comprises formula I ALA Is sequence of (SEQ ID NO: 562),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ala is:
R 0 =absent;
R 14 、R 57 =independently a or absent;
R 26 = A, C, G or absent;
R 5 、R 6 、R 15 、R 16 、R 21 、R 30 、R 31 、R 32 、R 34 、R 37 、R 41 、R 42 、R 43 、R 44 、R 45 、R 48 、R 49 、R 50 、R 58 、R 59 、R 63 、R 64 、R 66 、R 67 =independently N or absent;
R 11 、R 35 、R 65 =independently A, C, U or absent;
R 1 、R 9 、R 20 、R 38 、R 40 、R 51 、R 52 、R 56 =independently A, G or absent;
R 7 、R 22 、R 25 、R 27 、R 29 、R 46 、R 53 、R 72 =independently A, G, U or absent;
R 24 、R 69 =independently A, U or absent;
R 70 、R 71 =independently C or absent;
R 3 、R 4 =independently C, G or absent;
R 12 、R 33 、R 36 、R 62 、R 68 =independently C, G, U or absent;
R 13 、R 17 、R 28 、R 39 、R 55 、R 60 、R 61 =independently C, U or absent;
R 10 、R 19 、R 23 =independently G or absent;
R 2 = G, U or absent;
R 8 、R 18 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II ALA Is sequence (SEQ ID NO: 563),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ala is:
R 0 、R 18 =absent;
R 14 、R 24 、R 57 =independently a or absent;
R 15 、R 26 、R 64 =independently A, C, G or absent;
R 16 、R 31 、R 50 、R 59 =independently N or absent;
R 11 、R 32 、R 37 、R 41 、R 43 、R 45 、R 49 、R 65 、R 66 =independently A, C, U or absent;
R 1 、R 5 、R 9 、R 25 、R 27 、R 38 、R 40 、R 46 、R 51 、R 56 =independently A, G or absent;
R 7 、R 22 、R 29 、R 42 、R 44 、R 53 、R 63 、R 72 =independently A, G, U or absent;
R 6 、R 35 、R 69 =independently A, U or absent;
R 55 、R 60 、R 70 、R 71 =independently C or absent;
R 3 = C, G or absent;
R 12 、R 36 、R 48 =independently C, G, U or absent;
R 13 、R 17 、R 28 、R 30 、R 34 、R 39 、R 58 、R 61 、R 62 、R 67 、R 68 =independently C, U or absent;
R 4 、R 10 、R 19 、R 20 、R 23 、R 52 =independently G or absent;
R 2 、R 8 、R 33 =independently G, U or absent;
R 21 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III ALA (SEQ ID NO: 564),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ala is:
R 0 、R 18 =absent;
R 14 、R 24 、R 57 、R 72 =independently a or absent;
R 15 、R 26 、R 64 =independently A, C, G or absent;
R 16 、R 31 、R 50 =independently N or absent;
R 11 、R 32 、R 37 、R 41 、R 43 、R 45 、R 49 、R 65 、R 66 =independently a,C. U or absent;
R 5 、R 9 、R 25 、R 27 、R 38 、R 40 、R 46 、R 51 、R 56 =independently A, G or absent;
R 7 、R 22 、R 29 、R 42 、R 44 、R 53 、R 63 =independently A, G, U or absent;
R 6 、R 35 =independently A, U or absent;
R 55 、R 60 、R 61 、R 70 、R 71 =independently C or absent;
R 12 、R 48 、R 59 =independently C, G, U or absent;
R 13 、R 17 、R 28 、R 30 、R 34 、R 39 、R 58 、R 62 、R 67 、R 68 =independently C, U or absent;
R 1 、R 2 、R 3 、R 4 、R 10 、R 19 、R 20 、R 23 、R 52 =independently G or absent;
R 33 、R 36 =independently G, U or absent;
R 8 、R 21 、R 54 、R 69 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Arginine TREM consensus sequence
In one embodiment, a TREM disclosed herein comprises formula I ARG Is sequence of (SEQ ID NO: 565),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Arg is:
R 57 either =a or absent;
R 9 、R 27 =independently A, C, G or absent;
R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 、R 11 、R 12 、R 16 、R 21 、R 22 、R 23 、R 25 、R 26 、R 29 、R 30 、R 31 、R 32 、R 33 、R 34 、R 37 、R 42 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 51 、R 58 、R 62 、R 63 、R 64 、R 65 、R 66 、R 67 、R 68 、R 69 、R 70 、R 71 =independently N or absent;
R 13 、R 17 、R 41 =independently A, C, U or absent;
R 19 、R 20 、R 24 、R 40 、R 56 =independently A, G or absent;
R 14 、R 15 、R 72 =independently A, G, U or absent;
R 18 = A, U or absent;
R 38 either =c or absent;
R 35 、R 43 、R 61 =independently C, G, U or absent;
R 28 、R 55 、R 59 、R 60 =independently C, U or absent;
R 0 、R 10 、R 52 =independently G or absent;
R 8 、R 39 =independently G, U or absent;
R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II ARG (SEQ ID NO: 566),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Arg is:
R 18 =absent;
R 24 、R 57 =independently a or absent;
R 41 = A, C or absent;
R 3 、R 7 、R 34 、R 50 =independently A, C, G or absent;
R 2 、R 5 、R 6 、R 12 、R 26 、R 32 、R 37 、R 44 、R 58 、R 66 、R 67 、R 68 、R 70 =independently N or absent;
R 49 、R 71 =independently A, C, U or absent;
R 1 、R 15 、R 19 、R 25 、R 27 、R 40 、R 45 、R 46 、R 5 x、R 72 =independently A, G or absent;
R 14 、R 29 、R 63 =independently A, G, U or absent;
R 16 、R 21 =independently A, U or absent;
R 38 、R 61 =independently C or absent;
R 33 、R 48 =independently C, G or absent;
R 4 、R 9 、R 11 、R 43 、R 62 、R 64 、R 69 =independently C, G, U or absent;
R 13 、R 22 、R 28 、R 30 、R 31 、R 35 、R 55 、R 60 、R 65 =independently C, U or absent;
R 0 、R 10 、R 20 、R 23 、R 51 、R 52 =independently G or absent;
R 8 、R 39 、R 42 =independently G, U or absent;
R 17 、R 36 、R 53 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III ARG Is sequence (SEQ ID NO: 567),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Arg is:
R 18 =absent;
R 15 、R 21 、R 24 、R 41 、R 57 =independently a or absent;
R 34 、R 44 =independently A, C or absent;
R 3 、R 5 、R 58 =independently A, C, G or absent;
R 2 、R 6 、R 66 、R 70 =independently N or notPresence;
R 37 、R 49 =independently A, C, U or absent;
R 1 、R 25 、R 29 、R 40 、R 45 、R 46 、R 50 =independently A, G or absent;
R 14 、R 63 、R 68 =independently A, G, U or absent;
R 16 = A, U or absent;
R 38 、R 61 =independently C or absent;
R 7 、R 11 、R 12 、R 26 、R 48 =independently C, G or absent;
R 64 、R 67 、R 69 =independently C, G, U or absent;
R 4 、R 13 、R 22 、R 28 、R 30 、R 31 、R 35 、R 43 、R 55 、R 60 、R 62 、R 65 、R 71 =independently C, U or absent;
R 0 、R 10 、R 19 、R 20 、R 23 、R 27 、R 33 、R 51 、R 52 、R 56 、R 72 =independently G or absent;
R 8 、R 9 、R 32 、R 39 、R 42 =independently G, U or absent;
R 17 、R 36 、R 53 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Asparagine TREM consensus sequence
In one embodiment, a TREM disclosed herein comprises formula I ASN Is sequence of (SEQ ID NO: 568),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asn is:
R 0 、R 18 =absent;
R 41 either =a or absent;
R 14 、R 48 、R 56 =independently A, C, G or absent;
R 2 、R 4 、R 5 、R 6 、R 12 、R 17 、R 26 、R 29 、R 30 、R 31 、R 44 、R 45 、R 46 、R 49 、R 50 、R 58 、R 62 、R 63 、R 65 、R 66 、R 67 、R 68 、R 70 、R 71 =independently N or absent;
R 11 、R 13 、R 22 、R 42 、R 55 、R 59 =independently A, C, U or absent;
R 9 、R 15 、R 24 、R 27 、R 34 、R 37 、R 51 、R 72 =independently A, G or absent;
R 1 、R 7 、R 25 、R 69 =independently A, G, U or absent;
R 40 、R 57 =independently A, U or absent;
R 60 either =c or absent;
R 33 = C, G or absent;
R 21 、R 32 、R 43 、R 64 =independently C, G, U or absent;
R 3 、R 16 、R 28 、R 35 、R 36 、R 61 =independently C, U or absent;
R 10 、R 19 、R 20 、R 52 =independently G or absent;
R 54 = G, U or absent;
R 8 、R 23 、R 38 、R 39 、R 53 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II ASN Is sequence (SEQ ID NO: 569),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asn is:
R 0 、R 18 =no existence of
R 24 、R 41 、R 46 、R 62 =independently a or absent;
R 59 = A, C or absent;
R 14 、R 56 、R 66 =independently A, C, G or absent;
R 17 、R 29 =independently N or absent;
R 11 、R 26 、R 42 、R 55 =independently A, C, U or absent;
R 1 、R 9 、R 12 、R 15 、R 25 、R 34 、R 37 、R 48 、R 51 、R 67 、R 68 、R 69 、R 70 、R 72 =independently A, G or absent;
R 44 、R 45 、R 58 =independently A, G, U or absent;
R 40 、R 57 =independently A, U or absent;
R 5 、R 28 、R 60 =independently C or absent;
R 33 、R 65 =independently C, G or absent;
R 21 、R 43 、R 71 =independently C, G, U or absent;
R 3 、R 6 、R 13 、R 22 、R 32 、R 35 、R 36 、R 61 、R 63 、R 64 =independently C, U or absent;
R 7 、R 10 、R 19 、R 20 、R 27 、R 49 、R 52 =independently G or absent;
R 54 = G, U or absent;
R 2 、R 4 、R 8 、R 16 、R 23 、R 30 、R 31 、R 38 、R 39 、R 50 、R 53 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III ASN (SEQ ID NO: 570),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asn is:
R 0 、R 18 =no existence of
R 24 、R 40 、R 41 、R 46 、R 62 =independently a or absent;
R 59 = A, C or absent;
R 14 、R 56 、R 66 =independently A, C, G or absent;
R 11 、R 26 、R 42 、R 55 =independently A, C, U or absent;
R 1 、R 9 、R 12 、R 15 、R 34 、R 37 、R 48 、R 51 、R 67 、R 68 、R 69 、R 70 =independently A, G or absent;
R 44 、R 45 、R 58 =independently A, G, U or absent;
R 57 = A, U or absent;
R 5 、R 28 、R 60 =independently C or absent;
R 33 、R 65 =independently C, G or absent;
R 17 、R 21 、R 29 =independently C, G, U or absent;
R 3 、R 6 、R 13 、R 22 、R 32 、R 35 、R 36 、R 43 、R 61 、R 63 、R 64 、R 71 =independently C, U or absent;
R 7 、R 10 、R 19 、R 20 、R 25 、R 27 、R 49 、R 52 、R 72 =independently G or absent;
R 54 = G, U or absent;
R 2 、R 4 、R 8 、R 16 、R 23 、R 30 、R 31 、R 38 、R 39 、R 50 、R 53 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Aspartic acid TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I ASP (SEQ ID NO: 571),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asp is:
R 0 =no existence of
R 24 、R 71 =independently A, C or absent;
R 33 、R 46 =independently A, C, G or absent;
R 2 、R 3 、R 4 、R 5 、R 6 、R 12 、R 16 、R 22 、R 26 、R 29 、R 31 、R 32 、R 44 、R 48 、R 49 、R 58 、R 63 、R 64 、R 66 、R 67 、R 68 、R 69 =independently N or absent;
R 13 、R 21 、R 34 、R 41 、R 57 、R 65 =independently A, C, U or absent;
R 9 、R 10 、R 14 、R 15 、R 20 、R 27 、R 37 、R 40 、R 51 、R 56 、R 72 =independently A, G or absent;
R 7 、R 25 、R 42 =independently A, G, U or absent;
R 39 either =c or absent;
R 50 、R 62 =independently C, G or absent;
R 30 、R 43 、R 45 、R 55 、R 70 =independently C, G, U or absent;
R 8 、R 11 、R 17 、R 18 、R 28 、R 35 、R 53 、R 59 、R 60 、R 61 =independently C, U or absent;
R 19 、R 52 =independently G or absent;
R 1 = G, U or absent;
R 23 、R 36 、R 38 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II ASP (SEQ ID NO: 572),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asp is:
R 0 、R 17 、R 18 、R 23 =independently absent;
R 9 、R 40 =independently a or absent;
R 24 、R 71 =independently A, C or absent;
R 67 、R 68 =independently A, C, G or absent;
R 2 、R 6 、R 66 =independently N or absent;
R 57 、R 63 =independently A, C, U or absent;
R 10 、R 14 、R 27 、R 33 、R 37 、R 44 、R 46 、R 51 、R 56 、R 64 、R 72 =independently A, G or absent;
R 7 、R 12 、R 26 、R 65 =independently A, U or absent;
R 39 、R 61 、R 62 =independently C or absent;
R 3 、R 31 、R 45 、R 70 =independently C, G or absent;
R 4 、R 5 、R 29 、R 43 、R 55 =independently C, G, U or absent;
R 8 、R 11 、R 13 、R 30 、R 32 、R 34 、R 35 、R 41 、R 48 、R 53 、R 59 、R 60 =independently C, U or absent;
R 15 、R 19 、R 20 、R 25 、R 42 、R 50 、R 52 =independently G or absent;
R 1 、R 22 、R 49 、R 58 、R 69 =independently G, U or absent;
R 16 、R 21 、R 28 、R 36 、R 38 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III ASP Is sequence (SEQ ID NO: 573),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Asp is:
R 0 、R 17 、R 18 、R 23 =no existence of
R 9 、R 12 、R 40 、R 65 、R 71 =independently a or absent;
R 2 、R 24 、R 57 =independently A, C or absent;
R 6 、R 14 、R 27 、R 46 、R 51 、R 56 、R 64 、R 67 、R 68 =independently A, G or absent;
R 3 、R 31 、R 35 、R 39 、R 61 、R 62 =independently C or absent;
R 66 = C, G or absent;
R 5 、R 8 、R 29 、R 30 、R 32 、R 34 、R 41 、R 43 、R 48 、R 55 、R 59 、R 60 、R 63 =independently C, U or absent;
R 10 、R 15 、R 19 、R 20 、R 25 、R 33 、R 37 、R 42 、R 44 、R 45 、R 49 、R 50 、R 52 、R 69 、R 70 、R 72 =independently G or absent;
R 22 、R 58 =independently G, U or absent;
R 1 、R 4 、R 7 、R 11 、R 13 、R 16 、R 21 、R 26 、R 28 、R 36 、R 38 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Cysteine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I CYS Is sequence of (SEQ ID NO: 574),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Cys is:
R 0 =no existence of
R 14 、R 39 、R 57 =independently a or absent;
R 41 = A, C or absent;
R 10 、R 15 、R 27 、R 33 、R 62 =independently A, C, G or absent;
R 3 、R 4 、R 5 、R 6 、R 12 、R 13 、R 16 、R 24 、R 26 、R 29 、R 30 、R 31 、R 32 、R 34 、R 42 、R 44 、R 45 、R 46 、R 48 、R 49 、R 58 、R 63 、R 64 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 65 = A, C, U or absent;
R 9 、R 25 、R 37 、R 40 、R 52 、R 56 =independently A, G or absent;
R 7 、R 20 、R 51 =independently A, G, U or absent;
R 18 、R 38 、R 55 =independently C or absent;
R 2 = C, G or absent;
R 21 、R 28 、R 43 、R 50 =independently C, G, U or absent;
R 11 、R 22 、R 23 、R 35 、R 36 、R 59 、R 60 、R 61 、R 71 、R 72 =independently C, U or absent;
R 1 、R 19 =independently G or absent;
R 17 = G, U or absent;
R 8 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II CYS Is a sequence of (SEQ ID NO: 575),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Cys is:
R 0 、R 18 、R 23 =absent;
R 14 、R 24 、R 26 、R 29 、R 39 、R 41 、R 45 、R 57 =independently a or absent;
R 44 = A, C or absent;
R 27 、R 62 =independently A, C, G or absent;
R 16 = A, C, G, U or absent;
R 30 、R 70 =independently A, C, U or absent;
R 5 、R 7 、R 9 、R 25 、R 34 、R 37 、R 40 、R 46 、R 52 、R 56 、R 58 、R 66 =independently A, G or absent;
R 20 、R 51 =independently A, G, U or absent;
R 35 、R 38 、R 43 、R 55 、R 69 =independently C or absent;
R 2 、R 4 、R 15 =independently C, G or absent;
R 13 = C, G, U or absent;
R 6 、R 11 、R 28 、R 36 、R 48 、R 49 、R 50 、R 60 、R 61 、R 67 、R 68 、R 71 、R 72 =independently C, U or absent;
R 1 、R 3 、R 10 、R 19 、R 33 、R 63 =independently G or absent;
R 8 、R 17 、R 21 、R 64 =independently G, U or absent;
R 12 、R 22 、R 31 、R 32 、R 42 、R 53 、R 54 、R 65 =independently U or absent;
R 59 either =u or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III CYS (SEQ ID NO: 576),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Cys is:
R 0、 R 18 、R 23 =no existence of
R 14 、R 24 、R 26 、R 29 、R 34 、R 39 、R 41 、R 45 、R 57 、R 58 =independently a or absent;
R 44 、R 70 =independently A, C or absent;
R 62 = A, C, G or absent;
R 16 =n or absent;
R 5 、R 7 、R 9 、R 20 、R 40 、R 46 、R 51 、R 52 、R 56 、R 66 =independently A, G or absent;
R 28 、R 35 、R 38 、R 43 、R 55 、R 67 、R 69 =independently C or absent;
R 4 、R 15 =independently C, G or absent;
R 6 、R 11 、R 13 、R 30 、R 48 、R 49 、R 50 、R 60 、R 61 、R 68 、R 71 、R 72 =independently C, U or absent;
R 1 、R 2 、R 3 、R 10 、R 19 、R 25 、R 27 、R 33 、R 37 、R 63 =independently G or absent;
R 8 、R 21 、R 64 =independently G, U or absent;
R 12 、R 17 、R 22 、R 31 、R 32 、R 36 、R 42 、R 53 、R 54 、R 59 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Glutamine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I GLN (SEQ ID NO: 577),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gln is:
R 0 、R 18 =absent;
R 14 、R 24 、R 57 =independently a or absent;
R 9 、R 26 、R 27 、R 33 、R 56 =independently A, C, G or absent;
R 2 、R 4 、R 5 、R 6 、R 12 、R 13 、R 16 、R 21 、R 22 、R 25 、R 29 、R 30 、R 31 、R 32 、R 34 、R 41 、R 42 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 62 、R 63 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 17 、R 23 、R 43 、R 65 、R 71 =independently A, C, U or absent;
R 15 、R 40 、R 51 、R 52 =independently A, G or absent;
R 1 、R 7 、R 72 =independently A, G, U or absent;
R 3 、R 11 、R 37 、R 60 、R 64 =independently C, G, U or absent;
R 28 、R 35 、R 55 、R 59 、R 61 =independently C, U or absent;
R 10 、R 19 、R 20 =independently G or absent;
R 39 = G, U or absent;
R 8 、R 36 、R 38 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II GLN Is sequence of (SEQ ID NO: 578),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gln is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 24 、R 57 =independently a or absent;
R 17 、R 71 =independently A, C or absent;
R 25 、R 26 、R 33 、R 44 、R 46 、R 56 、R 69 =independently A, C, G or absent;
R 4 、R 5 、R 12 、R 22 、R 29 、R 30 、R 48 、R 49 、R 63 、R 67 、R 68 =independently N or absent;
R 31 、R 43 、R 62 、R 65 、R 70 =independently A, C, U or absent;
R 15 、R 27 、R 34 、R 40 、R 41 、R 51 、R 52 =independently A, G or absent;
R 2 、R 7 、R 21 、R 45 、R 50 、R 58 、R 66 、R 72 =independently A, G, U or absent;
R 3 、R 13 、R 32 、R 37 、R 42 、R 60 、R 64 =independently C, G, U or absent;
R 6 、R 11 、R 28 、R 35 、R 55 、R 59 、R 61 =independently C, U or absent;
R 9 、R 10 、R 19 、R 20 =independently G or absent;
R 1 、R 16 、R 39 =independently G, U or absent;
R 8 、R 36 、R 38 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III GLN (SEQ ID NO: 579),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gln is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 24 、R 41 、R 57 =independently a or absent;
R 17 、R 71 =independently A, C or absent;
R 5 、R 25 、R 26 、R 46 、R 56 、R 69 =independently A, C, G or absent;
R 4 、R 22 、R 29 、R 30 、R 48 、R 49 、R 63 、R 68 =independently N or absent;
R 43 、R 62 、R 65 、R 70 =independently A, C, U or absent;
R 15 、R 27 、R 33 、R 34 、R 40 、R 51 、R 52 =independently A, G or absent;
R 2 、R 7 、R 12 、R 45 、R 50 、R 58 、R 66 =independently A, G, U or absent;
R 31 = A, U or absent;
R 32 、R 44 、R 60 =independently C, G or absent;
R 3 、R 13 、R 37 、R 42 、R 64 、R 67 =independently C, G, U or absent;
R 6 、R 11 、R 28 、R 35 、R 55 、R 59 、R 61 =independently C, U or absent;
R 9 、R 10 、R 19 、R 20 =independently G or absent;
R 1 、R 21 、R 39 、R 72 =independently G, U or absent;
R 8 、R 16 、R 36 、R 38 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Glutamic acid TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I GLU (SEQ ID NO: 580),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Glu:
R 0 =absent;
R 34 、R 43 、R 68 、R 69 =independently A, C, G or absent;
R 1 、R 2 、R 5 、R 6 、R 9 、R 12 、R 16 、R 20 、R 21 、R 26 、R 27 、R 29 、R 30 、R 31 、R 32 、R 33 、R 41 、R 44 、R 45 、R 46 、R 48 、R 50 、R 51 、R 58 、R 63 、R 64 、R 65 、R 66 、R 70 、R 71 =independently N or absent;
R 13 、R 17 、R 23 、R 61 =independently A, C, U or absent;
R 10 、R 14 、R 24 、R 40 、R 52 、R 56 =independently A, G or absent;
R 7 、R 15 、R 25 、R 67 、R 72 =independently A, G, U or absent;
R 11 、R 57 =independently A, U or absent;
R 39 = C, G or absent;
R 3 、R 4 、R 22 、R 42 、R 49 、R 55 、R 62 =independently C, G, U or absent;
R 18 、R 28 、R 35 、R 37 、R 53 、R 59 、R 60 =independently =C, U or absent;
R 19 either =g or absent;
R 8 、R 36 、R 38 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II GLU (SEQ ID NO: 581),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Glu:
R 0 、R 18 、R 23 =no existence of
R 17 、R 40 =independently a or absent;
R 26 、R 27 、R 34 、R 43 、R 68 、R 69 、R 71 =independently A, C, G or absent;
R 1 、R 2 、R 5 、R 12 、R 21 、R 31 、R 33 、R 41 、R 45 、R 48 、R 51 、R 58 、R 66 、R 70 =independently N or absent;
R 44 、R 61 =independently A, C, U or absent;
R 9 、R 14 、R 24 、R 25 、R 52 、R 56 、R 63 =independently A, G or absent;
R 7 、R 15 、R 46 、R 50 、R 67 、R 72 =independently A, G, U or absent;
R 29 、R 57 =independently A, U or absent；
R 60 Either =c or absent;
R 39 = C, G or absent;
R 3 、R 6 、R 20 、R 30 、R 32 、R 42 、R 55 、R 62 、R 65 =independently C, G, U or absent;
R 4 、R 8 、R 16 、R 28 、R 35 、R 37 、R 49 、R 53 、R 59 =independently C, U or absent;
R 10 、R 19 =independently G or absent;
R 22 、R 64 =independently G, U or absent;
R 11 、R 13 、R 35 、R 38 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III GLU (SEQ ID NO: 582),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Glu:
R 0 、R 17 、R 18 、R 23 =no existence of
R 14 、R 27 、R 40 、R 71 =independently a or absent;
R 44 = A, C or absent;
R 43 = A, C, G or absent;
R 1 、R 31 、R 33 、R 45 、R 51 、R 66 =independentThe site is N or absent;
R 21 、R 41 =independently A, C, U or absent;
R 7 、R 24 、R 25 、R 50 、R 52 、R 56 、R 63 、R 68 、R 70 =independently A, G or absent;
R 5 、R 46 =independently A, G, U or absent;
R 29 、R 57 、R 67 、R 72 =independently A, U or absent;
R 2 、R 39 、R 60 =independently C or absent;
R 3 、R 12 、R 20 、R 26 、R 34 、R 69 =independently C, G or absent;
R 6 、R 30 、R 42 、R 48 、R 65 =independently C, G, U or absent;
R 4 、R 16 、R 28 、R 35 、R 37 、R 49 、R 53 、R 55 、R 58 、R 61 、R 62 =independently C, U or absent;
R 9 、R 10 、R 19 、R 64 =independently G or absent;
R 15 、R 22 、R 32 =independently G, U or absent;
R 8 、R 11 、R 13 、R 36 、R 38 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Glycine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I GLY (SEQ ID NO: 583),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gly is:
R 0 =absent;
R 24 either =a or absent;
R 3 、R 9 、R 40 、R 50 、R 51 =independently A, C, G or absent;
R 4 、R 5 、R 6 、R 7 、R 12 、R 16 、R 21 、R 22 、R 26 、R 29 、R 30 、R 31 、R 32 、R 33 、R 34 、R 41 、R 42 、R 43 、R 44 、R 45 、R 46 、R 48 、R 49 、R 58 、R 63 、R 64 、R 65 、R 66 、R 67 、R 68 =independently N or absent;
R 59 = A, C, U or absent;
R 1 、R 10 、R 14 、R 15 、R 27 、R 56 =independently A, G or absent;
R 20 、R 25 =independently A, G, U or absent;
R 57 、R 72 =independently A, U or absent;
R 38 、R 39 、R 60 =independently C or absent;
R 52 = C, G or absent;
R 2 、R 19 、R 37 、R 54 、R 55 、R 61 、R 62 、R 69 、R 70 =independently C, G, U or notPresence;
R 11 、R 13 、R 17 、R 28 、R 35 、R 36 、R 71 =independently C, U or absent;
R 8 、R 18 、R 23 、R 53 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II GLY (SEQ ID NO: 584),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gly is:
R 0 、R 18 、R 23 =no existence of
R 24 、R 27 、R 40 、R 72 =independently a or absent;
R 26 = A, C or absent;
R 3 、R 7 、R 68 =independently A, C, G or absent;
R 5 、R 30 、R 41 、R 42 、R 44 、R 49 、R 67 =independently A, C, G, U or absent;
R 31 、R 32 、R 34 =independently A, C, U or absent;
R 9 、R 10 、R 14 、R 15 、R 33 、R 50 、R 56 =independently A, G or absent;
R 12 、R 16 、R 22 、R 25 、R 29 、R 46 =independently A, G, U or absent;
R 57 = A, U or absent;
R 17 、R 38 、R 39 、R 60 、R 61 、R 71 =independently C or absent;
R 6 、R 52 、R 64 、R 66 =independently C, G or absent;
R 2 、R 4 、R 37 、R 48 、R 55 、R 65 =independently C, G, U or absent;
R 13 、R 35 、R 43 、R 62 、R 69 =independently C, U or absent;
R 1 、R 19 、R 20 、R 51 、R 70 =independently G or absent;
R 21 、R 45 、R 63 =independently G, U or absent;
R 8 、R 11 、R 28 、R 36 、R 53 、R 54 、R 58 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III GLY (SEQ ID NO: 585),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 2 0-R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Gly is:
R 0 、R 18 、R 23 =no existence of
R 24 、R 27 、R 40 、R 72 =independently a or absent;
R 26 = A, C or absent;
R 3 、R 7 、R 49 、R 68 =independently A, C, G or absent;
R 5 、R 30 、R 41 、R 44 、R 67 =independently N or absent;
R 31 、R 32 、R 34 =independently A, C, U or absent;
R 9 、R 10 、R 14 、R 15 、R 33 、R 50 、R 56 =independently A, G or absent;
R 12 、R 25 、R 29 、R 42 、R 46 =independently A, G, U or absent;
R 16 、R 57 =independently A, U or absent;
R 17 、R 38 、R 39 、R 60 、R 61 、R 71 =independently C or absent;
R 6 、R 52 、R 64 、R 66 =independently C, G or absent;
R 37 、R 48 、R 65 =independently C, G, U or absent;
R 2 、R 4 、R 13 、R 35 、R 43 、R 55 、R 62 、R 69 =independently C, U or absent;
R 1 、R 19 、R 20 、R 51 、R 70 =independently G or absent;
R 21 、R 22 、R 45 、R 63 =independently G, U or absent;
R 8 、R 11 、R 28 、R 36 、R 53 、R 54 、R 58 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Histidine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I HIS (SEQ ID NO: 586),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to His is:
R 23 =absent;
R 14 、R 24 、R 57 =independently a or absent;
R 72 = A, C or absent;
R 9 、R 27 、R 43 、R 48 、R 69 =independently A, C, G or absent;
R 3 、R 4 、R 5 、R 6 、R 12 、R 25 、R 26 、R 29 、R 30 、R 31 、R 34 、R 42 、R 45 、R 46 、R 49 、R 50 、R 58 、R 62 、R 63 、R 66 、R 67 、R 68 =independently N or absent;
R 13 、R 21 、R 41 、R 44 、R 65 =independently A, C, U or absent;
R 40 、R 51 、R 56 、R 70 =independently A, G or absent;
R 7 、R 32 =independently A, G, U or absent;
R 55 、R 60 =independently C or absent;
R 11 、R 16 、R 33 、R 64 =independently C, G, U or absent;
R 2 、R 17 、R 22 、R 28 、R 35 、R 53 、R 59 、R 61 、R 71 =independently C, U or absent;
R 1 、R 10 、R 15 、R 19 、R 20 、R 37 、R 39 、R 52 =independently G or absent;
R 0 = G, U or absent;
R 8 、R 18 、R 36 、R 38 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II HIS (SEQ ID NO: 587),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to His is:
R 0 、R 17 、R 18 、R 23 =absent;
R 7 、R 12 、R 14 、R 24 、R 27 、R 45 、R 57 、R 58 、R 63 、R 67 、R 72 =independently a or absent;
R 3 = A, C, U or absent;
R 4 、R 43 、R 56 、R 70 =independently A, G or absent;
R 49 = A, U or absent;
R 2 、R 28 、R 30 、R 41 、R 42 、R 44 、R 48 、R 55 、R 60 、R 66 、R 71 =independently C or absent;
R 25 = C, G or absent;
R 9 = C, G, U or absent;
R 8 、R 13 、R 26 、R 33 、R 35 、R 50 、R 53 、R 61 、R 68 =independently C, U or absent;
R 1 、R 6 、R 10 、R 15 、R 19 、R 20 、R 32 、R 34 、R 37 、R 39 、R 40 、R 46 、R 51 、R 52 、R 62 、R 64 、R 69 =independently G or absent;
R 16 = G, U or absent;
R 5 、R 11 、R 21 、R 22 、R 29 、R 31 、R 36 、R 38 、R 54 、R 59 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III HIS (SEQ ID NO: 588),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to His is:
R 0 、R 17 、R 18 、R 23 =no existence of
R 7 、R 12 、R 14 、R 24 、R 27 、R 45 、R 57 、R 58 、R 63 、R 67 、R 72 =independently a or absent;
R 3 = A, C or absent;
R 4 、R 43 、R 56 、R 70 =independently A, G or absent;
R 49 = A, U or absent;
R 2 、R 28 、R 30 、R 41 、R 42 、R 44 、R 48 、R 55 、R 60 、R 66 、R 71 =independently C or absent;
R 8 、R 9 、R 26 、R 33 、R 35 、R 50 、R 61 、R 68 =independently C, U or absent;
R 1 、R 6 、R 10 、R 15 、R 19 、R 20 、R 25 、R 32 、R 34 、R 37 、R 39 、R 40 、R 46 、R 51 、R 52 、R 62 、R 64 、R 69 =independently G or absent;
R 5 、R 11 、R 13 、R 16 、R 21 、R 22 、R 29 、R 31 、R 36 、R 38 、R 53 、R 54 、R 59 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Isoleucine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I ILE (SEQ ID NO: 589),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ile is:
R 23 =absent;
R 38 、R 41 、R 57 、R 72 =independently a or absent;
R 1 、R 26 =independently A, C, G or absent;
R 0 、R 3 、R 4 、R 6 、R 16 、R 31 、R 32 、R 34 、R 37 、R 42 、R 43 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 59 、R 62 、R 63 、R 64 、R 66 、R 67 、R 68 、R 69 =independently N or absent;
R 22 、R 61 、R 65 =independently A, C, U or absent;
R 9 、R 14 、R 15 、R 24 、R 27 、R 40 =independently A, G or absent;
R 7 、R 25 、R 29 、R 51 、R 56 =independently A, G, U or absent;
R 18 、R 54 =independently A, U or absent;
R 60 either =c or absent;
R 2 、R 52 、R 70 =independently C, G or absent;
R 5 、R 12 、R 21 、R 30 、R 33 、R 71 =independently C, G, U or absent;
R 11 、R 13 、R 17 、R 28 、R 35 、R 53 、R 55 =independently C, U or absent;
R 10 、R 19 、R 20 =independently G or absent;
R 8 、R 36 、R 39 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II ILE Is sequence of (SEQ ID NO: 590),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ile is:
R 0 、R 18 、R 23 =no existence of
R 24 、R 38 、R 40 、R 41 、R 57 、R 72 =independently a or absent;
R 26 、R 65 =independently A, C or absent;
R 58 、R 59 、R 67 =independently N or absent;
R 22 = A, C, U or absent;
R 6 、R 9 、R 14 、R 15 、R 29 、R 34 、R 43 、R 46 、R 48 、R 50 、R 51 、R 63 、R 69 =independently A, G or absent;
R 37 、R 56 =independently A, G, U or absent;
R 54 = A, U or absent;
R 28 、R 35 、R 60 、R 62 、R 71 =independently C or absent;
R 2 、R 52 、R 70 =independently C, G or absent;
R 5 = C, G, U or absent;
R 3 、R 4 、R 11 、R 13 、R 17 、R 21 、R 30 、R 42 、R 44 、R 45 、R 49 、R 53 、R 55 、R 61 、R 64 、R 66 =independently C, U or absent;
R 1 、R 10 、R 19 、R 20 、R 25 、R 27 、R 31 、R 68 =independently G or absent;
R 7 、R 12 、R 32 =independently G, U or absent;
R 8 、R 16 、R 33 、R 36 、R 39 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III ILE (SEQ ID NO: 591),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Ile is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 24 、R 38 、R 40 、R 41 、R 57 、R 72 =independently a or absent;
R 26 、R 65 =independently A, C or absent;
R 22 、R 59 =independently A, C, U or absent;
R 6 、R 9 、R 15 、R 34 、R 43 、R 46 、R 51 、R 56 、R 63 、R 69 independent =Ground is A, G or absent;
R 37 = A, G, U or absent;
R 13 、R 28 、R 35 、R 44 、R 55 、R 60 、R 62 、R 71 =independently C or absent;
R 2 、R 5 、R 70 =independently C, G or absent;
R 58 、R 67 =independently C, G, U or absent;
R 3 、R 4 、R 11 、R 17 、R 21 、R 30 、R 42 、R 45 、R 49 、R 53 、R 61 、R 64 、R 66 =independently C, U or absent;
R 1 、R 10 、R 19 、R 20 、R 25 、R 27 、R 29 、R 31 、R 32 、R 48 、R 50 、R 52 、R 68 =independently G or absent;
R 7 、R 12 =independently G, U or absent;
R 8 、R 16 、R 33 、R 36 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Methionine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I MET Is sequence of (SEQ ID NO: 592),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Met is:
R 0 、R 23 =absent;
R 14 、R 38 、R 40 、R 57 =independently a or absent;
R 60 = A, C or absent;
R 33 、R 48 、R 70 =independently A, C, G or absent;
R 1 、R 3 、R 4 、R 5 、R 6 、R 11 、R 12 、R 16 、R 17 、R 21 、R 22 、R 26 、R 27 、R 29 、R 30 、R 31 、R 32 、R 42 、R 44 、R 45 、R 46 、R 49 、R 50 、R 58 、R 42 、R 63 、R 66 、R 67 、R 68 、R 69 、R 71 =independently N or absent;
R 18 、R 35 、R 41 、R 59 、R 65 =independently A, C, U or absent;
R 9 、R 15 、R 51 =independently A, G or absent;
R 7 、R 24 、R 25 、R 34 、R 53 、R 56 =independently A, G, U or absent;
R 72 = A, U or absent;
R 37 either =c or absent;
R 10 、R 55 =independently C, G or absent;
R 2 、R 13 、R 28 、R 43 、R 64 =independently C, G, U or absent;
R 36 、R 61 =independently C, U or absent;
R 19 、R 20 、R 52 =independently G or absent;
R 8 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II MET (SEQ ID NO: 593),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Met is:
R 0 、R 18 、R 22 、R 23 =no existence of
R 14 、R 24 、R 38 、R 40 、R 41 、R 57 、R 72 =independently a or absent;
R 59 、R 60 、R 62 、R 65 =independently A, C or absent;
R 6 、R 45 、R 67 =independently A, C, G or absent;
R 4 =n or absent;
R 21 、R 42 =independently A, C, U or absent;
R 1 、R 9 、R 27 、R 29 、R 32 、R 46 、R 51 =independently A, G or absent;
R 17 、R 49 、R 53 、R 56 、R 58 =independently A, G, U or absent;
R 63 = A, U or absent;
R 3 、R 13 、R 37 =independently C or absent;
R 48 、R 55 、R 64 、R 70 =independently C, G or absent;
R 2 、R 5 、R 66 、R 68 =independently C, G, U or absent;
R 11 、R 16 、R 26 、R 28 、R 30 、R 31 、R 35 、R 36 、R 43 、R 44 、R 61 、R 71 =independently C, U or absent;
R 10 、R 12 、R 15 、R 19 、R 20 、R 25 、R 33 、R 52 、R 69 =independently G or absent;
R 7 、R 34 、R 50 =independently G, U or absent;
R 8 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III MET (SEQ ID NO: 594),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Met is:
R 0 、R 18 、R 22 、R 23 =no existence of
R 14 、R 24 、R 38 、R 40 、R 41 、R 57 、R 72 =independently a or absent;
R 59 、R 62 、R 65 =independently A, C or absent;
R 6 、R 67 =independently A, C, G or absent;
R 4 、R 21 =independently A, C, U or absent;
R 1 、R 9 、R 27 、R 29 、R 32 、R 45 、R 46 、R 51 =independently A, G or absent;
R 17 、R 56 、R 58 =independently A, G, U or absent;
R 49 、R 53 、R 63 =independently A, U or absent;
R 3 、R 13 、R 26 、R 37 、R 43 、R 60 =independently C or absent;
R 2 、R 48 、R 55 、R 64 、R 70 =independently C, G or absent;
R 5 、R 66 =independently C, G, U or absent;
R 11 、R 16 、R 28 、R 30 、R 31 、R 35 、R 36 、R 42 、R 44 、R 61 、R 71 =independently C, U or absent;
R 10 、R 12 、R 15 、R 19 、R 20 、R 25 、R 33 、R 52 、R 69 =independently G or absent;
R 7 、R 34 、R 50 、R 68 =independently G, U or absent;
R 8 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Leucine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I LEU (SEQ ID NO: 595),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Leu is:
R 0 =absent;
R 38 、R 57 =independently a or absent;
R 60 = A, C or absent;
R 1 、R 13 、R 27 、R 48 、R 51 、R 56 =independently A, C, G or absent;
R 2 、R 3 、R 4 、R 5 、R 6 、R 7 、R 9 、R 10 、R 11 、R 12 、R 16 、R 23 、R 26 、R 28 、R 29 、R 30 、R 31 、R 32 、R 33 、R 34 、R 37 、R 41 、R 42 、R 43 、R 44 、R 45 、R 46 、R 49 、R 50 、R 58 、R 62 、R 63 、R 65 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 17 、R 18 、R 21 、R 22 、R 25 、R 35 、R 55 =independently A, C, U or absent;
R 14 、R 15 、R 39 、R 72 =independently A, G or absent;
R 24 、R 40 =independently A, G, U or absent;
R 52 、R 61 、R 64 、R 71 =independently C, G, U or absent;
R 36 、R 53 、R 59 =independently C, U orAbsence of;
R 19 either =g or absent;
R 20 = G, U or absent;
R 8 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II LEU (SEQ ID NO: 596),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Leu is:
R 0 =no existence of
R 38 、R 57 、R 72 =independently a or absent;
R 60 = A, C or absent;
R 4 、R 5 、R 48 、R 50 、R 56 、R 69 =independently A, C, G or absent;
R 6 、R 33 、R 41 、R 43 、R 46 、R 49 、R 58 、R 63 、R 66 、R 70 =independently N or absent;
R 11 、R 12 、R 17 、R 21 、R 22 、R 28 、R 31 、R 37 、R 44 、R 55 =independently A, C, U or absent;
R 1 、R 9 、R 14 、R 15 、R 24 、R 27 、R 34 、R 39 =independently A, G or absent;
R 7 、R 29 、R 32 、R 40 、R 45 =independentThe ground is A, G, U or absent;
R 25 = A, U or absent;
R 13 = C, G or absent;
R 2 、R 3 、R 16 、R 26 、R 30 、R 52 、R 62 、R 64 、R 65 、R 67 、R 68 =independently C, G, U or absent;
R 18 、R 35 、R 42 、R 53 、R 59 、R 61 、R 71 =independently C, U or absent;
R 19 、R 51 =independently G or absent;
R 10 、R 20 =independently G, U or absent;
R 8 、R 23 、R 36 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III LEU (SEQ ID NO: 597),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Leu is:
R 0 =no existence of
R 38 、R 57 、R 72 =independently a or absent;
R 60 = A, C or absent;
R 4 、R 5 、R 48 、R 50 、R 56 、R 58 、R 69 =independently A, C, G or absent;
R 6 、R 33 、R 43 、R 36 、R 39 、R 63 、R 66 、R 70 =independently N or absent;
R 11 、R 12 、R 17 、R 21 、R 22 、R 28 、R 31 、R 37 、R 41 、R 44 、R 55 =independently A, C, U or absent;
R 1 、R 9 、R 14 、R 15 、R 24 、R 27 、R 24 、R 39 =independently A, G or absent;
R 7 、R 29 、R 32 、R 40 、R 45 =independently A, G, U or absent;
R 25 = A, U or absent;
R 13 = C, G or absent;
R 2 、R 3 、R 16 、R 30 、R 52 、R 62 、R 64 、R 67 、R 68 =independently C, G, U or absent;
R 18 、R 35 、R 42 、R 53 、R 59 、R 61 、R 65 、R 71 =independently C, U or absent;
R 19 、R 51 =independently G or absent;
R 10 、R 20 、R 26 =independently G, U or absent;
R 8 、R 23 、R 36 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Lysine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I LYS (SEQ ID NO: 598),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Lys is:
R 0 =no existence of
R 14 Either =a or absent;
R 40 、R 41 =independently A, C or absent;
R 34 、R 43 、R 51 =independently A, C, G or absent;
R 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 、R 11 、R 12 、R 16 、R 21 、R 26 、R 30 、R 31 、R 32 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 62 、R 63 、R 65 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 13 、R 17 、R 59 、R 71 =independently A, C, U or absent;
R 9 、R 15 、R 19 、R 20 、R 25 、R 27 、R 52 、R 56 =independently A, G or absent;
R 24 、R 29 、R 72 =independently A, G, U or absent;
R 18 、R 57 =independently A, U or absent;
R 10 、R 33 =independently C, G or absent;
R 42 、R 61 、R 64 =independently C, G, U or absent;
R 28 、R 35 、R 36 、R 37 、R 53 、R 55 、R 60 =independently C, U or absent;
R 8 、R 22 、R 23 、R 38 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II LYS (SEQ ID NO: 599),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Lys is:
R 0、 R 18 、R 23 =no existence of
R 14 Either =a or absent;
R 40 、R 41 、R 43 =independently A, C or absent;
R 3 、R 7 =independently A, C, G or absent;
R 1 、R 6 、R 11 、R 31 、R 45 、R 48 、R 49 、R 63 、R 65 、R 66 、R 68 =independently N or absent;
R 2 、R 12 、R 13 、R 17 、R 44 、R 67 、R 71 =independently A, C, U or absent;
R 9 、R 15 、R 19 、R 20 、R 25 、R 27 、R 34 、R 50 、R 52 、R 56 、R 70 、R 72 =independently A, G or absent;
R 5 、R 24 、R 26 、R 29 、R 32 、R 46 、R 69 =independently A, G, U or absent;
R 57 = A, U or absent;
R 10 、R 61 =independently C, G or absent;
R 4 、R 16 、R 21 、R 30 、R 58 、R 64 =independently C, G, U or absent;
R 28 、R 35 、R 36 、R 37 、R 42 、R 53 、R 55 、R 59 、R 60 、R 62 =independently C, U or absent;
R 33 、R 51 =independently G or absent;
R 8 = G, U or absent;
R 22 、R 38 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III LYS Is sequence of (SEQ ID NO: 600),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Lys is:
R 0 、R 18 、R 23 =no existence of
R 9 、R 14 、R 34 、R 41 =independently a or absent;
R 40 = A, C or absent;
R 1 、R 3 、R 7 、R 31 =independently A, C, G or absent;
R 48 、R 65 、R 68 =independently N or absent;
R 2 、R 13 、R 17 、R 44 、R 63 、R 66 =independently A, C, U or absent;
R 5 、R 15 、R 19 、R 20 、R 25 、R 27 、R 29 、R 50 、R 52 、R 56 、R 70 、R 72 =independently A, G or absent;
R 6 、R 24 、R 32 、R 49 =independently A, G, U or absent;
R 12 、R 26 、R 46 、R 57 =independently A, U or absent;
R 11 、R 28 、R 35 、R 43 =independently C or absent;
R 10 、R 45 、R 61 =independently C, G or absent;
R 4 、R 21 、R 64 =independently C, G, U or absent;
R 37 、R 53 、R 55 、R 59 、R 60 、R 62 、R 67 、R 71 =independently C, U or absent;
R 33 、R 51 =independently G or absent;
R 8 、R 30 、R 58 、R 69 =independently G, U or absent;
R 16 、R 22 、R 36 、R 38 、R 39 、R 42 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Phenylalanine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I PHE Is sequence of (SEQ ID NO: 601),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Phe is:
R 0 、R 23 =no existence of
R 9 、R 14 、R 38 、R 39 、R 57 、R 72 =independently a or absent;
R 71 = A, C or absent;
R 41 、R 70 =independently A, C, G or absent;
R 4 、R 5 、R 6 、R 30 、R 31 、R 32 、R 34 、R 42 、R 44 、R 45 、R 46 、R 48 、R 49 、R 57 、R 62 、R 63 、R 66 、R 67 、R 68 、R 69 =independently N or absent;
R 16 、R 61 、R 65 =independently A, C, U or absent;
R 15 、R 26 、R 27 、R 29 、R 40 、R 56 =independently A, G or absent;
R 7 、R 51 =independently A, G, U or absent;
R 22 、R 24 =independently A, U or absent;
R 55 、R 60 =independently C or absent;
R 2 、R 3 、R 21 、R 33 、R 43 、R 50 、R 64 =independently C, G, U or absent;
R 11 、R 12 、R 13 、R 17 、R 28 、R 35 、R 36 、R 59 =independently C, U or absent;
R 10 、R 19 、R 20 、R 25 、R 37 、R 52 =independently G or absent;
R 1 = G, U or absent;
R 8 、R 18 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II PHE (SEQ ID NO: 602),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Phe is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 24 、R 38 、R 39 、R 57 、R 72 =independently a or absent;
R 46 、R 71 =independently A, C or absent;
R 4 、R 70 =independently A, C, G or absent;
R 45 = A, C, U or absent;
R 6 、R 7 、R 15 、R 26 、R 27 、R 32 、R 34 、R 40 、R 41 、R 56 、R 69 =independently A, G or absent;
R 29 = A, G, U or absent;
R 5 、R 9 、R 67 =independently A, U or absent;
R 35 、R 49 、R 55 、R 60 =independently C or absent;
R 21 、R 43 、R 62 =independently C, G or absent;
R 2 、R 33 、R 68 =independently C, G, U or absent;
R 3 、R 11 、R 12 、R 13 、R 28 、R 30 、R 36 、R 42 、R 44 、R 48 、R 58 、R 59 、R 61 、R 66 =independently C, U or absent;
R 10 、R 19 、R 20 、R 25 、R 37 、R 51 、R 52 、R 63 、R 64 =independently G or absent;
R 1 、R 31 、R 50 =independently G, U or absent;
R 8 、R 16 、R 17 、R 22 、R 53 、R 54 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III PHE (SEQ ID NO: 603),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Phe is:
R 0 、R 18 、R 22 、R 23 =no existence of
R 5 、R 7 、R 14 、R 24 、R 26 、R 32 、R 34 、R 38 、R 39 、R 41 、R 57 、R 72 =independently a or absent;
R 46 = A, C or absent;
R 70 = A, C, G or absent;
R 4 、R 6 、R 15 、R 56 、R 69 =independently A, G or absent;
R 9 、R 45 =independently A, U or absent;
R 2 、R 11 、R 13 、R 35 、R 43 、R 49 、R 55 、R 60 、R 68 、R 71 =independently C or absent;
R 33 = C, G or absent;
R 3 、R 28 、R 36 、R 48 、R 58 、R 59 、R 61 =independently C, U or absent;
R 1 、R 10 、R 19 、R 20 、R 21 、R 25 、R 27 、R 29 、R 37 、R 40 、R 51 、R 52 、R 62 、R 63 、R 64 =independently G or absent;
R 8 、R 12 、R 16 、R 17 、R 30 、R 31 、R 42 、R 44 、R 50 、R 53 、R 54 、R 65 、R 66 、R 67 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Proline TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I PRO Is sequence of (SEQ ID NO: 604),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Pro:
R 0 =no existence of
R 14 、R 57 =independently a or absent;
R 70 、R 72 =independently A, C or absent;
R 9 、R 26 、R 27 =independently A, C, G or absent;
R 4 、R 5 、R 6 、R 16 、R 21 、R 29 、R 30 、R 31 、R 32 、R 33 、R 34 、R 37 、R 41 、R 42 、R 43 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 61 、R 62 、R 63 、R 64 、R 66 、R 67 、R 68 =independently N or absent;
R 35 、R 65 =independently A, C, U or absent;
R 24 、R 40 、R 56 =independently A, G or absent;
R 7 、R 25 、R 51 =independently A, G, U or absent;
R 55 、R 60 =independently C or absent;
R 1 、R 3 、R 71 =independently C, G or absent;
R 11 、R 12 、R 20 、R 69 =independently C, G, U or absent;
R 13 、R 17 、R 18 、R 22 、R 23 、R 28 、R 59 =independently C, U or absent;
R 10 、R 15 、R 19 、R 38 、R 39 、R 52 =independently G or absent;
R 2 =independently G, U or absent;
R 8 、R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II PRO (SEQ ID NO: 605),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Pro:
R 0 、R 17 、R 18 、R 22 、R 23 =absent;
R 14 、R 45 、R 56 、R 57 、R 58 、R 65 、R 68 =independently a or absent;
R 61 = A, C, G or absent;
R 43 =n or absent;
R 37 = A, C, U or absent;
R 24 、R 27 、R 33 、R 40 、R 44 、R 63 =independently A, G or absent;
R 3 、R 12 、R 30 、R 32 、R 48 、R 55 、R 60 、R 70 、R 71 、R 72 =independently C or absent;
R 5 、R 34 、R 42 、R 66 =independently C, G or absent;
R 20 = C, G, U or absent;
R 35 、R 41 、R 49 、R 62 =independently C, U or absent;
R 1 、R 2 、R 6 、R 9 、R 10 、R 15 、R 19 、R 26 、R 38 、R 39 、R 46 、R 50 、R 51 、R 52 、R 64 、R 67 、R 69 =independently G or absent;
R 11 、R 16 =independently G, U or absent;
R 4 、R 7 、R 8 、R 13 、R 21 、R 25 、R 28 、R 29 、R 31 、R 36 、R 53 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III PRO (SEQ ID NO: 606),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Pro:
R 0 、R 17 、R 18 、R 22 、R 23 =no existence of
R 14 、R 45 、R 56 、R 57 、R 58 、R 65 、R 68 =independently a or absent;
R 37 = A, C, U or absent;
R 24 、R 27 、R 40 =independently A, G or absent;
R 3 、R 5 、R 12 、R 30 、R 32 、R 48 、R 49 、R 55 、R 60 、R 61 、R 62 、R 66 、R 70 、R 71 、R 72 =independently C or absent;
R 34 、R 42 =independently C, G or absent;
R 43 = C, G, U or absent;
R 41 = C, U or absent;
R 1 、R 2 、R 6 、R 9 、R 10 、R 15 、R 19 、R 20 、R 26 、R 33 、R 38 、R 39 、R 44 、R 46 、R 50 、R 51 、R 52 、R 63 、R 64 、R 67 、R 69 =independently G or absent;
R 16 = G, U or absent;
R 4 、R 7 、R 8 、R 11 、R 13 、R 21 、R 25 、R 28 、R 29 、R 31 、R 35 、R 36 、R 53 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Serine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I SER (SEQ ID NO: 607),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Ser:
R 0 =absent;
R 14 、R 24 、R 57 =independently a or absent;
R 41 = A, C or absent;
R 2 、R 3 、R 4 、R 5 、R 6 、R 7 、R 9 、R 10 、R 11 、R 12 、R 13 、R 16 、R 21 、R 25 、R 26 、R 27 、R 28 、R 30 、R 31 、R 32 、R 33 、R 34 、R 37 、R 42 、R 43 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 62 、R 63 、R 64 、R 65 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 18 = A, C, U or absent;
R 15 、R 40 、R 51 、R 56 =independently A, G or absent;
R 1 、R 29 、R 58 、R 72 =independently A, G, U or absent;
R 39 = A, U or absent;
R 60 either =c or absent;
R 38 = C, G or absent;
R 17 、R 22 、R 23 、R 71 =independently C, G, U or absent;
R 8 、R 35 、R 36 、R 55 、R 59 、R 61 =independently C, U or absent;
R 19 、R 20 =independently G or absent;
R 52 = G, U or absent;
R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II SER (SEQ ID NO: 608),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Ser:
R 0 、R 23 =no existence of
R 14 、R 24 、R 41 、R 57 =independently a or absent;
R 44 = A, C or absent;
R 25 、R 45 、R 48 =independently A, C, G or absent;
R 2 、R 3 、R 4 、R 5 、R 37 、R 50 、R 62 、R 66 、R 67 、R 69 、R 70 =independently N or absent;
R 12 、R 28 、R 65 =independently A, C, U or absent;
R 9 、R 15 、R 29 、R 34 、R 40 、R 56 、R 63 =independently A, G or absent;
R 7 、R 26 、R 30 、R 33 、R 46 、R 58 、R 72 =independently A, G, U or absent;
R 39 = A, U or absent;
R 11 、R 35 、R 60 、R 61 =independently C or absent;
R 13 、R 38 =independently C, G or absent;
R 6 、R 17 、R 31 、R 43 、R 64 、R 68 =independently C, G, U or absent;
R 36 、R 42 、R 49 、R 55 、R 59 、R 71 =independently C, U or absent;
R 10 、R 19 、R 20 、R 27 、R 51 =independently G or absent;
R 1 、R 16 、R 32 、R 52 =independently G, U or absent;
R 8 、R 18 、R 21 、R 22 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III SER Is sequence of (SEQ ID NO: 609),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and is common to Ser:
R 0 、R 23 =no existence of
R 14 、R 24 、R 41 、R 57 、R 58 =independently a or absent;
R 44 = A, C or absent;
R 25 、R 48 =independently A, C, G or absent;
R 2 、R 3 、R 5 、R 37 、R 66 、R 67 、R 69 、R 70 =independently N or absent;
R 12 、R 28 、R 62 =independently A, C, U or absent;
R 7 、R 9 、R 15 、R 29 、R 33 、R 34 、R 40 、R 45 、R 56 、R 63 =independently A, G or absent;
R 4 、R 26 、R 46 、R 50 =independently A, G, U or absent;
R 30 、R 39 =independently A, U or absent;
R 11 、R 17 、R 35 、R 60 、R 61 =independently C or absent;
R 13 、R 38 =independently C, G or absent;
R 6 、R 64 =independently C, G, U or absent;
R 31 、R 42 、R 43 、R 49 、R 55 、R 59 、R 65 、R 68 、R 71 =independently C, U or absent;
R 10 、R 19 、R 20 、R 27 、R 51 、R 52 =independently G or absent;
R 1 、R 16 、R 32 、R 72 =independently G, U or absent;
R 8 、R 18 、R 21 、R 22 、R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Threonine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I THR (SEQ ID NO: 610),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Thr is:
R 0 、R 23 =no existence of
R 14 、R 41 、R 57 =independently a or absent;
R 56 、R 70 =independently A, C, G or absent;
R 4 、R 5 、R 6 、R 7 、R 12 、R 16 、R 26 、R 30 、R 31 、R 32 、R 34 、R 37 、R 42 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 62 、R 63 、R 64 、R 65 、R 66 、R 67 、R 68 、R 72 =independently N or absent;
R 13 、R 17 、R 21 、R 35 、R 61 =independently A, C, U or absent;
R 1 、R 9 、R 24 、R 27 、R 29 、R 69 =independently A, G or absent;
R 15 、R 25 、R 51 =independently A, G, U or absent;
R 40 、R 53 =independently A, U or absent;
R 33 、R 43 =independently C, G or absent;
R 2 、R 3 、R 59 =independently C, G, U or absent;
R 11 、R 18 、R 22 、R 28 、R 36 、R 54 、R 55 、R 60 、R 71 =independently C, U or absent;
R 10 、R 20 、R 38 、R 52 =independently G or absent;
R 19 = G, U or absent;
R 8 、R 39 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II THR Is sequence of (SEQ ID NO: 611),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Thr is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 41 、R 57 =independently a or absent;
R 9 、R 42 、R 44 、R 48 、R 56 、R 70 =independently A, C, G or absent;
R 4 、R 6 、R 12 、R 26 、R 49 、R 58 、R 63 、R 64 、R 66 、R 68 =independently N or absent;
R 13 、R 21 、R 31 、R 37 、R 62 =independently A, C, U or absent;
R 1 、R 15 、R 24 、R 27 、R 29 、R 46 、R 51 、R 69 =independently A, G or absent;
R 7 、R 25 、R 45 、R 50 、R 67 =independently A, G, U or absent;
R 40 、R 53 =independently A, U or absent;
R 35 either =c or absent;
R 33 、R 43 =independently C, G or absent;
R 2 、R 3 、R 5 、R 16 、R 32 、R 34 、R 59 、R 65 、R 72 =independently C, G, U or absent;
R 11 、R 17 、R 22 、R 28 、R 30 、R 36 、R 55 、R 60 、R 61 、R 71 =independently C, U or absent;
R 10 、R 19 、R 20 、R 38 、R 52 =independently G or absent;
R 8 、R 39 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III THR Is sequence of (SEQ ID NO: 612),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Thr is:
R 0 、R 18 、R 23 =no existence of
R 14 、R 40 、R 41 、R 57 =independently a or absent;
R 44 = A, C or absent;
R 9 、R 42 、R 48 、R 56 =independently A, C, G or absent;
R 4 、R 6 、R 12 、R 26 、R 58 、R 64 、R 66 、R 68 =independently N or absent;
R 13 、R 21 、R 31 、R 37 、R 49 、R 62 =independently A, C, U or absent;
R 1 、R 15 、R 24 、R 27 、R 29 、R 46 、R 51 、R 69 =independently A, G or absent;
R 7 、R 25 、R 45 、R 50 、R 63 、R 67 =independently A, G, U or absent;
R 53 = A, U or absent;
R 35 either =c or absent;
R 2 、R 33 、R 43 、R 70 =independently C, G or absent;
R 5 、R 16 、R 34 、R 59 、R 65 =independently C, G, U or absent;
R 3 、R 11 、R 22 、R 28 、R 30 、R 36 、R 55 、R 60 、R 61 、R 71 =independently C, U or absent;
R 10 、R 19 、R 20 、R 38 、R 52 =independently G or absent;
R 32 = G, U or absent;
R 8 、R 17 、R 39 、R 54 、R 72 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Tryptophan TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I TRP (SEQ ID NO: 613),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Trp is:
R 0 =absent;
R 24 、R 39 、R 41 、R 57 =independently a or absent;
R 2 、R 3 、R 26 、R 27 、R 40 、R 48 =independently A, C, G or absent;
R 4 、R 5 、R 6 、R 29 、R 30 、R 31 、R 32 、R 34 、R 42 、R 44 、R 45 、R 46 、R 49 、R 51 、R 58 、R 63 、R 66 、R 67 、R 68 =independently N or absent;
R 13 、R 14 、R 16 、R 18 、R 21 、R 61 、R 65 、R 71 =independently A, C, U or absent;
R 1 、R 9 、R 10 、R 15 、R 33 、R 50 、R 56 =independently A, G or absent;
R 7 、R 25 、R 72 =independently A, G, U or absent;
R 37 、R 38 、R 55 、R 60 =independently C or absent;
R 12 、R 35 、R 43 、R 64 、R 69 、R 70 =independently C, G, U or absent;
R 11 、R 17 、R 22 、R 28 、R 59 、R 62 =independently C, U or absent;
R 19 、R 20 、R 52 =independently G or absent;
R 8 、R 23 、R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II TRP (SEQ ID NO: 614),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Trp is:
R 0 、R 18 、R 22 、R 23 =no existence of
R 14 、R 24 、R 39 、R 41 、R 57 、R 72 =independently a or absent;
R 3 、R 4 、R 13 、R 61 、R 71 =independently A, C or absent;
R 6 、R 44 =independently A, C, G or absent;
R 21 = A, C, U or absent;
R 2 、R 7 、R 15 、R 25 、R 33 、R 34 、R 45 、R 56 、R 63 =independently A, G or absent;
R 58 = A, G, U or absent;
R 46 = A, U or absent;
R 37 、R 38 、R 55 、R 60 、R 62 =independently C or absent;
R 12 、R 26 、R 27 、R 35 、R 40 、R 48 、R 67 =independently C, G or absent;
R 32 、R 43 、R 68 =independently C, G, U or absent;
R 11 、R 16 、R 28 、R 31 、R 49 、R 59 、R 65 、R 70 =independently C, U or absent;
R 1 、R 9 、R 10 、R 19 、R 20 、R 50 、R 52 、R 69 =independently G or absent;
R 5 、R 8 、R 29 、R 30 、R 42 、R 51 、R 64 、R 66 =independently G, U or absent;
R 17 、R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III TRP (SEQ ID NO: 615),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Trp is:
R 0 、R 18 、R 22 、R 23 =no existence of
R 14 、R 24 、R 39 、R 41 、R 57 、R 72 =independently a or absent;
R 3 、R 4 、R 13 、R 61 、R 71 =independently A, C or absent;
R 6 、R 44 =independently A, C, G or absent;
R 21 = A, C, U or absent;
R 2 、R 7 、R 15 、R 25 、R 33 、R 34 、R 45 、R 56 、R 63 =independently A, G or absent;
R 58 = A, G, U or absent;
R 46 = A, U or absent;
R 37 、R 38 、R 55 、R 60 、R 62 =independently C or absent;
R 12 、R 26 、R 27 、R 35 、R 40 、R 48 、R 67 =independently C, G or absent;
R 32 、R 43 、R 68 =independently C, G, U or absent;
R 11 、R 16 、R 28 、R 31 、R 49 、R 59 、R 65 、R 70 =independently C, U or absent;
R 1 、R 9 、R 10 、R 19 、R 20 、R 50 、R 52 、R 69 =independently G or absent;
R 5 、R 8 、R 29 、R 30 、R 42 、R 51 、R 64 、R 66 =independently G, U or absent;
R 17 、R 36 、R 53 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Tyrosine TREM consensus sequences
In one embodiment, a TREM disclosed herein comprises formula I TYR Is sequence of (SEQ ID NO: 616),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Tyr is:
R 0 =no existence of
R 14 、R 39 、R 57 =independently a or absent;
R 41 、R 48 、R 51 、R 71 =independently A, C, G or absent;
R 3 、R 4 、R 5 、R 6 、R 9 、R 10 、R 12 、R 13 、R 16 、R 25 、R 26 、R 30 、R 31 、R 32 、R 42 、R 44 、R 45 、R 46 、R 49 、R 50 、R 58 、R 62 、R 63 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 22 、R 65 =independently A, C, U or absent;
R 15 、R 24 、R 27 、R 33 、R 37 、R 40 、R 56 =independently A, G or absent;
R 7 、R 29 、R 34 、R 72 =independently A, G, U or absent;
R 23 、R 53 =independently A, U or absent;
R 35 、R 60 =independently C or absent;
R 20 = C, G or absent;
R 1 、R 2 、R 28 、R 61 、R 64 =independently C, G, U or absent;
R 11 、R 17 、R 21 、R 43 、R 55 =independently C, U or absent;
R 19 、R 52 =independently G or absent;
R 8 、R 18 、R 36 、R 38 、R 54 、R 59 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II TYR (SEQ ID NO: 617),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Tyr is:
R 0 、R 18 、R 23 =no existence of
R 7 、R 9 、R 14 、R 24 、R 26 、R 34 、R 39 、R 57 =independently a or absent;
R 44 、R 69 =independently A, C or absent;
R 71 = A, C, G or absent;
R 68 =n or absent;
R 58 = A, C, U or absent;
R 33 、R 37 、R 41 、R 56 、R 62 、R 63 =independently A, G or absent;
R 6 、R 29 、R 72 =independently A, G, U or absent;
R 31 、R 45 、R 53 =independently A, U or absent;
R 13 、R 35 、R 49 、R 60 =independently C or absent;
R 20 、R 48 、R 64 、R 67 、R 70 =independently C, G or absent;
R 1 、R 2 、R 5 、R 16 、R 66 =independently C, G, U or absent;
R 11 、R 21 、R 28 、R 43 、R 55 、R 61 =independently C, U or absent;
R 10 、R 15 、R 19 、R 25 、R 27 、R 40 、R 51 、R 52 =independently G or absent;
R 3 、R 4 、R 30 、R 32 、R 42 、R 46 =independently G, U or absent;
R 8 、R 12 、R 17 、R 22 、R 36 、R 38 、R 50 、R 54 、R 59 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III TYR (SEQ ID NO: 618),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Tyr is:
R 0 、R 18 、R 23 =no existence of
R 7 、R 9 、R 14 、R 24 、R 26 、R 34 、R 39 、R 57 、R 72 =independently a or absent;
R 44 、R 69 =independently A, C or absent;
R 71 = A, C, G or absent;
R 37 、R 41 、R 56 、R 62 、R 63 =independently A, G or absent;
R 6 、R 29 、R 68 =independently A, G, U or absent;
R 31 、R 45 、R 58 =independently A, U or absent;
R 13 、R 28 、R 35 、R 49 、R 60 、R 61 =independently C or absent;
R 5 、R 48 、R 62 、R 67 、R 70 =independently C, G or absent;
R 1 、R 2 =independently C, G, U or absent;
R 11 、R 16 、R 21 、R 43 、R 55 、R 66 =independently C, U or absent;
R 10 、R 15 、R 19 、R 20 、R 25 、R 27 、R 33 、R 40 、R 51 、R 52 =independently G or absent;
R 3 、R 4 、R 30 、R 32 、R 42 、R 46 =independently G, U or absent;
R 8 、R 12 、R 17 、R 22 、R 36 、R 38 、R 50 、R 53 、R 54 、R 59 、R 65 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Valine TREM consensus sequence
In one embodiment, a TREM disclosed herein comprises formula I VAL (SEQ ID NO: 619),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Val is:
R 0 、R 23 =absent;
R 24 、R 38 、R 57 =independently a or absent;
R 9 、R 72 =independently A, C, G or absent;
R 2 、R 4 、R 5 、R 6 、R 7 、R 12 、R 15 、R 16 、R 21 、R 25 、R 26 、R 29 、R 31 、R 32 、R 33 、R 34 、R 37 、R 41 、R 42 、R 43 、R 44 、R 45 、R 46 、R 48 、R 49 、R 50 、R 58 、R 61 、R 62 、R 63 、R 64 、R 65 、R 66 、R 67 、R 68 、R 69 、R 70 =independently N or absent;
R 17 、R 35 、R 59 =independently A, C, U or absent;
R 10 、R 14 、R 27 、R 40 、R 52 、R 56 =independently A, G or absent;
R 1 、R 3 、R 51 、R 53 =independently A, G, U or absent;
R 39 =C orAbsence of;
R 13 、R 30 、R 55 =independently C, G, U or absent;
R 11 、R 22 、R 28 、R 60 、R 71 =independently C, U or absent;
R 19 either =g or absent;
R 20 = G, U or absent;
R 8 、R 18 、R 36 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula II VAL (SEQ ID NO: 620),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Val is:
R 0 、R 18 、R 23 =absent;
R 24 、R 38 、R 57 =independently a or absent;
R 64 、R 70 、R 72 =independently A, C, G or absent;
R 15 、R 16 、R 26 、R 29 、R 31 、R 32 、R 43 、R 44 、R 45 、R 49 、R 50 、R 58 、R 62 、R 65 =independently N or absent;
R 6 、R 17 、R 34 、R 37 、R 41 、R 59 =independently A, C, U or absent;
R 9 、R 10 、R 14 、R 27 、R 40 、R 46 、R 51 、R 52 、R 56 =independently A, G or absent;
R 7 、R 12 、R 25 、R 33 、R 53 、R 63 、R 66 、R 68 =independently A, G, U or absent;
R 69 = A, U or absent;
R 39 either =c or absent;
R 5 、R 67 =independently C, G or absent;
R 2 、R 4 、R 13 、R 48 、R 55 、R 61 =independently C, G, U or absent;
R 11 、R 22 、R 28 、R 30 、R 35 、R 60 、R 71 =independently C, U or absent;
R 19 either =g or absent;
R 1 、R 3 、R 2 0、R 42 =independently G, U or absent;
R 8 、R 21 、R 36 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
In one embodiment, a TREM disclosed herein comprises formula III VAL (SEQ ID NO: 621),
R 0 -R 1 -R 2 -R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 14 -R 15 -R 16 -R 17 -R 18 -R 19 -R 20 -R 21 -R 22 -R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 29 -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 39 -R 40 -R 41 -R 42 -R 43 -R 44 -R 45 -R 46 -[R 47 ] x -R 48 -R 49 -R 50 -R 51 -R 52 -R 53 -R 54 -R 55 -R 56 -R 57 -R 58 -R 59 -R 60 -R 61 -R 62 -R 63 -R 64 -R 65 -R 66 -R 67 -R 68 -R 69 -R 70 -R 71 -R 72
wherein R is a ribonucleotide residue and common to Val is:
R 0 、R 18 、R 23 =no existence of
R 24 、R 38 、R 40 、R 57 、R 72 =independently a or absent;
R 29 、R 64 、R 70 =independently A, C, G or absent;
R 49 、R 50 、R 62 =independently N or absent;
R 16 、R 26 、R 31 、R 32 、R 37 、R 41 、R 43 、R 59 、R 65 =independently A, C, U or absent;
R 9 、R 14 、R 27 、R 46 、R 52 、R 56 、R 66 =independently A, G or absent;
R 7 、R 12 、R 25 、R 33 、R 44 、R 45 、R 53 、R 58 、R 63 、R 68 =independently A, G, U or absent;
R 69 = A, U or absent;
R 39 either =c or absent;
R 5 、R 67 =independently C, G or absent;
R 2 、R 4 、R 13 、R 15 、R 48 、R 55 =independently C, G, U or absent;
R 6 、R 11 、R 22 、R 28 、R 30 、R 34 、R 35 、R 60 、R 61 、R 71 =independently C, U or absent;
R 10 、R 19 、R 51 =independently G or absent;
R 1 、R 3 、R 20 、R 42 =independently G, U or absent;
R 8 、R 17 、R 21 、R 36 、R 54 =independently U or absent;
[R 47 ] x =n or absent;
where, for example, x=1-271 (e.g., x=1-250, x=1-225, x=1-200, x=1-175, x=1-150, x=1-125, x=1-100, x=1-75, x=1-50, x=1-40, x=1-30, x=1-29, x=1-28, x=1-27, x=1-26, x=1-25, x=1-24, x=1-23, x=1-22, x=1-21, x=1-20, x=1-19, x=1-18, x=1-17, x=1-16, x=1-15 x=1-14, x=1-13, x=1-12, x=1-11, x=1-10, x=10-271, x=20-271, x=30-271, x=40-271, x=50-271, x=60-271, x=70-271, x=80-271, x=100-271, x=125-271, x=150-271, x=175-271, x=200-271, x=225-271, x=1, x=2, x=3, x=4, x=5, x=6, x=7, x, x=8, x=9, x=10, x=11, x=12, x=13, x=14, x=15, x=16, x=17, x=18, x=19, x=20, x=21, x=22, x=23, x=24, x=25, x=26, x=27, x=28, x=29, x=30, x=40, x=50, x=60, x=70, x=80, x=90, x=100, x=110, x=125, x=150, x=175, x=200, x=225, x=250, or x=271),
Provided that the TREM has one or both of the following characteristics: no more than 15% of the residues are N; or no more than 20 residues are present.
Variable region consensus sequences
In one embodiment, the TREM disclosed herein is at position R 47 Where the variable region is contained. In one embodiment of the present invention, in one embodiment, the variable region is 1-271 ribonucleotides (e.g., 1-250, 1-225, 1-200, 1-175, 1-150, 1-125, 1-100, 1-75, 1-50, 1-40, 1-30, 1-29, 1-28, 1-27, 1-26, 1-25, 1-24, 1-23, 1-22, 1-21, 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 10-271, 20-271, 30-271) 40-271, 50-271, 60-271, 70-271, 80-271, 100-271, 125-271, 150-271, 175-271, 200-271, 225-271, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225. 250 or 271 ribonucleotides). In one embodiment, the variable region comprises any, all, or a combination of adenine, cytosine, guanine, or uracil.
In one embodiment, the variable region comprises a ribonucleic acid (RNA) sequence encoded by a deoxyribonucleic acid (DNA) sequence disclosed in Table 4 (e.g., any one of SEQ ID NOS: 452-561, as disclosed in Table 4).
Table 4: exemplary variable region sequences.
/>
/>
/>
/>
Corresponding nucleotide positions
To determine whether a selected nucleotide position in a candidate sequence corresponds to a selected position in a reference sequence (e.g., SEQ ID NO:622,SEQ ID NO:623,SEQ ID NO:624), one or more of the following evaluations are performed.
Evaluation a:
1. the candidate sequences were aligned with each of the consensus sequences in tables 9 and 10. One or more consensus sequences having the most aligned positions (and which have at least 60% of the aligned candidate sequences) are selected.
The comparison is performed as follows. When run with a matching score from Table 11 (mismatch penalty of-1, gap opening penalty of-1, gap extension penalty of-0.5, and no penalty for end gaps), the candidate sequences from tables 10A-10B and the equivalent decoder consensus sequences were aligned based on a global alignment calculated using the Needleman-Wunsch algorithm. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate sequence and the consensus sequence by counting the number of matching positions in the alignment, dividing it by the greater of the number of non-N bases in the candidate sequence or the consensus sequence, and multiplying the result by 100. In the case where the scores of the multiple alignments (candidate sequence and single consensus sequence) are the same, the percent similarity is the maximum percent similarity calculated from the alignments where these scores are the same. This process is repeated for each of the candidate sequences and the remaining equidecoder consensus sequences in tables 10A-10B and the alignment that results in the greatest percent similarity is selected. If the alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and is used to correlate positions in the candidate sequence with positions in the consensus sequence, otherwise the candidate sequence is considered not aligned with any of the equidecoder consensus sequences. If juxtaposition exists at this point, all associated consensus sequences will proceed to step 2 in the analysis.
2. Using one or more of the consensus sequences selected from step 1, a consensus sequence position number is determined that is aligned to a selected position (e.g., modified position) in the candidate sequence. The position numbers of aligned positions in the consensus sequence are then assigned to selected positions in the candidate sequence, in other words, the selected positions in the candidate sequence are numbered according to the number of the consensus sequence. If there are juxtaposed consensus sequences in step 1 and they give different position numbers in this step 2, all these position numbers will proceed to step 5.
3. The reference sequence is aligned with the consensus sequence selected in step 1. The comparison is performed as described in step 1.
4. From the alignment of step 3, the consensus sequence position number is determined that is aligned with the selected position (e.g., modified position) in the reference sequence. The position numbers of the aligned positions in the consensus sequence are then assigned to selected positions in the reference sequence, in other words, the selected positions in the reference sequence are numbered according to the number of the consensus sequence. If juxtaposition exists at this point, all associated consensus sequences will proceed to step 5 in the analysis.
5. If the value of the position number determined for the reference sequence in step 2 is the same as the value of the position number determined for the candidate sequence in step 4, the position is defined as corresponding.
Evaluation B:
the reference sequence (e.g., TREM sequences described herein) and the candidate sequence are aligned with each other. The comparison is performed as follows.
When run with a matching score from Table 11 (mismatch penalty of-1, gap opening penalty of-1, gap extension penalty of-0.5, and no penalty for end gaps), the reference and candidate sequences are aligned based on a global alignment calculated using the Needleman-Wunsch algorithm. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate sequence and the reference sequence by counting the number of matching bases in the alignment, dividing it by the greater of the number of non-N bases in the candidate sequence or the reference sequence, and multiplying the result by 100. In the case where the scores of the multiple alignments are the same, the percent similarity is the maximum percent similarity calculated from the alignments for which the scores are the same. If the alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and is used to correlate the position in the candidate sequence with the position in the reference sequence, otherwise the candidate sequence is considered not aligned with the reference sequence.
A selected nucleotide position (e.g., a modified position) in a reference sequence is defined as corresponding if it is paired with a selected nucleotide position (e.g., a modified position) in a candidate sequence.
Evaluation C:
the candidate sequences are assigned nucleotide position numbers according to the comprehensive tRNA numbering system (CtNS), also known as the tRNAviz method (e.g., as described in Lin et al, nucleic Acids Research [ nucleic acids research ],47:W1, pages W542-W547, 2019, 7, 2), which serves as a comprehensive numbering system for tRNA molecules. The comparison is performed as follows.
1. The candidate sequence was assigned nucleotide positions according to the tRNAviz method. For new sequences that do not exist in the tRNAviz database, the number of the closest sequence in the database will be obtained. For example, if TREM differs from sequences in the database at any given nucleotide position, the numbering of trnas having wild-type sequences at that given nucleotide position is used.
2. Nucleotide positions were assigned to the reference sequence according to the method described in 1.
3. If the value of the position number determined for the reference sequence in step 1 is the same as the value of the position number determined for the candidate sequence in step 2, the position is defined as corresponding.
If selected positions in the reference sequence and the candidate sequence are found to correspond in at least one of the evaluations A, B and C, these positions correspond. For example, if two locations are found to correspond under evaluation a, but not under evaluation B or evaluation C, then these locations are defined as corresponding. Similarly, if two locations are found to correspond under evaluation B, but not under evaluation a or evaluation C, then these locations are defined as corresponding. In addition, if two positions are found to correspond under evaluation C, but not under evaluation a or evaluation B, these positions are defined as corresponding.
The numbers given above are for ease of illustration and do not imply a required order. If multiple evaluations are performed, they may be performed in any order.
TABLE 10A common sequences computationally generated for each equidecoder by comparing members of a family of equidecoders
/>
/>
/>
/>
/>
TABLE 10B consensus sequences computationally generated for each equidecoder by comparing members of the equidecoder family
/>
/>
/>
/>
Table 11: score value alignment
/>
Method for preparing TREM, TREM core fragment and TREM fragment
Methods for synthesizing oligonucleotides are known in the art and can be used to prepare TREMs, TREM core fragments or TREM fragments disclosed herein. For example, TREM core fragment, or TREM fragment can be synthesized using solid phase synthesis or liquid phase synthesis.
In one embodiment, a TREM, TREM core fragment, or TREM fragment prepared according to the synthetic methods disclosed herein has a different modification profile compared to TREM expressed and isolated from cells or compared to naturally occurring trnas.
An exemplary method for preparing synthetic TREM via 5' -silyl-2 ' -orthoester (2 ' -ACE) chemistry is provided in example 3. The method provided in example 3 can also be used to prepare a synthetic TREM core fragment or a synthetic TREM fragment. Additional synthetic methods are disclosed in Hartsel SA et al, (2005) Oligonucleotide Synthesis [ oligonucleotide Synthesis ],033-050, the entire contents of which are hereby incorporated by reference.
TREM composition
In one embodiment, the TREM composition, e.g., TREM pharmaceutical composition, comprises a pharmaceutically acceptable excipient. Exemplary excipients include those provided in the FDA inactive ingredients database (https:// www.accessdata.fda.gov/scripts/cder/iig/index. Cfm).
In one embodiment, a TREM composition, such as a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 grams TREM, TREM core fragment, or TREM fragment. In one embodiment, a TREM composition, such as a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or 100 milligrams TREM, TREM core fragment, or TREM fragment.
In one embodiment, the TREM composition, e.g., TREM pharmaceutical composition, is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% dry weight TREM, TREM core fragment or TREM fragment.
In one embodiment, the TREM composition comprises at least 1x 10 6 A TREM molecule of at least 1x 10 7 A TREM molecule of at least 1x 10 8 A TREM molecule or at least 1x 10 9 A TREM molecule.
In one embodiment, the TREM composition comprises at least 1x 10 6 At least 1x 10 of TREM core fragment molecules 7 At least 1x 10 of TREM core fragment molecules 8 A TREM core fragment molecule or at least 1x 10 9 And (3) TREM core fragment molecules.
In one embodiment, the TREM composition comprises at least 1x 10 6 At least 1x 10 of TREM fragment molecules 7 At least 1x 10 of TREM fragment molecules 8 A TREM fragment molecule or at least 1x 10 9 And (3) TREM fragment molecules.
In one embodiment, the TREM composition produced by any of the methods of preparation disclosed herein can be loaded with amino acids using in vitro loading reactions known in the art.
In one embodiment, the TREM composition comprises one or more TREMs, TREM core fragments, or TREM fragments. In one embodiment, the TREM composition comprises a single species of TREM, TREM core fragment, or TREM fragment. In one embodiment, the TREM composition comprises a first TREM, TREM core fragment or TREM fragment species and a second TREM, TREM core fragment or TREM fragment species. In one embodiment, the TREM composition comprises X TREMs, TREM core fragments or TREM fragment categories, wherein X = 2, 3, 4, 5, 6, 7, 8, 9 or 10.
In one embodiment, the TREM, TREM core fragment, or TREM fragment has at least 70%, 75%, 80%, 85%, 90% or 95%, or 100% identity to a sequence encoded by a nucleic acid in table 1.
In one embodiment, TREM comprises the consensus sequences provided herein.
The TREM composition can be formulated as a liquid composition, a lyophilized composition, or a frozen composition.
In some embodiments, the TREM composition may be formulated to be suitable for pharmaceutical use, such as a pharmaceutical TREM composition. In one embodiment, the pharmaceutical TREM composition is substantially free of materials and/or reagents for isolating and/or purifying TREM, TREM core fragments or TREM fragments.
In some embodiments, the TREM composition may be formulated with water for injection. In some embodiments, the TREM composition formulated with water for injection is suitable for pharmaceutical use, e.g., comprises a pharmaceutical TREM composition.
TREM characterization
The TREM, TREM core fragment or TREM fragment produced by any of the methods disclosed herein, or TREM composition, e.g., a pharmaceutical TREM composition, can be evaluated for characteristics associated with TREM, TREM core fragment or TREM composition, e.g., TREM core fragment or TREM fragment purity, sterility, concentration, structure, or functional activity. Any of the above features may be evaluated by providing a value for the feature, for example, by evaluating or testing a TREM, TREM core fragment or TREM fragment, or TREM composition or an intermediate in TREM composition production. The value may also be compared to a standard value or a reference value. In response to the evaluation, the TREM composition may be classified, for example, as ready to release, as per production standards for human trials, as per ISO standards, as per cGMP standards, or as per other pharmaceutical standards. In response to the evaluation, the TREM composition can be further processed, e.g., it can be divided into aliquots, e.g., into single or multiple doses, placed in containers (e.g., end use vials), packaged, transported, or put into commerce. In embodiments, one or more features may be adjusted, treated, or reprocessed to optimize the TREM composition in response to the evaluation. For example, the TREM composition can be conditioned, processed, or reprocessed to (i) increase the purity of the TREM composition; (ii) reducing the amount of fragments in the composition; (iii) reducing the amount of endotoxin in the composition; (iv) increasing the in vitro translational activity of the composition; (v) increasing the TREM concentration of the composition; or (vi) inactivating or removing any viral contaminant present in the composition, e.g., by lowering the pH of the composition or by filtration.
In one embodiment, the TREM, TREM core fragment, or TREM fragment (e.g., TREM composition or intermediate in TREM composition production) has a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% by mass.
In one embodiment, a TREM (e.g., TREM composition or intermediate in TREM composition production) has less than 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% TREM fragments relative to full-length TREM.
In one embodiment, the TREM, TREM core fragment, or TREM fragment (e.g., TREM composition or intermediate in TREM composition production) has a low level of endotoxin or no endotoxin present, e.g., a negative result as measured by a Limulus Amoebocyte Lysate (LAL) test.
In one embodiment, the TREM, TREM core fragment, or TREM fragment (e.g., TREM composition or intermediate in TREM composition production) has in vitro translational activity as measured by the assays described in examples 12-13.
In one embodiment, the TREM core fragment, or the TREM fragment (e.g., the TREM composition or an intermediate in the production of the TREM composition) has a TREM concentration of at least 0.1ng/mL, 0.5ng/mL, 1ng/mL, 5ng/mL, 10ng/mL, 50ng/mL, 0.1ug/mL, 0.5ug/mL, 1ug/mL, 2ug/mL, 5ug/mL, 10ug/mL, 20ug/mL, 30ug/mL, 40ug/mL, 50ug/mL, 60ug/mL, 70ug/mL, 80ug/mL, 100ug/mL, 200ug/mL, 300ug/mL, 500ug/mL, 1000ug/mL, 5000ug/mL, 10,000ug/mL, or 100,000 ug/mL.
In one embodiment, the TREM, TREM core fragment, or TREM fragment (e.g., TREM composition or intermediate in TREM composition production) is sterile, e.g., the composition or formulation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, the reconstituted composition or formulation meets USP <71> criteria, and/or the composition or formulation meets USP <85> criteria.
In one embodiment, the TREM, TREM core fragment, or TREM fragment (e.g., TREM composition or intermediate in TREM composition production) has undetectable levels of viral contaminants, e.g., has no viral contaminants. In one embodiment, any viral contaminants present in the composition, such as residual viruses, are inactivated or removed. In one embodiment, any viral contaminants, such as residual viruses, are inactivated, for example, by lowering the pH of the composition. In one embodiment, any viral contaminants, such as residual viruses, are removed, such as by filtration or other methods known in the art.
TREM administration
Any TREM composition or pharmaceutical composition described herein can be administered to a cell, tissue or subject, for example by direct administration to a cell, tissue and/or organ in vitro, ex vivo or in vivo. In vivo administration may be via, for example, local, systemic and/or parenteral routes, e.g., intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, genitourinary, intradermal, dermal, enteral, intravitreal, intracerebral, intrathecal or epidural routes.
Carrier and carrier
In some embodiments, a vector is used to deliver a TREM, TREM core fragment, or TREM fragment or TREM composition described herein to a cell, such as a mammalian cell or a human cell. The vector may be, for example, a plasmid or a virus. In some embodiments, the delivery is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the virus is an adeno-associated virus (AAV), a lentivirus, an adenovirus. In some embodiments, the system or components of the system are delivered to the cell with a virus-like particle or virion. In some embodiments, the delivery uses more than one virus, virus-like particle, or virosome.
Carrier agent
The TREM, TREM compositions, or pharmaceutical TREM compositions described herein may comprise a carrier, may be formulated with a carrier, or may be delivered in a carrier.
Viral vectors
The carrier can be a viral vector (e.g., a viral vector comprising sequences encoding TREM, TREM core fragments, or TREM fragments). The viral vector can be administered to a cell or subject (e.g., a human subject or animal model) to deliver TREM, TREM core fragment or TREM fragment, TREM composition, or pharmaceutical TREM composition.
Viral vectors may be administered systemically or locally (e.g., by injection). Viral genomes provide a rich source of vectors that can be used to efficiently deliver exogenous genes into mammalian cells. Viral genomes are known in the art as useful delivery vectors because polynucleotides contained within such genomes are typically incorporated into the nuclear genome of mammalian cells by universal or specialized transduction. These processes are part of the natural viral replication cycle and do not require the addition of proteins or agents to induce gene integration. Examples of viral vectors include retroviruses (e.g., retroviral family viral vectors), adenoviruses (e.g., ad5, ad26, ad34, ad35, and Ad 48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative strand RNA viruses (e.g., orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), paramyxoviruses (e.g., measles and sendai viruses)), positive strand RNA viruses (e.g., picornaviruses and alphaviruses), and double stranded DNA viruses (including adenoviruses, herpesviruses (e.g., herpes simplex virus type 1 and type 2, epstein-barr viruses, cytomegalovirus, replication defective herpesviruses), and poxviruses (e.g., vaccinia, modified ankara (MVA), chicken pox, and canary pox)). Other viruses include, for example, norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepatitis virus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include: avian leukemia sarcoma, avian type C virus, mammalian type C virus, B virus, D virus, oncogenic retrovirus, HTLV-BLV group, lentivirus, alpha retrovirus, gamma retrovirus, foamy virus (Coffin, J.M., retroviradae: the viruses and their replication [ retrovirus: virus and replication ], virology [ Virology ] (third edition) Lippincott-Raven [ LiPinscott-Ravin ], philadelphia, 1996). Other examples include murine leukemia virus, murine sarcoma virus, murine mammary tumor virus, bovine leukemia virus, feline sarcoma virus, avian leukemia virus, human T cell leukemia virus, baboon endogenous virus, gibbon ape leukemia virus, merson Pfizer (Mason Pfizer) monkey virus, monkey immunodeficiency virus, monkey sarcoma virus, rous sarcoma virus, and lentivirus. Other examples of carriers are described, for example, in U.S. patent No. 5,801,030, the teachings of which are incorporated herein by reference. In some embodiments, the system or components of the system are delivered to the cell with a virus-like particle or virion.
Cell and vesicle based vehicles
The TREM, TREM core fragments or TREM fragments, TREM compositions or pharmaceutical TREM compositions described herein can be administered to cells in vesicles or other membrane-based carriers.
In embodiments, a TREM, TREM core fragment or TREM fragment, or TREM composition or pharmaceutical TREM composition described herein is administered in or via a cell, vesicle, or other membrane-based carrier. In one embodiment, the TREM, TREM core fragment, TREM fragment, or TREM composition or pharmaceutical TREM composition may be formulated in a liposome or other similar vesicle. Liposomes are spherical vesicle structures composed of a lipid bilayer of one or more layers surrounding an inner aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasmatic enzymes, and transport their cargo across the biological membrane and the Blood Brain Barrier (BBB) (for reviews see, e.g., sphch and Navarro, journal of Drug Delivery [ journal of drug delivery ], volume 2011, article ID 469679, page 12, 2011.doi:10.1155/2011/469679).
Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to form liposomes as drug carriers. Methods of preparing multilamellar vesicle lipids are known in the art (see, e.g., U.S. patent No. 6,693,086, the teachings of which are incorporated herein by reference for multilamellar vesicle lipid preparation). Although vesicle formation is spontaneous when lipid membranes are mixed with aqueous solutions, vesicle formation can also be accelerated by applying force in the form of oscillations using a homogenizer, sonicator or squeeze device (for reviews see, e.g., spuch and Navarro, journal of Drug Delivery [ J. Drug delivery ], volume 2011, article ID 469679, page 12, 2011.doi:10.1155/2011/469679). The extruded lipids may be prepared by extrusion through a filter having a reduced size, as described in Templeton et al, nature Biotech [ Nature Biotech ],15:647-652,1997, the teachings of which are incorporated herein by reference for the preparation of extruded lipids.
Lipid nanoparticles are another example of a carrier that provides a biocompatible and biodegradable delivery system for a TREM, TREM core fragment, TREM fragment, or TREM composition or pharmaceutical TREM composition described herein. Nanostructured Lipid Carriers (NLCs) are modified Solid Lipid Nanoparticles (SLNs) that retain the properties of SLNs, improve drug stability and drug loading, and prevent drug leakage. Polymeric Nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLN), a novel carrier combining liposomes and polymers, can also be used. These nanoparticles have the complementary advantage of PNP and liposomes. PLN is composed of a core-shell structure; the polymer core provides a stable structure and the phospholipid shell provides good biocompatibility. Thus, the two components improve the effective drug encapsulation, promote surface modification, and prevent leakage of water-soluble drugs. For reviews, see, for example, li et al 2017, nanomaterials [ nanomaterials ]7,122; doi 10.3390/nano7060122.
Exemplary lipid nanoparticles are disclosed in international application PCT/US2014/053907, the entire contents of which are hereby incorporated by reference. For example, the LNP described in paragraphs [403-406] or [410-413] of PCT/US2014/053907 may be used as a carrier for a TREM, a TREM core fragment, a TREM fragment, or a TREM composition or a pharmaceutical TREM composition as described herein.
Other exemplary lipid nanoparticles are disclosed in U.S. patent 10,562,849, the entire contents of which are hereby incorporated by reference. For example, LNPs having formula (I) described in columns 1-3 of us patent 10,562,849 can be used as carriers for TREMs, TREM core fragments, TREM fragments, or TREM compositions or pharmaceutical TREM compositions described herein.
Lipids that can be used to form nanoparticles (e.g., lipid nanoparticles) include those described in table 4 of WO 2019217941, for example, which is incorporated by reference. For example, the lipid-containing nanoparticle may comprise one or more of the lipids in table 4 of WO 2019217941. The lipid nanoparticle may comprise additional elements, such as polymers, such as the polymers described in table 5 of WO 2019217941, which is incorporated by reference.
In some embodiments, the conjugated lipid, when present, may include one or more of the following: PEG-Diacylglycerols (DAG) (such as l- (monomethoxy-polyethylene glycol) -2, 3-dimyristoylglycerol (PEG-DMG)), PEG-Dialkoxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinic diacylglycerols (PEGs-DAG) (such as 4-0- (2 ',3' -di (tetradecanoyloxy) propyl-l-0- (w-methoxy (polyethoxy) ethyl) succinate (PEG-S-DMG)), PEG dialkoxypropyl carbamate, N- (carbonyl-methoxy polyethylene glycol 2000) -1, 2-distearoyl-sn-glycerol-3-phosphate ethanolamine sodium salt, as well as those described in table 2 of WO 2019051289 (incorporated by reference) and combinations of the foregoing.
In some embodiments, sterols that may be incorporated into the lipid nanoparticle include one or more of cholesterol or cholesterol derivatives, such as those in WO 2009/127060 or US 2010/013088, which are incorporated by reference. Additional exemplary sterols include plant sterols, including those described in Eygeris et al (2020), incorporated herein by reference.
In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits aggregation of the particles, and a sterol. The amounts of these components may be varied independently to achieve the desired characteristics. For example, in some embodiments, the lipid nanoparticle comprises: an ionizable lipid in an amount of about 20mol% to about 90mol% of the total lipid (in other embodiments, it may be 20% -70% (mol), 30% -60% (mol), or 40% -50% (mol); about 50mol% to about 90 mol%) of the total lipid present in the lipid nanoparticle; the amount of the non-cationic lipid is about 5mol% to about 30mol% of the total lipid; the conjugated lipid is present in an amount of about 0.5mol% to about 20mol% of the total lipid and the sterol is present in an amount of about 20mol% to about 50mol% of the total lipid. The ratio of total lipid to nucleic acid may be varied as desired. For example, the ratio of total lipid to nucleic acid (mass or weight) may be about 10:1 to about 30:1.
In some embodiments, the ratio of lipid to nucleic acid (mass/mass ratio; w/w ratio) may be in the following range: about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to provide a desired N/P ratio, such as an N/P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or higher. Typically, the total lipid content of the lipid nanoparticle formulation may range from about 5mg/mL to about 30 mg/mL.
Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for delivery of compositions described herein, e.g., nucleic acids (e.g., RNAs) described herein include:
in some embodiments, an LNP comprising formula (i) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (ii) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (iii) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (v) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (vi) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (viii) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (ix) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
Wherein X is 1 Is O, NR 1 Or a direct bond, X 2 Is C2-5 alkylene, X 3 Is C (=O) or a direct bond, R 1 Is H or Me, R 3 Is Ci-3 alkyl, R 2 Is Ci-3 alkyl, or R 2 To which nitrogen atom and X are attached 2 Together 1-3 carbon atoms of (a) form a 4-, 5-or 6-membered ring, or X 1 Is NR 1 ，R 1 And R is 2 Together with the nitrogen atom to which they are attached form a 5-or 6-membered ring, or R 2 And R is R 3 Together with the nitrogen atom to which they are attached form a 5-, 6-or 7-membered ring, Y 1 Is C2-12 alkylene, Y 2 Selected from the group consisting of
n is 0 to 3, R 4 Is Ci-15 alkyl, Z 1 Is Ci-6 alkylene or a direct bond, Z 2 Is that(in either orientation) or absent, provided that if Z 1 Is a direct bond, then Z 2 Absence of; r is R 5 Is C5-9 alkyl or C6-10 alkoxy, R 6 Is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R 7 H or Me, or salts thereof, provided that if R 3 And R is 2 Is C2 alkyl, X 1 Is O, X 2 Is a linear C3 alkylene group, X 3 C (=0), Y 1 Is a linear Ce alkylene group, (Y) 2 )n-R 4 Is thatR 4 Is a linear C5 alkyl group, Z 1 Is C2 alkylene, Z 2 Absent, W is methylene, R 7 Is H, then R 5 And R is 6 Not Cx alkoxy.
In some embodiments, an LNP comprising formula (xii) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
In some embodiments, an LNP comprising formula (xi) is used to deliver a TREM composition described herein to the liver and/or hepatocytes.
Wherein->
In some embodiments, the LNP comprises a compound having formula (xiii) and a compound having formula (xiv).
In some embodiments, LNP comprising formula (xv) is used to deliver TREM compositions described herein to the liver and/or hepatocytes.
In some embodiments, LNP comprising a formulation of formula (xvi) is used to deliver a TREM composition described herein to lung endothelial cells.
Wherein->
In some embodiments, the lipid compound used to form the lipid nanoparticle for delivery of the compositions described herein (e.g., TREMs described herein) is prepared by one of the following reactions:
in some embodiments, the compositions described herein (e.g., TREM compositions) are provided in LNP comprising ionizable lipids. In some embodiments, the ionizable lipid is heptadec-9-yl 8- ((2-hydroxyethyl) (6-oxo-6- (undecyloxy) hexyl) amino) octanoate (SM-102); for example as described in example 1 of US9,867,888 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (9 z,12 z) -3- ((4, 4-bis (octyloxy) butanoyl) oxy) -2- (((((3- (diethylamino) propoxy) carbonyl) oxy) methyl) propyloctadeca-9, 12-dienoate (LP 01), e.g., as synthesized in example 13 of WO 2015/095340 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 9- ((4-dimethylamino) butyryl) oxy) heptadecanedioic acid di ((Z) -non-2-en-1-yl) ester (L319), e.g., as synthesized in example 7, example 8, or example 9 of US2012/0027803 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 1,1' - ((2- (4- (2- ((2- (bis (2-hydroxydodecylamino) ethyl) piperazin-1-yl) ethyl) azetidinediyl) bis (dodecane-2-ol) (C12-200), e.g., as synthesized in examples 14 and 16 of WO 2010/053572, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is an Imidazole Cholesterol Ester (ICE) lipid (3 s,10R,13R, 17R) -10, 13-dimethyl-17- ((R) -6-methylhept-2-yl) -2,3,4,7,8,9,10,11,12,13,14,15,16,17-decatetrahydro-lH-cyclopenta [ a ] phenanthren-3-yl 3- (1H-imidazol-4-yl) propionate, such as structure (I) from WO 2020/106946 (incorporated herein by reference in its entirety).
In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, such as a cationic lipid that may exist in a positively charged form or a neutral form depending on pH, or an amine-containing lipid that may be readily protonated. In some embodiments, the cationic lipid is a lipid that is capable of being positively charged, for example, under physiological conditions. Exemplary cationic lipids include one or more positively charged amine groups. In some embodiments, the lipid particles comprise a cationic lipid formulated with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), PEG, cholesterol, and polymer conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids as disclosed herein may have an effective pKa of greater than 6.0. In embodiments, the lipid nanoparticle may comprise a second cationic lipid having an effective pKa different from (e.g., greater than) the first cationic lipid. The lipid nanoparticle may comprise 40 to 60 mole% of cationic lipids, neutral lipids, steroids, polymer conjugated lipids, and therapeutic agents (e.g., TREMs described herein) encapsulated within or associated with the lipid nanoparticle. In some embodiments, TREM is co-formulated with a cationic lipid. TREM can adsorb to the surface of LNP (e.g., LNP comprising cationic lipids). In some embodiments, TREM may be encapsulated in an LNP (e.g., an LNP comprising a cationic lipid). In some embodiments, the lipid nanoparticle may comprise a targeting moiety, e.g., a targeting moiety coated with a targeting agent. In an embodiment, the LNP formulation is biodegradable. In some embodiments, lipid nanoparticles comprising one or more lipids described herein (e.g., formulas (i), (ii), (vii), and/or (ix)) encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% TREM.
Exemplary ionizable lipids that can be used in the lipid nanoparticle formulation include, but are not limited to, those listed in table 1 of WO 2019051289, which is incorporated by reference herein. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: x of US 2016/0311759; i in US 20150376115 or US 2016/0376224; i, II or III of US 20160151284; i, IA, II or IIA of US 20170210967; i-c of US 20150140070; a of US 2013/0178541; US 2013/0303587 or US 2013/01233338; US 2015/0141678I; II, III, IV or V of US 2015/0239218; i of US 2017/019904; i or II of WO 2017/117528; a of US 2012/0149894; a of US 2015/0057373; a of WO 2013/116126; a of US 2013/0090372; a of US 2013/0274523; a of US 2013/0274504; a of US 2013/0053572; a of WO 2013/016058; a of WO 2012/162210; i of US 2008/042973; i, II, III or IV of US 2012/01287870; i or II of US 2014/0200257; i, II or III of US 2015/0203446; i or III of US 2015/0005363; i, IA, IB, IC, ID, II, IIA, IIB, IIC, IID or III-XXIV of US 2014/0308304; US 2013/0338210; i, II, III or IV of W0 2009/132131; a of US 2012/01011478; i or XXXV of US 2012/0027796; XIV or XVII of US 2012/0058144; US 2013/0323369; i of US 2011/017125; i, II or III of US 2011/0256175; i, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of US 2012/0202871; i, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV or XVI of US 2011/0076335; i or II of US 2006/008378; US 2013/012338I; i or X-A-Y-Z of US 2015/0064242; XVI, XVII or XVIII of US 2013/0022649; i, II or III of US 2013/016307; i, II or III of US 2013/016307; i or II of US 2010/0062967; I-X of US 2013/0189351; i of US 2014/0039032; v of US 2018/0028664; i of US 2016/0317458; i of US 2013/0195920; 5, 6 or 10 of US10,221,127; III-3 of WO 2018/081480; i-5 or I-8 of WO 2020/081938; 18 or 25 of US 9,867,888; a of US 2019/0136131; II of WO 2020/219876; 1 of US 2012/0027803; OF-02 OF US 2019/0240049; 23 of US10,086,013; cKK-E12/A6 by Miao et al (2020); c12-200 of WO 2010/053572; 7C1 of Dahlman et al (2017); 304-O13 or 503-O13 of Whitehead et al; TS-P4C2 of US 9,708,628; i of WO 2020/106946; WO 2020/106946.
In some embodiments, the ionizable lipid is MC3 (6 z,9z,28z,3 lz) -heptadecane-6, 9,28,3 l-tetraen-l 9-yl-4- (dimethylamino) butyrate (DLin-MC 3-DMA or MC 3), e.g., as described in example 9 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, e.g., as described in example 10 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (l 3Z, l 6Z) -a, a-dimethyl-3-nonylbehenyl-l 3, l 6-dien-l-amine (compound 32), e.g., as described in example 11 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, e.g., as described in example 12 of WO 2019051289A9 (incorporated herein by reference in its entirety).
Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycerophosphate-ethanolamine, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylcholine (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylethanolamine (DOPE), palmitoyl phosphatidylcholine (POPC), palmitoyl phosphatidylethanolamine (POPE), dioleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE) dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidyl ethanolamine (such as 16-O-monomethyl PE), dimethyl-phosphatidyl ethanolamine (such as 16-O-dimethyl PE), l 8-l-trans-PE, 1-stearoyl-2-oleoyl-phosphatidyl ethanolamine (SOPE), hydrogenated Soybean Phosphatidyl Choline (HSPC), lecithin (EPC), dioleoyl phosphatidyl serine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidyl choline (DMPC), dimyristoyl phosphatidyl glycerol (DMPG), distearoyl phosphatidyl glycerol (DSPG), bis-erucic phosphatidylcholine (DEPC), palmitoyl Oleoyl Phosphatidylglycerol (POPG), bis-elapsinyl phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, lecithin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphoric acid, lysophosphatidylcholine, di-linoleoyl phosphatidylcholine, or mixtures thereof. It should be understood that other diacyl phosphatidyl choline and diacyl phosphatidyl ethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, palmitoyl, stearoyl or oleoyl. In certain embodiments, additional exemplary lipids include, but are not limited to, those described by Kim et al (2020) dx.doi.org/10.1021/acs.nanolet.0c01386, which are incorporated herein by reference. In some embodiments, such lipids include plant lipids (e.g., DGTS) that were found to improve liver transfection with mRNA.
Other examples of non-cationic lipids suitable for use in the lipid nanoparticle include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glyceryl ricinoleate, cetyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate, polyethoxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramides, sphingomyelin, and the like. Other non-cationic lipids are described in WO 2017/099823 or U.S. patent publication US 2018/0028664, the contents of which are incorporated herein by reference in their entirety.
In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II or IV of US 2018/0028664, which is incorporated by reference in its entirety. The non-cationic lipids may comprise, for example, 0% -30% (mole) of the total lipids present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5% -20% (mole) or 10% -15% (mole) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid is about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).
In some embodiments, the lipid nanoparticle does not comprise any phospholipids.
In some aspects, the lipid nanoparticle may further comprise a component such as a sterol to provide membrane integrity. One exemplary sterol that can be used in the lipid nanoparticle is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogues such as 5 a-cholestanol, 53-cholestanol, cholestanyl- (2 '-hydroxy) -ethyl ether, cholestanyl- (4' -hydroxy) -butyl ether and 6-ketocholestanol; nonpolar analogs such as 5 a-cholestane, cholestenone, 5 a-cholestanone, 5 p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, e.g., cholesteryl- (4' -hydroxy) -butyl ether. Exemplary cholesterol derivatives are described in PCT publication WO 2009/127060 and U.S. patent publication US 2010/0130588, each of which is incorporated herein by reference in its entirety.
In some embodiments, the component that provides membrane integrity, such as sterols, may comprise 0-50% (mole) (e.g., 0-10%, 10% -20%, 20% -30%, 30% -40%, or 40% -50%) of the total lipids present in the lipid nanoparticle. In some embodiments, such components are 20% -50% (mole), 30% -40% (mole) of the total lipid content of the lipid nanoparticle.
In some embodiments, the lipid nanoparticle may comprise polyethylene glycol (PEG) or conjugated lipid molecules. Typically, these are used to inhibit aggregation of lipid nanoparticles and/or to provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ) -lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic Polymer Lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol) conjugated lipid.
Exemplary PEG-lipid conjugates include, but are not limited to, PEG-Diacylglycerols (DAG) such as l- (monomethoxy-polyethylene glycol) -2, 3-dimyristoylglycerol (PEG-DMG), PEG-Dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramides (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinic diacylglycerols (PEGs-DAG) such as 4-0- (2 ',3' -di (tetradecanoyloxy) propyl-1-0- (w-methoxy (polyethoxy) ethyl) succinate (PEG-S-DMG), PEG dialkoxypropyl carbamate, N- (carbonyl-methoxy polyethylene glycol 2000) -l, additional exemplary PEG-lipid conjugates are described, for example, in U.S. Pat. No. 5,885,6l3, U.S. Pat. No. 6,287,59l, U.S. 2003/007829, U.S. Pat. No. 2005/0175682, U.S. Pat. No. 2008/0020058, U.S. Pat. No. 2011/017125, U.S. Pat. No. 2010/013088, U.S. Pat. No. 2016/0376224, U.S. Pat. No. 2017/019904, and U.S. Pat. No. 099823, all of which are incorporated herein by reference in their entirety, in some embodiments, the PEG-lipid is a compound of formula III, III-a-I, III-a-2, III-b-1, III-b-2, or V of U.S. Pat. No. 5,885,6l-2, the content of this patent document is incorporated herein by reference in its entirety. In some embodiments, the PEG-lipid has formula II of US 20150376115 or US2016/0376224, the contents of both of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristoxypropyl, PEG-dipalmitoxypropyl, or PEG-distearyloxy propyl. The PEG-lipid may be one or more of the following: PEG-DMG, PEG-dilauryl glycerol, PEG-dipalmitoyl glycerol, PEG-distearyl glycerol, PEG-dilauryl glycerolipid amide, PEG-dimyristoyl glycerolipid amide, PEG-dipalmitoyl glycerolipid amide, PEG-distearyl glycerolipid amide, PEG-cholesterol (l- [8' - (cholest-5-en-3 [ beta ] -oxy) carboxamide-3 ',6' -dioxaoctyl ] carbamoyl- [ omega ] -methyl-poly (ethylene glycol)), PEG-DMB (3, 4-ditetradecylbenzyl- [ omega ] -methyl-poly (ethylene glycol) ether) and 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N- [ methoxy (polyethylene glycol) -2000]. In some embodiments, the PEG-lipid comprises a structure selected from the group consisting of:
In some embodiments, lipids conjugated to molecules other than PEG may also be used in place of PEG-lipids. For example, polyoxazoline (POZ) -lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates may be used in place of or in addition to PEG-lipids.
Exemplary conjugated lipids (i.e., PEG-lipids, (POZ) -lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids) are described in PCT and LIS patent applications listed in table 2 of WO 2019051289 A9 (the contents of all of which are incorporated herein by reference in their entirety).
In some embodiments, PEG or conjugated lipid may comprise 0% -20% (mole) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid is present in an amount of 0.5% -10% or 2% -5% (mole) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipids, non-cationic lipids, sterols, and PEG/conjugated lipids can be varied as desired. For example, the lipid particle may comprise from 30% to 70% of the ionizable lipid by mole or total weight of the composition, from 0% to 60% cholesterol by mole or total weight of the composition, from 0% to 30% of the non-cationic lipid by mole or total weight of the composition, and from 1% to 10% conjugated lipid by mole or total weight of the composition. Preferably, the composition comprises 30% to 40% of ionizable lipids based on the moles or total weight of the composition, 40% to 50% of cholesterol based on the moles or total weight of the composition, and 10% to 20% of non-cationic lipids based on the moles or total weight of the composition. In some other embodiments, the composition is 50% -75% ionizable lipid by mole or total weight of the composition, 20% -40% cholesterol by mole or total weight of the composition, and 5% -10% non-cationic lipid by mole or total weight of the composition, and 1% -10% conjugated lipid by mole or total weight of the composition. The composition may contain 60% to 70% of ionizable lipids based on the moles or total weight of the composition, 25% to 35% of cholesterol based on the moles or total weight of the composition, and 5% to 10% of non-cationic lipids based on the moles or total weight of the composition. The composition may also contain up to 90% by mole or total weight of the composition of an ionizable lipid and from 2% to 15% by mole or total weight of the composition of a non-cationic lipid. The formulation may also be a lipid nanoparticle formulation, for example comprising 8% -30% of ionizable lipids, based on the moles or total weight of the composition, 5% -30% of non-cationic lipids, based on the moles or total weight of the composition, and 0-20% cholesterol, based on the moles or total weight of the composition; 4% -25% by mole or total weight of the composition of ionizable lipids, 4% -25% by mole or total weight of the composition of non-cationic lipids, 2% -25% by mole or total weight of the composition of cholesterol, 10% -35% by mole or total weight of the composition of conjugated lipids, and 5% by mole or total weight of the composition of cholesterol; or 2% -30% of ionizable lipids based on moles or total weight of the composition, 2% -30% of non-cationic lipids based on moles or total weight of the composition, 1% -15% of cholesterol based on moles or total weight of the composition, 2% -35% of conjugated lipids based on moles or total weight of the composition, and 1% -20% of cholesterol based on moles or total weight of the composition; or even up to 90% by moles or total weight of the composition of ionizable lipids and from 2% to 10% by moles or total weight of the composition of non-cationic lipids, or even 100% by moles or total weight of the composition of cationic lipids. In some embodiments, the lipid particle formulation comprises ionizable lipids, phospholipids, cholesterol, and pegylated lipids in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipids, cholesterol, and pegylated lipids in a molar ratio of 60:38.5:1.5.
In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a pegylated lipid, wherein the mole ratio of the lipid of the ionizable lipid is in the range of 20 to 70 mole percent, targeted at 40-60, the mole percent of the non-cationic lipid is in the range of 0 to 30, targeted at 0 to 15, the mole percent of the sterol is in the range of 20 to 70, targeted at 30 to 50, and the mole percent of the pegylated lipid is in the range of 1 to 6, targeted at 2 to 5.
In some embodiments, the lipid particle comprises ionizable lipid/non-cationic lipid/sterol/conjugated lipid in a molar ratio of 50:10:38.5:1.5.
In one aspect, the present disclosure provides lipid nanoparticle formulations comprising phospholipids, lecithins, phosphatidylcholines, and phosphatidylethanolamine.
In some embodiments, one or more additional compounds may also be included. Those compounds may be administered alone or additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticle may contain other compounds than the first nucleic acid in addition to the nucleic acid or at least the second nucleic acid. Other additional compounds may be selected from the group consisting of, without limitation: small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptidomimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.
In some embodiments, LNPs are directed to a specific tissue by adding a targeting domain. For example, biological ligands can be displayed on the surface of LNPs to enhance interaction with cells displaying cognate receptors, thereby facilitating association with and delivery of cargo to tissues in which the cells express the receptor. In some embodiments, the biological ligand may be a ligand that drives delivery to the liver, e.g., LNP displaying GalNAc facilitates delivery of the nucleic acid cargo to hepatocytes displaying asialoglycoprotein receptors (ASGPRs). Work by Akine et al Mol Ther [ molecular therapy ]18 (7): 1357-1364 (2010) teaches conjugation of trivalent GalNAc ligands to PEG-lipids (GalNAc-PEG-DSG) to produce an ASGPR dependent LNP to obtain observable LNP loading effects (see, e.g., akine et al 2010, supra, FIG. 6). Other LNP formulations exhibiting ligands, such as those incorporating folic acid, transferrin, or antibodies, are discussed in WO 2017223135, which is incorporated herein by reference in its entirety, and in addition, the references used therein are also incorporated herein: namely, kolhatkar et al, curr Drug Discov Technol [ contemporary drug discovery technique ]. 20118:197-206; musacchio and Tochiclin, front Biosci [ bioscience Front ]2011 16:1388-1412; yu et al, mol Membrane Biol [ molecular Membrane biology ]2010 27:286-298; patil et al, crit Rev Ther Drug Carrier Syst [ important comments on therapeutic drug carrier systems ]. 2008:25:1-61; benoit et al, biomacromolecules [ biomacromolecule ].2011 12:2708-2714; zhao et al, expert Opin Drug Deliv [ drug delivery expert view ].2008 5:309-319; akine et al Mol Ther [ molecular therapy ].2010 18:1357-1364; srinivasan et al, methods Mol Biol [ Methods of molecular biology ]. 2012:820:105-116; ben-Arie et al, methods Mol Biol [ Methods of molecular biology ].2012 757:497-507; peer 2010J Control Release [ journal of controlled release ].20:63-68; peer et al, proc Natl Acad Sci U S A [ Proc. Natl. Acad. Sci. USA ]2007104:4095-4100; kim et al, methods Mol Biol. [ Methods of molecular biology ] 201721:339-353; subramannya et al Mol Ther [ molecular therapy ].2010 18:2028-2037; song et al, nat Biotechnol. [ Nature Biotechnology ]2005 23:709-717; peer et al Science [ Science ]. 2008:319:627-630; and Peer and Lieberman, gene Ther [ Gene therapy ].201118:1127-1133.
In some embodiments, LNP is selected for tissue specific activity by adding a selective organ targeting (Selective ORgan Targeting, SORT) molecule to a formulation comprising traditional components, such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and poly (ethylene glycol) (PEG). The teachings of Cheng et al Nat Nanotechnol 15 (4): 313-320 (2020) demonstrate that the addition of a complementary "SORT" component can precisely alter the in vivo RNA delivery profile and mediate tissue-specific (e.g., lung, liver, spleen) gene delivery and editing, depending on the percentage and biophysical properties of the SORT molecule.
In some embodiments, the LNP comprises biodegradable ionizable lipids. In some embodiments, the LNP comprises (9 z, l2 z) -3- ((4, 4-bis (octyloxy) butanoyl) oxy) -2- (((((3- (diethylamino) propoxy) carbonyl) oxy) methyl) propyloctadeca-9, l 2-dienoate, also known as 3- ((4, 4-bis (octyloxy) butanoyl) oxy) -2- (((((3- (diethylamino) propoxy) carbonyl) oxy) methyl) propyl (9 z, l2 z) -octadeca-9, l 2-dienoate) or another ionizable lipid. See, e.g., WO 2019/067992, WO/2017/173054, WO 2015/095340 and WO 2014/136086, and the lipids of the references provided therein. In some embodiments, the terms cationic and ionizable are interchangeable in the context of LNP lipids, e.g., wherein the ionizable lipid is cationic according to pH.
In some embodiments, the mean LNP diameter of the LNP formulation may be between tens and hundreds of nm, as measured by Dynamic Light Scattering (DLS). In some embodiments, the mean LNP diameter of the LNP formulation can be about 40nm to about 150nm, such as about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm. In some embodiments, the mean LNP diameter of the LNP formulation can be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm. In some embodiments, the mean LNP diameter of the LNP formulation may be about 70nm to about 100nm. In particular embodiments, the mean LNP diameter of the LNP formulation may be about 80nm. In some embodiments, the mean LNP diameter of the LNP formulation may be about 100nm. In some embodiments, the LNP formulation has an average LNP diameter ranging from about l mm to about 500mm, from about 5mm to about 200mm, from about 10mm to about 100mm, from about 20mm to about 80mm, from about 25mm to about 60mm, from about 30mm to about 55mm, from about 35mm to about 50mm, or from about 38mm to about 42mm.
In some cases, the LNP may be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the LNP, e.g., the particle size distribution of the lipid nanoparticles. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The polydispersity index of the LNP may be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the LNP may be from about 0.10 to about 0.20.
The zeta potential of the LNP can be used to indicate the electrokinetic potential of the composition. In some embodiments, the zeta potential may describe the surface charge of the LNP. Lipid nanoparticles having a relatively low charge (positive or negative) are generally desirable because higher charged species may undesirably interact with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP may be from about-10 to about +20mV, from about-10 to about +15mV, from about-10 to about +10mV, from about-10 to about +5mV, from about-10 to about 0mV, from about-10 to about-5 mV, from about-5 to about +20mV, from about-5 to about +15mV, from about-5 to about +10mV, from about-5 to about +5mV, from about-5 to about 0mV, from about 0 to about +20mV, from about 0 to about +15mV, from about 0 to about +10mV, from about 0 to about +5mV, from about +5 to about +20mV, from about +5 to about +15mV, or from about +5 to about +10mV.
Encapsulation efficiency of TREM describes the amount of TREM that is encapsulated or otherwise associated with the LNP after preparation relative to the initial amount provided. Encapsulation efficiency is desirably high (e.g., near 100%). Encapsulation efficiency may be measured, for example, by comparing the amount of TREM in a solution containing lipid nanoparticles before and after disruption of the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in a solution. Fluorescence can be used to measure the amount of free TREM in the solution. For the lipid nanoparticles described herein, the encapsulation efficiency of TREM can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.
The LNP may optionally comprise one or more coatings. In some embodiments, the LNP may be formulated in a capsule, film, or tablet with a coating. Capsules, films or tablets comprising the compositions described herein may have any useful size, tensile strength, hardness or density.
Additional exemplary lipid, formulation, method and LNP characterizations are taught by WO 2020061457, which is incorporated herein by reference in its entirety.
In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (sameir Fisher) or a TransIT-mRNA transfection reagent (Mi Lusi organism (Mirus Bio)). In certain embodiments, LNP is formulated using a GenVoy ILM ionizable lipid mixture (precision nanosystems (Precision NanoSystems)). In certain embodiments, LNPs are formulated using 2, 2-dioleyleneyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC 2-DMA) or dioleylenemethyl-4-dimethylaminobutyrate (DLin-MC 3-DMA or MC 3), the formulation and in vivo use of which are taught in Jayaraman et al Angew Chem Int Ed Engl [ German application chemistry ]51 (34): 8529-8533 (2012), which is incorporated herein by reference in its entirety.
LNP formulations optimized for delivery of CRISPR-Cas systems (e.g., cas9-gRNA RNP, gRNA, cas9 mRNA) are described in WO 2019067992 and WO 2019067910, both incorporated by reference.
Additional specific LNP formulations useful for delivering nucleic acids, described in US 8158601 and US 8168775, both incorporated by reference, include the formulation used in patsiran (patsiran) sold under the name ontatro.
The exosomes may also be used as a TREM, TREM core fragment, TREM fragment or TREM composition or drug delivery vehicle for a drug TREM composition as described herein. For review, see Ha et al, 2016, 7, acta Pharmaceutica Sinica B, journal of pharmacy, english edition, volume 6, stage 4, pages 287-296; https:// doi.org/10.1016/j.apsb.2016.02.001.
The ex vivo differentiated erythrocytes may also be used as a carrier for the TREM, TREM core fragments, TREM fragments or TREM compositions or pharmaceutical TREM compositions described herein. See, for example, WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO 2015153102; WO 2018151829; WO 2018009838; shi et al 2014.Proc Natl Acad Sci USA [ Proc. Natl. Acad. Sci. USA ]111 (28): 10131-10136; us patent 9,644,180; huang et al 2017.Nature Communications [ Nature communication ]8:423; shi et al 2014.Proc Natl Acad Sci USA [ Proc. Natl. Acad. Sci. USA ]111 (28): 10131-10136.
Fusion compositions, for example as described in WO 2018208728, may also be used as vehicles to deliver TREMs, TREM core fragments, TREM fragments or TREM compositions or pharmaceutical TREM compositions described herein.
Virosomes and virus-like particles (VLPs) may also be used as carriers to deliver TREM, TREM core fragments, TREM fragments or TREM compositions or pharmaceutical TREM compositions described herein to target cells.
Plant nanovesicles, for example, as described in WO 2010097380 A1, WO 2013070324 A1, or WO 2017004526 A1, may also be used as carriers to deliver TREMs, TREM core fragments, TREM fragments, or TREM compositions or pharmaceutical TREM compositions described herein.
Delivery without carrier
The TREM, TREM core fragment or TREM fragment, TREM composition or pharmaceutical TREM composition can be administered to the cells without a carrier, for example via naked delivery of TREM, TREM core fragment or TREM fragment, TREM composition or pharmaceutical TREM composition.
In some embodiments, naked delivery as used herein refers to delivery without a carrier. In some embodiments, delivery without a carrier, e.g., naked delivery, includes delivery with a moiety, e.g., a targeting peptide.
In some embodiments, a TREM, TREM core fragment or TREM fragment, or TREM composition or pharmaceutical TREM composition described herein is delivered to a cell without a carrier, e.g., via a naked delivery. In some embodiments, delivery without a carrier, e.g., naked delivery, includes delivery with a moiety, e.g., a targeting peptide.
Use of TREM
Compositions comprising TREMs comprising ASGPR binding moieties (e.g., pharmaceutical TREM compositions described herein) can modulate the function of a cell, tissue, or subject. In embodiments, a composition described herein comprising a TREM comprising an ASGPR binding moiety (e.g., a pharmaceutical TREM composition) is contacted with a cell or tissue, or administered to a subject in need thereof, in an amount and for a time sufficient to modulate (increase or decrease) one or more of the following parameters: adaptor functions (e.g., homologous or nonhomologous adaptor functions), such as rate, efficiency, robustness, and/or specificity of initiation or extension of polypeptide chains; ribosome binding and/or occupancy; regulatory functions (e.g., gene silencing or signaling); cell fate; mRNA stability; protein stability; protein transduction; protein compartmentalization. Parameters can be adjusted, for example, by at least 5% (e.g., at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more) compared to a reference tissue, cell or subject (e.g., a healthy, wild-type or control cell, tissue or subject).
In another aspect, the present disclosure provides a method of treating a subject having an endogenous Open Reading Frame (ORF) comprising a premature stop codon (PTC), the method comprising providing a TREM composition comprising a TREM, TREM core fragment, or TREM fragment disclosed herein, wherein the TREM comprises an anticodon paired with the PTC in the ORF; the subject is contacted with a composition comprising TREM, TREM core fragment, or TREM fragment in an amount and/or for a time sufficient to treat the subject, thereby treating the subject. In one embodiment, the PTC comprises UAA, UGA, or UAG.
In another aspect, the present disclosure provides a method of treating a subject having a disease or disorder associated with a premature stop codon (PTC), the method comprising providing a TREM composition comprising a TREM, TREM core fragment, or TREM fragment disclosed herein; the subject is contacted with a composition comprising TREM, TREM core fragment, or TREM fragment in an amount and/or for a time sufficient to treat the subject, thereby treating the subject. In one embodiment, the PTC comprises UAA, UGA, or UAG. In one embodiment, the disease or disorder associated with PTC is a disease or disorder described herein, e.g., cancer or monogenic disease.
In embodiments of any of the methods disclosed herein, the codon having the first sequence comprises a mutation (e.g., a point mutation, e.g., a nonsense mutation), resulting in a premature stop codon (PTC) selected from UAA, UGA, or UAG. In one embodiment, the codon or PTC having the first sequence comprises a UAA mutation. In one embodiment, the codon or PTC having the first sequence comprises a UGA mutation. In one embodiment, the codon or PTC having the first sequence comprises a UAG mutation.
In another aspect, the present disclosure provides a method of preparing a TREM, TREM core fragment, or TREM fragment disclosed herein, the method comprising ligating a first nucleotide and a second nucleotide to form a TREM.
In one embodiment, the TREM, TREM core fragment, or TREM fragment is non-naturally occurring (e.g., synthetic).
In one embodiment, the TREM, TREM core fragment, or TREM fragment is prepared by cell-free solid phase synthesis.
In another aspect, the disclosure provides a method of modulating a tRNA cell in a cell, the method comprising: providing a TREM, TREM core fragment, or TREM fragment disclosed herein, and contacting a cell with the TREM, TREM core fragment, or TREM fragment, thereby modulating the tRNA pool in the cell.
In one aspect, the present disclosure provides a method of contacting a cell, tissue, or subject with a TREM, TREM core fragment, or TREM fragment disclosed herein, the method comprising: contacting the cell, tissue, or subject with the TREM, TREM core fragment, or TREM fragment, thereby contacting the cell, tissue, or subject with the TREM, TREM core fragment, or TREM fragment.
In another aspect, the present disclosure provides a method of delivering TREM, TREM core fragment, or TREM fragment to a cell, tissue, or subject, the method comprising: providing a cell, tissue, or subject, and contacting the cell, tissue, or subject with a TREM, TREM core fragment, or TREM fragment disclosed herein.
In one aspect, the disclosure provides a method of modulating a tRNA pool in a cell that comprises an endogenous Open Reading Frame (ORF), the ORF comprising a codon having a first sequence, the method comprising:
optionally, information on the abundance of one or both of (i) and (ii), e.g., information on the relative amounts of (i) and (ii) in the cell, is obtained, wherein (i) is a tRNA portion (first tRNA portion) having an anticodon that pairs with a codon in the ORF that has a first sequence, and (ii) is an cognate receptor tRNA portion (second tRNA portion) having an anticodon that pairs with a codon in the cell that is not the codon that has the first sequence;
Contacting the cell with a TREM, TREM core fragment, or TREM fragment disclosed herein, wherein the TREM, TREM core fragment, or TREM fragment has an anticodon paired with: the codon having the first sequence; or a codon other than the codon having the first sequence in an amount and/or for a time sufficient to modulate the relative amounts of the first tRNA part and the second tRNA part in the cell,
thereby modulating the tRNA pool in the cell.
In another aspect, the disclosure provides a method of modulating a tRNA pool in a subject with an ORF that comprises a codon having a first sequence, the method comprising:
optionally, information on the abundance of one or both of (i) and (ii), e.g., information on the relative amounts of (i) and (ii) in the subject, is obtained, wherein (i) is a tRNA portion (first tRNA portion) having an anticodon that pairs with a codon in the ORF that has a first sequence, and (ii) is an cognate receptor tRNA portion (second tRNA portion) having an anticodon that pairs with a codon in the subject that is not the codon that has the first sequence;
contacting the subject with a TREM, TREM core fragment, or TREM fragment disclosed herein, wherein the TREM, TREM core fragment, or TREM fragment has an anticodon paired with: the codon having the first sequence; or a codon other than the codon having the first sequence in an amount and/or for a time sufficient to modulate the relative amounts of the first tRNA part and the second tRNA part in the subject,
Thereby modulating the tRNA pool in the subject.
All references and publications cited herein are hereby incorporated by reference.
Examples are given
1. A tRNA effector molecule (TREM) comprising an asialoglycoprotein receptor (ASGPR) binding moiety, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide of the TREM, or at a terminus (e.g., a 5 'or 3' terminus) of the TREM, or within an internucleotide linkage of the TREM.
2. The TREM of embodiment 1, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide of the TREM.
3. The TREM of any of embodiments 1-2, wherein the ASGPR binding moiety binds to a terminus (e.g., a 5 'or 3' terminus) of the TREM.
4. The TREM of any of embodiments 1-3, wherein the ASGPR binding moiety is present within an internucleotide linkage of TREM.
5. A TREM, comprising:
(i) A sequence of formula a, the sequence comprising:
[L1] y - [ ASt domain 1] x -[L2] x - [ DH domain] x -[L3] x - [ ACH Domain] x - [ VL domain] y - [ TH domain] x -[L4] x - [ ASt domain 2] x (A); and
(ii) An asialoglycoprotein receptor (ASGPR) binding moiety (e.g., a GalNAc moiety, e.g., galNAc);
where y is 0 or 1 and x is 1.
6. The TREM of example 5, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide within the ASt domain 1.
7. The TREM of any of embodiments 1-6, wherein the ASGPR binding moiety binds to a nucleobase at any of positions 1-9 within the TREM.
8. The TREM of example 5, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide within the DH domain.
9. The TREM of claims 1-8, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any one of positions 10-26 within the TREM.
10. The TREM of example 5, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide within the ACH domain.
11. The TREM of any of embodiments 1-10, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of positions 27-43.
12. The TREM of example 5, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide within the TH domain.
13. The TREM of any of embodiments 1-12, wherein the ASGPR binding portion binds to a nucleobase within a nucleotide at any of positions 50-64.
14. The TREM of example 5, wherein the ASGPR binding moiety binds to a nucleobase within the ASt domain 2.
15. The TREM of any of embodiments 1-14, wherein the ASGPR binding moiety binds to a nucleobase at any of positions 65-76 within the TREM.
16. The TREM of any of embodiments 1-15, wherein the ASGPR binding moiety (e.g., galNAc moiety, e.g., galNAc) is coupled to a nucleobase moiety of a nucleotide of the TREM molecule via a covalent bond (e.g., at a nitrogen atom or a carbon atom in the nucleobase moiety).
17. The TREM of any of embodiments 1-16, wherein the nucleobase is a naturally occurring nucleobase or a non-naturally occurring nucleobase.
18. The TREM of any of embodiments 1-17, wherein the nucleobase comprises uracil, adenine, guanine, cytosine, thymine, or a variant thereof.
19. The TREM molecule of any of embodiments 1-18, wherein the ASGPR binding moiety comprises a GalNAc moiety (e.g., galNAc or a GalNAc analog).
20. The TREM molecule of any of embodiments 1-19, wherein the ASGPR binding portion comprises a plurality of GalNAc moieties.
21. The TREM molecule of any of embodiments 1-20, wherein the ASGPR binding moiety comprises a structure of formula (I):
or a salt thereof, wherein:
Each of X and Y is independently O, N (R 7 ) Or S;
R 1 、R 3 、R 4 and R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution;
or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring;
R 2a is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；
R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution;
R 7 is hydrogen, alkyl, or C (O) -alkyl;
R 8 and R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl;
R A Is hydrogen, or alkyl, alkenyl, alkynyl, and n is an integer between 0 and 6, wherein the structure of formula (I) may be attached to a linker or TREM.
22. The TREM of embodiment 21, wherein the GalNAc moiety comprises a plurality of structures of formula (I).
23. The TREM of any of embodiments 21-22, wherein the GalNAc moiety further comprises a linker.
24. The TREM of any of embodiments 1-23, wherein the ASGPR-binding moiety comprises a structure of formula (I-a):
or a salt thereof, wherein:
R 2a is hydrogen or alkyl;
R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；
R 3 、R 4 And R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution; and is also provided with
R 8 Is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl,
Where "" "means a bond in any configuration and" "" means an attachment point to a linker or TREM.
25. The TREM of any of embodiments 1-24, wherein the ASGPR binding moiety comprises a structure of formula (II):
or a salt thereof, wherein:
x is O, N (R) 7 ) Or S;
each of W or Y is independently O or C (R 10a )(R 10b ) Wherein one of W and Y is O;
R 1 、R 3 、R 4 and R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution;
or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring;
R 2a is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；
R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution; r is R 7 Is hydrogen, alkyl, or C (O) -alkyl;
R 8 and R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; r is R 10a And R is 10b Independently is hydrogen, heteroalkyl, haloalkyl, or halo; and R is A Is hydrogen, or alkyl, alkenyl, alkynyl,
wherein the structure of formula (I) may be attached to a linker or TREM.
26. The TREM of any of embodiments 1-25, wherein the ASGPR binding moiety comprises a structure of formula (II):
or a salt thereof, wherein X is O, N (R 7 ) Or S;
R 1 、R 3 、R 4 and R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution;
or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring;
R 2a Is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution;
R 7 is hydrogen, alkyl, or C (O) -alkyl;
R 8 and R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; and R is A Is hydrogen, or alkyl, alkenyl, alkynyl,
wherein the structure of formula (I) may be attached to a linker or TREM.
27. The TREM of any of embodiments 1-26, wherein the ASGPR binding moiety comprises a structure of formula (II-b):
or a salt thereof, wherein:
x is O, N (R) 7 ) Or S;
R 1 、R 3 、R 4 and R 5 Each of which is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl, C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution;
or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring;
R 2a is hydrogen or alkyl; r is R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；
R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution;
R 7 is hydrogen, alkyl, or C (O) -alkyl; r is R 8 And R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl; and is also provided with
R A Is hydrogen, or alkyl, alkenyl, alkynyl, wherein the structure of formula (I) may be attached to a linker or TREM.
28. The TREM of any of embodiments 1-27, wherein the ASGPR-binding moiety comprises a structure of formula (III):
or a salt thereof, wherein R 1 、R2a、R2b、R 3 、R 4 、R 5 、R 6a And R 6b Wherein "" "represents an attachment point to a branching point, another linker, or a nucleotide within one or more domains of TREM is as defined by formula (I), L is a linker, and n is an integer between 1 and 100.
29. The TREM of embodiment 28, wherein L comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
30. The TREM of any of embodiments 28-29, wherein L comprises a carbonyl, amide, amine, or ester moiety.
31. The TREM of any of embodiments 1-30, wherein the ASGPR binding moiety comprises a structure of formula (III-a):
or a salt thereof, wherein:
R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a and R 6b Each of which and its sub-variables are as defined in formula (I), L 1 And L 2 Each of M and n is independently an integer between 1 and 100, and M is a linker, wherein "" "represents an attachment point to a branching point, additional linker, or nucleotide within one or more domains of TREM.
32. The TREM of any of embodiments 1-31, wherein the ASGPR binding moiety comprises a structure of formula (II-b):
or a salt thereof, wherein: />
R 1 、R 2a 、R 2b 、R 3 、R 4 、R 5 、R 6a And R 6b Each of which and its sub-variables are as defined for formula (I);
L 1 、L 2 and L 3 Each of which is independently a linker;
each of m, n, and o is independently an integer between 1 and 100;
and M is a branching point, whereRepresents the point of attachment to a branching point, additional linker, or nucleotide within one or more domains of TREM.
33. The TREM of any one of embodiments 31-32, wherein L 1 、L 2 And optionally L 3 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
34. The TREM of any one of embodiments 31-33, wherein L 1 、L 2 And optionally L 3 Independently comprising a carbonyl, amide, amine, or ester moiety.
35. The TREM of any of embodiments 31-34, wherein M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
36. The TREM of any of embodiments 31-35, wherein M comprises a carbonyl, amide, amine, or ester moiety.
37. The TREM of any of embodiments 1-36, wherein the ASGPR binding moiety comprises a structure of formula (II-c):
or a salt thereof, wherein:
R 2a 、R 2b 、R 3 、R 4 、R 5 each of (a)The sub-variables are as defined in formula (I);
L 1 、L 2 and L 3 Each of which is independently a linker; and is also provided with
M is a branching point, wherein "" "represents the point of attachment to a nucleotide within one or more domains of the branching point, additional linker, or TREM.
38. The TREM, L as in example 37 1 、L 2 And L 3 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
39. The TREM of any one of embodiments 37-38, wherein L 1 、L 2 And L 3 Independently comprising a carbonyl, amide, amine, or ester moiety.
40. The TREM of any of embodiments 37-39, wherein M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
41. The TREM of any of embodiments 37-40, wherein M comprises a carbonyl, amide, amine, or ester moiety.
42. The TREM of any of embodiments 1-41, wherein the TREM is selected from TREMs provided in table 12, e.g., any of compounds 99-131.
43. The TREM of any of embodiments 1-42, wherein the ASGPR binding moiety is selected from any of compounds (X-i) - (X-xxiii), and/or salts or protected forms thereof.
44. The TREM of any of embodiments 1-43, wherein the ASGPR binding moiety is selected from any of compound (X-i), compound (X-xxii), and compound (X-xxiii), and/or a salt or protected form thereof.
45. The TREM of any of embodiments 1-44, wherein the ASGPR binding moiety is a compound (X-i) and/or a salt or protected form thereof.
45. The TREM of any of embodiments 1-44, wherein the ASGPR binding moiety is a compound (X-xxii) and/or a salt or protected form thereof.
46. The TREM of any of embodiments 1-44, wherein the ASGPR binding moiety is a compound (X-xxiii) and/or a salt or protected form thereof.
47. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of TREM positions 1, 16, 17, 19, 20, 21, 46, 47, or 50.
48. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at multiple TREM positions selected from 1, 2, 3, 4, 5, 6, 7, 8, or 9.
49. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of TREM positions 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26.
50. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at a plurality of TREM positions selected from 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26.
51. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of TREM positions 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43.
52. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at a plurality of TREM positions selected from 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43.
53. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of TREM positions 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64.
54. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at a plurality of TREM positions selected from 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64.
55. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at any of TREM positions 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76.
56. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at a plurality of TREM positions selected from 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76.
57. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at TREM position 1, 16, 17, 19, 20, 21, 46, 47, or 50 of a TREM comprising one of SEQ ID nos.: 1-654, for example.
58. The TREM of any of embodiments 1-46, wherein the ASGPR binding moiety binds to a nucleobase within a nucleotide at TREM position 1, 16, 17, 19, 20, 21, 46, 47, or 50 of a TREM comprising one of SEQ ID nos.: 1-654, for example.
59. The TREM of any of embodiments 1-58, wherein the TREM comprises a sequence selected from any of SEQ ID NOs 1-654.
60. The TREM of any of embodiments 1-59, wherein the TREM comprises a sequence selected from any of the TREMs provided in table 12, e.g., SEQ ID NOs 622-654.
61. The TREM of any of embodiments 1-60, wherein the TREM comprises a sequence selected from SEQ ID No.622, SEQ ID No. 650, and SEQ ID No. 653.
62. The TREM of any of embodiments 1-61, wherein the TREM comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any of the TREMs provided in table 12, e.g., SEQ ID nos 622-654 provided in table 12.
63. The TREM of any of embodiments 1-62, wherein the TREM comprises a sequence that is at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any of SEQ ID nos. 622-654 provided in table 12, for example.
64. The TREM of any of embodiments 1-63, wherein the TREM comprises a TREM provided in table 12, e.g., at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, or 75nt (but less than full length) of any of SEQ ID nos. 622-654 disclosed in table 12.
65. The TREM of any of embodiments 1-64, wherein the TREM comprises a TREM provided in table 12, e.g., at least 60nt, 65nt, 70nt, or 75nt of any of SEQ ID nos. 622-654 disclosed in table 12.
66. The TREM of any of embodiments 1-65, wherein the TREM comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, or 75nt (but less than full length) of TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the TREMs provided in table 12, e.g., any of SEQ ID nos. 622-654 disclosed in table 12.
67. The TREM of any of embodiments 1-66, wherein the TREM comprises at least 60nt, 65nt, 70nt, or 75nt of a TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-654 disclosed in table 12.
68. The TREM of any of claims 1-67, wherein the TREM comprises a sequence that differs from any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-652 provided in table 12, by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt.
69. The TREM of any of embodiments 1-68, wherein the TREM is selected from the group consisting of SEQ ID No.622, SEQ ID No.650, and SEQ ID No.653.
70. The TREM of any of embodiments 1-69, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID No. 622.
71. The TREM of any of embodiments 1-69, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID No. 650.
72. The TREM of any of embodiments 1-69, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID No. 653.
73. The TREM of any of embodiments 1-72, wherein the TREM is a compound provided in table 12, e.g., any of compound numbers 99-131.
74. The TREM of any of embodiments 1-40, wherein the TREM retains the ability to support protein synthesis, e.g., relative to TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
75. The TREM of any of embodiments 1-74, wherein the TREM retains the ability to be loaded with a synthetase, e.g., relative to a TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
76. The TREM of any of embodiments 1-75, wherein the TREM retains the ability to be bound by an elongation factor, e.g., relative to a TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
77. The TREM of any of embodiments 1-76, wherein the TREM retains the ability to introduce amino acids into a peptide chain, e.g., relative to a TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
78. The TREM of any of embodiments 1-77, wherein the TREM retains the ability to support extension or support initiation, e.g., relative to TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
79. The TREM of any of embodiments 1-78, wherein the TREM has a binding affinity between 0.01nM and 100mM for ASGPR.
80. The TREM of any of embodiments 1-79, wherein the TREM comprises a chemical modification, e.g., a chemical modification described herein, e.g., any of tables 5-8.
81. A pharmaceutical composition comprising a TREM as claimed in any one of the preceding embodiments.
82. The pharmaceutical composition of embodiment 81, further comprising a pharmaceutically acceptable component, such as an excipient.
83. A lipid nanoparticle formulation comprising the TREM of any one of embodiments 1-80.
84. A lipid nanoparticle formulation comprising the pharmaceutical composition of any one of claims 81-82.
86. A method of delivering the TREM of any of embodiments 1-80, or the pharmaceutical composition of any of embodiments 81-82, or the lipid nanoparticle of any of embodiments 83-84 to a subject or cell.
87. A method of treating a subject having a disease or disorder associated with PTC, the method comprising administering the TREM of any one of embodiments 1-80, or the pharmaceutical composition of any one of embodiments 81-82, or the lipid nanoparticle of any one of embodiments 83-84 to the subject, thereby treating the subject having the disease or disorder.
Examples
The following examples are provided to further illustrate some embodiments of the disclosure, but are not intended to limit the scope of the invention; it will be appreciated by their exemplary nature that other procedures, methods or techniques known to those skilled in the art may alternatively be used.
Example content list:
example 1: preparation of selected ASGPR binding moieties
Compound 200: l1- (((2 r,3r,4r,5r,6 r) -3-acetamido-4, 5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) -16, 16-bis ((3- ((3- (5- (((2 r,3r,4r,5r,6 r) -3-acetamido-4, 5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) pentanoylamino) -propyl) amino) -3-oxopropoxy) methyl) -5,11,18-trioxo-14-oxa-6,10,17-triaza-icosaxane-29-acid (compound 100) can be prepared according to the procedure provided by Nair k et al (2014) j.am. Chem. Soc [ american chemical society ],134 (49), 16958-16961.
Compound 201: triple GalNAc azide (N- (N-propargyl dodecanoylamino) -tris { 2-oxa-6, 10-diaza-5, 11-dioxo-15- [3,4, 6-tri-O-acetyl-2-acetamido-2-deoxy-beta-D-glucopyranosyloxy ] pentadecyl } methane) is commercially available (e.g., from Promi company (Primetich); catalog No. 0079).
Compound 202:1- (((2R, 3R,4R,5R, 6R) -3-acetamido-4, 5-dihydroxy-6- (hydroxymethyl) tetrahydro-2H-pyran-2-yl) oxy) -18, 18-bis (17- (((2R, 3R,4R,5R, 6R) -3-acetamido-4, 5-dihydroxy-6- (hydroxymethyl) tetrahydro-2H-pyran-2-yl) oxy) -5-oxo-2,9,12,15-tetraoxa-6-azaheptadecyl) -13, 20-dioxo-3,6,9,16-tetraoxa-12, 19-diazatrioundec-31-oic acid
Compound 203: (17S, 20S) -1- (((2R, 3R,4R,5R, 6R) -3-acetamido-4, 5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) -20- (1- (((2R, 3R,4R,5R, 6R) -3-acetamido-4, 5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) -11-oxo-3, 6, 9-trioxa-12-azahexadecan-16-yl) -17- (2- (2- (2- (((2R, 3R,4R,5R, 6R) -3-acetamido-4, 5-diacetoxy-6- (acetoxymethyl) tetrahydro-2H-pyran-2-yl) oxy) ethoxy) acetamido-11, 18-dioxo-3, 6, 9-trioxa-12, 19-diaza-eicosane-9,796,756 is prepared by the procedure set forth herein in its entirety.
/>
Example 2: preparation of selected nucleotides
Amino nucleobase 1: modified nucleotides comprising AN amine handle at the nucleobase, such as AN1 (C6-U phosphoramidite (5 ' -dimethoxytrityl-5- [ N- (trifluoroacetylaminohexyl) -3-acrylamido ] -uridine, 2' -O-triisopropylsilyloxymethyl-3 ' - [ (2-cyanoethyl) - (N, N-diisopropyl) ] -phosphoramidite)) are available from glan Research; catalog nos. 10-3039. Briefly, AN amino modifier C6-U phosphoramidite (wherein the primary amine is protected as trifluoroacetate) was purchased and incorporated into TREM to provide the amino nucleobase AN1.
Alkyne nucleobase 2: modified nucleotides comprising AN alkyne handle at the nucleobase, such as AN2 (C8-alkyne-dT-CE phosphoramidite (5 ' -dimethoxytrityl-5- (octa-1, 7-diynyl) -2' -deoxyuridine, 3' - [ (2-cyanoethyl) - (N, N-diisopropyl) ] -phosphoramidite)) are available from gram research company; catalog number 10-1540. The C8-alkyne-dT-CE phosphoramidite was chemically incorporated into TREM molecules via standard phosphoramidite chemistry to give the amino nucleobase AN2.
Example 3: synthesis of exemplary TREM
This example describes the synthesis of an exemplary TREM. TREM can be chemically synthesized and purified by HPLC according to standard solid phase synthesis methods and phosphoramidite chemistry (see, e.g., scaringe s. Et al (2004) Curr Protoc Nucleic Acid Chem [ current protocols for nucleic acid chemistry ],2.10.1-2.10.16; usen. Et al (1987) j.am. Chem. Soc [ journal of american chemistry ],109, 7845-7854). Exemplary nucleotide phosphoramidites for synthesis include 5 '-O-dimethoxytrityl-N6- (benzoyl) -2' -O-tert-butyldimethylsilyl-adenosine-3 '-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5' -O-dimethoxytrityl-N4- (acetyl) -2 '-O-tert-butyldimethylsilyl-cytidine-3' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5 '-O-dimethoxytrityl-N2- (isobutyryl) -2' -O-tert-butyldimethylsilyl-guanosine-3 '-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, and 5' -O-dimethoxytrityl-2 '-O-tert-butyldimethylsilyl-uridine-3' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite.
A large number of TREM's are synthesized in this manner, including in particular (1) arginine non-homologous TREM (e.g., TREM-Arg-TGA) which contains the sequence of ARG-UCU-TREM but has an anticodon sequence corresponding to UCA rather than UCU (i.e., SEQ ID NO: 622); (2) A serine non-homologous TREM named TREM-Ser-TAG, which contains the sequence of Ser-GCU-TREM but has an anticodon sequence corresponding to CUA instead of GCU (i.e. SEQ ID NO: 653); and (3) a glutamine non-homologous TREM named TREM-Gln-TAA, which contains the sequence of GLN-CUG-TREM, but has an anticodon sequence corresponding to UUA instead of CUG (i.e., SEQ ID NO: 650).
Example 4: synthesis of TREM with terminal amino linker
This example describes the synthesis of TREM molecules with an amino linker at the 5' end. Amino linkers were added to the 5' end of the oligonucleotides via phosphoramidite chemistry on a synthesizer. For example, TFA-amino C6 CED phosphoramidite (compound 205) may be incorporated at the 5' end of an oligonucleotide. Similar chemistry can be used to couple an amino linker to the 3' terminus.
In addition, the amino linker may be incorporated into the TREM sequence by using phosphoramidite comprising an amino hexyl linker. In these cases, compounds such as 6- (4-monomethoxytritylamino) hexyl- (2-cyanoethyl) - (N, N-diisopropyl) phosphoramidite, which is commercially available from ChemGenes (ChemGenes); directory number CLP-1563.
Example 5: synthesis of TREM comprising ASGPR binding moiety
This example describes the synthesis of an exemplary TREM comprising an ASGPR binding moiety. Several methods of coupling ASGPR binding moieties to TREM can be used, including amide formation and triazole-based click chemistry can be used.
For example, the carboxylic acid triple antenna GalNAc molecule of example 1 (compound 200) was coupled to an oligonucleotide with an amino linker via an amide bond formation reaction. Briefly, a solution of compound 200 (2 eq), HATU (1.8 eq) and diisopropylethylamine (8 eq) in dry acetonitrile (or dry DMF) was vortexed for 2 min. To this solution was added an aqueous solution of TREM (1 equivalent) with an amino linker (e.g., TREM with an amino linker listed in example 4). The reaction mixture was vortexed for 2 min and held at room temperature for 60 min, at which time the solvent was removed under vacuum, diluted with water, and purified by reverse phase column chromatography or ion exchange chromatography. In the case where the GalNAc moiety contains protecting groups, these protecting groups are removed by appropriate treatment. For example, when the free hydroxyl groups in the GalNAc moiety are protected with acetyl groups, ammonium hydroxide treatment is performed at room temperature for 6h, followed by purification to give the final GalNAc-TREM conjugate (206).
ASGPR binding moieties with free carboxylic acids (e.g. Compounds 200, 20 2 And 203) is also first activated to pentafluorophenyl ester (PFP) and then coupled to the free amine on TREM, whether coupled at the 3 'or 5' end or internally coupled to a nucleobase amine (e.g., a linker on a nucleobase).
In addition, TREM was coupled to various ASGPR binding moieties by converting certain ASGPR binding moieties with free carboxylic acids (e.g., compounds 200, 202, and 203) to N-hydroxysuccinimide (NHS) activated compounds. Briefly, the ASGPR-binding moiety with carboxylic acid was dissolved in Dimethylformamide (DMF), and N-hydroxysuccinimide (NHS, 1.1 eq) and N, N-diisopropylcarbodiimide (1.1 eq) were added. The solution was stirred at room temperature for 18 hours and coupled directly with TREM without further purification. TREMs with free amine groups (e.g. TREMs with terminal amino linkers or TREMs with modified nucleotides (e.g. AN1 or AN 2)) were dissolved in a mixture of 50mM sodium carbonate/sodium bicarbonate buffer (pH 9.6) and dimethyl sulfoxide (DMSO) 4:6v/v. To this solution was added 1.2 molar equivalents of a solution of NHS ester activated ASGPR binding moiety in DMF. The reaction was carried out at room temperature for 1 hour, then 1.2 molar equivalents of NHS ester-activated ASGPR binding moiety in DMF was added. After 1 hour, the reaction was diluted 15-fold with water, filtered through a 1.2 μm filter, and purified by reverse phase HPLC (Xbridge C18 Prep 19x50mM, using 100mM triethylamine acetate (pH 7)/95% acetonitrile buffer system). Any protecting groups on the ASGPR binding portion are then removed, for example, by treatment with 3M sodium acetate (pH 5.2) and 80% ethanol.
Alternatively, TREM molecules bearing alkyne groups are conjugated to ASGPR binding moieties bearing azide groups, such as triple GalNAc azide (compound 201). The reaction is carried out via copper-catalyzed azide-alkyne cycloaddition (saneyshi h. Et al. (2017) biorg. Med. Chem [ bio-organic chemistry and pharmaceutical chemistry ],25,3350-3356; incorporated herein by reference in its entirety) and purified using standard techniques to produce a triazole-containing moiety, such as compound 207 below.
Table 12 summarizes a list of TREMs containing ASGPR binding moieties prepared according to the protocols provided herein. Each TREM in the sequence is unconjugated (e.g., control), or conjugated to i) an ASGPR binding moiety (abbreviated as "GalNAc" in the tables) described herein; ii) a fluorophore (e.g. Cy 3); and/or iii) a linker (abbreviated as "5-LC-N" in the table). The molecular weight of each TREM was confirmed by LC-MS, wherein the measured molecular weight was found to be within +/-0.04% of the calculated molecular weight of each TREM.
Table 12: exemplary TREM comprising ASGPR binding portions
/>
/>
/>
/>
/>
Example 6: synthesis of biotin-conjugated TREM molecules as probes
This example describes the synthesis of biotin-conjugated TREM molecules. For example, these molecules can be used as GalNAc-TREM conjugation mimics and can be used to study which positions along the TREM sequence are suitable for labelling (+) -biotin N-hydroxysuccinimide ester (which is available from Sigma-Aldrich (catalog No. H1759)). The TREM molecule with free amine can be synthesized as described previously, e.g. example 4, and then coupled to (+) -biotin N-hydroxysuccinimide ester to form an amide bond according to the procedure outlined, e.g., bengstrom m. Et al (1990) nucleic. Briefly, a solution of TREM molecules with amino base modifications and an excess of (+) -biotin N-hydroxysuccinimide ester can be mixed together and vortexed at 37 ℃ for several hours. LCMS analysis was used to determine if the reaction was complete. The solvent is removed in vacuo, and the resulting residue is diluted with water and then purified using reverse phase column chromatography to give the final compound (e.g., compound 208).
For example, the biotin moiety was installed at positions 20 and 47 of an arginine non-homologous TREM molecule, named TREM-Arg-TGA-biotin-20 and TREM-Arg-TGA-biotin-47, respectively. Arginine non-homologous TREM molecules contain the sequence of the ARG-UCU-TREM body, but the anticodon sequence corresponds to UCA rather than UCU.
Example 7: synthesis of biotin-conjugated TREM molecules as probes
This example describes the synthesis of TREM molecules conjugated to biotin at the 5' end. (+) -Biotin N-hydroxysuccinimide ester is available from Sigma-Ordrich company (catalog number H1759). TREM molecules having an amino linker at the 5' end can be prepared, for example, as described in example 4. The amino-modified TREM is then coupled with (+) -biotin N-hydroxysuccinimide ester to form an amide bond according to the procedure outlined, for example, by Bengstrom m et al (1990) nucleic. Briefly, a solution of amino modified TREM and excess (+) -biotin N-hydroxysuccinimide ester were mixed together and vortexed at 37 ℃ for several hours. LCMS analysis was used to determine if the reaction was complete. The solvent is removed in vacuo, and the resulting residue is diluted with water and then purified using reverse phase column chromatography to give the final compound (e.g., compound 209).
For example, the biotin moiety is attached to an arginine non-cognate TREM molecule, known as TREM-Arg-TGA-5' -biotin. Arginine non-homologous TREM molecules contain the sequence of the ARG-UCU-TREM body, but the anticodon sequence corresponds to UCA rather than UCU.
Example 8: analysis of GalNAc-TREM via HPLC
This example describes analysis of GalNAc-TREM molecules via HPLC. GalNAc-TREM molecules can be analyzed by HPLC, for example, to evaluate the purity and homogeneity of the composition. A Waters Aquity UPLC system using a Waters BEH C18 column (2.1mm x 50mm x 1.7 μm) can be used for this analysis. Samples can be prepared by dissolving 0.5nmol of the oligonucleotide in 75 μl of water and injecting 2 μl of the solution. The buffer used may be 50mM dimethyl hexyl ammonium acetate and 10% CH 3 CN (acetonitrile) as buffer A and 50mM dimethyl hexyl ammonium acetate and 75% CH 3 CN as buffer B (gradient of 25% to 75% buffer B over 5 min) at 60℃at a flow rate of 0.5mL/min.
Example 9: analysis of GalNAc-TREM via Mass Spectrometry
This example describes mass spectrometry analysis of GalNAc-TREM molecules. ESI-LCMS data for oligonucleotides can be obtained on a Thermo Ultimate3000-LTQ-XL mass spectrometer. The sample may be prepared by: 0.5nmol of the oligonucleotide was dissolved in 75. Mu.L of water and 10. Mu.L of the solution was directly injected onto a Novat company C18 (HTCS-HTC 1-4) trap column. After injection into the trap column, the sample may be purified using 85% CH 3 CN, 50mM HFIP (hexafluoro-2-propanol), 10. Mu.M EDTA (ethylenediamine tetraacetic acid), 0.35% DIPEA (N, N-diisopropylethylamine) was eluted directly onto LTQ-MS and the mass to charge ratio (M/z) was determined.
Example 10 in vitro delivery of GalNAc-TREM into ASGPR expressing cells
This example describes the in vitro delivery of exemplary GalNAc-conjugated TREMs into ASGPR-expressing U2OS cells under naked (non-transfection) conditions. The methods described in this example can be used to assess the level of GalNAc-TREM in cells expressing ASGR after delivery.
Host cell modification
U2OS cell lines engineered to stably express ASGP receptors (ASGPR) were generated using plasmid transfection and selection. Briefly, these cells were co-transfected with plasmids encoding the ASGPRI gene and puromycin selection cassette. The following day, cells were selected with puromycin. The remaining cells were expanded and tested for ASGPR expression.
Delivery of GalNAc-TREM under naked conditions
ASGPR engineered U2OS cells were harvested and diluted to 4X 10 in complete growth medium 4 Individual cells/mL, then 100uL of the diluted cell suspension was added to a 96-well plate (3904, corning, usa). The plate was placed at 37℃in 5% CO 2 In the incubator to allow the cells to adhere to the bottom of the wells. After 20-24 hours, each GalNAc-TREM modified with a fluorophore (Cy 3) at the 5' end was diluted to a 10-fold concentration (e.g., 1000 nM) in rnase-free water and added to the wells at a 1:10 dilution. The plate was placed at 37℃in 5% CO 2 The incubator was kept for 20-24 hours, and then tRNA was quantitatively measured to determine the intracellular level of GalNAc-TREM.
Quantitative tRNA delivery using real-time imaging
Plates were removed from the incubator 20-24 hours after tRNA delivery. After aspiration of the medium, hoechest 33342 (thermofiser, usa) was diluted to 1:10,000 in complete growth medium and added to the cells. Plates were incubated for 10min at room temperature (about 25 ℃) and then washed 6 times with 1 XDPBS. After the last wash, complete growth medium was added to the plate (100 uL per well). The plates were then imaged under an ImageXpress Pico microscope (Molecular Device, usa) with three channels (Cy 3/DAPI/bright field) at 20 x magnification. The average intensity of Cy3 channels was quantified by the "cell score" function of the microscope software. Free uptake of gin-TAA (compounds 112, 113 and 114) conjugated with GalNAc at three different positions along TREM by ASGPR1 expressing U2OS cells was detected by visualizing Cy3 tags with fluorescence microscopy (fig. 1A to 1F). Negative control cells (FIGS. 1G to 1H) were exposed to unconjugated Gln-TAA TREM, while positive controls (FIGS. 1I to 1J) were exposed to GalNAc modified Gln-TAA TREM and RNAiMAX transfection reagent. Fig. 2 is a quantification of the mean intensity of microscopy results, indicating that the free uptake of TREM is as good as transfection-promoted TREM uptake. Similar results were obtained with Ser-TAG (compounds 122 and 123; fig. 3A to 3H and fig. 4) and Arg-TGA (compounds 104, 105, and 106; fig. 5A to 5J and fig. 6) modified TREM.
Example 11 in vitro delivery of GalNAc-TREM into Primary human hepatocytes
This example describes the in vitro delivery of TREM conjugated with GalNAc into primary human hepatocytes under naked conditions (no transfection agent). The methods described in this example can be used to assess the level of GalNAc-TREM in hepatocytes after delivery.
Hepatocytes (X008001-P, american in vitro BioIVT, USA) of 10 donor human cryoplates from one Lipups cryovial (cryo-vial of Liverpool) were carefully thawed at 37℃and diluted in pre-warmed INVITROGRO CP medium. The total cell count and the number of living cells were determined using a cell counter. Successful defrost procedure prediction>70% viability. The cells were further diluted to 7×105 viable cells/mL and 70uL of the diluted cell suspension was seeded in a collagen-coated 96-well plate (354649, corning, usa). The plate was gently shaken back and forth and side to evenly distribute the cells. The plates were exposed to 37℃5% CO 2 In an incubator. After 2 hours, the plates were carefully washed with INVITROGRO CP medium. GalNAc-TREM was diluted to working concentration (e.g. 100 nM) in growth medium and added to wells. The plates were exposed to 37℃5% CO 2 The incubator was kept for 20-24 hours, and then tRNA was quantitatively measured to determine the intracellular level of GalNAc-TREM.
Quantitative tRNA delivery using Cy3 real-time imaging
Plates were removed from the incubator 20-24 hours after tRNA delivery. After aspiration of the medium, hoechest 33342 (62249, zemoer femil, usa) was diluted to 1:10,000 in invitroro CP medium and added to the cells. Plates were incubated for 10min at room temperature (about 25 ℃) and then washed 6 times with 1 XDPBS. After the last wash, INVITROGRO CP medium is added to the plate (100 uL per well). The plates were then imaged under an ImageXpress Pico microscope (molecular instruments, usa) with three channels (Cy 3/DAPI/bright field) at 20 x magnification. The average intensity of Cy3 channels was quantified by the "cell score" function of the microscope software. Fig. 7A to 7J depict fluorescence microscopy images of Cy3 conjugated modified Gln-TAA TREM. Free uptake of TREM by primary human hepatocytes was equally effective or better than cells incubated with TREM and transfection reagent. Fig. 8 is a quantification of uptake by each TREM (as measured by mean intensity). Similar results were obtained with Ser-TAG TREM (FIGS. 9A to 9H and FIG. 10) and Arg-TGA TREM (FIGS. 11A to 11J and FIG. 12).
Example 12 read-through of premature stop codon (PTC) in reporter protein via administration of TREM comprising an ASGPRG binding moiety by transfection
This example describes an assay to test the ability of non-homologous TREM with ASGPR binding moiety ("GalNAc-TREM") to read PTC in cells expressing proteins with PTC. This example describes three different GalNAc modified TREMs (Gln-TAA, ser-TAG, or Arg-TGA), although TREMs specifying any of the other 19 amino acids may also be used. The specific GalNAc TREMs tested are summarized in table 12 above.
Host cell modification
Cell lines engineered to stably express NanoLuc reporter constructs containing premature stop codons (PTC) were generated using the fpin system according to the manufacturer's instructions.
Delivery of non-homologous GalNAc-TREM into host cells by transfection
To ensure proper folding of each TREM, galNAc-TREM was heated at 85 ℃ for 2 minutes and then rapidly cooled at 4 ℃ for 5 minutes. For the delivery of GalNAc-TREM into NanoLuc reporter cells, according to the manufacturerWas reverse transfected on NanoLuc reporter cells using lipofectamine RNAiMAX (sameifeishier technologies (ThermoFisher Scientific), usa). Briefly, 5uL of 2.5uM GalNAc-TREM solution was diluted in 20uL RNAiMAX/OptiMEM mixture. After gently mixing for 30min at room temperature, 25uL GalNAc-TREM/transfection mixture was added to 96-well plates and left to stand for 20-30min before cells were added. NanoLuc reporter cells were harvested and diluted to 4X 10 in complete growth medium 5 Each cell/mL, 100uL of the diluted cell suspension was then added to a plate containing GalNAc-TREM and mixed. After 24h, 100uL of complete growth medium was added to 96-well plates to maintain cell health.
Translation inhibition assay
To monitor the efficacy of GalNAc-TREM at 48 hours after delivery of the GalNAc-TREM into the cells, the PTC in the report construct was read through, and a Nanoglo bioluminescence assay (Promega, USA) was performed according to the manufacturer's instructions. Briefly, the cell culture medium was replaced and allowed to equilibrate to room temperature. The NanoGlo reagent was prepared by mixing the buffer with the substrate in a 50:1 ratio. 50uL of the mixed NanoGlo reagent was added to a 96-well plate and mixed on a shaker at 600rpm for 10min. After 2 minutes, the plates were centrifuged at 1000g, then incubated at room temperature for 5min, and the samples were then measured for bioluminescence. As positive control, host cells expressing the PTC-free NanoLuc reporter construct were used. As a negative control, host cells expressing the NanoLuc reporter construct with PTC were used, but not transfected with GalNAc-TREM. The efficacy of GalNAc-TREM was measured as the ratio of NanoLuc luminescence in the experimental sample to that of the positive control or the ratio of NanoLuc luminescence in the experimental sample to that of the negative control. It is expected that if GalNAc-TREM is functional, it may be able to read through the termination mutation in the NanoLuc reporter gene and produce a higher luminescence reading than that measured in the negative control. If GalNAc-TREM is not functional, the termination mutation is not rescued, and luminescence less than or equal to the negative control is detected. Gln-TAA TREM (modified with GalNAc at different positions, respectively) showed concentration-dependent read-through ability in ASGPR1-U2OS-nLuc-PTC reporter cells (FIG. 13). Ser-TAG and Arg-TGA TREM showed similar concentration-dependent read-through ability (FIGS. 14 and 15).
The effect of including ASGPR binding moieties in TREM sequences was evaluated and summarized in table 13 below. The data for each modified TREM is provided as log2 fold change compared to the simulated sample, where "1" represents less than 4.00log2 fold change; "2" means a log2 fold change greater than or equal to 4.01 and less than 7.00log2 fold change; and "3" means a fold change of greater than or equal to 7.01log 2. The results indicate that ASGPR binding moieties and other modifications are tolerable at many positions, but that specific sites are sensitive to the modification or exhibit improved activity when modified.
Table 13: read-through ability of exemplary TREM modified with ASGPR binding moiety
Example 13: readthrough of premature stop codons (PTC) in reporter proteins via administration of TREM comprising ASGPR binding moieties in ASGPR expressing cells
This example describes an assay to test the ability of non-homologous GalNAc-TREM to read through PTC in cell lines expressing reporter proteins with PTC. This example describes certain TREM sequences, although non-homologous TREMs specifying any of the 20 amino acids may be used.
Host cell modification
Cell lines engineered to stably express ASGPR and NanoLuc reporter constructs containing premature stop codons (PTC) were generated using the fpin system according to the manufacturer's instructions. Briefly, HEK293T (293T CRL-3216) cells were co-transfected with an expression vector containing a Nanoluc reporter gene with PTC (e.g.pcDNA 5/FRT-NanoLuc-TAA and pOG44 Flp-recombinase expression vectors). After 24 hours, the medium was replaced with fresh medium. First, theTwo days, cells were split at a ratio of 1:2 and screened with 100ug/mL hygromycin for 5 days. The remaining cells were expanded and tested for expression of the reporter construct. Following this expansion step, the cells are co-transfected with a plasmid encoding the ASGRI gene and a selection cassette (e.g., a puromycin cassette). The following day, cells were selected with puromycin. The remaining cells were expanded and tested for ASGPR expression.
Synthesis and preparation of non-homologous GalNAc-TREM
In this example, arginine non-homologous GalNAc-TREM is produced such that it contains the sequence of the ARG-UCU-TREM host, but has an anticodon sequence corresponding to UCA instead of UCU, and is conjugated to a GalNAc moiety. Arginine non-homologous GalNAc-TREM can be synthesized as described previously and its quality controlled using the methods as described herein. To ensure proper folding, TREM was heated at 85 ℃ for 2 minutes and then rapidly cooled at 4 ℃ for 5 minutes.
Delivery of non-homologous GalNAc-TREM into host cells
As described herein, 100nM arginine non-homologous GalNAc-TREM can be delivered to mammalian cells either in the naked state or using transfection reagents.
Translation inhibition assay
To monitor the efficacy of PTC in arginine non-homologous GalNAc-TREM read-through report constructs, cells were evaluated approximately 24-48 hours after TREM delivery. The cell culture medium was changed and the cells equilibrated to room temperature. ONE-Glo to be equal to the volume of cell culture medium TM EX reagent was added to the wells and mixed for 3min at 500rpm on an orbital shaker, then an equal volume of nanoDLR was added to the cell culture medium TM Stop&Glo and mixed on an orbital shaker at 500rpm for 3min. The reaction was incubated at room temperature for 10min and luminescence was read by a plate reader to detect NanoLuc activity. As positive control, host cells expressing the PTC-free NanoLuc reporter construct were used. As a negative control, host cells expressing the NanoLuc reporter construct with PTC were used, but not transfected with GalNAc-TREM. The efficacy of GalNAc-TREM can be measured as the ratio of NanoLuc luminescence in the experimental sample to that of the positive control. It is expected that if arginine non-homologous TREM is functionalThen a termination mutation in the read-through NanoLuc reporter may occur and produce a higher luminescence reading than that measured in the negative control. If arginine non-homologous TREM is not functional, the termination mutation may not be rescued and luminescence less than or equal to the negative control is detected.
Example 14: readthrough of premature stop codon (PTC) in alpha-Galactosidase (GLA) ORF by administration of TREM comprising an ASGPR binding moiety
This example describes an assay that tests the ability of non-homologous GalNAc-TREM to read through PTC (e.g., R220X) in the Open Reading Frame (ORF) of alpha-Galactosidase (GLA) in hepatocytes differentiated from a cell line derived from a reprogrammed Fabry patient. This example describes arginine non-homologous GalNAc-TREM, although non-homologous TREM specifying any of the other 19 amino acids may be used.
Patient derived cells
Fibroblasts derived from patients with fabry disease, having PTC (e.g., R220X) in the alpha-Galactosidase (GLA) Open Reading Frame (ORF), may be obtained from a center or tissue, such as the coriolis institute (Coriell Institute) (catalogues GM00881 and GM 02769). As previously shown, patient-derived fibroblasts were reprogrammed to ipscs and differentiated into hepatocytes (Takahashi, k. And Yamanaka, s. (2006) Cell [ Cell ]126,663-676 (2006); park i. Et al (2008) Nature [ Nature ]451,141-146; jia, b. Et al (2014) Life Sci. [ Life Sci ]108,22-29).
Synthesis and preparation of non-homologous GalNAc-TREM
In this example, arginine non-homologous GalNAc-TREM is produced such that it contains the sequence of the ARG-UCU-TREM host, but has an anticodon sequence corresponding to UCA instead of UCU, and is conjugated to a GalNAc moiety. Arginine non-homologous GalNAc-TREM was synthesized as described previously and its quality was controlled using the methods described in examples 8-9. To ensure proper folding, TREM was heated at 85 ℃ for 2 minutes and then rapidly cooled at 4 ℃ for 5 minutes.
Delivery of non-homologous GalNAc-TREM into hepatocytes
100nM of arginine non-homologous GalNAc-TREM can be delivered naked into iPSC-derived hepatocytes (derived from fibroblasts derived from Fabry disease patients).
Translation inhibition assay
To monitor the efficacy of arginine non-homologous GalNAc-TREM to read through PTC in GLA ORF, 24-48 hours after transfection, cell culture medium was changed and cells were lysed. Using Western blot detection, in this example of GLA enzyme, non-homologous GalNAc-TREM efficacy was measured as the level of full-length protein expression in reprogrammed hepatocytes given Arg non-homologous TREM compared to the GLA expression level found in control hepatocytes that did not receive TREM. For example, as a control, cells of a human not affected by the disease (i.e., cells having an ORF with WT GLA transcripts) may be used. It is expected that if the non-homologous GalNAc-TREM is functional, it can read through the PTC, and the detected full-length protein level will be higher than that found in reprogrammed hepatocytes not administered with the non-homologous GalNAc-TREM. If the non-homologous GalNAc-TREM is not functional, the full-length protein level detected will be similar to that found in patient-derived fibroblasts or reprogrammed hepatocytes that have not been administered with the non-homologous GalNAc-TREM.
Example 15: reading through premature stop codon (PTC) in alpha-Galactosidase (GLA) ORF by administration of TREM comprising an ASGPR binding moiety to produce a functional GLA protein
This example describes an assay that tests the ability of non-homologous GalNAc-TREM to read through a PTC (e.g., R220X) in the alpha-Galactosidase (GLA) Open Reading Frame (ORF) in hepatocytes (a cell line derived from a differentiated self-programming fabry patient) to produce a functional GLA protein. This example describes arginine non-homologous GalNAc-TREM, although non-homologous TREM specifying any of the other 19 amino acids may be used. Fibroblasts derived from patients with fabry disease, having PTC (e.g., R220X) in the alpha-Galactosidase (GLA) Open Reading Frame (ORF), may be obtained from centers or tissues, such as the coriolis institute (catalogue numbers GM00881 and GM 02769). Cells may be reprogrammed and differentiated according to the exemplary protocol provided in example 14.
To monitor the function of GLA protein produced by arginine non-homologous GalNAc-TREM mediated PTC read-through, GLA protein activity assay can be performed using the α -galactosidase activity assay kit (Ai Bokang company (Abcam)) according to the manufacturer's instructions. Alternatively, GLA activity can be determined using the artificial substrate 4-methylumbelliferone- α -D-galactoside, as previously described in Desnick RJ et al J Lab Clin Med 1973; 81:157-71.
Example 16: correction of missense mutations in ORFs by administration of GalNAc-TREM
This example describes the administration of GalNAc-TREM to correct missense mutations. In this example, galNAc-TREM translates a reporter gene with a missense mutation into a WT protein by incorporating wild-type (WT) amino acids (at missense positions) in the protein.
Host cell modification
According to the manufacturer's instructions, the FlpIN system can be used to generate cell lines that stably express GFP reporter constructs containing missense mutations (e.g., T203I or E222G) that prevent GFP excitation at 470nm and 390nm wavelengths. Briefly, HEK293T (293TCRL-3216) cells were co-transfected with an expression vector containing a GFP reporter gene with a missense mutation (e.g., pcDNA5/FRT-nanoLuc-TAA and pOG44 Flp-recombinase expression vectors). After 24 hours, the medium was replaced with fresh medium. The next day, cells were split at a 1:2 ratio and screened with 100ug/mL hygromycin for 5 days. The remaining cells were expanded and tested for expression of the reporter construct.
Transfection of non-homologous GalNAc-TREM into host cells
To deliver GalNAc-TREM to mammalian cells, 100nM TREM was transfected into cells expressing ORFs with missense mutations using lipofectamine 2000 reagent according to the manufacturer's instructions. After 6-18 hours, the transfection medium was removed and replaced with fresh complete medium.
Missense mutation correction assay
To monitor the efficacy of missense mutations in GalNAc-TREM correction reporter constructs, 24-48 hours after naked delivery of GalNAc-TREM, cell culture media was changed and cell fluorescence was measured. In the experiment, TREM not conjugated with GalNAc moiety was used as a negative control for the assay, and cells expressing WT GFP were used as a positive control for the assay. If GalNAc-TREM is functional, GFP protein is expected to fluoresce when irradiated with a fluorometer at an excitation wavelength of 390nm, as observed in the positive control. If GalNAc-TREM is not functional, GFP will only fluoresce when excited with 470nm wavelength, as observed in the negative control, indicating that missense mutations are uncorrected.
Example 17: evaluation of protein expression level of SMC-containing ORF after GalNAc-TREM administration
This example describes the administration of GalNAc-TREM to alter the expression level of an ORF containing SMC.
To generate a system to investigate the effect of GalNAc-TREM administration on the protein expression level of SMC-containing proteins (in this example, from PNPL3A gene expression encoding adiponectin), a plasmid containing the PNPL3A rs738408ORF sequence was transfected into the cell line THLE-3 of normal human hepatocytes, which was edited by CRISPR/Cas to contain a frameshift mutation in the coding exon of PNPLA3 to knock out endogenous PNPLA3 (THLE-3_pnpla3 ko cells). As a control, aliquots of THLE-3_PNPLA3KO cells were transfected with plasmids containing the wild type PNPL3A ORF sequence.
Evaluation of protein level of ORF containing SMC
GalNAc-TREM was delivered to THLE-3_PNPLA3KO cells containing the rs738408ORF sequence and to THLE-3_PNPLA3KO cells containing the wild type PNPL3A ORF sequence. In this example, the GalNAc-TREM contains a proline isoreceptor with an AGG anti-codon base paired with a CCT codon, i.e., the sequence of the GalNAc-TREM is GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC. A time course in the range of 30 minutes to 6 hours is performed, including time points at intervals of one hour in length. At each time point, cells were trypsinized, washed and lysed. Cell lysates were analyzed by western blotting and the blots were probed with antibodies to adiponectin protein. Total protein loading controls, such as GAPDH, actin or tubulin, were also probed as loading controls.
The methods described in this example can be used to evaluate the expression level of adiponectin protein in cells containing the rs738408 ORF.
Example 18: modulation of protein translation rate of SMC-containing ORFs by administration of GalNAc-TREM
This example describes the administration of GalNAc-TREM to alter the protein translation rate of an ORF containing SMC.
To monitor the effect of GalNAc-TREM addition on the translational extension rate, an in vitro translation system, in this example RRL system (plagmaigy corporation), was used, wherein the change in fluorescence of the reporter Gene (GFP) over time was an alternative indicator of the translation rate.
Evaluation of protein translation Rate of SMC-containing ORFs
First, mammalian lysates can be produced that deplete endogenous tRNA using antisense oligonucleotides that target sequences between the anticodon and the variable loop (see, e.g., cui et al, 2018.Nucleic Acids Res. [ nucleic acid research]46 (12):6387-6400). In this example, in addition to 0.1-0.5ug/uL of mRNA encoding the wild-type TERT ORF fused via a linker to the GFP ORF or mRNA encoding the rs2736098TERT ORF fused via a linker to the GFP ORF, TREM comprising an alanine isoreceptor containing a UGC anticodon that base pairs with the GCA codon, i.e., the TREM has a sequence of GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUUGCAUGUAUGAGGUCCCGGGUUCGAUCCCCGGCAUCUCCA, was added to the in vitro translation assay lysate. By using lambda at 37 DEG C ex 485/λ em Fluorescence increase on the microplate reader of 528 monitored progress of GFP mRNA translation, with data points collected every 30 seconds over 1 hour. The amount of fluorescence over time was plotted to determine the translational extension rate of the wild-type ORF compared to the rs2736098ORF with and without GalNAc-TREM. The methods described in this example can be used to evaluate the translation rate of the rs2736098ORF and wild type ORF in the presence or absence of GalNAc-TREM.

Claims (65)

1. A tRNA effector molecule (TREM) comprising:
(i) A sequence of formula a, the sequence comprising:
[L1] y - [ ASt domain 1] x -[L2] x - [ DH domain] x -[L3] x - [ ACH Domain] x - [ VL domain] y - [ TH domain] x -[L4] x - [ ASt domain 2] x ，(A)；
Wherein independently, [ L1] and [ VL domain ] are optional;
each y is independently 0 or 1; and is also provided with
Each x is 0 or 1; and
(ii) An asialoglycoprotein receptor (ASGPR) binding moiety (e.g., a GalNAc moiety, e.g., galNAc),
wherein the ASGPR binding moiety is conjugated to a nucleobase within a nucleotide of the TREM, or is conjugated at a terminus (e.g., a 5 'or 3' terminus) of the TREM, or is conjugated within an internucleotide linkage of the TREM.
2. The TREM of claim 1, wherein each x is 1.
3. The TREM of any one of claims 1-2, wherein the ASGPR portion is present within the L1, ASt domain 1, L2, DH domain, L3, ACH domain, VL domain, TH domain, L4, or ASt domain.
4. The TREM of any of claims 1-3, wherein the ASGPR binding moiety is present within L1.
5. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within ASt domain 1.
6. The TREM of any of claims 1-3, wherein the ASGPR binding moiety is present within L2.
7. The TREM of any one of claims 1-3, wherein the ASGPR binding portion is present within a DH domain.
8. The TREM of any of claims 1-3, wherein the ASGPR binding moiety is present within L3.
9. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within the ACH domain.
10. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within a VL domain.
11. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within TH domain.
12. The TREM of any of claims 1-3, wherein the ASGPR binding moiety is present within L4.
13. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within ASt domain 2.
14. The TREM of any of claims 1-3, wherein the ASGPR binding portion is present within one of L1, ASt domain 1, or ASt domain 2.
15. The TREM of any one of claims 1-14, wherein the ASGPR binding moiety is covalently bound to a nucleobase within a nucleotide of the TREM, or covalently bound at a terminus (e.g., a 5 'or 3' terminus) of the TREM, or covalently bound within an internucleotide linkage of the TREM (e.g., at a nitrogen atom or a carbon atom in the nucleobase moiety).
16. The TREM of any one of claims 1-15, wherein the ASGPR binding moiety (e.g., galNAc moiety, e.g., galNAc) binds to nucleobases within a nucleotide of the TREM.
17. The TREM of any one of claims 1-16, wherein the nucleobase is a naturally occurring nucleobase or a non-naturally occurring nucleobase.
18. The TREM of any one of claims 1-17, wherein the nucleobase comprises uracil, adenine, guanine, cytosine, thymine, or a variant thereof.
19. The TREM of any one of claims 1-15, wherein the ASGPR binding moiety (e.g., galNAc moiety, e.g., galNAc) binds to one or both ends within the TREM.
20. The TREM of claim 19, wherein the ASGPR binding moiety (e.g., galNAc moiety, e.g., galNAc) binds to the 5' end of the TREM.
21. The TREM of claim 19, wherein the ASGPR binding moiety (e.g., galNAc moiety, e.g., galNAc) binds to the 3' end of the TREM.
22. The TREM of any one of claims 1-15, wherein the ASGPR binding moiety is present within an internucleotide linkage of the TREM.
23. The TREM of any of claims 1-22, wherein the TREM comprises the sequence of any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-654.
24. The TREM of any of claims 1-23, wherein the TREM comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any of the TREMs provided in table 12, e.g., SEQ ID nos 622-654 provided in table 12.
25. The TREM of any of claims 1-24, wherein the TREM comprises a sequence that is at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-654 provided in table 12.
26. The TREM of any one of claims 1-25, wherein the TREM comprises a TREM provided in table 12, e.g., at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, or 75nt (but less than full length) of any one of SEQ ID nos. 622-654 disclosed in table 12.
27. The TREM of any of claims 1-26, wherein the TREM comprises a TREM provided in table 12, e.g., at least 60nt, 65nt, 70nt, or 75nt of any of SEQ ID nos 622-654 disclosed in table 12.
28. The TREM of any of claims 1-27, wherein the TREM comprises at least 5 ribonucleotides (nt), 10nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, or 75nt (but less than full length) of TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the TREMs provided in table 12, e.g., any of SEQ ID nos. 622-654 disclosed in table 12.
29. The TREM of any of claims 1-28, wherein the TREM comprises at least 60nt, 65nt, 70nt, or 75nt of a TREM that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-654 disclosed in table 12.
30. The TREM of any of claims 1-29, wherein the TREM comprises a sequence that differs from any of the TREMs provided in table 12, e.g., SEQ ID nos. 622-652 provided in table 12, by no more than 1 ribonucleotide (nt), 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 12nt, 14nt, 16nt, 18nt, or 20 nt.
31. The TREM of any one of claims 1-30, wherein the TREM is selected from SEQ ID No.622, SEQ ID No.650, and SEQ ID No.653.
32. The TREM of any one of claims 1-31, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 622.
33. The TREM of any one of claims 1-31, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 650.
34. The TREM of any one of claims 1-31, wherein the TREM is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID No. 653.
35. The TREM of any one of claims 1-34, wherein the ASGPR binding portion comprises a structure of formula (III-b):
or a salt thereof, wherein:
each X is independently O, N (R 7 ) Or S;
R 1 、R 3 、R 4 and R 5 Each of (a) is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, C (O) -alkyl, C (O) -alkenyl, C (O) -alkynyl, C (O) -heteroalkyl, C (O) -haloalkyl, C (O) -aryl C (O) -heteroaryl, C (O) -cycloalkyl, or C (O) -heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 8 Substitution;
or R is 3 And R is 4 Together with the oxygen atom to which they are attached form a group optionally containing one or more R 8 A substituted heterocyclyl ring;
R 2a is hydrogen or alkyl;
R 2b is-C (O) alkyl (e.g., C (O) CH) 3 )；
R 6a And R is 6b Each of which is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, halo, cyano, nitro, -OR A Aryl, heteroaryl, cycloalkyl, or heterocyclyl, wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, aryl, heteroaryl, cycloalkyl, and heterocyclyl is optionally substituted with one or more R 9 Substitution;
R 7 is hydrogen, alkyl, or C (O) -alkyl;
R 8 and R is 9 Independently is hydrogen, halo, cyano, alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, or heterocyclyl;
R A is hydrogen, or alkyl, alkenyl, alkynyl;
L 1 、L 2 and L 3 Each of which is independently a linker;
each of m, n, and o is independently an integer between 1 and 100;
m is a linker which is used for the connection,
wherein the method comprises the steps ofRepresents an attachment point to a branching point, another linker or TREM, such as a linker, nucleobase, internucleotide linkage or terminal within a TREM sequence.
36. The TREM of claim 35, wherein X is O.
37. The TREM of any one of claims 35-36, R 1 、R 3 、R 4 And R 5 Each of which is independently hydrogen or alkyl (e.g., CH 3 )。
38. The TREM of any one of claims 35-37, R 2a Is hydrogen and R 2b Is C (O) CH 3 。
39. The TREM of any of claims 35-38, wherein R 6a And R is 6b Is hydrogen.
40. The TREM of any of claims 35-39, wherein each of m, n, and o is independently an integer between 1 and 10.
41. The TREM of any of claims 35-40, wherein each of m, n, and o is independently 1.
42. The TREM of any of claims 35-41, wherein L 1 、L 2 And L 3 Independently comprising an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
43. The TREM of any of claims 35-42, wherein L 1 、L 2 And L 3 Independently being cleavable or non-cleavable.
44. The TREM according to any one of claims 35-43, wherein L 1 、L 2 And L 3 Independently comprising polyethylene glycol groups.
45. The TREM of any of claims 35-44, wherein M comprises an alkylene, alkenylene, alkynylene, heteroalkylene, or haloalkylene group.
46. The TREM of any of claims 35-45, wherein M comprises an ester, amide, disulfide, ether, carbonate, aryl, heteroaryl, cycloalkyl, or heterocyclyl group.
47. The TREM of any of claims 35-46, wherein M is cleavable or non-cleavable.
48. The TREM of any one of claims 1-47, wherein the ASGPR binding portion comprises galactose (Gal), galactosamine (GalNH) 2 ) Or an N-acetylgalactosamine (GalNAc) moiety.
49. The TREM of any one of claims 1-48, wherein the ASGPR binding portion comprises a plurality of galactose (Gal), galactosamine (GalNH) 2 ) Or an N-acetylgalactosamine (GalNAc) moiety.
50. The TREM of any one of claims 1-49, wherein the ASGPR binding portion comprises an ASGPR carbohydrate and an ASGPR linker.
51. The TREM of any one of claims 1-50, wherein the ASGPR binding moiety comprises a tri-antennary GalNAc moiety.
52. The TREM of any of claims 1-51, wherein the TREM is a compound provided in table 12, e.g., any of compound numbers 99-131.
53. The TREM of any one of claims 1-52, wherein the TREM retains the ability to support protein synthesis, e.g., relative to TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
54. The TREM of any one of claims 1-53, wherein the TREM retains the ability to be loaded with a synthetase, e.g., relative to a TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
55. The TREM of any one of claims 1-54, wherein the TREM retains the ability to be bound by an elongation factor, e.g., relative to a TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
56. The TREM of any one of claims 1-55, wherein the TREM retains the ability to introduce amino acids into a peptide chain, e.g., relative to TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
57. The TREM of any one of claims 1-56, wherein the TREM retains the ability to support extension or support initiation, e.g., relative to TREM or naturally occurring tRNA that does not comprise an ASGPR binding moiety.
58. The TREM of any one of claims 1-57, wherein the TREM has a binding affinity between 0.01nM and 100mM for ASGPR.
59. The TREM of any one of claims 1-58, wherein the TREM further comprises a chemical modification (e.g., a naturally occurring modification or a non-naturally occurring chemical modification).
60. A pharmaceutical composition comprising the TREM of any one of claims 1-59.
61. The pharmaceutical composition of claim 60, further comprising a pharmaceutically acceptable component, e.g., an excipient.
62. A lipid nanoparticle formulation comprising the TREM of any one of claims 1-59.
63. A lipid nanoparticle formulation comprising the pharmaceutical composition of any one of claims 60-61.
64. A method of making the TREM of any of claims 1-59.
65. A composition for use in treating a subject having a PTC-related disease or disorder, comprising administering to the subject a TREM comprising an ASGPR-binding moiety described herein (e.g., TREM of any of claims 1-59), or the pharmaceutical composition of any of claims 60-61, or the lipid nanoparticle formulation of any of claims 62-63, thereby treating the subject having the disease or disorder.
CN202180094267.XA 2020-12-23 2021-12-23 Modified TREM compositions and uses thereof Pending CN117083383A (en)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US202063130377P 2020-12-23 2020-12-23
US63/130,374 2020-12-23
US63/130,377 2020-12-23
US63/130,373 2020-12-23
US63/130,387 2020-12-23
US63/130,381 2020-12-23
US63/130,375 2020-12-23
PCT/US2021/065159 WO2022140702A1 (en) 2020-12-23 2021-12-23 Compositions of modified trems and uses thereof

Publications (1)

Publication Number Publication Date
CN117083383A true CN117083383A (en) 2023-11-17

Family

ID=88717650

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180094267.XA Pending CN117083383A (en) 2020-12-23 2021-12-23 Modified TREM compositions and uses thereof

Country Status (1)

Country Link
CN (1) CN117083383A (en)

Similar Documents

Publication Publication Date Title
AU2017200950B2 (en) Compositions and methods for modulating hbv and ttr expression
CN108368507B (en) iRNA compositions of programmed cell death 1 ligand 1(PD-L1) and methods of use thereof
TWI788312B (en) SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
JP2019535288A (en) Modified RNA agent with reduced off-target effect
CN115516090A (en) TREM compositions and uses thereof
CN116018405A (en) TREM compositions and related methods
JP2022511866A (en) Chemically modified RNAi constructs and their use
JP2024501288A (en) Compositions of modified TREM and uses thereof
EA003130B1 (en) Cationic virosomes as transfer system for genetic material
WO2018152327A1 (en) Enhancing stability and immunomodulatory activity of liposomal spherical nucleic acids
JP2022509809A (en) Nucleic acid for inhibiting C3 expression in cells
KR20230011913A (en) Compositions and methods for targeted RNA delivery
JP2021520207A (en) SiRNA with vinyl phosphonate at the 5&#39;end of the antisense strand
CN117083383A (en) Modified TREM compositions and uses thereof
WO2023064513A2 (en) Trem compositions and methods of use
WO2023250112A1 (en) Compositions of modified trems and uses thereof
US9067964B2 (en) Complex and method for enhancing nuclear delivery
JP2023504186A (en) Peptide docking excipients for targeted nucleic acid delivery
US20230203509A1 (en) Trem compositions and methods relating thereto
CA3226651A1 (en) Compositions and methods for targeted rna delivery
CN116583602A (en) G protein-coupled receptor 75 (GPR 75) iRNA compositions and methods of use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination