CN117069844B

CN117069844B - Bispecific antibody containing specific isoelectric point anti-human BCMA nano antibody and application thereof

Info

Publication number: CN117069844B
Application number: CN202311049259.0A
Authority: CN
Inventors: 杨寒朔
Original assignee: Chengdu Saiengino Biotechnology Co ltd
Current assignee: Chengdu Saiengino Biotechnology Co ltd
Priority date: 2022-12-06
Filing date: 2023-08-18
Publication date: 2024-02-09
Anticipated expiration: 2043-08-18
Also published as: CN117069842A; CN117069844A; CN117069842B

Abstract

The invention belongs to the technical field of biology, and particularly relates to a bispecific antibody containing an anti-human BCMA nanobody with a specific isoelectric point and application thereof. The bispecific antibodies provided by the invention comprise a first binding domain that specifically targets a CD3 molecule and a second binding domain that specifically targets a BCMA protein; the first binding domain and the second binding domain are bound by (G ₄ S) ₃ linker connection. The isoelectric point of the second binding domain sequence is 7.8-9.6.

Description

Bispecific antibody containing specific isoelectric point anti-human BCMA nano antibody and application thereof

The present application claims priority of "anti-human BCMA nanobody having a specific isoelectric point and its preparation method and application", and "202211557239X" based on bispecific antibody of anti-BCMA nanobody having a specific isoelectric point, CAR-T formulation and application ", filed in chinese patent application No. 2022115570784, 12, 2022, both priority inventive patent applications are incorporated by reference in their entirety.

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a bispecific antibody containing an anti-human BCMA nanobody with a specific isoelectric point and application thereof.

Background

B cell maturation antigen (B-cell maturation antigen, BCMA), also known as tumor necrosis factor receptor superfamily member 17 (TNFRS 17) or CD269, is a protein specifically expressed on the surface of plasma cells and differentiated plasma cells, whose extracellular domain is composed of 185 amino acid residues, plays a major role in B cell maturation and differentiation into plasma cells. BCMA is a receptor for proliferation-inducing ligand (APRIL) and B cell activating factor (B-cell activating factor, BAFF) of the tumor necrosis factor superfamily. Both can trigger NF- κB signaling, increase the expression of pro-survival BCL-2 family genes and down-regulate pro-apoptotic genes, in addition, BCMA can activate JNK and MAPK8 signaling pathways, and these signaling pathways are involved in regulating humoral immunity, B cell development and homeostasis, promote B cell survival in different development stages, and are key to regulating B cell proliferation, maturation and differentiation into plasma cells.

Multiple Myela (MM) is the second major hematological malignancy next to non-hodgkin's lymphoma, and is characterized by abnormal proliferation of malignant plasma cells in the bone marrow and osteolytic bone lesions. Related clinical symptoms include osteolytic lesions, anemia, renal insufficiency, hypercalcemia, infections and other related organ dysfunctions. BCMA protein and mRNA are almost exclusively found on plasma cells in normal human tissues, but are selectively overexpressed during malignant transformation of plasma cells, are highly expressed on the surface of multiple myeloma cells, and elevated BCMA levels in serum of MM patients promote tumor cell growth, survival and development of drug resistance, mainly by activating NF- κ B, AKT, phosphatidylinositol 3 kinase (PI 3K), STAT3 and MAPK intracellular signaling cascades. The current major treatment regimens are chemotherapy, autologous Stem Cell Transplantation (ASCT) and novel drugs (proteasome inhibitors, immunomodulatory drugs and monoclonal antibodies such as daratumumab or elotuzumab), which, although they delay the progression of the disease, MM remains largely incurable, and most patients relapse after multiple line therapy.

In 1993, an antibody having only heavy chain variable region (variabledomain of the heavy chain of HCAb, VHH) and CH2 and CH3 regions, called single domain antibody (singledomain antibody, sdAb), also called nanobody, was isolated from serum of camelids and sharks, which is superior to conventional antibodies in terms of molecular size, stability, solubility, penetrability, and the like. Furthermore, the VHH structure is cloned and expressed alone, while still retaining its antigen specificity and binding affinity for the original heavy chain intact, being the smallest antibody fragment known to bind antigen. Nanobodies may therefore play an advantage in vaccine development, disease diagnosis and treatment.

In view of the foregoing, there is a need in the art to develop anti-BCMA nanobodies and related applications to alleviate the deficiencies of current medical techniques in the treatment of multiple myeloma.

Disclosure of Invention

In view of the above, the present invention aims to provide an anti-human BCMA nanobody having a specific isoelectric point, a bispecific antibody comprising the same, and applications thereof, and the specific technical scheme is as follows.

An anti-human BCMA nanobody, which comprises a heavy chain variable region, wherein the heavy chain variable region comprises a framework region and a complementarity determining region, the isoelectric point value range of the heavy chain variable region is 7.8-9.6, and the sequence of the heavy chain variable region is shown as SEQ ID NO. 1-SEQ ID NO. 48.

Preferably, the BCMA nanobody of the invention has an isoelectric point ranging from 8.0 to 9.5.

Further, the anti-human BCMA nanobody has an affinity KD value ranging from 1×10 ^-9 ～10×10 ^-12 。

A bispecific antibody comprising a first binding domain that specifically targets a CD3 molecule and a second binding domain that specifically targets a BCMA protein; the second binding domain of the targeted BCMA protein is a nano antibody shown in SEQ ID NO. 1-SEQ ID NO. 48.

Further, the first binding domain and the second binding domain pass (G ₄ S) ₃ linker connection.

Further, the first binding domain of the CD3 targeting molecule is an OKT3 antibody.

The preparation method of the bispecific antibody comprises the following steps:

step 1: taking plasmid containing full-length sequence of human BCMA gene as a template, and preparing recombinant protein of specific targeted BCMA by using a eukaryotic expression system;

step 2: immunizing an animal by using the recombinant protein prepared in the step 1, extracting total RNA of peripheral blood lymphocytes of the immunized animal, reversely transcribing the total RNA into cDNA, and performing two rounds of amplification by nested PCR, wherein the primers amplified by the first round of nested PCR are shown as SEQ ID NO.49 and SEQ ID NO. 50; the primers of the second round of nested PCR amplification are shown as SEQ ID NO.51 and SEQ ID NO.52, so that nanobody genes are obtained and cloned to a phage display vector to construct a phage nanobody library;

step 3: panning the nanobody constructed in step 2 using the recombinant protein specifically targeting BCMA prepared in step 1 using phage display technology, further panning (e.g., identified by means of a clone ELISA) nanobodies capable of specifically binding BCMA protein;

step 4: linking the elutriated nanobody specifically binding BCMA protein with OKT3 antibody targeting CD3 molecule via (G4S) 3 linker;

step 5: and carrying out affinity detection on the constructed bispecific antibody.

Further, the nano-antibody which is elutriated in the step 3 and specifically binds to BCMA protein is further detected, and the nano-antibody with isoelectric point value in the range of 7.8-9.6 is screened out.

Preferably, the nanobody with isoelectric point value in the range of 8.0-9.5 is screened out.

The use of the bispecific antibody in the manufacture of a medicament for targeting multiple myeloma.

Further, the multiple myeloma is a multiple myeloma that highly expresses BCMA.

The application of the bispecific antibody in preparing medicaments for B lymphocyte malignant tumor, chronic lymphocytic leukemia, diffuse large B cell lymphoma, neuromyelitis optica spectrum diseases, rheumatoid arthritis, multiple sclerosis or systemic lupus erythematosus.

B cell activating factor (BAFF; BLyS; TALL-1) and proliferation-inducing ligand (APRIL) are two homologous members of the Tumor Necrosis Factor (TNF) superfamily, which play a role in the pathology of lupus erythematosus, rheumatoid arthritis and other autoimmune diseases. Existing research evidence suggests that the production of these two cytokines in the bone marrow microenvironment plays a key role in the survival and proliferation of myeloma cells. Both BAFF and APRIL are transmembrane activators and calcium modulators located on the surface of myeloma cells, while B Cell Maturation Antigen (BCMA) is a ligand of both TNF receptor family members. Thus, nanobodies capable of specifically targeting BCMA proteins could theoretically also play a role in the lupus erythematosus, rheumatoid arthritis and other autoimmune diseases.

Beneficial technical effects

The isoelectric point (pI) of an antibody is the pH at which the surface of the antibody molecule is uncharged, and is related to the quantitative ratio of acidic amino acids to basic amino acids contained in its sequence. The pH of the normal physiological environment of the human body is 7.2-7.4, and the antibody has positive charge when the pI is more than the pH; at pI < pH, the antibody is negatively charged. Since most cell surfaces are negatively charged, antibodies need to be positively charged to exert efficient liquid phase endocytosis (pinocytosis). In order to make the antibody exert better efficacy, the pI value of the therapeutic nano-antibody screened by the invention is in the range of 7.8-9.6, and the nano-antibody can be fully absorbed after administration, so that the therapeutic nano-antibody can play a role in targeted killing of BCMA tumor cells after being prepared into a bispecific antibody. Further experiments show that the BCMA nano antibody provided by the invention can play a stronger target killing effect after being prepared into a bispecific antibody within the range of PI value of 8.0-9.5.

Furthermore, the nano antibody with specific isoelectric point prepared by the method has good affinity, and the bispecific antibody prepared by the method has lasting in-vivo anti-tumor activity, and experiments prove that the bispecific antibody prepared by the method can exert an anti-tumor effect for 60 days, so that the bispecific antibody can exert great clinical potential in the treatment of multiple myeloma and spontaneous immune diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are of some embodiments of the invention and that other drawings may be derived from these drawings without inventive faculty.

FIG. 1 is an electrophoresis diagram of recombinant protein BCMA-mFc purified by means of affinity chromatography to obtain high purity;

FIG. 2 shows the total RNA of camelid lymphocytes extracted after immunization, and the electrophoresis pattern of PCR amplification products (A: first round amplification products; B: second round amplification products);

FIG. 3 is an electrophoresis diagram of recombinant nanobodies purified by means of affinity chromatography;

FIG. 4 is a graph showing absorbance at OD450 nm of an indirect ELISA method for co-incubating the obtained nanobody with BCMA recombinant protein coated in an ELISA plate and other irrelevant antigens;

FIG. 5 is a graph showing in vitro killing activity of bispecific antibody Nbs-OKT3 against myeloma cells;

FIG. 6 is a graph showing the survival of a model of the implantation of the bispecific antibody Nbs-OKT3 into MM mice.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. It will be apparent that the described embodiments are some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Herein, "and/or" includes any and all combinations of one or more of the associated listed items.

Herein, "plurality" means two or more, i.e., it includes two, three, four, five, etc.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising one … …" does not exclude the presence of other like elements in a process, method, article, or apparatus that comprises the element.

As used in this specification, the term "about" is typically expressed as +/-5% of the value, more typically +/-4% of the value, more typically +/-3% of the value, more typically +/-2% of the value, even more typically +/-1% of the value, and even more typically +/-0.5% of the value.

In this specification, certain embodiments may be disclosed in a format that is within a certain range. It should be appreciated that such a description of "within a certain range" is merely for convenience and brevity and should not be construed as a inflexible limitation on the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within that range. For example, a rangeThe description of (2) should be regarded as having been specificallySub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc. are disclosed, as are individual numbers within this range, such as 1,2,3,4,5, and 6. The above rule applies regardless of the breadth of the range.

Example 1

The embodiment provides a method for constructing, expressing and purifying BCMA recombinant protein expression vector

1.1 construction of eukaryotic expression vectors

The full-length sequence of human BCMA gene is synthesized into a pMD19-T vector, a plasmid containing the full-length BCMA gene is used as a template, a primer is designed for amplification to obtain a BCMA extracellular region (ECD) gene, the BCMA extracellular region (ECD) gene is cloned into a pVax-mFc vector subjected to double enzyme digestion by restriction enzymes PstI and XbaI in a digestion connection mode, the pVax-mFc vector is transformed into DH5 alpha competent cells, screening is carried out through a kanamycin resistance plate, monoclonal sequencing is selected for identification, and the successfully constructed vector is named as pVax-mFc-BCMA-His.

1.2 recombinant protein expression and purification

The successfully constructed recombinant plasmid pVax-mFc-BCMA-His is transfected into HEK293T cells by using a transfection reagent PEI, the supernatant is collected after 5 days of expression, and the recombinant protein BCMA-mFc with high purity is obtained by purifying by using Ni gel through an affinity chromatography mode, and the result is shown in figure 1. The recombinant protein has the effect of specifically targeting a BCMA target.

Example 2

Screening and preparation method of anti-BCMA protein nano antibody

2.1 protein emulsification and animal immunization

The BCMA recombinant protein purified in example 1 (for example, 1 mg) was mixed with an equal volume of aluminum hydroxide adjuvant and the camel was immunized subcutaneously through the neck for the first time, then immunized continuously 4 times every 2 weeks, and peripheral anticoagulation was collected on day 7 after impact immunization.

2.2 construction of phage antibody library and antibody screening

2.2.1 isolation of peripheral blood lymphocytes

200mL of peripheral blood, containing a large number of B lymphocytes, was collected aseptically from the neck vein of the camel, and diluted with an equal volume of PBS buffer. And separating by Ficoll-Paque Plus lymphocyte separating liquid to obtain peripheral blood lymphocyte, wherein the obtained lymphocyte can be directly used for extracting total RNA or frozen at-80 ℃ for standby.

2.2.2 nanobody Gene amplification

Firstly extracting total RNA of lymphocyte, carrying out reverse transcription by taking the RNA as a template to obtain cDNA, then taking the cDNA as the template, amplifying VHH genes by using nested PCR, wherein the first round of amplification primers are CALL001 and CALL002 (see table 1), and separating and recovering about 700bp fragments by agarose gel electrophoresis (figure 2 a); a second round of PCR amplification was then performed using the recovered 700bp product as template, the second round of amplification primers VHH-FOR, VHH-REV (see Table 1), and the 400bp fragment was separated and recovered by agarose gel electrophoresis (FIG. 2 b).

TABLE 1 primer sequences required for VHH Gene amplification

Primer name	Primer sequence (5 '-3')	Sequence numbering
			CALL001	GTCCTGGCTGCTCTTCTACAAGG	49
CALL002	GGTACGTGCTGTTGAACTGTTCC	50
			VHH-FOR	CAGGTGCAGCTGCAGGAGTCTGGGGGAG	51
VHH-REV	CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT	52

2.2.3 construction of phage display vectors

Both the PCR product amplified and recovered in the above step and the phage display vector pMECS were digested with the restriction enzymes Pst I and Not I, and then ligated using T4 DNA ligase.

2.2.4 electrotransformation and harvesting of phage antibody libraries

Adding the ligation product obtained in the above steps into TG1 competent cells, transforming the cells into TG1 by using an electrotransformation instrument, adding an SOC culture medium after electrotransformation is completed, culturing and activating the cells for 1h at 37 ℃ and 220rpm, uniformly coating the culture on an LB/Amp-Glu plate, culturing the cells for 6-8 h at 37 ℃, collecting the cells, adding sterile glycerol to reach the final concentration of 15%, and storing the prepared phage library at-80 ℃ or directly using the phage library for subsequent antibody screening.

2.2.5 screening of specific nanobodies

Taking the prepared phage library as an antibody source, taking a phage library with 20 times of library capacity, adding an auxiliary phage M13K07 to obtain recombinant phage for expressing the antibody, incubating the recombinant phage with BCMA recombinant protein coated in an ELISA plate, eluting with 0.1M Glycine (pH 1.5), re-infecting TG1 strain with the eluent, culturing at 37 ℃ and 220rpm to logarithmic phase, and adding the auxiliary phage to display the antibody on the surface of the phage. After repeating the above steps for 3 rounds of screening, a monoclonal colony is selected from the colony plate prepared by the third round of screening for amplification culture, a monoclonal ELISA is used for identifying the nanobody capable of specifically binding to BCMA protein, and the colony is subjected to sequencing analysis to obtain 48 specific nanobodies against BCMA, as shown in Table 2.

TABLE 2 nanobody complete sequence

The CDR regions of the sequences shown in SEQ ID NOS.1-48 are shown in Table 3 below.

TABLE 3 nanobody CDR regions

2.2.7 preparation of nanobodies

The VHH gene is amplified by taking a recombinant plasmid pMECS-Nbs containing the nanobody gene in 2.2.5 as a template, cloned into a eukaryotic expression vector pcDNA3.1-hFc in a way of enzyme digestion connection, and the plasmid is extracted and transfected into HEK293T cells after the construction is successful, the supernatant is collected after the expression is carried out for 5 days, and the recombinant nanobody is obtained by purifying the recombinant nanobody by utilizing a Ni column in an affinity chromatography way (figure 3).

Example 3

3.1 isoelectric point measurement of anti-BCMA protein nanobody

The isoelectric point (pI) of an antibody is the pH at which the surface of the antibody molecule is uncharged, and is related to the ratio of the number of acidic amino acids to the number of basic amino acids it contains. The pH of the normal physiological environment of the human body is 7.2-7.4, when the pI is more than the pH, the antibody is positively charged, the blood clearance rate and tissue retention rate of the antibody are increased, and the half-life period is relatively short; at pI < pH, the antibody is negatively charged, tissue uptake time is reduced, blood clearance rate is reduced, and half-life is longer.

The isoelectric point of the 48 anti-BCMA specific nano-antibodies obtained by the invention is 7.8-9.6, and specific data are shown in Table 4.

TABLE 4 nanobody pI values

Sequence(s)	1	2	3	4	5	6	7	8	9	10	11	12
													pI	7.82	7.84	7.84	7.84	7.85	7.89	7.9	7.9	7.9	8.27	8.4	8.41
Sequence(s)	13	14	15	16	17	18	19	20	21	22	23	24
													pI	8.42	8.43	8.5	8.51	8.51	8.53	8.53	8.54	8.54	8.64	8.64	8.64
Sequence(s)	25	26	27	28	29	30	31	32	33	34	35	36
													pI	8.66	8.7	8.73	8.85	8.85	8.87	8.89	8.89	8.91	8.96	9.05	9.07
Sequence(s)	37	38	39	40	41	42	43	44	45	46	47	48
													pI	9.1	9.1	9.12	9.13	9.15	9.16	9.23	9.3	9.33	9.39	9.47	9.61

Example 4

Biacore detection of nanobody affinity

The binding affinity of the batch of nano antibodies with antigen BCMA-mFc coated on CM5 chip is detected by using Biacore 8k instrument, and the result is shown in Table 5, and KD value of the 48 nano antibodies screened by the invention is in the range of 1.21×10 ^-9 ～9.46×10 ^-12 Has good affinity.

TABLE 5 in vitro binding affinity and kinetic analysis of nanobodies to BCMA proteins

/>

Remarks: 1E-04=1×10 ^-4 ；1E+04＝1×10 ⁴ The method comprises the steps of carrying out a first treatment on the surface of the And others by analogy.

Example 5

Specific analysis of anti-BCMA protein nanobodies

The affinity of the nano antibody and BCMA antigen is compared by an indirect ELISA method, the BCMA recombinant protein is coated in a 96-hole ELISA plate, the prepared nano antibody (0.1 mug/mL) is added into the ELISA plate after the sealing is finished, and the detection is carried out by utilizing an HRP-marked goat anti-human secondary antibody, and the result is shown in figure 4, the CDR regions of the obtained 48 nano antibodies can be specifically combined with the BCMA protein and do not react with other irrelevant antigens, so that the nano antibodies have good specific binding activity with the BCMA protein, and can specifically target multiple myeloma.

Example 6

In vitro killing Activity analysis of bispecific antibody Nbs-OKT3 on myeloma cells

Taking the nano-antibodies (E11\E12\E47) of SEQ ID No.11, no.12 and No.47 as an example, the above 3-segment nano-antibody sequences and an antibody OKT3 of an anti-CD 3 molecule are respectively constructed into eukaryotic expression vectors in series by using a (G4S) 3linker, and HEK293T cells are transfected for 5 days, and supernatants are collected and purified by using a Ni column. The nano antibody shown in SEQ ID NO.11 has isoelectric point of 8.4, KD value of 9.46E-12, CDR1 sequence of GNTYC, CDR2 sequence of IEYDGRT and CDR3 sequence of KTENTCLRKFGGADNAI. The nano antibody shown in SEQ ID NO.12 has an isoelectric point of 8.41, a KD value of 3.64E-10, a sequence of CDR1 of GYTYSNYC, a sequence of CDR2 of INSDGST and a sequence of CDR3 of AALTAGCTRYAS. The nano antibody shown in SEQ ID NO.47 has an isoelectric point of 9.47 and a KD value of 3.14E-10, the sequence of CDR1 is GFTFSSYD, the sequence of CDR2 is INRGGDYT, and the sequence of CDR3 is AKDWGTSISSMI.

The bispecific antibody (1 mug/mL, 0.1 mug/mL, 0.01 mug/mL, 0.001 mug/mL) with different concentrations is respectively incubated with the multiple myeloma cell line MM.1S-luciferase and activated T cells for 24 hours according to the effective target ratio (diabody: target cells) of 3:1, and the killing activity is evaluated by detecting the fluorescence intensity through an enzyme-labeling instrument, and the result is shown in figure 5, the bispecific antibody has stronger killing activity to the BCMA positive natural MM cell line in vitro. Wherein the portion of the targeted CD3 molecule mediates the formation of immune synapses to redirect T cells to activate the T cells and release cytotoxins and cytokines to perform a killing function.

Example 7

Validation of anti-tumor Activity of bispecific antibodies in vivo

MM.1S-luciferase and RPMI-8226-luciferase cells (both cell lines are human myeloma cells, which naturally express BCMA) were used in each case at a rate of 2X 10 ⁶ The individual cells were inoculated into NCG mice of 6 to 10 weeks old via the tail vein, and tumor growth was detected in a biopsy instrument 15 days after inoculation and randomly divided into 3 groups of 5. The control group was PBS having the same volume as that of the administered dose, and the mode of administration of the bispecific antibody (Nbs E11-OKT3 as the bispecific antibody used in this embodiment) was intraperitoneal administration, 30. Mu.g/dose, and 5X 10 was inoculated into each tail vein at the same time as the first administration ⁶ The bispecific antibody was administered 1 time every 7 days for a total of 3 times per activated T cell. The survival status of each mouse was observed for a statistical time period of 60 days in the experimental, control and blank (PBS) groups. The results are shown in fig. 6, the survival time of the mice with the bispecific antibody group is obviously longer than that of the mice with the control antibody and the PBS group, and the bispecific antibody prepared by the nano-antibody has lasting anti-tumor activity on the multiple myeloma cells. In this example, the control antibody was a bispecific antibody that was not targeted to BCMA, and was set as a control to exclude the effect of CD3 molecules in the bispecific antibody provided by the present invention.

The embodiments of the present invention have been described above with reference to the accompanying drawings, but the present invention is not limited to the above-described embodiments, which are merely illustrative and not restrictive, and many forms may be made by those having ordinary skill in the art without departing from the spirit of the present invention and the scope of the claims, which are to be protected by the present invention.

Claims

1. The anti-human BCMA nanobody is characterized by comprising a heavy chain variable region, wherein the heavy chain variable region comprises a framework region and a complementarity determining region, the isoelectric point value range of the heavy chain variable region is 8.0-9.5, and the sequences of the heavy chain variable region are shown as SEQ ID NO.11, NO.12 and NO. 47.

2. The anti-human BCMA nanobody as claimed in claim 1 wherein said anti-human BCMA nanobody has an affinity KD value ranging from 1 x 10 ^-9 ~10×10 ^-12 。

3. A bispecific antibody comprising a first binding domain that specifically targets a CD3 molecule and a second binding domain that specifically targets a BCMA protein, wherein the antibody is specifically targeted to a CD3 molecule by (G ₄ S) ₃ Connecting the linker; the first binding domain of the targeting CD3 molecule is an OKT3 antibody; the second binding domain of the targeted BCMA protein is the anti-human BCMA nanobody of claim 1 or 2.

4. Use of a bispecific antibody of claim 3 in the manufacture of a medicament for targeting multiple myeloma.

5. The use of claim 4, wherein the multiple myeloma is a multiple myeloma that highly expresses BCMA.