CN117069813A - Parthenogenesis haploid induction gene BnDMP and application thereof - Google Patents

Abstract

The application discloses a parthenogenesis haploid induction gene BnDMP and application thereof. The application provides an application of BnDMP protein in regulating and controlling plant haploid induction capacity or fruit number: the BnDMP protein is any one of the following B1) to B4): b1 Amino acid sequence is a protein shown in sequence 12 or sequence 14 or sequence 16 or sequence 18; b2 Fusion proteins obtained by ligating a tag to the N-terminus and/or C-terminus of the protein represented by B1); b3 A protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of the protein shown in the B1); b4 A protein having 75% or more homology with the amino acid sequence of the protein shown in B1) and having the same function.

Description

Parthenogenesis haploid induction gene BnDMP and application thereof

The application relates to a parthenogenesis haploid induction gene and application thereof, which are respectively applied for the application number 202111462060.1, the application date 2021.12.02 and the application and creation name of the parthenogenesis haploid induction gene.

Technical Field

The application relates to the field of agricultural biotechnology mainly based on genome editing technology and the field of crop genetic breeding, in particular to a preparation method and application of a plant female parent haploid induction line, and in particular relates to application of a parthenogenesis haploid induction gene BnDMP mutant obtained by using the gene editing technology as a plant haploid induction line in inducing plants to generate female parent haploids.

Background

The field crop production is an important material basis for maintaining human survival, and can be divided into monocotyledonous crops and dicotyledonous crops in botanic aspects, wherein the monocotyledonous crops mainly comprise rice, wheat, corn and the like, and the dicotyledonous crops mainly comprise soybean, rape, cotton, tomatoes, cucumbers and the like. Pure line creation is a key element of the breeding process for monocotyledonous crops and dicotyledonous crops. The haploid breeding technology can accelerate the pure line breeding process, can realize the rapid directional improvement of the inbred line by combining with the gene editing technology, can greatly improve the breeding efficiency, and is a common key technology in crop breeding. Currently, haploid breeding technology has been applied in maize breeding on a large scale, and key genes controlling maize haploid induction have been cloned, which provides a discriminable path for construction of haploid breeding technology systems based on hybrid induction in other crops. Currently, the phospholipase gene zmlla 1 has successfully obtained haploids on rice and wheat. However, the gene has high conservation in monocotyledonous crops, so that the application of the gene in dicotyledonous crops is limited.

At present, haploids are mainly generated on dicotyledonous crops or anther is cultivated in vitro, the efficiency is low, the genotype dependence on materials is high, and large-scale application is difficult to realize. Although introduction of the genetically modified centromere specific histone CENH3 into the arabidopsis CENH3 mutant induces haploid production, this approach produces a large number of euploids during induction, which limits to some extent the application of the method in breeding.

Disclosure of Invention

The invention firstly provides a novel application of the protein shown in B1) or B2) or B3) or B4);

b1 Amino acid sequence is a protein shown in sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18;

b2 A fusion protein obtained by ligating a tag to the N-terminus and/or C-terminus of a protein represented by sequence 2, sequence 4, sequence 6, sequence 8, sequence 10, sequence 12, sequence 14, sequence 16, or sequence 18;

b3 A protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 or the sequence 4 or the sequence 6 or the sequence 8 or the sequence 10 or the sequence 12 or the sequence 14 or the sequence 16 or the sequence 18;

B4 A protein which has 75% or more homology with the amino acid sequence shown in sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18 and has the same function.

The invention provides application of a protein shown in B1) or B2) or B3) or B4) in regulating plant haploid induction capacity or fruit number.

The haploid induction capacity of the regulatory plant is represented as follows: when the activity of the above protein in a plant is inhibited, the plant becomes a plant haploid inducer, and when the expression or activity of the above protein in a plant is increased, the plant haploid inducer is reduced or deleted. The protein activity is inhibited from expressing the protein or the protein is inactive. The reduced haploid inducer capacity or the absence of said plant is embodied by an increased number of fruits (e.g., siliques) of said plant.

The regulation and control of the number of the plant fruits is shown as follows: the number of plant fruits (e.g., horn fruits) decreases when the activity of the above protein in the plant is inhibited, and increases when the expression or activity of the above protein in the plant is increased. The protein activity is inhibited from expressing the protein or the protein is inactive.

In B2) above, the tag refers to a polypeptide or protein that is fusion expressed with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above B3), the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

In the above B4), the homology of 75% or more may be 80% or more or 85% or more or 90% or more or 91% or more or 92% or more or 93% or 94% or more or 95% or more or 96% or more or 97% or more or 98% or more or 99% or more.

The invention also provides a new application of the biological material related to the protein;

the biomaterial is any one of the following A1) to a 12):

a1 Nucleic acid molecules encoding the above proteins;

a2 An expression cassette comprising A1) said nucleic acid molecule;

a3 A) a recombinant vector comprising the nucleic acid molecule of A1);

a4 A recombinant vector comprising the expression cassette of A2);

a5 A) a recombinant microorganism comprising the nucleic acid molecule of A1);

A6 A) a recombinant microorganism comprising the expression cassette of A2);

a7 A) a recombinant microorganism comprising the recombinant vector of A3);

a8 A) a recombinant microorganism comprising the recombinant vector of A4);

a9 A transgenic plant cell line comprising the nucleic acid molecule of A1);

a10 A transgenic plant cell line comprising the expression cassette of A2);

a11 A transgenic plant cell line comprising the recombinant vector of A3);

a12 A) a transgenic plant cell line comprising the recombinant vector of A4).

The invention provides application of the biological material related to the protein in regulating and controlling plant haploid inducibility or fruit number.

In the above A1), the nucleic acid molecule is a gene represented by the following C1) or C2) or C3) or C4):

c1 A cDNA molecule or a genomic DNA molecule shown in sequence 1 or sequence 3 or sequence 5 or sequence 7 or sequence 9 or sequence 11 or sequence 13 or sequence 15 at positions 33-767 or sequence 17 at positions 32-434;

c2 A cDNA molecule or a genomic DNA molecule having 70% or more identity to the nucleotide sequence defined in C1);

c3 A cDNA molecule or a genomic DNA molecule derived from a dicot and having 70% or more identity with the nucleotide sequence defined in C1);

c4 A cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions to a nucleotide sequence defined under C1) or C2) or C3).

The gene has the following functions: when the above genes in a plant are suppressed or knocked out, the plant becomes a plant haploid inducer; when the above genes are expressed in a plant, the haploid inducer ability of the plant decreases and the number of fruits increases. The inhibition is complete inhibition.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence set forth in coding sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The invention also provides a new application of the substance shown in m1 or m 2:

m1, a substance inhibiting the activity of the protein in the plant;

m2, a substance that inhibits expression of a gene encoding the protein in a plant or a substance that knocks out a gene encoding the protein in a plant.

The invention provides application of a substance shown in m1 or m2 in cultivating a plant haploid induction line or cultivating a plant haploid or improving plant haploid induction capacity.

In the above application, the substance inhibiting the activity of the protein in the plant may be any substance capable of deleting the activity of the protein in the plant, such as a protein, polypeptide or small molecule compound (e.g., protein activity inhibitor) that inhibits the synthesis of the protein or promotes the degradation of the protein or inhibits the function of the protein;

the substance that inhibits the expression of the gene encoding the protein in the plant may be any substance that can prevent the expression of the gene encoding the protein in the plant, such as a substance that silences the gene encoding the protein in the plant (e.g., miRNA, siRNA, dsRNA, shRNA, etc.);

by knockout is meant that the host cell carrying the knockout substance does not produce a functional protein product of the gene, which may be a substance that effects the host cell not to produce a functional protein product of the gene in any way, such as removing all or part of the coding gene sequence, introducing frame shift mutations such that no functional protein is produced, removing or altering regulatory components (e.g., promoter editing) such that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Typically, the knockout is performed at the genomic DNA level such that the progeny of the cell also permanently carry the knockout. Further, the substance of the gene encoding the above protein in the knocked-out plant may be any substance capable of mutating the gene encoding the above protein in the plant (the mutant form may be a deletion mutation and/or an insertion mutation and/or a base substitution) to thereby lose activity, such as zinc finger protein ZFN gene editing system or TALENs gene editing system or CRISPR/Cas9 gene editing system, and the like. Still further, the substance of the gene encoding the above protein in the knockout plant is a CRISPR/Cas9 gene editing system.

The invention also provides a preparation method of the plant haploid inducer.

The preparation method of the plant haploid induction line provided by the invention is as follows D1) or D2):

d1 Inhibiting the activity of the protein in the recipient plant to obtain a plant haploid inducer;

d2 Inhibiting the expression of the gene encoding the protein in the recipient plant or knocking out the gene encoding the protein in the recipient plant to obtain a plant haploid inducer.

The invention also provides a preparation method of the plant haploid inducer.

The preparation method of the plant haploid inducer provided by the invention comprises the step of selfing the plant haploid inducer prepared by the preparation method of the plant haploid inducer.

The invention also provides a method for improving the induction capacity of the plant haploid.

The method for improving the plant haploid induction capacity comprises the following steps: inhibiting the activity of the protein in the receptor plant, or inhibiting the expression of the gene encoding the protein in the receptor plant, or knocking out the gene encoding the protein in the receptor plant to obtain a plant haploid inducer; the haploid inducer of the plant haploid inducer line is higher than the recipient plant.

In the above method for producing a plant haploid inducer, the number of selfing may be at least one, and more specifically may be one.

The preparation method of the plant haploid inducer line further comprises the step of screening homozygous mutants. The homozygous mutant is a plant individual with identical mutation on two homologous chromosomes of the genes for encoding the proteins.

Further, when the recipient plant is canola, the gene is a BnDMP1A gene and/or a BnDMP2A gene and/or a BnDMP1C gene and/or a BnDMP2C gene; inhibiting the expression of BnDMP1A gene and/or BnDMP2A gene and/or BnDMP1C gene and/or BnDMP2C gene in rape or knocking out BnDMP1A gene and/or BnDMP2A gene and/or BnDMP1C gene and/or BnDMP2C gene in rape to obtain transgenic rape, namely a rape haploid induction line;

when the recipient plant is tobacco, the gene is an NtDMP1 gene and/or an NtDMP2 gene and/or an NtDMP3 gene; inhibiting the expression of NtDMP1 genes and/or NtDMP2 genes and/or NtDMP3 genes in tobacco or knocking out the NtDMP1 genes and/or the NtDMP2 genes and/or the NtDMP3 genes in tobacco to obtain transgenic tobacco, namely a tobacco haploid induction system;

When the recipient plant is cotton, the gene is a GhDMP1 gene and/or a GhDMP2 gene; the method is to inhibit the expression of GhDMP1 genes and/or GhDMP2 genes in cotton or knock out the GhDMP1 genes and/or GhDMP2 genes in cotton to obtain transgenic cotton, namely a cotton haploid induction line.

Furthermore, the mode of the gene encoding the protein in the knockout receptor plant is CRISPR/Cas9.

The method for knocking out the gene encoding the protein in the receptor plant comprises the following steps: a CRISPR/Cas9 vector containing a target sequence is introduced into a recipient plant to yield a transgenic plant. The target sequence targets a target gene in a recipient plant.

The gene encoding the protein is a DNA molecule shown in 33-767 th bit of sequence 1 or sequence 3 or sequence 5 or sequence 7 or sequence 9 or sequence 11 or sequence 13 or sequence 15 or 32-434 th bit of sequence 17.

In a specific embodiment of the invention, when the recipient plant is canola, the target sequence for CRISPR/Cas9 is positions 26-45 of sequence 15, positions 4-23 of sequence 11, positions 56-75 of sequence 15, and positions 159-178 of sequence 11. The CRISPR/Cas9 vector containing the target sequence is specifically a vector obtained by inserting a DNA molecule shown in a sequence 19 into a pDIRECT-22C vector. The plant haploid induction line can be a BnDMP gene mutation homozygous strain BnDMP-1 or a BnDMP gene mutation homozygous strain BnDMP-2. The genomic DNA of BnDMP gene mutant homozygous line BnDMP-1 and wild type canola Westar differs only in that insertion of base G, which is located between positions 162-163 of sequence 11 and insertion of base G and base A, which is located between positions 42-43 of sequence 15, and insertion of base A, which is located between positions 72-73 of sequence 15, occurs on both homologous chromosomes of the gene encoding BnDMP1A, and insertion of base A, which is located between positions 42-43 of sequence 17 and between positions 72-73 of sequence 17, occurs on both homologous chromosomes of the gene encoding BnDMP 2C. The genomic DNA of the BnDMP gene mutant homozygous line BnDMP-2 and the wild type rape Westar only differ in that an insertion of a base G, which is located between positions 162-163 of the sequence 11, occurs on both homologous chromosomes of the gene encoding BnDMP1A, and in that a base substitution, which replaces the DNA molecule shown in positions 43-53 of the sequence 15 with a sequence of: TATACA, the insertion position of the base T is located between the 72 th and 73 th positions of the sequence 15, and the insertion of the base A, which is located between the 42 th and 43 th positions of the sequence 17 and between the 72 th and 73 th positions of the sequence 17, occurs on both homologous chromosomes of the gene encoding BnDMP 2C.

The invention also provides a preparation method of the plant haploid.

The preparation method of the plant haploid provided by the invention comprises the following steps: and (3) selfing the plant haploid induction line or the offspring thereof prepared according to the preparation method of the plant haploid induction line or hybridizing the plant haploid induction line or the offspring thereof serving as a male parent with other plant materials to obtain the selfed offspring or the hybridized offspring, namely the plant haploid.

Further, the preparation method of the plant haploid further comprises the following steps: and carrying out fluorescent marker identification and/or haploid character identification and/or leaf ploidy identification and/or molecular marker identification on the selfing offspring or the filial generation single plant, and selecting at least one offspring single plant identified as a haploid by a method as a plant haploid.

Further, the fluorescent label identification method can be performed according to the following method: hybridizing the plant haploid induction line carrying the fluorescent protein expression element as a male parent and a female parent to obtain a hybridization offspring, and judging whether the seed to be detected is haploid or tetraploid (diploid) by detecting whether the hybridization offspring seed has fluorescent signals or not: if the seed to be detected has no fluorescence or weak fluorescence, the seed is or is candidate to be a haploid; if the test seed exhibits strong fluorescence, the seed is or is candidate to be a tetraploid (diploid). Further, whether the seed to be detected has fluorescence or not is detected by a fluorescent lamp. Furthermore, the male parent carries a TagRFP fluorescent protein expression element driven by a promoter AtOLEO1, and can judge whether the hybrid offspring seeds are haploid or tetraploid (diploid) according to whether the hybrid offspring seeds have red fluorescence.

The haploid character identification method can be carried out according to the following method: if the plant to be detected has the characteristics of short plant, narrower leaf blade, up-rushing, compact plant type, male sterility and the like, the plant is or is candidate to be a haploid; if the plant to be detected has the characteristics of high plant, large leaf width, shawl, normal fertility and the like, the plant is or is candidate to be tetraploid (diploid).

The leaf ploidy identification method can be carried out according to the following method: extracting cell nuclei of tender leaves of plants to be detected, and taking tetraploid (diploid) plant leaves as a control; the signal was again detected with a flow cytometer, and the tetraploid (diploid) nuclear signal was first detected and the tetraploid (diploid) nuclear signal peak was set to 100 (haploid nuclear signal peak appears near 50 because the genetic material within the tetraploid (diploid) cell is twice that within the haploid cell). If the nuclear signal peak of the plant to be detected appears near 50, the plant is or is candidate to be a haploid; if the signal peak of the plant to be tested appears near 100, which is the same as the position of the tetraploid (diploid) cell nucleus signal intensity enrichment, the plant is or is candidate to be tetraploid (diploid).

The molecular marker identification can be carried out according to the following method: PCR amplification is carried out by adopting a male parent (female parent haploid induction system) and a female parent polymorphism primer, and whether a plant to be detected is haploid or tetraploid (diploid) is judged according to a PCR amplification product: if the amplified product of the plant to be detected only has the banding pattern of the female parent and does not have the banding pattern of the male parent, the plant is or is candidate to be a haploid; if the amplified product of the plant to be tested has heterozygous banding patterns of the male parent and the female parent, the plant is or is candidate to be tetraploid (diploid).

The use or method of any one of the above, wherein the plant is a dicot; further, the dicotyledonous plant may be carrot, sunflower, papaya, beet, melon, alfalfa, walnut, sesame, rubber tree, tapioca, lotus, sweet cherry, rose, potato, grape, soybean, tomato, cucumber, pepper, cotton, tobacco, or canola; further, the rape may specifically be wild rape Westar or hau-A; the tobacco may specifically be wild-type tobacco K326; the cotton can be wild cotton Hua cotton No. 1; the soybean may specifically be wild type williams 82.

The invention finally provides a method for preparing the transgenic plant with reduced haploid inducibility or increased fruit number.

The preparation method of the transgenic plant with reduced haploid inducibility or increased fruit number provided by the invention comprises the following steps: the expression quantity and/or activity of the protein in a plant haploid induction system are improved, and a transgenic plant is obtained; the haploid inducer capacity of the transgenic plant is lower than that of the plant haploid inducer line, and the number of fruits of the transgenic plant is higher than that of the plant haploid inducer line.

Further, the method for increasing the expression quantity and/or activity of the protein in the plant haploid induction line is to over-express the protein in the plant haploid induction line.

The over-expression method is to introduce the gene encoding the protein into a plant haploid induction line.

Furthermore, the gene encoding the protein is a DNA molecule shown in 33-767 positions or 32-434 positions of sequence 1 or sequence 3 or sequence 5 or sequence 7 or sequence 9 or sequence 11 or sequence 13 or sequence 15.

The plant haploid induction line is an arabidopsis mutant of knockout gene AtDMP8 (the AtDMP8 gene sequence is shown as 95 th-826 th positions of sequence 20 in a sequence table) and AtDMP9 (the AtDMP9 gene sequence is shown as 141 th-875 th positions of sequence 21 in the sequence table), such as an arabidopsis DMP gene mutant DMP8DMP9 (T2-19-1), compared with the genome DNA of wild type arabidopsis Col-0, the difference of the arabidopsis DMP gene mutant DMP8DMP9 (T2-19-1) is only that fragment deletion occurs on two homologous chromosomes of a gene encoding the AtDMP8 protein, the deleted fragment is positioned at 115 th-511 th positions of the sequence, and fragment deletion occurs on two homologous chromosomes of the gene encoding the AtDMP9 protein, and the deleted fragment is positioned at 161 th-564 th positions of the sequence 21.

The invention verifies conservation of haploid induction function of DMP homologous genes in different dicotyledonous crops by a genetic complementation mode on the basis of cloning parthenogenesis haploid key induction genes DMP, and the specific method is as follows: cloning DMP homologous genes in different dicotyledonous crops by means of gene synthesis or PCR amplification, constructing promoters of AtDMP9 genes in arabidopsis to drive expression vectors of the DMP homologous genes in the dicotyledonous crops respectively, transforming the constructed expression vectors into the arabidopsis DMP8DMP9 mutant, and observing the fruiting numbers of plants carrying the expression vectors and not carrying the expression vectors to prove that the DMP homologous genes in the dicotyledonous crops are related to parthenogenesis haploid induction, so that the haploid induction function of the DMP homologous genes in different dicotyledonous crops has higher conservation. Furthermore, the gene editing technology is utilized to edit the important DMP homologous genes in dicotyledon rape, so that a parthenogenesis haploid induction line is obtained, and the function of regulating and controlling plant haploid induction capacity of the DMP genes in dicotyledon rape is proved again. The dicotyledonous crop haploid induction method established by the invention has broad prospects for innovation and application of crop breeding commonality core technology.

Drawings

FIG. 1 is a schematic diagram of the construction process of the DMP gene complementation vector of different crops.

FIG. 2 is a comparison of haploids and tetraploids of canola. Panel a shows the haploid seedling stage of rape, panel b shows the flow test results, and panel c shows the haploid maturation stage. In FIGS. a-c, haploid is on the left and tetraploid is on the right.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.

The vectors pICH41295, pICH41308, pICH41276, pICH47742, pL1-F1-FastR, pICH41744 and pICSL4723 in the examples described below are all described in the literature "Engler C, youle M, gruetzner R, ehnert T, werner S, jones J D G, patron N J, marillon et S.A. Golden Gate Modular Cloning Toolbox for Plants [ J ]. ACS Synthetic Biology,2014,3 (11): 839-843." and are available to the public, and the test materials are only used for the relevant experiments of the invention and are not used as other applications.

The vector pDIRECT-22C in The examples described below is described in The literature "Cerak, T.and S.J.Curtin, et al (2017)," A multi-purpose toolkit to enable advanced genome engineering in plants "," The Plant Cell: tpc.00922.2016 "," and is available to The public from The applicant, and this test material is used only for repeated experiments related to The invention and is not used for other purposes.

The Arabidopsis DMP gene mutants DMP8DMP9 (T2-19-1) and Col-0 in the examples described below are both described in the literature "Zhong Y, chen B, li M, wang D, jiao Y, qi X, wang M, liu Z, chen C, wang Y, chen M, li J, xiao Z, cheng D, liu W, bouterier K, liu C, chen S.A DMP-triggered in vivo maternal haploid induction systemin the dicotyledonous Arabidopsis [ J ]. Nature Plants,2020,6 (5): 466-472". The public is available from the applicant, and the biological material is used only for the relevant experiments of the duplicate invention and is not available for other uses.

Wild type rape Westar in the examples described below is described in the literature "Silva N F, stone S L, christie L N, et al expression of the S receptor kinase in self-compatible Brassica napus cv. Westar leads to the allele-specific rejection of self-incompatible Brassica napus pollen [ J ]. Molecular genetics and genomics:MGG,2001,265 (3): 552-559 ], publicly available from the applicant, and this biomaterial is used only for repeated experiments relating to the invention and is not used for other purposes.

Wild type rape hau-a in the following examples is described in document "Chen Fengyi. Research on cabbage type rape hau CMS proteomics [ D ] university of agriculture in chinese, 2017", publicly available from applicant, which biological material is used only for repeated experiments related to the invention and is not used for other purposes.

The genes and proteins related to the present invention and their sequences are shown in Table 1. The DNA sequences in Table 1 are CDS sequences of the corresponding genes except for sequence 15 and sequence 17, encoding the corresponding protein sequences. The 33 th to 767 th positions of the sequence 15 are CDS sequences of the protein shown in the sequence 16, and the 32 nd to 434 th positions of the sequence 17 are CDS sequences of the protein shown in the sequence 18.

TABLE 1 Gene sequence and protein sequence according to the invention

Example 1 conservation verification of haploid inducer functions of DMP homologous genes in different dicotyledonous crops

1. Acquisition of amino acid sequence of DMP homologous Gene

The DMP homologous gene sequences in cotton, tobacco and canola were cloned by PCR amplification.

The cotton GhDMP1 and GhDMP2 genes are highly homologous, the used amplification primers are identical, the PCR amplification is carried out by designing the amplification primers, the amplification primers are cloned to a vector, then monoclonal sequencing is selected and then the amplification primers are respectively compared with the GhDMP1 and GhDMP2 gene sequences, and thus the GhDMP1 and GhDMP2 gene sequences are obtained. The primers for amplifying the GhDMP1 and GhDMP2 genes are as follows:

GhDMP1/2-CDS1F：tttgaagacaaaatgGAGCAAACCCACCATGG；

GhDMP1/2-CDS1R：tttgaagacaaAAGCTCAAGCAGCCATGCAACC。

The tobacco NtDMP1, ntDMP2 and NtDMP3 genes are highly homologous, the amplification primers are identical, the PCR amplification is carried out by designing the amplification primers, the amplification primers are cloned to the vector, and after monoclonal sequencing, the amplification primers are respectively compared with the NtDMP1, ntDMP2 and NtDMP3 gene sequences, so that the NtDMP1, ntDMP2 and NtDMP3 gene sequences are obtained. The NtDMP1, ntDMP2 and NtDMP3 gene amplification primers were as follows:

NtDMP-CDS1F1：tttgaagacaaaatgGAGCAAAGTACTGAGGGAATTG；

NtDMP1-CDS1R1：tttgaagacaaACCTCTTATCTTTTGGCACATCCA；

NtDMP2/3-CDS1R1：tttgaagacaaACCTCTCATCTTTTGGCACATCCA；

NtDMP-CDS1F2：tttgaagacaaAGGTACGTCGTGGGATTTAC；

NtDMP-CDS1R2：tttgaagacaaAAGCTTAAGCAGACATACATCCAATACCAT。

the BnDMP1A, bnDMP1C, bnDMP A and BnDMP2C genes of rape are highly homologous, amplification primers are designed to carry out PCR amplification and clone to a vector, and after single-clone sequencing is selected, the single-clone sequencing is respectively compared with BnDMP1A, bnDMP1C, bnDMP A and BnDMP2C gene sequences, so that BnDMP1A, bnDMP1C, bnDMP A and BnDMP2C gene sequences are obtained. The BnDMP1A, bnDMP1C, bnDMP A and BnDMP2C gene amplification primers were as follows:

BnDMP1A/1C-CDS1F：tttgaagacaaaatgGAGAAAACAGAGGAAAGT；

BnDMP1A/1C-CDS1R：tttgaagacaaAAGCTCAAGCAGACATGCATCCAAC；

BnDMP2A/C-CDS1F：tttgaagacaaaatgGAGAAAACAGAGGAAAGC；

BnDMP2A/C-CDS1R：tttgaagacaaAAGCTCAAGCGGACATGCATCCAAC；

BnDMP2C-CDS1R1：tttgaagacaaCTCTCTTCCTCCTCCTGCGGCG；

BnDMP2C-CDS1F2：tttgaagacaaAGAGATTCCGGTAAGTGATGATA。

2. construction and transformation of DMP homologous gene complementary vector

1. Fragments of the DMP homologous genes in different crops obtained above were cloned into the level0 vector pICH41308 by the golden gate method, respectively, to obtain the vector pL0-DMP-CDS1 carrying different DMP gene sequences (b in fig. 1).

2. Amplifying the promoter sequence of the AtDMP9 gene by using the genomic DNA of arabidopsis thaliana Col-0 as a template and using a primer pair DMP9-proF/R, and cloning the amplified product into a level0 vector pICH41295 to obtain a vector pL0-AtDMP9-pro (a in figure 1);

The sequence of the Arabidopsis AtDMP9 gene promoter amplification primer is as follows:

DMP9-proF：tttgaagacaaGGAGccttccaagactcgga；

DMP9-proR：tttgaagacaaCATTTTTCGTGTGTTTCTCTCTGTTTTT。

3. amplifying the AtuNos terminator sequence by using a vector plasmid carrying the AtuNos terminator sequence as a template and using a primer pair TerATuNosF/R, and cloning the amplified product into a level 0 vector pICH41276 to obtain a vector pL0-terAtuNos (c in figure 1);

the sequence of the AtuNos terminator amplification primer is as follows:

TerAtuNosF：tttgaagacaagcttgtcaagcagatcgttca；

TerAtuNosR：tttgaagacaaAGCGTCGATCTAGTAACATAG。

4. the BsaI cleavage site fragments (DMP gene CDS sequences) in the vectors pL0-DMP-CDS1, bsaI cleavage site fragments (promoters of the AtDMP9 gene genes) in the vectors pL0-AtDMP9-pro and BsaI cleavage site fragments (AtuNos terminator sequences) in the vectors pL0-terAtuNos are respectively connected to a Level 1 vector pICH47742 in a cleavage connection mode to obtain Level 1 vectors pL1-F2-pDMP9 of the different crop DMP homologous genes.

5. The Level 1 vector pL 1-F2-pDPMP 9 of the homologous gene of different crops (promoter of the gene of AtDMP 9+CDS sequence of the gene of DMP+AtuNos+terminator sequence of the gene of AtDMP), the BbsI cleavage site of the vector pL1-F1-FastR (FastR fragment) and the BbsI cleavage site of the vector pICH41744 (L2E fragment) are respectively connected to the Level 2 vector pICSL4723 by means of cleavage connection, so as to obtain the final complementary vector pL 2-FastR+pDP9: DMP (E in FIG. 1).

6. The DMP homologous gene complementary vectors of different crops are respectively transformed into agrobacterium GV3101, then transformed into an arabidopsis DMP gene mutant DMP8DMP9 (T2-19-1) by a dipping method, and then transformed seeds are screened by RFP fluorescence, so that positive transgenic seeds are finally obtained.

7. The positive transgenic seeds are planted and selfed, and plants with the ratio of fluorescence to non-fluorescence carried seeds in the selfed offspring being about 3:1 are selected for the next analysis.

3. Seed setting number analysis of transgenic plants carrying DMP homologous gene complementation vectors

Since the arabidopsis haploid inducer gene DMP8DMP9 (T2-19-1) was found to have lower numbers of selfing and crossing horn results than wild type arabidopsis Col-0. If the DMP homologous gene has the same haploid induction function in other crops, the fruit set number of transgenic plants carrying the DMP homologous gene complementation vector would be theoretically higher than that of the mutant DMP8DMP9 (T2-19-1). Therefore, in order to verify the functions of the DMP homologous genes in other crops, the statistics and analysis of the numbers of the seed set of the transgenic plants of the mutant DMP8DMP9 and the complementary vectors carrying the DMP homologous genes of different crops are respectively carried out, and the specific operation steps are as follows:

1. Fixing the horn fruit to be observed on a glass slide adhered with a double-sided adhesive tape;

2. under the integral mirror, the two sides of the horn fruit are gently scratched by using the tip of a 1mL syringe, and the peel of the horn fruit is torn off by using a pointed tweezer;

3. counting the number of normal seeds in the fruits, and calculating the average fruiting number of the fruits.

The results show that: the results of the self-mating fruits of transgenic plants carrying the complementary vectors of the DMP homologous genes of different crops were all significantly increased compared to the mutant DMP8DMP9 (table 2). These results indicate that the exogenous DMP homologous genes can complement the phenotype of the mutant DMP8DMP9, indicating that the DMP homologous genes in these crops all have the function of regulating the haploid induction ability of plants.

TABLE 2 statistical tables of the number of self-mating fruit set of mutant DMP8DMP9 and transgenic plants carrying DMP homologous genes

Material genotype	Real number of average selfing junction
		Wild type Arabidopsis Col-0	52.8
dmp8dmp9	13.4
		dmp8dmp9+GhDMP1	29.8 a
dmp8dmp9+GhDMP2	29.0 a
		dmp8dmp9+NtDMP1	44.3 a
dmp8dmp9+NtDMP2	39.3 a
		dmp8dmp9+NtDMP3	42.0 a
dmp8dmp9+BnDMP1A	29.1 a
		dmp8dmp9+BnDMP1C	30.6 a
dmp8dmp9+BnDMP2A	31.4 a
		dmp8dmp9+BnDMP2C	20.8 a

Note that: a represents that the junction real number is significantly different from that of dmp8dmp 9; more than 3 independent transgenic plants were taken for each genotype material.

Example 2 preparation of BnDMP Gene knockout rape mutant and use thereof

1. Knockout of BnDMP genes using CRISPR/Cas9 systems

BnDMP genes (BnDMP represents four genes of BnDMP1A, bnDMP2A, bnDMP C and BnDMP 2C) in the rape are knocked out by using a CRISPR/Cas9 system, and the BnDMP gene knocked-out mutant is obtained. Since there are only three homologous genes of BnDMP1A, bnDMP A and BnDMP2C in rape Westar. Therefore, only these three genes were knocked out, and the specific procedure was as follows:

1. selection of sgRNA sequences

Target site sequences with the length of 20bp are respectively designed on BnDMP1A, bnDMP A and BnDMP2C genes.

Target site 1 is located at 26 th to 45 th positions of sequence 15, and at 26 th to 45 th positions of sequence 17, and target site 1 is CACGAAAATGGAGAAAACAG.

Target site 2 is located at positions 4-23 of sequence 11, and target site 2 sequence is GAGAAAACAGAGGAAAGTGT.

Target site 3 is located at 56 th to 75 th positions of sequence 15, 56 th to 75 th positions of sequence 17, and target site 3 is TGGGATCAGAGTTTACACGA.

Target site 4 is located at positions 159-178 of sequence 11, and target site 4 is GAACTCCTTGAGCGACCATG.

2. Construction of CRISPR/Cas9 vectors

The CRISPR/Cas9 vector is a vector obtained by inserting the DNA molecule shown in sequence 19 into pDIRECT-22C vector.

3. Obtaining transgenic plants

And (3) converting the CRISPR/Cas9 vector obtained in the step (2) into an agrobacterium competent cell GV3101 (the agrobacterium GV3101 competent cell is purchased from Beijing Olympic tripod communications biotechnology Co., ltd., and can be obtained by the public through purchase) through heat shock to obtain recombinant bacteria GV3101/CRISPR/Cas9.

And then the recombinant bacterium GV3101/CRISPR/Cas9 is transformed into wild rape Westar (recombinant agrobacterium is subjected to 28 ℃ propagation), the bacterial liquid after propagation is used for infecting rape Westar), and the T0 generation transgenic rape plant is obtained after the selection of the kana resistance.

4. Identification of transgenic plants mutated in BnDMP Gene

And (3) collecting the T0 generation transgenic rape plant leaves obtained in the step (3), extracting genome DNA as a template, and carrying out PCR amplification by adopting the following primers to obtain PCR amplification products of different strains.

The BnDMP1A gene mutation sequence detection primer has the following sequence:

BnDMP1AF1：CTTCTTGATTCCAGAGATCAC；

BnDMP1AR1：GAAGAAGAAGCAGGAGGTTG。

the BnDMP2A gene mutation sequence detection primer has the following sequence:

BnDMP2AF1：CCACCACTGGTTAAGCGATACT；

BnDMP2AR1：CATGCGACGTTTTCGACCTC。

the BnDMP2C gene mutation sequence detection primer has the following sequence:

BnDMP2CF2：CCCTTAGGACTAACGAACTCGC；

BnDMP2CR1：CACTTACCGGAATCTCTGCCTC。

and (3) carrying out Sanger sequencing on PCR amplified products of different strains, and respectively comparing the PCR amplified products with BnDMP genes corresponding to the wild rape Westar according to sequencing results. The genotypes of the respective BnDMP were identified according to the following principles, respectively.

The genotype of the strain is a heterozygous genotype (BnDMP gene mutation on 1 chromosome in 2 homologous chromosomes, and BnDMP gene non-mutation on the other 1 chromosome) when the sequence with bimodal characteristics from the target site sequence, and the strain is a T0 generation transgenic rape heterozygous mutant strain;

the sequence with specific unimodal characteristics from the target site sequence is the same as the BnDMP gene sequence of the wild rape Westar, the genotype of the strain is wild type, namely the BnDMP gene sequence has no mutation; if the BnDMP gene sequence of the strain is different from that of the wild rape Westar, the genotype of the strain is a homozygous genotype (the BnDMP genes on 2 homologous chromosomes are mutated), and the strain is a T0 generation transgenic rape homozygous mutant strain.

5. Genotyping of T1-generation rape

Selfing the T0 generation transgenic rape BnDMP gene mutant strain obtained in the step 4, harvesting seeds, and sowing to obtain the T1 generation transgenic rape. The genotype of BnDMP gene of T1 generation transgenic rape is identified, and the specific method is as follows: and (3) taking genomic DNA of the T1 generation transgenic rape as a template, and respectively utilizing mutation sequence detection primers of BnDMP1A, bnDMP A and BnDMP2C genes to identify genotypes of 3 BnDMP genes of the T1 generation transgenic rape according to the method in the step (4).

Finally obtaining the T1 generation transgenic rape BnDMP gene mutation homozygous lines BnDMP-1 and BnDMP-2. The specific mutation cases were as follows:

the T1 generation transgenic rape 3 BnDMP gene mutation homozygous lines BnDMP-1 differ from the genomic DNA of wild type rape Westar only in that the insertion of base G, which is located between positions 162-163 of the sequence 11 and the insertion of base G and base A, which is located between positions 42-43 of the sequence 15, and the insertion of base A, which is located between positions 72-73 of the sequence 15, and the insertion of base A, which is located between positions 42-43 of the sequence 17 and between positions 72-73 of the sequence 17, occurs on both homologous chromosomes of the gene encoding BnDMP 2C.

The T1 generation transgenic rape 3 BnDMP gene mutation homozygous lines BnDMP-2 differ from the genomic DNA of wild type rape Westar only in that the insertion of a base G, which is located between positions 162-163 of the sequence 11, occurs on both homologous chromosomes of the gene encoding BnDMP1A and in that the insertion of a base T, which is a substitution of the DNA molecule shown at positions 43-53 of the sequence 15, occurs on both homologous chromosomes of the gene encoding BnDMP 2A: TATACA, the insertion position of the base T is located between the 72 th and 73 th positions of the sequence 15, and the insertion of the base A, which is located between the 42 th and 43 th positions of the sequence 17 and between the 72 th and 73 th positions of the sequence 17, occurs on both homologous chromosomes of the gene encoding BnDMP 2C.

The T1 generation transgenic rape mutant line is used for the following haploid inducibility analysis experiment.

2. Application of BnDMP gene knockout rape mutant in inducing generation of haploid

Identification of haploid selfing Induction ability of BnDMP Gene knockout rape mutant

Since wild rape Westar is a homozygous inbred line, the haploid cannot be identified by molecular markers in the inbred offspring of the mutant obtained by knocking out the BnDMP gene on this background. Therefore, seed obtained by selfing mutants of different types of combinations obtained by BnDMP gene were planted, and haploid identification was performed on the selfed offspring as follows.

1. Plant phenotype identification

After planting the selfed seeds, observing the phenotype of the single plant, wherein the haploid has the characteristics of short plant, narrow leaf blade, up-rushing, compact plant type, male sterility and the like, and the tetraploid is characterized by high plant, wide leaf blade, shawl and normal fertility (a and c in fig. 2).

2. Flow cytometry leaf identification

Carrying out flow cytometry detection on the plant which shows the haploid character and is obtained in the step 1, wherein the specific method is as follows: extracting cell nuclei of tender leaves of plants to be detected, and taking tetraploid rape leaves as a control; the signal was again detected with a flow cytometer, the tetraploid nuclear signal was first detected, and the tetraploid nuclear signal peak position was set to 100 (since the genetic material in the tetraploid cell is twice that in its haploid cell, the haploid nuclear signal peak position appears around 50). If the nuclear signal peak of the plant to be detected appears near 50, the plant to be detected is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the tetraploid cell nuclear signal intensity enrichment position, and the plant to be tested is tetraploid (b in FIG. 2).

In the offspring single plant of BnDMP gene mutation homozygous strain selfing, if the identification results are haploid according to the 2 methods, the plant is a haploid plant; if the identification result of any one of the methods is not haploid, the plant is not haploid.

Counting the identification results and calculating the haploid induction rate according to the following formula: haploid inductivity (%) = (haploid number of plants/total number of plants) ×100. As can be seen from Table 3, haploids can be obtained in the inbred offspring after mutation of the canola BnDMP gene.

TABLE 3 haploid induction statistics in the bdmp mutant inbred offspring

Genotype of the type	Total plant number	Haploid plant number	Haploid inducer (percent)
				WT	343	0	0
bndmp-1	97	1	1.03
				bndmp-2	45	2	4.44

Note that: WT is rape wild type material Westar.

Identification of haploid hybridization Induction ability of BnDMP Gene knockout rape mutant

The mutants with different types of combinations obtained by BnDMP genes are hybridized with rape hau-A material to obtain offspring, and haploids in the offspring are identified by the following method.

1. Fluorescent marker identification

The CRISPR/Cas9 vector carries the expression element of the promoter atolo eo1 drive TagRFP (Entacmaea quadricolor). Since the promoter AtOLEO1 is specifically expressed in mature seed embryos, the fluorescent signal of TagRFP can be observed by fluorescent lamps. Thus, by hybridizing the mutant carrying the expression element as male parent with other female parent material that does not carry fluorescence, the resulting seed will have embryos of tetraploid seed that exhibit red fluorescence due to the genome of the male parent, while embryos of haploid seed will exhibit weak fluorescence due to the origin of the female parent.

2. Molecular marker identification

And (2) further planting the weakly fluorescent seeds identified in the step (1), extracting genome DNA (deoxyribonucleic acid) of the seeds, carrying out PCR (polymerase chain reaction) amplification by using rape hau-A material and a polymorphism primer (A07 F+A07R) among transgenic rape mutant lines, and carrying out agarose banding pattern detection on an amplified product, wherein if the amplified product of a single plant to be detected shows 1 band, the single plant band is considered to be the rape hau-A material band type, and the band type of a male parent material does not exist, and the single plant is a haploid. If the amplified product of the single plant to be detected shows 2 bands, the single plant band is considered to be rape hau-A material and the hybrid band type of the transgenic rape mutant line, the single plant is the offspring of normal hybridization and is tetraploid.

The rape haploid identification primer sequence is as follows:

A07F：CGGGGCCATAAAAACAGTGAAG；

A07R：GCCTTCAGCGACTTGAACATC。

3. plant phenotype identification

The haploid plant identified in the step 2 is further observed for phenotype, the haploid has the characteristics of dwarf plant, narrower leaf blade, up-rushing, compact plant type, male sterility and the like, and the tetraploid is characterized by high plant, wide leaf blade, shaggy and normal fertility (a and c in fig. 2).

4. Flow cytometry leaf identification

Carrying out flow cytometry detection on the plants which are obtained in the step 3 and show the haploid character, wherein the specific method is as follows: extracting cell nuclei of tender leaves of plants to be detected, and taking tetraploid rape leaves as a control; the signal was again detected with a flow cytometer, the tetraploid nuclear signal was first detected, and the tetraploid nuclear signal peak position was set to 100 (since the genetic material in the tetraploid cell is twice that in its haploid cell, the haploid nuclear signal peak position appears around 50). If the nuclear signal peak of the plant to be detected appears near 50, the plant to be detected is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the tetraploid cell nuclear signal intensity enrichment position, and the plant to be tested is tetraploid (b in FIG. 2).

In the offspring single plant hybridized by BnDMP gene mutation homozygous strain and rape hau-A material, if the identification results are haploid according to the 4 methods, the plant is a haploid plant; if the identification result of any one of the methods is not haploid, the plant is not haploid.

Counting the identification results and calculating the haploid induction rate according to the following formula: haploid inductivity (%) = (haploid number of plants/total number of plants) ×100. As can be seen from the statistics in Table 4, bnDMP gene mutant homozygous lines were crossed with other materials, and haploids were obtained in the offspring.

TABLE 4 haploid induction statistics in the bndmp mutant hybrid offspring

Hybrid combinations	Total plant number	Haploid number	Haploid inducer (percent)
				hau-A×WT	557	0	0.00
hau-A×bndmp-1	570	22	3.86
				hau-A×bndmp-2	91	1	1.10

Note that: WT is rape wild type material Westar.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. Use of a protein as shown in B1) or B2) or B3) or B4) for regulating haploid inducer ability or fruit number in a plant:

   b1 Amino acid sequence is a protein shown in sequence 12 or sequence 14 or sequence 16 or sequence 18;

   b2 A fusion protein obtained by ligating a tag to the N-terminus and/or C-terminus of a protein represented by sequence 12, sequence 14, sequence 16 or sequence 18;

   b3 A protein with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 12 or the sequence 14 or the sequence 16 or the sequence 18;

   b4 A protein having 75% or more homology with the amino acid sequence shown in sequence 12 or sequence 14 or sequence 16 or sequence 18 and having the same function.
2. 2. Use of a biological material related to the protein of claim 1 for regulating haploid inducer capacity or fruit number in a plant;

   the biomaterial is any one of the following A1) to a 12):

   a1 A nucleic acid molecule encoding the protein of claim 1;

   a2 An expression cassette comprising A1) said nucleic acid molecule;

   a3 A) a recombinant vector comprising the nucleic acid molecule of A1);

   a4 A recombinant vector comprising the expression cassette of A2);

   a5 A) a recombinant microorganism comprising the nucleic acid molecule of A1);

   A6 A) a recombinant microorganism comprising the expression cassette of A2);

   a7 A) a recombinant microorganism comprising the recombinant vector of A3);

   a8 A) a recombinant microorganism comprising the recombinant vector of A4);

   a9 A transgenic plant cell line comprising the nucleic acid molecule of A1);

   a10 A transgenic plant cell line comprising the expression cassette of A2);

   a11 A transgenic plant cell line comprising the recombinant vector of A3);

   a12 A) a transgenic plant cell line comprising the recombinant vector of A4).
3. 3. The use according to claim 2, characterized in that: a1 The nucleic acid molecule is a gene as shown in the following C1) or C2) or C3) or C4):

   c1 A cDNA molecule or a genomic DNA molecule shown in sequence 11 or sequence 13 or sequence 15 or sequence 17;

   c2 A cDNA molecule or a genomic DNA molecule having 70% or more identity to the nucleotide sequence defined in C1);

   c3 A cDNA molecule or a genomic DNA molecule derived from a dicot and having 70% or more identity with the nucleotide sequence defined in C1);

   c4 A cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions to a nucleotide sequence defined under C1) or C2) or C3).
4. Use of a substance represented by m1 or m2 for breeding a plant haploid inducer line or breeding a plant haploid or increasing plant haploid inducer capacity:

   m1, a substance which inhibits the activity of the protein of claim 1 in plants;

   m2, a substance which inhibits the expression of a gene encoding the protein of claim 1 in a plant or a substance which knocks out a gene encoding the protein of claim 1 in a plant.
5. 5. The preparation method of the plant haploid induction line is as follows D1) or D2):

   d1 Inhibiting the activity of the protein of claim 1 in a recipient plant to obtain a plant haploid inducer;

   d2 Inhibiting expression of a gene encoding the protein of claim 1 in a recipient plant or knocking out a gene encoding the protein of claim 1 in a recipient plant to obtain a plant haploid inducer.
6. 6. A method for preparing a plant haploid inducer line comprising the step of selfing the plant haploid inducer line prepared by the method of claim 5.
7. 7. A method for improving the haploid inducer ability of a plant comprising the steps of: inhibiting the activity of the protein of claim 1 in a recipient plant, or inhibiting the expression of a gene encoding the protein of claim 1 in a recipient plant, or knocking out a gene encoding the protein of claim 1 in a recipient plant, to obtain a plant haploid inducer; the haploid inducer of the plant haploid inducer line is higher than the recipient plant.
8. 8. A preparation method of a plant haploid comprises the following steps: selfing the plant haploid induction line or the offspring thereof prepared by the method according to claim 5 or 6 or crossing the plant haploid induction line or the offspring thereof as a male parent with other plant materials to obtain the selfed offspring or the crossed offspring, namely the plant haploid.
9. 9. The method according to claim 8, wherein: the method further comprises the steps of: and carrying out fluorescent marker identification and/or haploid character identification and/or leaf ploidy identification and/or molecular marker identification on the selfing offspring or the filial generation single plant, and selecting at least one offspring single plant identified as a haploid by a method as a plant haploid.
10. 10. A method for preparing a transgenic plant with reduced haploid inducer ability or increased fruit number, comprising the steps of: increasing the expression level and/or activity of the protein of claim 1 in a plant haploid inducer line to obtain a transgenic plant; the haploid inducer capacity of the transgenic plant is lower than that of the plant haploid inducer line, and the number of fruits of the transgenic plant is higher than that of the plant haploid inducer line.