CN117051131B - SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof - Google Patents
SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof Download PDFInfo
- Publication number
- CN117051131B CN117051131B CN202311311454.6A CN202311311454A CN117051131B CN 117051131 B CN117051131 B CN 117051131B CN 202311311454 A CN202311311454 A CN 202311311454A CN 117051131 B CN117051131 B CN 117051131B
- Authority
- CN
- China
- Prior art keywords
- sheep
- brucellosis
- resistance
- molecular marker
- snp molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241001494479 Pecora Species 0.000 title claims abstract description 119
- 206010006500 Brucellosis Diseases 0.000 title claims abstract description 91
- 239000003147 molecular marker Substances 0.000 title claims abstract description 64
- 238000001514 detection method Methods 0.000 title claims abstract description 23
- 238000009395 breeding Methods 0.000 claims abstract description 17
- 230000001488 breeding effect Effects 0.000 claims abstract description 17
- 239000002773 nucleotide Substances 0.000 claims abstract description 11
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 11
- 238000000034 method Methods 0.000 claims description 14
- 239000003153 chemical reaction reagent Substances 0.000 claims description 8
- 210000000349 chromosome Anatomy 0.000 claims description 8
- 238000012216 screening Methods 0.000 claims description 6
- 230000006872 improvement Effects 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 2
- 239000000523 sample Substances 0.000 description 14
- 210000004369 blood Anatomy 0.000 description 8
- 239000008280 blood Substances 0.000 description 8
- 241000589562 Brucella Species 0.000 description 7
- 239000007850 fluorescent dye Substances 0.000 description 7
- 238000010791 quenching Methods 0.000 description 6
- 230000000171 quenching effect Effects 0.000 description 6
- 241000282414 Homo sapiens Species 0.000 description 5
- 238000012408 PCR amplification Methods 0.000 description 5
- 230000003321 amplification Effects 0.000 description 5
- 238000012098 association analyses Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 5
- 239000000243 solution Substances 0.000 description 5
- 238000002875 fluorescence polarization Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- 238000003908 quality control method Methods 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 238000002965 ELISA Methods 0.000 description 3
- 241001465754 Metazoa Species 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 238000010201 enrichment analysis Methods 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- 208000035240 Disease Resistance Diseases 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 230000002860 competitive effect Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 210000002966 serum Anatomy 0.000 description 2
- 241000005672 Baia Species 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 241000726221 Gemma Species 0.000 description 1
- 241001647091 Saxifraga granulata Species 0.000 description 1
- 239000007983 Tris buffer Substances 0.000 description 1
- 206010000210 abortion Diseases 0.000 description 1
- 231100000176 abortion Toxicity 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000003242 anti bacterial agent Substances 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 206010003246 arthritis Diseases 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 239000003640 drug residue Substances 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 230000017188 evasion or tolerance of host immune response Effects 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 238000002373 gas-phase electrophoretic mobility molecular analysis Methods 0.000 description 1
- 208000000509 infertility Diseases 0.000 description 1
- 231100000535 infertility Toxicity 0.000 description 1
- 230000036512 infertility Effects 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 201000005737 orchitis Diseases 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000000513 principal component analysis Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- LENZDBCJOHFCAS-UHFFFAOYSA-N tris Chemical compound OCC(N)(CO)CO LENZDBCJOHFCAS-UHFFFAOYSA-N 0.000 description 1
- 230000001018 virulence Effects 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
- 206010048282 zoonosis Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular marker assisted breeding, in particular to an SNP molecular marker related to sheep brucellosis resistance, and a detection primer and application thereof. The SNP molecular marker related to sheep brucellosis resistance character provided by the invention contains a nucleotide sequence with the polymorphism of the 101 st position of the sequence shown as SEQ ID NO.1 as T/C. The SNP molecular marker can accurately detect the resistance of sheep to brucellosis, can realize early prediction of the brucellosis resistance of sheep, is used for breeding of the brucellosis resistance sheep and molecular marker assisted breeding of the brucellosis resistance of sheep, and effectively improves the breeding efficiency of the brucellosis resistance of sheep.
Description
Technical Field
The invention relates to the technical field of molecular marker assisted breeding, in particular to SNP molecular markers related to sheep brucellosis resistance, and detection primers and application thereof.
Background
Brucellosis is a zoonosis caused by brucellosis infection. Clinical symptoms of brucellosis include wave heat, arthritis, and reproductive disorders (orchitis and epididymitis in male animals, abortion and infertility in female animals), etc. Brucella has the characteristics of immune evasion and recessive infection, wherein the virulence and infectivity of the sheep Brucella are strongest, so that huge economic loss is caused for sheep breeding industry, and the Brucella becomes a great potential safety hazard of public health. The molecular markers related to the brucellosis resistance are mined in the host animal sheep and applied to auxiliary disease-resistant breeding of sheep, so that the transmission path of brucellosis can be fundamentally cut off, the prevention of human diseases and animals and the forward shift of a gate can be truly realized, and the environmental pollution and the drug residue hazard caused by the abuse of antibiotics can be reduced. It is therefore highly necessary to mine sheep for brucellosis-resistant related molecular markers and to verify them in large sample populations.
Disclosure of Invention
The invention provides SNP molecular markers related to sheep brucellosis resistance characters, and detection primers and application thereof.
According to the invention, through carrying out whole genome association analysis on the brucellosis resistance traits of sheep of different varieties, SNP molecular markers related to the brucellosis resistance traits in sheep genome are found, and through verifying sheep population with large sample size, the SNP molecular markers have obvious correlation with the brucellosis resistance traits of sheep, and can be used for detecting the resistance of sheep to brucellosis. In order to facilitate detection, the invention also develops a primer combination for detecting the SNP molecular marker.
Based on the findings, the invention provides the following technical scheme:
in a first aspect, the invention provides a SNP molecular marker related to sheep brucellosis resistance traits, wherein the SNP molecular marker comprises a nucleotide sequence with the polymorphism of the 101 st position of the sequence shown as SEQ ID NO.1 as T/C.
The polymorphic site of the SNP molecular marker is positioned at 35695983 of chromosome 3 of sheep reference genome with version number of oar_v1.0 and 2017, 11 months, and the polymorphism is T/C.
The SNP molecular marker has obvious correlation with the resistance of sheep to brucellosis, can accurately identify the resistance of sheep of different varieties to brucellosis, is used for molecular marker assisted breeding and variety improvement of sheep to resist brucellosis, and improves molecular breeding efficiency.
Based on the polymorphic site 35695983 of chromosome 3 of sheep reference genome of 2017, 11 th month with the version number of oar_v1.0, the invention develops a primer for amplifying the SNP molecular marker aiming at the upstream and downstream sequences of the polymorphic site for detection. By combining the upstream and downstream sequences of the SNP polymorphic site, the sequence shown as SEQ ID NO.1 is obtained. It will be understood by those skilled in the art that sequence fragments of different lengths can be developed for amplification and detection of SNP sites based on the above SNP sites and sequences upstream and downstream thereof, and thus the sequence shown in SEQ ID NO.1 does not constitute a limitation on the SNP molecular marker of the present invention, as long as the sequence fragment containing the polymorphic site at 35695983 position of chromosome 3 of sheep reference genome having version number of oar_v1.0, month 11 of 2017 is within the scope of protection of the SNP molecular marker of the present invention.
In some embodiments of the present invention, the nucleotide sequence of the SNP molecular marker related to the sheep brucellosis resistance trait is shown in SEQ ID NO.1, the polymorphic site is located at 101 st position of the sequence shown in SEQ ID NO.1, and the polymorphism is T/C.
SEQ ID NO.1:
AGCCACCAGGTGGCTCTTCACATGCCCGCCTTCCTTCAGGGCCCCCTGGAGTAGATAGGCACCCCCCTACCCCATCTAACCTCAGGAGTAATCACTTCCAYGTTAGGTGCCCAGGGAAGCTATCCTGAGGGCCACGGGCCAGGCCTTCCTGTCACTGCCAGCCCACACCAGCCTGGGAGTCTCGGCAGACCTTTCATCCCA. Wherein Y is the polymorphic site of the SNP molecular marker, y=t or C.
In some embodiments of the invention, the SNP molecular markers described above are amplified from primers having sequences shown in SEQ ID NO.2-4 using sheep genome as a template.
The genotype of the polymorphic site of the SNP molecular marker is TT or CC, which corresponds to the high resistance of brucellosis, and the genotype is TC, which corresponds to the low resistance of brucellosis.
In the SNP molecular marker, sheep with the 'TT' homozygous genotype and the 'CC' homozygous genotype have obviously higher brucellosis resistance compared with 'TC' heterozygous genotype.
In a second aspect, the invention provides a primer combination for amplifying the SNP molecular marker related to the sheep brucellosis resistance trait.
Based on the location of the polymorphic site of the SNP molecular marker provided above in the genome and the sequence upstream and downstream thereof, one skilled in the art can develop various types of primers for amplifying the SNP molecular marker.
The above primer may be any primer that can be used to detect the genotype of a SNP molecular marker.
Preferably, the primer combination comprises primers with sequences shown as SEQ ID NO.2-4, wherein the primers with sequences shown as SEQ ID NO.2-3 are forward primers, and the primers with sequences shown as SEQ ID NO.4 are reverse universal primers.
SEQ ID NO.2:5’-GCTTCCCTGGGCACCTAACA-3’;
SEQ ID NO.3:5’-CTTCCCTGGGCACCTAACG-3’;
SEQ ID NO.4:5’-CTACCCCATCTAACCTCAGGAGTAA-3’。
The primer combination can realize efficient amplification and genotyping aiming at the SNP molecular markers.
KASP, i.e. competitive allele-specific PCR, can carry out high-precision double-allele typing of SNP by a specific fluorescent probe, and has stable and accurate analysis, low cost, high efficiency and easy realization of high throughput and automation. Therefore, to achieve efficient detection, the present invention developed a KASP primer combination for detecting the above-mentioned SNP molecular markers based on the KASP technique.
Preferably, the KASP primer combination comprises a first forward primer, a second forward primer and a reverse universal primer, wherein the sequence of the first forward primer is a specific fluorescent tag sequence and a sequence shown as SEQ ID NO.2 which are connected in sequence, and the sequence of the second forward primer is a specific fluorescent tag sequence and a sequence shown as SEQ ID NO.3 which are connected in sequence; the nucleotide sequence of the reverse universal primer is shown as SEQ ID NO. 4.
The fluorescent labels of the first forward primer and the second forward primer described above are different.
In some embodiments of the invention, the primer combination comprises the forward primer set forth in SEQ ID NO.5-6 and the reverse universal primer set forth in SEQ ID NO. 4.
In a third aspect, the invention provides a kit comprising a primer combination as described above.
For ease of detection, the kit may also contain other reagents for PCR amplification including, but not limited to, DNA polymerase, PCR reaction buffers, probes, dNTPs, mg 2+ Water, etc.
The above reagents may be packaged individually or may be provided as a premix after mixing.
The kit described above may have any of the following uses:
1) Detecting or assisting in detecting the resistance of sheep to brucellosis;
2) Screening or identifying sheep with high brucellosis resistance;
3) Early prediction of brucellosis resistance of sheep;
4) Molecular marker assisted breeding of sheep with brucellosis resistance;
5) Improvement of brucellosis resistance in sheep.
In a fourth aspect, the present invention provides the use of any one of the following 1) -8) of a SNP molecular marker or a detection primer for said SNP molecular marker:
1) The method is applied to detecting or assisting in detecting the resistance of sheep to brucellosis;
2) The application in preparing a reagent for detecting or assisting in detecting the resistance of sheep to brucellosis;
3) Use in screening or identifying sheep with high resistance to brucellosis;
4) Use in the preparation of a reagent for screening or identifying sheep with high resistance to brucellosis;
5) Application in early prediction of brucellosis resistance of sheep;
6) The application of the method in preparing early prediction reagent for the brucellosis resistance of sheep;
7) Application in molecular marker assisted breeding of sheep to brucellosis resistance;
8) The application in the improvement of the brucellosis resistance strain of sheep.
The polymorphic site of the SNP molecular marker is positioned at 35695983 of chromosome 3 of sheep reference genome with version number of oar_v1.0, and the polymorphism is T/C.
In some embodiments of the invention, the SNP molecular marker comprises a nucleotide sequence having a polymorphism T/C at position 101 of the sequence shown in SEQ ID NO. 1.
In some embodiments of the present invention, in the above application, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is located at position 101 of the sequence shown as SEQ ID NO.1, and the polymorphism is T/C.
In some embodiments of the present invention, the detection primer of the SNP molecular marker comprises a primer with a sequence shown as SEQ ID NO.2-4, wherein the primer with a sequence shown as SEQ ID NO.2-3 is a forward primer, and the primer with a sequence shown as SEQ ID NO.4 is a reverse universal primer.
In the application, the genotype of the polymorphic site of the SNP molecular marker is TT or CC, which corresponds to the high resistance of brucellosis, and the genotype is TC, which corresponds to the low resistance of brucellosis.
In the application, sheep with genotype of 'TT' and 'CC' of the SNP molecular marker are selected as parents for breeding brucellosis resistance characters.
In a fifth aspect, the invention provides a method of detecting brucellosis resistance in a sheep, the method comprising: detecting the genotype of an SNP molecular marker related to the brucellosis resistance property of sheep in a sheep genome, wherein the polymorphic site of the SNP molecular marker is positioned at 35695983 position of chromosome 3 of a sheep reference genome with a version number of oar_v1.0 and a polymorphism of T/C in 11 months 2017.
The genotype of the polymorphic locus of the SNP molecular marker is TT or CC, which corresponds to the high resistance of brucellosis, and the genotype is TC, which corresponds to the low resistance of brucellosis.
In some embodiments of the invention, the SNP molecular marker comprises a nucleotide sequence with a polymorphism T/C at position 101 of the sequence as set forth in SEQ ID NO. 1.
In some embodiments of the invention, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is positioned at 101 st position of the sequence shown as SEQ ID NO.1, and the polymorphism is T/C.
Preferably, the method comprises the steps of:
1) Extracting genome DNA of sheep to be detected;
2) Using the genome DNA of the step 1) as a template, and carrying out PCR amplification by using primers with sequences shown as SEQ ID NO. 2-4;
3) Analyzing the genotype of the SNP molecular marker in the PCR amplification product, judging the resistance of the sheep to be detected to brucellosis according to the genotype, judging the sheep to be detected to have high resistance to brucellosis if the genotype of the polymorphic site of the SNP molecular marker is TT or CC, and judging the sheep to have low resistance to brucellosis if the genotype is TC.
The beneficial effects of the invention at least comprise: the SNP molecular marker related to the brucellosis resistance of sheep can accurately detect the resistance of sheep to brucellosis, can realize early prediction of the brucellosis resistance of sheep, is not limited by age, sex and the like of sheep, can be accurately screened even when the sheep is born, can be used for breeding of the brucellosis resistant sheep and molecular marker assisted breeding of the brucellosis resistance of sheep, can obviously promote the breeding process of the brucellosis resistant sheep, effectively improves the breeding efficiency, and has important significance for developing and utilizing excellent economic characteristics of excellent sheep varieties and protecting and reasonably utilizing seed resources.
Drawings
In order to more clearly illustrate the invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the genotyping results of the polymorphic sites of the SNP molecular markers in example 2 according to the invention.
FIG. 2 shows the results of the population expansion verification of SNP markers in sheep populations according to example 2 of the invention, wherein p < 0.01 is represented.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The invention provides an SNP molecular marker related to sheep brucellosis resistance, wherein a polymorphic site of the SNP molecular marker is positioned on a 35695983 bp th chromosome of a 3 rd sheep, and the site has T/C base mutation and has obvious correlation with sheep brucellosis resistance; presumably, the site mutation may affect the ability of sheep to clear brucella; at this polymorphic site, sheep with a "TT" homozygous genotype and a "CC" homozygous genotype have a stronger brucellosis resistance than the "TC" heterozygous genotype; the position of the polymorphic site of the SNP molecular marker is based on sheep genome sequence information version number oar_v1.0, 11 months in 2017. The SNP molecular marker provided by the invention has important guiding significance for distinguishing and screening sheep with brucellosis resistance characters through genotypes, and can improve the accuracy and efficiency of screening the brucellosis resistance of the sheep.
The method for detecting the genotype of the SNP molecular marker is not particularly limited, and the genotype detection method conventional in the art can be used. In a specific embodiment of the invention, the KASP method is used to detect the genotype of the SNP molecular marker in the genome of a sheep to be tested.
The SNP molecular marker related to the sheep anti-brucellosis character or the detection primer thereof can be used in combination with other SNP molecular markers related to the sheep anti-brucellosis character or the detection primers thereof for identifying the sheep anti-brucellosis character.
EXAMPLE 1 development of SNP molecular markers related to the anti-brucellosis Property of sheep
In the embodiment, 4 sheep populations of saxifrage, dongfolishen, texol and Texol are taken as samples, and SNP molecular markers related to the anti-brucellosis property of sheep are developed by using whole genome association analysis (GWAS), and specifically are as follows:
raising sheep of the species of safock, dongfoli, texafock and Texak under the same condition, naturally infecting brucellosis, collecting sheep blood samples, and respectively detecting whether sheep is infected with the brucellosis by adopting a competitive enzyme-linked immunosorbent assay (cELSA), an indirect enzyme-linked immunosorbent assay (iELISA) and a Fluorescence Polarization Assay (FPA), wherein positive judgment threshold lines of the methods are as follows: cELISA:30, iELISA:15, FPA:20, above the threshold line, positive. And if the detection results of the three methods are positive, judging that brucella is suffered, if the detection results are negative, judging that the patient is healthy, and otherwise judging that the patient is suspicious. Finally, 25 sheep judged to have brucellosis were selected as an experimental group, 25 sheep judged to be healthy were selected as a control group, and total genome association analysis (GWAS) was performed on the 50 sheep, wherein information of the sick sheep and blood sample detection results thereof are shown in table 1, and information of the healthy sheep and blood sample detection results thereof are shown in table 2.
TABLE 1
TABLE 2
The 50 sheep blood DNA samples were subjected to whole genome re-sequencing with a sequencing platform of Huada gene T7 at a depth of 20× and a total sequencing amount of 2.6T. Sequence alignment and quality control are carried out on the sequencing data, wherein data filtering uses software fastp, alignment and mutation detection uses software GTX, and an aligned VCF file with the size of 71.08 GB is obtained. The quality control uses software PLINK, and the quality control standard is as follows: -mini 0.1-geno 0.1-maf 0.05-hwe e-5, and the effective SNP number after quality control is 24,683,444. Using software PLINK, code: the principal component analysis is performed by plink-bfile filename-pca 10-out filename-pca-chr-set 27-alloy-extra-chr. Quantitative trait (iELISA value) was selected, using GEMMA (Version 0.95) software, toIs a mouldThe model base, genome assembly Oar _rambouillet_v1.0, was used as a reference genome for whole genome association analysis. SNP annotation and enrichment analysis were then performed, wherein the SNP locus annotation used tool was https:// baia. Ensembl. Org/index. Html, the reference genome was Genome assembly Oar _rambouille_v1.0, the GO enrichment analysis used tool was https:// biit. Cs. Ut. Ee/gprofiler/last, the reference genome was Homo sapiens (Human), ovis aries (shaep), and the KEGG enrichment analysis used tool was: https:// david. Ncifcrf. Gov, reference genome is Homo sapiens (Human), ovis aries (Sheep).
In whole genome association analysis, top 1000 SNP-log 10 (P) has a value of 4.56-7.36, and is annotated to 100 genes, wherein-log 10 (P) 48 SNP values of 6 or more are added to 13 genes. Among the 48 SNPs, SNP molecular markers which are obviously related to the brucellosis disease resistance phenotype of sheep are selected. Finally, the SNP molecular marker related to the sheep anti-brucellosis trait is obtained, a polymorphic site of the SNP molecular marker is positioned on a 35695983 bp rd chromosome of sheep (sheep genome sequence information version number oar_v1.0, month 2017), T/C base mutation exists at the site, the SNP molecular marker has obvious correlation with the sheep anti-brucellosis trait, the polymorphic site is cELISA value, iELISA value and FPA value of sheep individuals with 'TT' homozygous genotype and 'CC' homozygous genotype are obviously lower than those of 'TC' heterozygous genotype (p is less than 0.01), namely, compared with 'TC' heterozygous genotype, sheep with 'TT' homozygous genotype and 'CC' homozygous genotype has stronger brucellosis resistance, and 'CC' and 'TT' are dominant genotypes of the anti-brucellosis sheep. The SNP molecular marker corresponds to a sequence shown as SEQ ID NO.1, wherein the polymorphic site is positioned at 101bp, and the polymorphism is T or C.
Based on the SNP molecular markers, the invention further develops KASP primers for detecting the SNP molecular markers, and the KASP primers are specifically as follows:
Primer X:
5'-gaaggtgaccaagttcatgctGCTTCCCTGGGCACCTAACA-3' (SEQ ID NO.5, lower case part is the specific fluorescent tag sequence FAM);
Primer Y:
5'-gaaggtcggagtcaacggattCTTCCCTGGGCACCTAACG-3' (SEQ ID NO.6, lower case part is the specific fluorescent tag sequence VIC);
Primer R:
5’-CTACCCCATCTAACCTCAGGAGTAA-3’(SEQ ID NO.4)。
the polymorphic sites of the SNP molecular markers obtained above can be distinguished in the sheep population of this example by using the KASP primer described above into three genotypes of TC "heterozygous genotype," TT "homozygous genotype and" CC "homozygous genotype.
Example 2 application of SNP molecular markers related to sheep anti-brucellosis character
The enlarged population verification is carried out on SNP molecular markers which are developed in example 1 and related to the sheep brucellosis resistance, and the enlarged population verification is concretely as follows:
1. collecting sheep blood sample to be tested and identifying serum antibody concentration
The jugular blood of 129 safomites, 130 tofopristine sheep, 133 white safomites and 29 texels sheep, which were not vaccinated, were collected from a farm naturally infected with brucella. The concentration of Brucella antibody in serum is detected by adopting an indirect enzyme-linked immunosorbent assay (iELISA) method. The individual iELISA value can be used as an index for representing the disease resistance, namely, the lower the iELISA value is, the stronger the brucellosis resistance of the individual is, and the weaker the brucellosis resistance of the individual is. In the examples, the determination threshold for negative and positive in the result of the iELISA was set to 15.
2. Extracting genome DNA in sheep blood sample to be detected
And extracting genome DNA in the sheep blood sample to be detected by adopting a magnetic bead method.
3. Amplification of SNP molecular marker fragments
PCR amplification was performed using the genomic DNA extracted in the above 2 as a template and the KASP primer combinations (SEQ ID NOS.5-6 and SEQ ID NO. 4) developed in example 1, as follows:
(1) KASP amplification system:
1.6 The μl reaction system comprises: 50-100 ng/. Mu.L of genomic DNA, 0.8. Mu.L of Primer mix (preferably, primer mix ratio: 100. Mu. Mol/L of forward Primer X and Primer Y each 60. Mu.L, 100. Mu. Mol/L of universal reverse Primer R150. Mu.L, 10 mM Tris. Mu.L of HCl 230. Mu.L), 2 XMaster mix 0.4. Mu.L, and double distilled water make up 1.6. Mu.L.
The reaction system is a preferable reaction system of a Douglas Array Tape platform, and other reasonable reaction systems can achieve the same detection purpose.
Wherein the 2 XMaster mix comprises a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B, and high-fidelity Taq enzyme, dNTP and Mg 2+ Etc. The fluorescent probe A has a sequence of 5'-GAAGGTGACCAAGTTCATGCT-3', and the 5' end of the fluorescent probe A is connected with 1 fluorescent group FAM; the fluorescent probe B has a sequence of 5'-GAAGGTCGGAGTCAACGGATT-3', and the 5' end of the fluorescent probe B is connected with 1 fluorescent group VIC; the nucleotide sequence of the quenching probe A is 5'-AGCATGAACTTGGTCACCTTC-3', and the 3' -end of the quenching probe A is connected with 1 fluorescent group BHQ; the nucleotide sequence of the quenching probe B is 5'-AATCCGTTGACTCCGACCTTC-3', and the 3' -end of the quenching probe B is connected with 1 fluorescent group BHQ.
(2) PCR reaction conditions:
amplification of DNA fragment: pre-denaturation at 94 ℃ for 15 min, and setting a cycle; denaturation at 94℃for 20 s, gradient annealing at 61-55℃for 60℃ 60 s, 10 cycles were set, each cycle being reduced by 0.6 ℃.
Fluorescence signal enhancement: denaturation at 94℃for 20 s, annealing at 55℃for 60℃ 60 s, 26 cycles were set.
4. And detecting PCR amplification products by adopting a Douglas Array Tape platform to obtain genotypes of polymorphic loci of the SNP molecular markers.
The polymorphism loci genotype of the SNP molecular markers of 421 sheep were detected, and the results are shown in Table 3 and FIG. 1, and the three genotypes of "CC", "TC" and "TT" were distinguished in the detected sheep population. The correlation analysis of the genotype and the resistance trait of the brucellosis is carried out, and the result is shown in the figure 2, the iELISA values of the 'CC' and 'TT' genotype sheep individuals are obviously lower than those of the 'CT' genotype, which indicates that the resistance of the 'CC' and 'TT' genotype sheep individuals to the brucellosis is higher than those of the 'CT' genotype, and the SNP molecular marker provided by the invention has higher accuracy in the identification of the resistance trait of the brucellosis.
TABLE 3 number of individuals of different genotypes at polymorphic sites of SNP molecular markers in sheep populations
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims (3)
- An SNP molecular marker or the use of any one of the following 1) to 5) of a detection primer for said SNP molecular marker:1) The application in preparing a reagent for detecting or assisting in detecting the resistance of sheep to brucellosis;2) Use in the preparation of a reagent for screening or identifying sheep with high resistance to brucellosis;3) The application of the method in preparing early prediction reagent for the brucellosis resistance of sheep;4) Application in molecular marker assisted breeding of sheep to brucellosis resistance;5) The application in the improvement of the brucellosis resistance of sheep;the polymorphic site of the SNP molecular marker is positioned at 35695983 of chromosome 3 of sheep reference genome with version number of oar_v1.0 and 2017, 11 months, and the polymorphism is T/C;the genotype of the polymorphic locus of the SNP molecular marker is TT or CC, which corresponds to the high resistance of brucellosis, and the genotype is TC, which corresponds to the low resistance of brucellosis.
- 2. The use according to claim 1, wherein the detection primer of the SNP molecular marker comprises a primer with a sequence shown as SEQ ID NO.2-4, wherein the primer with a sequence shown as SEQ ID NO.2-3 is a forward primer and the primer with a sequence shown as SEQ ID NO.4 is a reverse universal primer.
- 3. The use according to claim 1, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the polymorphic site is located at position 101 of the sequence shown as SEQ ID NO.1, and the polymorphism is T/C.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202311311454.6A CN117051131B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202311311454.6A CN117051131B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN117051131A CN117051131A (en) | 2023-11-14 |
CN117051131B true CN117051131B (en) | 2024-01-30 |
Family
ID=88659433
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202311311454.6A Active CN117051131B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN117051131B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117385060B (en) * | 2023-12-08 | 2024-03-26 | 中国科学院遗传与发育生物学研究所 | SNP marker related to sheep growth performance and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105603092A (en) * | 2016-02-05 | 2016-05-25 | 中国农业科学院北京畜牧兽医研究所 | SNP marker related to sheep multi-horn character and application thereof |
CN113249495A (en) * | 2021-06-29 | 2021-08-13 | 西北农林科技大学 | Sheep liquid phase chip and application thereof |
KR20220095679A (en) * | 2020-12-30 | 2022-07-07 | 대한민국(농림축산식품부 농림축산검역본부장) | Single nucleotide polymorphism marker for identification of Brucella and primer set for detection |
CN115948567A (en) * | 2022-08-18 | 2023-04-11 | 塔里木大学 | SNP molecular marker related to sheep lambing number trait and application thereof |
-
2023
- 2023-10-11 CN CN202311311454.6A patent/CN117051131B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105603092A (en) * | 2016-02-05 | 2016-05-25 | 中国农业科学院北京畜牧兽医研究所 | SNP marker related to sheep multi-horn character and application thereof |
KR20220095679A (en) * | 2020-12-30 | 2022-07-07 | 대한민국(농림축산식품부 농림축산검역본부장) | Single nucleotide polymorphism marker for identification of Brucella and primer set for detection |
CN113249495A (en) * | 2021-06-29 | 2021-08-13 | 西北农林科技大学 | Sheep liquid phase chip and application thereof |
CN115948567A (en) * | 2022-08-18 | 2023-04-11 | 塔里木大学 | SNP molecular marker related to sheep lambing number trait and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN117051131A (en) | 2023-11-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7732138B2 (en) | Rapid genotyping analysis and the device thereof | |
CN117051131B (en) | SNP molecular marker related to sheep brucellosis resistance character, detection primer and application thereof | |
CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
US11739374B2 (en) | Methods and compositions for pathogen detection in plants | |
US20100297633A1 (en) | Method of amplifying nucleic acid | |
CN117051132B (en) | Sheep SNP molecular marker and application thereof in sheep brucellosis resistance character detection | |
CN117051133B (en) | SNP molecular marker for detecting brucellosis resistance of sheep, detection primer and application thereof | |
CN117051135B (en) | Brucellosis resistance SNP molecular marker of sheep and application thereof | |
CN115851973B (en) | Method, kit and application for rapidly detecting human InDel genetic polymorphism by real-time fluorescence PCR | |
CN117051134B (en) | SNP molecular marker related to sheep brucellosis resistance character, detection primer, kit and application thereof | |
CN117070643B (en) | SNP molecular marker related to brucellosis resistance of sheep and application thereof | |
JP2009100653A (en) | Polynucleotide containing single nucleotide polymorphism (snp), snp marker used for discriminating species of rice and comprising the polynucleotide, and method for discriminating species of rice by the snp analysis | |
Notsu et al. | A pooled testing system to rapidly identify cattle carrying the elite controller BoLA‐DRB3* 009: 02 haplotype against bovine leukemia virus infection | |
CN111269994B (en) | Method for identifying bull variety by using cattle Y chromosome mononucleotide genetic marker | |
CN113789395B (en) | Method for identifying source of bull ruminants by utilizing Y chromosome mononucleotide genetic markers | |
CN110484627B (en) | Method for monitoring genetic quality of A/J inbred line mice, primer set and application thereof | |
CN115323048A (en) | Primer combination and method for detecting human embryo alpha-thalassemia gene mutation | |
Losi et al. | An alternative method to isoenzyme profile for cell line identification and interspecies cross-contaminations: cytochrome b PCR-RLFP analysis | |
Hue-Roye et al. | Principles of PCR-based assays | |
CN114277117A (en) | Lip cleft palate related SNP marker and application thereof | |
US11939630B2 (en) | Fluorescent PCR method for detecting HLA-B*15:02 allele and specific primer probe combination thereof | |
KR102470994B1 (en) | Single nucleotide polymorphism marker for identification of Brucella canis and primer set for detection | |
WO2023013421A1 (en) | Novel technique for rapid screening of blood type-related sugar chain gene for improving accuracy in cancer diagnosis using tumor marker ca19-9 | |
US20140073530A1 (en) | Rapid Genotyping Analysis and the Method Thereof | |
CN117187428A (en) | SNP molecular marker of rice blast resistance gene Pi2, KASP primer combination, kit and application of SNP molecular marker |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |