CN117051115B

CN117051115B - Primer group for identifying species and germ line of incoming and outgoing cattle and pigs and application of primer group

Info

Publication number: CN117051115B
Application number: CN202211140682.7A
Authority: CN
Inventors: 魏菁; 张子群; 王�琦; 曾繁华; 姜冰; 高远; 宋铭忻; 吴鑫本; 徐浩洋; 孙卓
Original assignee: Harbin Customs Technology Center
Current assignee: Harbin Customs Technology Center
Priority date: 2022-09-20
Filing date: 2022-09-20
Publication date: 2024-04-30
Anticipated expiration: 2042-09-20
Also published as: CN117051115A

Abstract

The invention belongs to the technical field of biomass resource identification, and discloses a primer set for identifying the species and the germ line of incoming and outgoing cattle and pigs and application thereof, wherein the primer set for identifying the species and the germ line of incoming and outgoing cattle and pigs comprises a primer set I and a primer set II; the first primer group is a pig qPCR primer group which is used for identifying the difference SNP loci in pig species and subgenera thereof, and the nucleotide sequence of the pig qPCR primer group is SEQ ID NO: 1-SEQ ID NO:96; the primer group II is a cattle qPCR primer group which is used for identifying SNP loci in cattle species and subgenera thereof, and the nucleotide sequence of the cattle qPCR primer group is SEQ ID NO: 97-SEQ ID NO:220. the PCR identification method for the species and the germ line of the various domestic animals in and out is used for identifying the species and the germ line of the germ line resources of the domestic animals in and out, and ensures the safety of the germ line resources of China and the quality of the germ line resources of imported animals.

Description

Primer group for identifying species and germ line of incoming and outgoing cattle and pigs and application of primer group

Technical Field

The invention belongs to the technical field of biomass resource identification, and particularly relates to a primer group for identifying the species and the germ line of incoming and outgoing cattle and pigs and application thereof.

Background

At present, biological germplasm resources are genetic diversity resources taking species as units, are important material basis for sustainable development of human society, are national major strategic basic resources, relate to national security and main rights, are irreplaceable precious raw materials for genetic engineering and industrialization in the time of 'bioeconomical', are basic materials for technological innovation, and are becoming important points of competition in countries around the world. The genetic resource of livestock and poultry is an important component part of biomass resource of organisms, is a precious resource formed by long-term evolution, and is also the part which has the closest and most direct relationship with human beings.

Because of the long history of China, numerous nations, wide variation of geography and climate, china becomes one of the most abundant countries of livestock and poultry genetic resources in the world, and has rich and colorful diversity, wherein, the China has a plurality of unique precious resources in the world. According to the current investigation, there are 576 livestock and poultry varieties (groups), wherein the local varieties (groups) account for about three fourths. These local varieties are selected for a long time to form unique germplasm characteristics. To date, they still play an important role in the development of animal husbandry. The government of China is willing to develop cooperative research and communication with each country in the field of livestock and poultry genetic resources, and strives together for the protection and utilization of global livestock and poultry genetic resources and the sustainable development of animal husbandry.

Historically, the Roman empire introduced our pig breeds as early as two thousand years ago. In the 19 th century, developed countries have been depriving our country of germplasm resources with the fading and confusion of the country. For example, in the beginning of 19 th century, the saffron pig flows into Ying, mei, then into Germany, fa, ri and other countries, the American pig breeds are utilized to breed Bozhong pigs, and the England is used to cultivate Cheng Bake summer excellent modern high-yield pig breeds; the great economic value is created by using Beijing ducks in China to breed famous cherry valley ducks in the year 50 of the 20 th century; the American and French are utilized to cultivate the modern lean type pig breeds with high reproductive performance; other 30 varieties such as silky fowl, lion head goose, maple pig, jinhua pig, guanzhong donkey, nanyang cow, luxi cow, inner Mongolian goat and the like flow into some countries and regions of Asia, europe, america and oceangoin.

With the development of biotechnology, the excellent characteristics of high-quality germplasm resources in China have been the object of some countries and organizations cast greedy eyes on to try to obtain high-quality germplasm resources of livestock and poultry in China through various means (semen, embryo, blood sample, DNA sample and the like). Neglecting germplasm resource management will endanger the main rights and safety of livestock germplasm resources in China to a certain extent. At present, the world of germplasm resources generally only acknowledges the main rights and does not acknowledge the intellectual property rights, but the excellent varieties cultivated by the germplasm resources and genes separated from the germplasm resources are protected by the intellectual property rights. Therefore, a livestock and poultry germplasm resource gene identification evaluation system must be established as soon as possible, so that the livestock and poultry germplasm resources in China are ensured not to run off in international communication, and the autonomous status of the livestock and poultry germplasm resources in China is ensured.

Along with the development of Chinese economy, the requirements of animal proteins such as meat, eggs, milk and the like are increasingly expanded as the living standard of people is improved in the rapid development stage of the Chinese economy, the requirements of domestic animal husbandry are also increased, and a large number of excellent species of livestock, breeds of birds, semen, embryo and the like are introduced from abroad in China every year, so that the requirements of domestic species and the development of livestock breeding industry are improved. In particular, the wide application of modern animal breeding techniques, including Artificial Insemination (AI) and Embryo Transfer (ET), has become a major means of animal breeding and genetic breeding, playing an extremely important role in livestock production. With the wide application of artificial insemination and embryo transfer technologies in China in recent years, the popularity of cow application frozen semen is over 90 percent. The amount of imported quality animal genetic material is also greatly increasing. The introduced livestock semen in China is mainly cow semen, sheep semen and pig semen, and the types of imported embryos comprise cow embryo, sheep embryo and goat embryo.

However, problems are caused therewith, quarantine and supervision management of genetic materials of the entering animals in China are mainly focused on aspects of epidemic disease safety management and the like, the main purpose is to prevent epidemic disease from being transmitted, but the requirements on the quality of the genetic materials of the animals as germplasm resources (including genetic characters and genetic diseases) are few, and meanwhile, detection means are relatively deficient. Therefore, the quality and the genetic character of the introduced animal genetic material cannot be ensured, and the introduction of good varieties and the improvement of domestic varieties are not facilitated.

In addition, in customs port inspection and quarantine work, embryo, semen, blood, DNA and other germplasm resources are carried along with passengers and goods frequently, and due to the lack of feasible identification and evaluation technical means, certain difficulties are brought to on-site law enforcement, high-quality germplasm resources in China are possibly lost, and immeasurable losses are brought to the development of future animal husbandry and biodiversity in China.

According to the three conditions, in order to prevent the loss of livestock and poultry germplasm resources in China and maintain the quality of introduced good livestock varieties in China, an effective technical means is provided for port law enforcement work, and a method for identifying and checking the germplasm resources of in-and-out livestock and poultry is needed to be established.

Morphological markers, cell markers and biochemical markers adopted by scientists for livestock and poultry germplasm resources in the past decades are based on gene expression results and are indirectly reflected on genes, and a molecular marker (Molecular Markers) utilized in recent years is a reflection of DNA level genetic variation and is a direct reflection of genes. Molecular markers directly detect differences between organisms on DNA molecules. The DNA molecular marker is a DNA fragment which can reflect a certain difference characteristic in genome of an individual organism or group of species, and the molecular marker technology is to detect the variation of the individual organism on the gene or genotype to reflect the difference between the individual organisms.

Domestic animal variety resources are rich, and according to statistics, 596 domestic animal varieties exist in China, and 280 domestic animal varieties are listed in the Chinese domestic animal and poultry species. The diversification of the origin and the complex diversity of the natural ecological environment bring about rich livestock genetic resources in China, such as the well-known Taihu pigs, "Sanhuang chickens", beijing ducks, northeast China pigs and the like. In view of the importance of livestock germplasm resource protection, domestic and foreign scholars actively explore livestock germplasm resource protection theory and identification methods. The inspection and quarantine method of animals and plants in and out of China is continuously perfected, but no effective system is established for quarantine technologies of embryos, semen, blood and the like of different species. The current detection method is as follows:

1. embryo: in vitro embryo detection requires observation of its structure and dynamic changes under appropriate temperature and gas conditions using biological and physical microscopes. Embryo cell activity identification, namely firstly, looking at the normal appearance and morphology of the embryo, uniform blastomere and complete zona pellucida; alternatively, blue staining can be performed with stage, living cells can be left uncolored, and IgG antibodies can be labeled with FITC fluorescent dye, with most of the fluorescence being male embryos.

The embryo quarantine sampling is special, unlike semen and blood production, the detected sample can not be reused, but the economic loss is small, and the quarantine method is not special and is easy to carry out. However, embryo quarantine is not easy, because the number of embryos produced is not large, the cost is very high, the inspected sample is expensive (hundreds of dollars or even thousands of yuan), and the vitality is affected or damaged to different degrees through quarantine treatment, so that the method is not suitable for transplanting, the quarantine loss is large, and the quarantine of all embryos is not possible. Embryo identification generally takes 4-5 embryo cells for identification.

Semen: semen transportation process is usually carried out by freezing, storing in liquid nitrogen at ultralow temperature, and thawing when in use. Semen examination includes sperm density, motility, semen PH, etc. The simplest method for determining the pH of semen is to use universal paper or dye with brominated musk blue, and detect the different colors on a colorimeter. The average bovine value was 6.9; 7.5 pigs; and 7.5.

3. Blood: animal blood has individual specific properties, for example bovine and caprine, and in their erythrocytes there are epitopes which cause differences in blood type between individuals. The classification of animal blood types is mainly performed by the reaction of hemagglutinin of the same species in red blood cells and normal serum, and later, classification is performed by a scientist's continuous research using so-called immune antibodies obtained by immunizing a heterogeneous animal. The blood type of animals of different species is used as a genetic and breeding mark, and the main tasks are blood family registration, paternity test, and identification of the relationships among species, varieties and strains of livestock. Antisera were prepared in japan by the same immunization method using zouzuki et al, and the antigens in A, B, C, D, E were separated from netherlands cows, jersey cows, senna cows, switzerland brown cows, japan, and cows. Internationally, bovine blood groups were classified into A, B, C, FV, J, L, M, N, S, Z, R ' -S ', T ', FC13 systems based on the identified standard serum.

4. DNA: with the continuous perfection of DNA recombination, gene cloning and sequence analysis technologies, people find abundant molecular markers at the DNA level, and mainly divide the molecular markers into RFLP (restriction fragment length polymorphism), RAPD (random amplified polymorphic DNA), ALFP (amplified fragment length polymorphism), STS (sequence marker locus), SSR or SSLP (simple repeated sequence), DNA fingerprinting technology and the like. However, these techniques have complicated steps, high cost, poor sensitivity and specificity, high technical requirements, and easy error generation in the test process, and are generally applied to genetic breeding and scientific research work, and cannot meet the requirements of rapid and accurate identification of germplasm resources for inspection and quarantine of incoming and outgoing animals.

At present, the technology is widely applied to identification of transgenic plants, microorganisms and animals at present, and forms a plurality of national detection standards. As the import and export of germplasm resources of livestock and poultry are gradually increased in recent years, attention has just been paid, a set of simple and feasible molecular biological identification method for semen, embryo and blood of different species such as cattle and pigs in China is not established at present, and the attribute of the germplasm resources of the livestock and poultry cannot be scientifically and effectively judged in import and export inspection and quarantine. Therefore, the differential gene is obtained by combining bioinformatics with candidate genes and a gene chip screening method, and a qualitative and quantitative PCR amplification technology of species and subspecies is established, so that the industrial requirement can be effectively solved.

Through the above analysis, the problems and defects existing in the prior art are as follows:

(1) In the existing method for detecting the animal and plant germplasm resources, because the embryo production quantity is not large, the cost is high, the detected sample is expensive, the vitality is affected or damaged to different degrees through quarantine treatment, the method is not suitable for transplanting, the quarantine loss is large, and the quarantine of all embryos is less likely.

(2) The existing RFLP, RAPD, ALFP, STS, SSR or SSLP and DNA fingerprint technology has complicated steps, higher cost, poor sensitivity and specificity, high technical requirement, easy error generation in the test process and incapability of meeting the requirement of rapid and accurate identification of germplasm resources by inspection and quarantine of incoming and outgoing animals.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention provides a primer group for identifying the species and the germ line of incoming and outgoing cattle and pigs and application thereof.

The invention is realized in such a way that a primer set for identifying the species and the germ line of the incoming and outgoing cattle and pigs comprises a primer set I and a primer set II;

Wherein, the first primer group is a pig qPCR primer group, and the nucleotide sequence of the pig qPCR primer group is SEQ ID NO: 1-SEQ ID NO:96; the primer group II is a cattle qPCR primer group, and the nucleotide sequence of the cattle qPCR primer group is SEQ ID NO: 97-SEQ ID NO:220.

Further, the primer set one is used for identifying the difference SNP locus in the pig species and the subgenera thereof;

The primer group II is used for identifying the differential SNP loci in the bovine species and the subgenera thereof.

It is another object of the present invention to provide a method for screening a primer set for identification of the species and germ line of an entry and exit cow and pig, which comprises the steps of:

Searching isogenome complete sequences of different species through NCBI, and analyzing genes differentially expressed among different species through bioinformatics software;

randomly selecting a differentially expressed gene sequence, designing a Primer according to the gene sequence by using Primer premier5.0 software, and carrying out homology analysis in NCBI by using BLAST;

Step three, sampling in a sterile super clean bench, extracting total DNA with a detected sample and taking the total DNA as a template, carrying out PCR amplification with primers designed by screening genes, carrying out qualitative and quantitative PCR amplification and checking.

Further, the different species include bovine and porcine.

Further, the screening method of the primer set for the identification of the species and germ line of incoming and outgoing cattle and pigs further comprises: for distinguishing different varieties and species of the same species of livestock, screening genes with different varieties and species of different species by adopting a gene chip technology, selecting genes with different expression according to chip results, verifying the chip results by using a fluorescent quantitative PCR method, and observing whether the qualitative and fluorescent quantitative PCR experimental results are consistent with the chip results or not; and (3) verifying the consistent gene according to the screening of a gene chip and the fluorescent quantitative PCR, designing a primer according to the gene, and carrying out PCR amplification by taking the DNA of the detected sample as a template to identify different varieties and species.

Further, the PCR amplification procedure was as follows: 94 ℃ for 1min;98℃30s,56℃30s,68℃1min,35 cycles, drop PCR each cycle reduced by 0.5 ℃;68 ℃ for 5min;4 ℃.

Further, the PCR amplification system is as follows: 2 XGflex Buffer 12.5. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, template DNA 1. Mu.L, TKS-Gflex 0.5. Mu.L, water 9. Mu.L.

Further, the sequencing result of the PCR amplification product shows that the bovine mitochondrial D-Loop gene consists of 619-911 bases; wherein, the sequencing result of Siemens is SEQ ID NO:221, the sequence of the hefton is SEQ ID NO:222, jean's sequencing result is SEQ ID NO:223, angust sequencing result is SEQ ID NO:224, the sequencing result of holstein is SEQ ID NO:225.

Further, sequencing results of the PCR amplification products show that the pig mitochondrial D-Loop gene consists of 905-1195 bases; wherein, the sequencing result of about kexia is SEQ ID NO:226, petand gave the sequence of SEQ ID NO:227, duroc's sequencing result is SEQ ID NO:228, randresi sequencing results are SEQ ID NO:229.

It is another object of the present invention to provide a kit for detecting porcine or bovine germplasm resources comprising the primer set for entry and exit bovine and porcine species and germline identification.

In combination with the above technical solution and the technical problems to be solved, please analyze the following aspects to provide the following advantages and positive effects:

First, aiming at the technical problems in the prior art and the difficulty of solving the problems, the technical problems solved by the technical proposal of the invention are analyzed in detail and deeply by tightly combining the technical proposal to be protected, the results and data in the research and development process, and the like, and some technical effects brought after the problems are solved have creative technical effects. The specific description is as follows:

The invention adopts molecular biology technology, and establishes a PCR qualitative and quantitative detection method for the embryo, semen and blood specificity of different species by extracting DNA from the embryo, semen and blood of dairy cows, beef cattle and pigs and combining bioinformatics. The invention establishes the molecular biological identification technology of the specificity of the embryo, the semen and the blood of different species by applying bioinformatics sequence comparison, gene chip, qualitative and fluorescent quantitative PCR methods.

The invention adopts the gene chip technology to screen genes differentially expressed between different varieties and species, selects a plurality of genes differentially expressed according to the chip result, verifies the chip result by using methods such as fluorescent quantitative PCR and the like, and observes whether the qualitative and fluorescent quantitative PCR experimental results are consistent with the chip result; and (3) verifying the consistent gene according to the screening of a gene chip and the fluorescent quantitative PCR, designing a primer according to the gene, and carrying out PCR amplification by taking the DNA of the detected sample as a template to identify different varieties and species.

The invention obtains the species and subspecies difference genes of cows, beef cattle and pigs, establishes qualitative and fluorescent quantitative PCR identification methods of embryo, semen and blood of cows, beef cattle and pigs; specifically screening out specific genes of the species and subspecies of cows, beef cattle and pigs, establishing qualitative and fluorescent quantitative PCR identification methods of the species of the pigs and the cattle, and establishing qualitative and fluorescent quantitative PCR identification methods of the species of the northeast China pigs, holstein cattle and Siemens cattle, and can carry out qualitative and fluorescent quantitative PCR identification of DNA levels on semen, embryos and blood of the species of the cattle and the pigs.

The PCR method adopted by the invention has the advantages of sensitive and quick response, can identify and obtain obvious amplification results only by a small number of cells, and reduces the detection cost to the minimum through optimizing the conditions. In order to obtain polymorphisms in genomes between different species of cattle, the invention also provides for sequencing of Holstein cattle, angas cattle, jean cattle, lifuzan cattle and Norway red cattle genomes to identify specific genetic differences between these different species of cattle. Four versions were published in succession since the beginning of the 2003 bovine genome sequencing project: 20040927, btau _1.0, btau _2.0 of 20050310, btau _3.1 of 20060815, btau _4.0 of 20080805; whereas the pig genome is approximately 2.7x106 kb in size.

Secondly, the technical scheme is regarded as a whole or from the perspective of products, and the technical scheme to be protected has the following technical effects and advantages:

In order to analyze the identification and evaluation of the germplasm resources of the inbound and outbound livestock, the invention carries out genetic diversity research on special livestock varieties of northeast China, holstein cattle, siemens cattle and the like and high-quality varieties with larger import quantity (containing breeds, semen, embryos, blood and DNA), determines genetic differences among varieties, particularly molecular genetic differences, provides a new technical means for the quality evaluation of the germplasm resources of the inbound and outbound livestock and the identification of varieties (strains), establishes a solid foundation for establishing a detection system and an information base of the germplasm resources of the inbound and outbound livestock, and ensures the main rights and safety of the germplasm resources of the livestock and the poultry in China.

The PCR identification method for the species and the germ line of the various domestic animals in and out is established by the invention, is used for identifying the species and the germ line of the species resources of the domestic animals in and out, ensures the safety of the germ line resources of China and the quality of the germ line resources of imported animals, and has great economic benefit. At present, a set of systematic, simple and feasible molecular biological identification method for semen, embryo and blood of different species of cattle, pigs and the like in China is not established, and the attribute of the related livestock and poultry germplasm resources cannot be scientifically and effectively judged in customs entry and exit inspection and quarantine. The invention obtains the differential gene by combining bioinformatics with candidate genes and gene chip screening method, establishes qualitative and quantitative PCR amplification technology of species and subspecies, and can effectively solve the industry requirement.

The invention detects polymorphism of mitochondrial genome and nuclear genome simultaneously.

The invention uses bioinformatics analysis to select the locus combination which can most represent the genome variation of a plurality of varieties as a core marker to distinguish different varieties.

The invention converts SNP loci detected by sequencing and gene chips into a qPCR method which can be rapidly detected and is easy to operate.

Thirdly, as inventive supplementary evidence of the claims of the present invention, the following important aspects are also presented:

1. The invention provides a method for detecting variety genetic information of customs import and export animal individuals, blood, semen and embryo tissues, which fills up the technical blank.

2. At present, a set of systematic, simple and feasible molecular biological identification method is not established for individuals, semen, embryos and blood of different species such as cattle, pigs and the like in China, and the attribute of the related livestock and poultry germplasm resources cannot be scientifically and effectively judged in customs entrance and exit inspection and quarantine. The differential genes are obtained by a method of bioinformatics combined with gene chip screening, and a group of SNP locus combinations which can be used for identifying pig and cow varieties are screened, so that the industry requirement is effectively solved.

And simultaneously, variety identification is carried out by combining genome and mitochondrial genome detection.

The invention researches the genome and mitochondrial genome of different varieties simultaneously, and successfully obtains the genetic difference of the introduced varieties of pigs and cattle mainly abroad. The difference SNP locus information between all genome varieties is obtained through mitochondrial genome and all genome SNP chip detection, and the variety identification SNP locus combination and judgment rules are formed by combining the difference SNP locus information between the mitochondrial genome varieties, and qPCR verification is carried out on the difference locus.

3. The detection method is optimized in multiple aspects, so that the detection process is more convenient.

The qualitative and quantitative PCR amplification technology is established, and the qPCR marker has the advantages of accuracy, high sensitivity, convenience, short period and the like, and can be used for rapid identification of different varieties of pigs and cattle.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a flow chart of a method for screening primer sets for identification of species and germ lines of incoming and outgoing cattle and pigs according to an embodiment of the present invention;

FIG. 2 is a schematic diagram of a screening method for primer sets for identification of species and germ lines of incoming and outgoing cattle and pigs according to an embodiment of the present invention;

FIG. 3 is a schematic diagram of the PCR amplification result of the bovine D-Loop region provided by the embodiment of the invention; m: DNA MARKER 2000,2000; 1 to 5: (jean, holstein, heft, angust, siemens) target gene PCR products;

FIG. 4 is a schematic diagram of the PCR amplification result of the bovine D-Loop region provided by the embodiment of the invention; m: DNA MARKER 2000,2000; 1 to 3: (Holstein semen and embryo) target gene PCR products;

FIG. 5 is a schematic diagram of the PCR amplification result of the pig D-Loop region provided by the embodiment of the invention; m: DNA MARKER 2000,2000; 1 to 4: (about the gram of the summer, the leather blue, duroc, landress) target gene PCR product;

FIG. 6 is a schematic diagram of a homology analysis result of a bovine D-Loop region provided by an embodiment of the present invention;

FIG. 7 is a schematic diagram of the results of homology analysis in the porcine D-Loop region provided by the example of the present invention;

FIG. 8 is a schematic diagram of the results of analysis of the sequence of the bovine D-Loop region provided by the embodiment of the invention;

FIG. 9 is a schematic diagram of the result of the sequence analysis of the porcine D-Loop region provided by the embodiment of the invention;

FIG. 10 is a diagram showing the results of the analysis of the evolution of the bovine D-Loop region according to the embodiment of the invention;

FIG. 11 is a schematic diagram of the results of the analysis of the evolution of the porcine D-Loop region provided by the embodiment of the invention.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

In view of the problems of the prior art, the present invention provides a primer set for identifying the species and the germ line of incoming and outgoing cattle and pigs and application thereof, and the present invention is described in detail below with reference to the accompanying drawings.

1. The embodiments are explained. In order to fully understand how the invention may be embodied by those skilled in the art, this section is an illustrative embodiment in which the claims are presented for purposes of illustration.

The primer set for identifying the species and the germ line of the incoming and outgoing cattle and pigs provided by the embodiment of the invention comprises a primer set I and a primer set II; wherein, primer group I is pig qPCR primer group, and the nucleotide sequence of pig qPCR primer group is SEQ ID NO: 1-SEQ ID NO:96; the primer group II is a primer group of the cattle qPCR, and the nucleotide sequence of the primer group of the cattle qPCR is SEQ ID NO: 97-SEQ ID NO:220.

The primer group I provided by the embodiment of the invention is used for identifying the difference SNP loci in the pig species and the subgenera thereof; the second primer group is used for identifying the differential SNP locus in the bovine species and the subgenera thereof.

As shown in fig. 1, the screening method of the primer set for identifying the species and the germ line of the incoming and outgoing cattle and pigs provided by the embodiment of the invention comprises the following steps:

S101, searching isogenome complete sequences of different species through NCBI, and analyzing genes differentially expressed among different species through bioinformatics software;

S102, randomly selecting a differentially expressed gene sequence, designing a primer according to the gene sequence by using PRIMER PREMIER 5.0.0 software, and performing homology analysis in NCBI by using BLAST;

s103, sampling in a sterile super clean bench, extracting total DNA from a detected sample and taking the total DNA as a template, performing PCR amplification by using primers designed by screening genes, performing qualitative and quantitative PCR amplification and checking.

The different species provided by the embodiment of the invention comprise cattle and pigs.

The screening method of the primer group for identifying the species and the germ line of the incoming and outgoing cattle and pigs provided by the embodiment of the invention further comprises the following steps: for distinguishing different varieties and species of the same species of livestock, screening genes differentially expressed between the different varieties and species by adopting a gene chip technology, selecting the genes differentially expressed according to a chip result, verifying the chip result by using a fluorescent quantitative PCR method, and observing whether the results of qualitative and fluorescent quantitative PCR experiments are consistent with the chip result; and (3) verifying the consistent gene according to the screening of a gene chip and the fluorescent quantitative PCR, designing a primer according to the gene, and carrying out PCR amplification by taking the DNA of the detected sample as a template to identify different varieties and species.

The PCR amplification procedure provided by the embodiment of the invention is as follows: 94 ℃ for 1min;98℃30s,56℃30s,68℃1min,35 cycles, drop PCR each cycle reduced by 0.5 ℃;68 ℃ for 5min;4 ℃.

The PCR amplification system provided by the embodiment of the invention is as follows: 2 XGflex Buffer 12.5. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, template DNA 1. Mu.L, TKS-Gflex 0.5. Mu.L, water 9. Mu.L.

The sequencing result of the PCR amplification product provided by the embodiment of the invention shows that the bovine mitochondrial D-Loop gene consists of 619-911 bases; wherein, the sequencing result of Siemens is SEQ ID NO:221, the sequence of the hefton is SEQ ID NO:222, jean's sequencing result is SEQ ID NO:223, angust sequencing result is SEQ ID NO:224, the sequencing result of holstein is SEQ ID NO:225.

Sequencing results of PCR amplification products provided by the embodiment of the invention show that the pig mitochondria D-Loop gene consists of 905-1195 bases; wherein, the sequencing result of about kexia is SEQ ID NO:226, petand gave the sequence of SEQ ID NO:227, duroc's sequencing result is SEQ ID NO:228, randresi sequencing results are SEQ ID NO:229.

The embodiment of the invention provides a kit for detecting pig or cow germplasm resources, which comprises a primer group for identifying incoming and outgoing cows and pig species and germline.

2. Application example. In order to prove the inventive and technical value of the technical solution of the present invention, this section is an application example on specific products or related technologies of the claim technical solution.

The invention is tested by Ningbo customs technical center, scientific and technological project verification test report, project name: research on methods for identifying and detecting germplasm resources of incoming and outgoing pigs and cattle (2019 HK 050); delegation unit: haar coastal customs technology center; the consignment date is 2021, 10, 29; completion date: 2021, 11, 5; and comparing the test results, wherein the test sample detection results of the provided seed crystals of the pigs and the cattle are consistent with the corresponding variety information. Namely, the detection result of the kit is consistent with the variety information result. Can effectively distinguish different varieties of pigs and cattle.

And detecting the pure line verification sample and the test sample by using the pig and cow variety identification detection kit provided by the Harbin littoral technology center. Is completely consistent with the record information of the actual variety. The verification result shows that the established pig and cow variety identification and detection method is quick, sensitive, simple, convenient and practical. Is suitable for rapid identification and detection of pig and cattle breeds. The method has the advantage of high detection speed. Simple and convenient detection operation and accurate detection result. Can ask the laboratory to determine and detect important varieties of pigs and cattle.

3. Evidence of the effect of the examples. The embodiment of the invention has a great advantage in the research and development or use process, and has the following description in combination with data, charts and the like of the test process.

1. Experimental method

The experiment searches genome complete sequences of different species (human, cow, pig) and the like through NCBI (National Center for Biotechnology Information), analyzes genes differentially expressed among different species through bioinformatics software, randomly selects a plurality of gene sequences differentially expressed according to the gene sequences, uses PRIMER PREMIER 5.0.0 software, designs a primer, uses BLAST to carry out homology analysis in NCBI (National Center for Biotechnology Information), and ensures the specificity of the primer. Finally, sampling in a sterile super clean bench, extracting total DNA by using the detected sample, using the total DNA as a template, and carrying out PCR amplification by using primers designed by screening genes to carry out qualitative and quantitative PCR amplification and detection.

For distinguishing different varieties and species of the same species of livestock, a gene chip technology is adopted to screen genes which are differentially expressed between different varieties and species, a plurality of genes which are differentially expressed are selected according to the chip result, the chip result is verified by using methods such as fluorescent quantitative PCR and the like, and whether the qualitative and fluorescent quantitative PCR experimental results are consistent with the chip result or not is observed. And then, according to the gene chip screening and the fluorescent quantitative PCR, verifying the consistent gene, designing a primer according to the gene, and carrying out PCR amplification by taking the DNA of the detected sample as a template to identify different varieties and species.

2. Technical route

The experimental subjects were: northeast pig, holstein cow and Siemens cow;

the genomic DNA sequence was searched by NCBI and the specific technical route is shown in FIG. 2.

3. Experimental results

3.1 PCR amplification results of the target Gene

PCR amplification is carried out on serum, blood, semen and embryo samples of cattle and pigs by referring to primers designed by mitochondrial genomes of cattle and pigs published in GenBank, target gene bands of about 1300bp are obtained, and the results are shown in figures 3-5.

3.2 Sequencing results in the mitochondrial D-Loop region of cattle

Sequencing results of PCR amplified products show that the bovine D-Loop gene consists of 619-911 bases, and the sequencing results are as follows:

siementadol (SEQ ID NO: 221):

aacactattaatatagttccataaatgcaaagagccttatcagtattaaatttatcaaaaatcccaataactcaacacagaatttgcaccctaaccaaatattacaaacaccactagctaacataacacgcccatacacagaccacagaatgaattacccaggcaagaggtaatgtacataacattaatgtaataaagacatgatatgtatatagtacattaaattatataccccatgcatataagcaagtacatgatctctataatagtacataatacatacaattattaattgtacatagtacattatatcaaatccatcctcaacaacatatctactatataccccttccactagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgctaagcagaggatccctcttctcgctccgggcccatagaccgtgggggtcgctatttaatgaattttaccaggcatctggttctttcttcagggccatctcatctaaagtggtccattctttcctcttaaataagacatctcgatggactaatgactaatcagcccatgctcacacataactgtgctgtcatacatttggtatttttttattttgggggatgcttggactcagctatggccgtcaaaggccccgacccggagcatctattgtagctggacttaactgcatcttgagcaccagcataatgataggcatgggcattacagtcaatggtcacaggacataaattacattatatatcccccccttcataaaaacctcccccttaaatattcaccaccacttttaacagacttttccctagatacttatttaaattttccacactttcaatactcaatttagcactccaaacaaagtcaatatataaacgcaggcccccccccccg

Sea Ford (SEQ ID NO: 222):

aacactattaatatagttccataaatacaaagagccttatcagtattaaatttatcaaaaatcccaataactcaacacagaatttgcaccctaaccaaatattacaaacaccactagctaacataacacgcccatacacagaccacagaatgaattacctacgcaaggggtaatgtacataacattaatgtaataaagacataatatgtatatagtacattaaattatatgccccatgcatataagcaagtacatgacctctatagcagtacataatacatataattattgactgtacatagtacattatgtcaaattcattcttgatagtatatctattatatattccttaccattagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgctaggcag-ggatccct cttctcgctccgggcccataaaccgtgggggtcgctatccaatgaattttaccaggcatctggttctttcttcagggc-atctc atctaaaacggtccattctttcctcttaaataagacatctcgatggactaatggctaatcagcc-atgct---cacacataactgt gctgtcatacatttggtattttttt-atttggggatgc

Jersey (SEQ ID NO: 223):

aacactattaatatagttccataaatgcaaagagccttatcagtattaaatttatcaaaaatcccaataactcaacacagaatttgcaccctaaccaaatattacaaacaccactagctaacataacacgcccatacacagaccacagaatgaattacccaggcaagaggtaatgtacataacattaatgtaataaagacatgatatgtatatagtacattaaattatataccccatgcatataagcaagtacatgatttctataatagtacataatacatataattattaattgtacatagtacattatatcaaattcattctcaacaacatatctactatatacccctt-ccattagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgctaggcag-ggatccct cttctcgctccgggcccatagaccgtgggggtcgctatttaatgaattttaccaggcatctggttctttcttcagg-ccatctca tctaaaacggtccattctttcctcttaaataagacatctcgatggactagtggctaatcagcccatgct---cacacataactgt gctgtcatacatttggtattttttt-attttgggggatgcttggactcagctatggccgtcaaaggccccgacccggagcatcta ttgtagctggacttaactgcatcttgagcaccagcataatgataggcatgggcattacagtcaatggtcacaggacataaattacattatatatcccccccttcataaaaacctcccccttaaatattcaccaccacttttaacagacttttccctagatacttatttaaattttccacactttcaatactcaatttagcactccaaacaaagtcaatatataaacgcaggccccccccccc

Angust (SEQ ID NO: 224):

aacactattaatatagttccataaatacaaagagccttatcagtattaaatttatcaaaaatcccaataactcaacacagaatttgcaccctaaccaaatattacaaacaccactagctaacataacacgcccatacacagaccacagaatgaattacctacgcaaggggtaatgtacataacattaatgtaataaagacataatatgtatatagtacattaaattatataccccatgcatataagcaagtacatgacttctatagcagtacataatacatataattattgactgtacatagtacattatgtcaaattcatccttgatagtatatctattatatattccttaccatcagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgctaggcag-ggatccct cttctcgctccgggcccataaaccgtgggggtcgctatccaatgaactttaccaggcatctggttctttcttcagggccatctc atctaaaacggtccattctttcctcttaaataagacatctcgatggactaatggctaatcagcccatgctca---cacataactg tgctgtcatacatttggtatttttt-tattttgggggatgcttggaatcagctatggccgtcaaaggccctgacccggagcattta ttgtagctggacttaactgcattttgagcaccagcataatgataagcgtggacattacagtcaatggtcacaggacataaattatattatatatcccccccttcataaaaatttcccccttaaatatttaccaccacttttaacagacttttccctagataattatttaaatttttcacgctttcaataatcaatttagcactccaaacaaagtcaatatataaacgcaggcccccccccccc

Holsteine (SEQ ID NO: 225):

aacactattaatatagttccataaatacaaagagccttatcagtattaaatttatcaaaaatcccaataactcaacacagaatttgcaccctaaccaaatattacaaacaccactagctaacataacacgcccatacacagaccacagaatgaattacctacgcaaggggtaatgtacataacattaatgtaataaagacataatatgtatatagtacattaaattatatgccccatgcatataagcaagtacatgacctctatagtagtacataatacatataattattgactgtacatagtacattatgtcaaattcattcttgatagcatatctattacatattccttaccattagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgctaggcag-ggatccct cttctcgctccgggcccataaaccgtgggggtcgctatccaatgaattttaccaggcatctggttctttcttcagggccatctc atctaaaacggtccattctttcctcttaaataagacatctcgatggactaatggctaatcagcccatgctca---cacataactg tgctgtcatacatttggtatttttt-tattttgggggatgcttggactcagctatggccgtcaaaggccctgacccggagcatct attgtagctggacttaactgcatcttgagcaccagcataatgataagcgtggacattacagtcaatggtcacaggacataaattatattatatatcccccccttcataaaaatttcccccttaaatatctaccaccacttttaacagacttttccctagatacttatttaaatttttcacgctttcaatactcaatttagcactccaaacaaagtcaatatataaacgcaggccccccccccc

Sequencing results of PCR amplified products show that the pig D-Loop gene consists of 905-1195 bases, and the sequencing results are as follows:

About summer (SEQ ID NO: 226):

caaccaaaacaagcattccattcgtatgcaaaccaaaacgccaagtacttaattactatctttaaaacaaaaaaacccataaaaattgcgcacaaacatacaaatatgtgaccccaaaaattttaccattgaaaaccaaaaaatctaatatactataaccctatgtacgtcgtgcattaactgctagtccccatgcatataagcatgtacatattattattaatattacatagtacatattattattgatcgtacatagcacatatcatgtcaaataactccagtcaacatgcatatcaccaccactagatcacgagcttaactaccatgccgcgtgaaaccagcaacccgcttggcagggatccctcttctcgctccgggcccataaaccgtgggggtttctattgatgaactttaacaggcatctggttcttacttcaggaccatctcacctaaaatcgcccactctttccccttaaataagacatctcgatggactaatgactaatcagcccatgctcacacataactgaggtttcatacatttggtattttttaatttttggggatgcttagactcagccatggccgtcaaaggccctaacacagtcaaatcaattgtagctggacttcatggaactcatgatccggcacgacaatccaaacaaggtgctattcagtcaatggttacgggacataacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgcgcatataagcaggtaaattattagctcattcaaaccccccttaccccccattaaacttatgctctacacaccctataacgccttgccaaaccccaaaaacaaagcagagtgtacaaatacaataagcctaacttacactaaacaacatttaacaacacaaaccaccatatcttataaaacacttacttaaatacgtgctacgaaagcaggcacctacccccctagatttttacgccaatctaccataaataaatttaaaattacaacacaataacctcccaaaatataagcacctatttaagtatacgcccacaatctgaatatagcttata

piteland (SEQ ID NO: 227):

atgcaaaccaaaacgccaagtacttaattactatctttaaaacaaaaaaacccataaaaattgcgcacaaacatacaaatatgtgaccccaaaaattttaccattgaaaaccaaaaaatctaatatactataaccctatgtacgtcgtgcattaactgctagtccccatgcatataagcatgtacatattattattaatattacatagtacatattattattgatcgtacatagcacatatcatgtcaaataactccagtcaacatgcatatcaccaccactagatcacgagcttaactaccatgccgcgtgaaaccagcaacccgcttggcagggatccctcttttcgctccgggcccataaaccgtgggggtttctattgatgaactttaacaggcatctggttcttacttcaggaccatctcacctaaaatcgcccactctttccccttaaataagacatctcgatggactaatgactaatcagcccatgctcacacataactgaggtttcatacatttggtattttttaatttttggggatgcttagactcagccatggccgtcaaaggccctaacacagtcaaatcaattgtagctggacttcatggaactcatgatccggcacgacaatccaaacaaggtgctattcagtcaatggttacgggacataacgtacatacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgcgcatataagcaggtaaat

duroc (SEQ ID NO: 228):

atgcaaaccaaaacgccaagtacttaattactatctttaaaacaaaaaaacccataaaaattgcgcacaaacatacaaatatgtgaccccaaaaatttaaccattgaaaaccaaaaaatctaatatactataaccctatgtacgtcgtgcattaattgctagtccccatgcatataagcatgtacatattattattaatattacatagtacatattattattgatcgtacatagcacatatcatgtcaaataactccagtcaacatgcatatcaccaccactagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgcttggcagggatccctcttctcgctccgggcccataaaccgtgggggtttctattgatgaactttaacaggcatctggttcttacttcaggaccatctcacctaaaatcgcccactctttccccttaaataagacatctcgatggactaatgactaatcagcccatgctcacacataactgaggtttcatacatttggtattttttaatttttggggatgcttggactcagccatggccgtcaaaggccctaacacagtcaaatcaattgtagctggacttcatggaactcatgatccggcacgacaatccaaacaaggtgctattcagtcaatggttacgggacataacgtacatacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcg---taca cgtgcgtacacg---tgcgtacacgtgcgtacacgtgcgtacac

landressi (SEQ ID NO: 229):

atgcaaaccaaaacgccaagtacttaattactatctttaaaacaaaaaaacccataaaaattgcgcacaaacatacaa atatgcgaccccaaaaatttaaccattaaaaac-aaaaaatttaatatattatagccctatgtacgtcgtgcattaactgctagtc cccatgcatataagcatgtacatattattattaatattacatagtacatattattattgatcgtacatagcacatatcatgtcaaataattccagtcaacatgcgtatcaccaccattagatcacgagcttaattaccatgccgcgtgaaaccagcaacccgcttggcagggatccctcttctcgctccgggcccataaatcgtgggggtttctattgatgaactttaacaggcatctggttcttacttcaggaccatctcacctaaaatcgcccactctttccccttaaataagacatctcgatggactagtgactaatcagcccatgctcacacataactgaggtttcatacatttggtattttttaacttttggggatgcttggactcagccatggccgtcaaaggccctaacacagtcaaatcaattgtagctggacttcatggaactcatgatccggcacgacaatccaaacaaggtgctattcagtcaatggttacgggacataacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacacgtgcgtacac

3.3 mitochondrial D-loop region sequence analysis in cattle and pigs

Comparing the sequence of the D-loop region of the bovine mitochondria with the published sequence of NCBI, the homology is over 90 percent, the homology between each variety is highest, the homology between different varieties is lower, the homology between Siementail and jean is higher, and the homology between Haifeord, angas and Holstein is relatively higher, as shown in figure 6.

The sequence of the D-loop region of the pig mitochondria is compared with the published sequence of NCBI, the homology is more than 90 percent, and the homology with samples of about Kexia and GenBank is relatively low except for the sample of Landress-1. The homology between each variety is highest, the homology between different varieties is lower, and the homology between Duroc and Pittlan is higher than that of other two varieties. The homology between about Xia Helan Dersine is not high and the homology between Lande riside and Duroc and Pitch is high, as shown in FIG. 7.

Through comparison of 548bp sequences of D-Loop, the similar sites of Siemens and jersey are more, and the similar sites of Siemens and jersey are less, for example, the bases of Siemens and jersey at 160bp, 162bp and 168bp are C, G, A respectively, and the other three jersey is T, C, G; the base groups of Siemens and jean at 291bp and 293bp are A and T respectively, and the other three cattle are G, C; thus, it is presumed that these sites may be different sites for distinguishing different cattle, and furthermore, no difference was found between samples of different origin by sequence analysis of blood, semen and embryos of Holstein cattle, so that it is presumed that different samples can be used for variety identification (see FIG. 8).

Through the comparison of D-Loop sequences, some site changes exist between 84 and 156bp, such as C and T base changes exist at 84bp, A and T base changes exist at 106bp, base C deletion exists at 112bp, and all the sites can become sites for identifying different varieties. As a result of comparing the sequences at 838-952 bp, the sequences of the yoku-xia and the Sus-scrofa are similar, the difference between the sequences of the yoku-xia and the Sus-scrofa and pigs of other varieties is large, a large number of base changes and deletions exist, and all the sites possibly become mutation sites for distinguishing pigs of different varieties (see figure 9).

3.4 Sequence evolution analysis of the mitochondrial D-loop region in cattle and pigs

Through evolutionary analysis, it was found that the affinities of sitaglycone and jersey were closer, while the affinities of the other three species were closer, the affinities of the two-branched cattle were farther, and the embryo and semen derived samples were closest to the affinities of the holstein cattle, which were both serum derived (see fig. 10).

The evolutionary analysis found that the relatedness of york Xia Helan dec, doloque and peter blue was far, the relatedness of landex and doloque was close to peter blue, and the relatedness of york summer and susscirofa was close (see fig. 11).

4. Conclusion(s)

4.1 Probes and primers

Probes and primers with good specialization are obtained after screening and used for the next identification work of variety division, as shown in table 1.

TABLE 1 pig qPCR primer sequences

/>

TABLE 2 bovine qPCR primer sequences

/>

4.2 QPCR verification results of SNP loci for pig variety identification

Flanking sequences on the genome were obtained for all 24 SNP sites and they were aligned to a reference genome at the chromosomal level, qPCR primers were designed, where 24(rs326489727、rs80981235、rs331659524、rs320797850、rs81478914、rs324836824、rs81226749、rs81453155、rs80963344、rs80822078、rs81341621、rs336424990、rs713033621、rs328455367、rs81245542、rs341802410、rs341206647、rs81339855、rs330023521、rs81273238、rs343459348、rs81293118、rs81453225、rs81453214) sites were successfully transformed into qPCR markers.

The qPCR reaction is sensitive, the detectable range of the template concentration is large, and in the experiment, the DNA typing results of the template quantity of 250, 500 and 1000ng are completely consistent. Samples with DNA content within this range after extraction can be directly detected without adjusting the DNA concentration.

The annealing temperature of each Primer was found to be in the range of 48 to 60℃by Primer5 software. The annealing temperature is optimized for maintaining uniformity and operational convenience. The annealing temperature is set to 54 ℃, 56 ℃, 60 ℃, 64 ℃, 68 ℃ respectively, and experimental results show that the annealing temperature can reach better parting results within 56-64 ℃.

QPCR typing analysis is carried out on 80 pig samples by using 24 pairs of designed primers, the obtained typing is compared with the typing of a gene chip, and the typing results of the two previous and subsequent detection are consistent, wherein the consistency is 100%. The SNP marker has good repeatability and stability, and can be used as a core marker for identifying the pig variety.

4.3 QPCR verification results of SNP loci for bovine variety identification

Flanking sequences were obtained for all 31 SNP sites and they were aligned to a chromosome-level reference genome, qPCR primers were designed, 31 of which were successfully transformed into qPCR markers.

The annealing temperature of each Primer was found to be in the range of 48 to 60℃by Primer5 software. The annealing temperature is optimized for maintaining uniformity and operational convenience. The annealing temperature is set to 54 ℃, 56 ℃, 60 ℃, 64 ℃, 68 ℃ respectively, and experimental results show that the annealing temperature can reach better parting results within 60-64 ℃.

And carrying out qPCR typing analysis on 100 bovine samples by using 31 pairs of designed primers, and comparing the obtained typing with the typing of a gene chip, wherein the typing results of the two previous and subsequent detection are consistent, and the consistency is 100%. The SNP marker has good repeatability and stability, and can be used as a core marker for variety identification of cattle.

4.4 Variety identification genotyping tables

The detected 80 pig samples are randomly divided into 2 groups, one group of 40 samples is used as a training set, the specific sites of different varieties are obtained through analysis, and the other group is used as a verification set to verify the variety dividing judgment standard. The two results were combined to obtain SNP locus combinations and typing tables (see Table 3) for dividing pig breeds.

TABLE 3 genotyping table for pig breeds identification

/>

The 100 detected bovine samples are randomly divided into 2 groups, one group of 50 samples is used as a training set, the specific sites of different varieties are obtained through analysis, and the other group is used as a verification set to verify the variety dividing judgment standard. The two results were combined to obtain SNP locus combinations and typing tables (see Table 4) for dividing bovine breeds.

TABLE 4 genotyping table for bovine breeds identification

/>

The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.

Claims

1. A primer set for identifying the species and the germ line of the incoming and outgoing cattle and pigs, which is characterized by comprising a primer set I and a primer set II;

2. The primer set for identification of the species and germ line of entry and exit cows and pigs of claim 1, wherein the primer set is a primer set for identification of differential SNP sites in the species of pigs and their sub-species;

3. A kit for detecting porcine or bovine germplasm resources, characterized in that the kit for detecting porcine or bovine germplasm resources comprises a primer set according to any one of claims 1-2 for the identification of the species and germline of incoming and outgoing cows and pigs.