CN117025749A

CN117025749A - Cerebral ischemia reperfusion injury marker and application thereof

Info

Publication number: CN117025749A
Application number: CN202310762076.7A
Authority: CN
Inventors: 杨志福; 曹金一; 王婧雯; 陈悦; 杨乐; 葛洁; 乔逸; 陈苏宁; 冯智军; 舒艳; 赵阳
Original assignee: Air Force Medical University of PLA
Current assignee: Air Force Medical University of PLA
Priority date: 2023-06-27
Filing date: 2023-06-27
Publication date: 2023-11-10

Abstract

One or more embodiments of the present disclosure provide a cerebral ischemia reperfusion injury marker and use, and indicate that intestinal flora, and/or metabolites of intestinal flora, may be used as a cerebral ischemia reperfusion injury marker, in a cerebral ischemia reperfusion injury detection kit, or in preparing a composition for preventing and treating cerebral ischemia reperfusion injury.

Description

Cerebral ischemia reperfusion injury marker and application thereof

Technical Field

One or more embodiments of the present disclosure relate to the field of medical technology, and in particular, to markers of cerebral ischemia reperfusion injury and applications thereof.

Background

Currently, ischemic stroke accounts for 80% of stroke (IS) diseases, which are usually treated early in the treatment period by intravenous thrombolysis and mechanical reperfusion, but the reperfusion of blood further causes damage and death of nerve cells, which IS known as cerebral ischemia reperfusion injury (Cerebral Ischemia/reperfusion Injury, CI/RI). CI/RI has complex pathological mechanisms, and relates to multiple targets and mechanisms. The traditional Chinese medicine has the characteristics of multi-component, multi-path and multi-target effects and the advantages of overall regulation, and has unique therapeutic advantages and potential for treating CI/RI of complex pathological mechanisms. The decoction is the most representative prescription for treating cerebral apoplexy, and modern scholars show that astragalus and safflower (HQ-HH) in the decoction can represent female prescriptions to play a role in treatment through prescription disassembly and prescription reduction, clinical and laboratory researches. HQ-HH has wide clinical application, but the action mechanism is not clear, so that the clinical popularization and further development and application of the HQ-HH are limited to a certain extent. Therefore, the research on oral traditional Chinese medicine needs to open up a new direction. In recent years, research on intestinal flora and diseases has become a hotspot, and a new view is provided for research on traditional Chinese medicines. In addition, the theory of traditional Chinese medicine and intestinal flora are dialectical treatments of diseases under the guidance of overall view, and the traditional Chinese medicine has the characteristics of systematicness and integrity. It can be seen that the integral regulation and control of intestinal flora has common characteristics with the theory of traditional Chinese medicine, and the intestinal flora is probably one of important targets for the oral administration of traditional Chinese medicine to exert the drug effect. However, there has been no study in the prior art of the relationship of gut flora, especially metabolites of the gut flora, to CI/RI.

Disclosure of Invention

In view of this, the present specification is based on the "spleen invigorating, qi invigorating, blood circulation promoting, and blood stasis removing" treatment of qi deficiency and blood stasis type CI/RI, and by one or more embodiments, it is an object to propose a marker for cerebral ischemia reperfusion injury and application thereof, and further study on the causal relationship between intestinal flora and its metabolites and related indexes of post-stroke immune inflammation, so as to determine the marker for cerebral ischemia reperfusion injury, and hopefully realize a "bottom-up" treatment means.

In view of the above, one or more embodiments of the present disclosure provide a marker for cerebral ischemia reperfusion injury, including intestinal flora, and/or metabolites of intestinal flora.

Further, the metabolites of the intestinal flora are short chain fatty acids.

Further, the short chain fatty acid is one or a combination of more of propionic acid, butyric acid and isobutyric acid.

Further, the short chain fatty acid is one or the combination of two of butyric acid and caproic acid.

One or more embodiments of the present disclosure further provide for the use of any of the markers described above in the preparation of a cerebral ischemia reperfusion injury detection kit.

One or more embodiments of the present disclosure also provide the use of any of the markers described above for the preparation of a composition for the prevention and treatment of cerebral ischemia reperfusion injury.

From the foregoing, it can be seen that one or more of the examples herein discuss the effect of HQ-HH on the CI/RI rat intestinal flora and its metabolite SCFAs. The research result shows that the CI/RI reduces the content of SCFA-producing intestinal flora in intestinal tracts and SCFA-producing intestinal flora metabolites in feces, serum and brain tissues; the relative abundance of harmful bacillus, gastric tumor coccus and clostridium can be obviously reduced after HQ-HH is given or HQ-HH is transplanted; increasing the relative abundance of beneficial bacteria such as Ranunculus, helicobacter, oscillating bacteria, acremodelling bacteria and Acremodelling bacteria, thereby regulating the species composition of SCFAs flora produced by CI/RI intestinal tracts, maintaining intestinal flora steady state, and further increasing the content variation of SCFAs at each part in the body. The HQ-HH can promote the increase of SCFAs producing bacteria by regulating the stable state of intestinal flora, and further can increase in vivo SCFAs, thereby playing a role in brain protection. Based on the above, the intestinal flora and/or metabolites of the intestinal flora (such as propionic acid, butyric acid, isobutyric acid and other short chain fatty acids in serum and feces or butyric acid, caproic acid and the like in brain tissue) can be used as a cerebral ischemia reperfusion injury marker, applied to a cerebral ischemia reperfusion injury detection kit or applied to preparation of a composition for preventing and treating cerebral ischemia reperfusion injury.

Drawings

For a clearer description of one or more embodiments of the present description or of the solutions of the prior art, the drawings that are necessary for the description of the embodiments or of the prior art will be briefly described, it being apparent that the drawings in the description below are only one or more embodiments of the present description, from which other drawings can be obtained, without inventive effort, for a person skilled in the art.

FIG. 1 is the effect of HQ-HH and FMT on CI/RI rat cerebral infarction in the examples;

FIG. 2 is the effect of HQ-HH and FMT on CI/RI rat brain tissue pathology lesions in the examples;

FIG. 3 shows quantitative PCR and bacterial copy number results for each experimental set in the examples;

FIG. 4 shows the dilution curves of intestinal flora in each group of examples (FIG. 4A shows a Rank-abundance curve; FIG. 4B shows a Shannon-Wiene curve);

fig. 5 shows the analysis of alpha-diversity of intestinal flora in each group in the example (fig. 5A shows Ace index analysis chart, fig. 5B shows Chao index analysis chart, fig. 5C shows Shannon index analysis chart, and fig. 5D shows Simpson index analysis chart);

FIG. 6 shows the beta-diversity analysis of intestinal flora in each group in the examples (FIG. 6A shows PCoA; FIG. 6B shows ANOSIM);

FIG. 7 shows the relative abundance of various groups of intestinal flora at the phylum, class level in the examples;

FIG. 8 is a graph showing relative abundance at the genus level of each group of intestinal flora in the examples;

FIG. 9 shows the variation of the SCFAs content of the rat feces of each experimental group in the examples;

FIG. 10 shows the change in serum SCFAs for rats in each experimental group in the examples;

FIG. 11 shows the variation of the SCFAs content in the brain tissue of rats in each experimental group in the examples;

FIG. 12 shows the results of HE staining of intestinal tissue from each experimental group in the examples;

FIG. 13 is a graph showing the results of staining of the goblet cells PAS of intestinal tissue of each experimental group in the examples, wherein the arrows in the graph point to the purplish red goblet cells;

FIG. 14 shows the concentrations of LPS, LBP and D-Lac in the plasma of each experimental group in the examples; wherein, fig. 14A is the concentration of LPS in plasma of each experimental group; FIG. 14B shows the concentration of LBP in plasma of each experimental group; FIG. 14C shows the concentration of D-Lac in plasma of each experimental group;

FIG. 15 shows the expression of SCFAs receptors GPR41, GPR43 and GPR109A in intestinal tissue of each experimental group in the examples;

FIG. 16 shows the expression of zonulin ZO-1, ocludin and Claudin-5 in brain tissue of each experimental group in the examples;

FIG. 17 shows the expression of SCFAs receptors GPR41, GPR43 and GPR109A in brain tissue of each experimental group in the examples;

FIG. 18 shows IL-1β, IL-10, IL-6, IL-32 and TNF- α expression in brain tissue of each experimental group in the examples;

FIG. 19 shows the result of immunofluorescent staining of M1 microglial cells from each experimental group in the examples;

FIG. 20 shows the result of immunofluorescent staining of M2 type microglial cells of each experimental group in the examples;

in the above figures, # represents P <0.05 compared to sham group, # represents P <0.01 compared to sham group; * Represents P <0.05 compared to the Model group and P <0.01 compared to the Model group.

Detailed Description

For the purposes of promoting an understanding of the principles and advantages of the disclosure, reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same.

It is noted that unless otherwise defined, technical or scientific terms used in one or more embodiments of the present disclosure should be taken in a general sense as understood by one of ordinary skill in the art to which the present disclosure pertains.

In the prior art, the compatibility of HQ-HH (mass ratio of 5:1) can obviously reduce the cerebral infarction area of CI/RI rats and promote the recovery of nerve functions, which indicates that the efficacy is clear. It was subsequently demonstrated that CI/RI resulted in deregulation of intestinal flora, increased intestinal permeability, disruption of intestinal barrier, and found that HQ-HH can maintain bile acid homeostasis, decrease rat Th17 cells, increase Treg cells, decrease brain inflammatory response, protect blood brain barrier integrity, and improve CI/RI by activating intestinal flora metabolite bile acid receptor FXR. In addition, it has been shown in the prior art that intestinal flora metabolites such as Short Chain Fatty Acids (SCFAs) interact bi-directionally with the nervous system through the intestinal brain axis and in a variety of ways, causing neuroimmune inflammatory reactions, dysfunction of the intestinal mucosa and blood brain barrier, direct stimulation of the vagus nerve, the spinal nerves of the enteric nervous system, the neuroendocrine hypothalamic-pituitary-adrenal axis, etc. causing neurological diseases. The above studies have shown that HQ-HH can affect the intestinal flora and its metabolites and play a crucial role in the CI/RI process, but the relationship between the relevant indicators of post-CI/RI immune inflammatory response and the specific functional mechanisms of the intestinal flora, and the relationship between the efficacy of the intestinal microbiota metabolites SCFAs and HQ-HH, is not clear.

Therefore, on the basis of the prior art, the research deeply discusses the effect of HQ-HH on the intestinal flora and the metabolite SCFAs thereof in the process of treating CI/RI by utilizing the mode of fecal fungus transplantation technology so as to clarify the mechanism of the intestinal flora and the SCFAs to participate in cerebral ischemia treatment, and is hopeful to find a new effective method for treating cerebral ischemia and provide a new thought for clinical treatment of cerebral ischemia stroke.

The abbreviations of Chinese and English related in the application are shown in Table 1.

Table 1 Chinese and English abbreviation Table

Example 1 pharmaceutical and formulation of the agent

The astragalus and safflower (mass ratio 5:1) aqueous extract was purchased from Guangdong party pharmaceutical Co., ltd., lot number: 2020053.

naoxintong capsules are provided by Shanxi step size pharmaceutical Co., ltd., drug approval document: chinese medicine standard Z20025001,0.4g×18×2×1 box.

Preparing an antibiotic cocktail: 100mg/kg of vancomycin, 200mg/kg of neomycin sulfate, 200mg/kg of metronidazole and 200mg/kg of ampicillin.

Example 2 Experimental methods

2.1 preparation of fecal suspension

In order to reduce experimental errors, fresh and molded faeces of rats are collected by an anus stimulation method at 8 points in the morning in a unified manner, a evenly mixed faeces sample is taken and dissolved in physiological saline according to a ratio of 1:5, and the mixture is placed on a vortex oscillator to prepare suspension. Filtering the suspension with double-layer gauze, centrifuging the collected suspension at 2000r/min for 20min (r=10cm), and collecting supernatant as fecal suspension.

2.2 MCAO/R model preparation

SD rats were fed adaptively for 7 days, during which time sufficient food and water were ensured. The rats were randomly divided into 4 groups of 10 animals each according to the random number table method: sham surgery group (Sham); model sets (models); astragalus and safflower extract dosing group (HQ-HH); naoxintong capsule treatment group (Naoxintong, NXT). The medicines are dissolved in physiological saline, the administration dosage is converted by the surface area of animals and human bodies, and the administration dosage is determined according to the earlier-stage study of the subject group and is continuously infused and administrated for 14 days once a day; sham and Model lavage saline. 1 hour after day 7 of dosing, the MCAO/R model was prepared by the wire-tie method.

Rats were fasted but not water-inhibited 24 hours prior to molding, were anesthetized with 3% pentobarbital sodium for intraperitoneal injection prior to surgery, and were fixed on surgical plates after anesthesia. With reference to classical molding method, the skin hair of rat neck is removed, disinfected with iodine, and the right common carotid artery of rat is blunt-isolated by cutting a vertical opening of about 1.5cm in the middle of neck

(Common carotid artery, CCA), external carotid artery (External carotid artery, ECA) and internal carotid artery (Internal carotid artery, ICA). Ligating the proximal end of the right CCA and the ECA, cutting a small opening at the lower end of the bifurcation of the CCA, slowly inserting a nylon wire into the ICA until there is slight resistance, and introducing the wire to a depth of about (18.5+/-0.5) mm. Then, nylon wires are fixed, the surgical field is cleaned, and the skin is sutured. Finally placing the rat in a thermal insulation cage for heating and preserving heat, pulling out a nylon wire after 2 hours, and putting the rat back into the cage after waking up, thus finishing the molding. The sham group only performs the procedure of surgically separating CCA, ECA and ICA.

2.3 grouping of animals

Grouping of rats without fecal transplantation: SD rats were acclimatized in a clean room for 7 days, during which sufficient food and water were ensured. The pad and food are replaced regularly, so that the living environment is clean, and the diet is clean and sanitary. The rats were randomly divided into 4 groups of 10 animals each according to the random number table method: sham, model, HQ-HH. The medicines are dissolved in physiological saline water and are administrated by stomach irrigation for 7 days once a day; sham and Model lavage saline. After 1 hour of dosing on day seven, the MCAO/R model was prepared by the wire-tie method. The gastric administration was continued for seven days, and samples were collected on the fourteenth day.

Grouping rats subjected to fecal fungus transplantation: SD rats adaptively fed in the clean room for 7 days were classified according to the random number table method: donor group (HQ-HH group) and acceptor group (FMT group). The HQ-HH group is administrated by gastric lavage for 7 days, and after administration for 1 hour on the seventh day, an MCAO/R model is prepared by a wire tying method; and continuing to perform gastric lavage administration for 7 days, collecting a rat fecal sample from the HQ-HH group after 2 hours of gastric lavage administration on the 7 th day, and preparing a fecal suspension to be stored in a refrigerator at the temperature of minus 80 ℃ for later use. In order to eliminate the influence of own intestinal flora, the recipient group firstly eliminates own intestinal bacteria for 6 days before the fecal bacteria is transplanted, and a pseudo-sterile model is constructed. After one day interval, FMT group was subjected to faecal fungus transplantation, each was given by lavage at 10ml/kg for 14 days, and MCAO/R model was constructed on day 7, and faecal samples, serum templates and brain tissue samples were collected after 2 hours of the last lavage.

2.4 real-time fluorescent quantitative PCR

Primer name: eub338_ Eub806

F terminal sequence: ACTCCTACGGGAGGCAGCAG

R terminal sequence: GGACTACHVGGGTWTCTAAT

The PCR reaction steps are carried out after the standard curve is prepared:

1) Preparing a main mixed solution: mu.l 2X ChamQ SYBR Color qPCR Master Mix,0.8. Mu.l primer F (5 uM), 0.8. Mu.l primer R (5 uM), 0.4. Mu.l 50X ROX Reference Dye 1,2. Mu.l Template (DNA), 6. Mu.l ddH2O.

2) PCR cycle conditions: HOLD 95 ℃ for 3min; cycliE (Melt 95-5 sec, anneal 58-30 sec, extend 72℃for 1 min) repeats 40 CYCLEs.

2.5 16s rRNA

DNA extraction, polymerase chain reaction amplification and sequencing experiments. All stool samples were subjected to the same DNA extraction and PCR amplification procedure by the same laboratory staff. Fecal samples were suspended in 790. Mu.l of sterile lysis buffer and placed in a 2ml screw cap tube containing 1g of glass beads. The mixture was vigorously spun and then incubated at 70℃for 1h. After incubation for 10 minutes with maximum speed beading. DNA was extracted according to the manufacturer's instructions for using the e.z.n.a.0rstool DNA Kit, which did not include a lysis step, and stored at-20 ℃ for further analysis. The V3-V4 region of the 16S rRNA gene was amplified using the extracted DNA as a template. The V3-V4 region of each stool specimen was amplified by polymerase chain reaction using 5'-CCTACGGGNGGCWGCAG-3' and 5'-GACTACHVGGGTATCTAATCC-3' at 341-805 th position of the E.coli 16S rRNA gene as templates, respectively. The polymerase chain reaction was performed in an EasyCycler 96 polymerase chain reaction system using the following procedure: denaturation at 95℃for 3min, followed by 21 cycles at 94℃for 0.5min (denaturation), 58℃for 0.5min, 72℃for 0.5min (extension) and finally 72℃for 5min. The Shanghai Meibo biomedical technology Co., ltd. According to the manufacturer's instructions, products from different samples were indexed and mixed in equal proportions using the Miseq platform for sequencing.

Data was extracted from the raw data using userch 8.0, mass filtered sequences were clustered into unique sequences according to the Uparse OTU analysis pipeline and ranked in order of decreasing abundance to identify representative sequences. After determining the representative sequence with Uparse, the chimeric sequences were removed using Uparse and the Operational Taxonomic Units (OTUs) were classified according to 97% similarity. The systematic assignment of each 16S rRNA gene sequence was analyzed using RDP Classifier.

2.6 metabonomics

Preparing a standard substance: first, a working solution of 10mg/mL is prepared from pure standard substances of short-chain fatty acids (acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid and caproic acid) in proper quantity by using diethyl ether, and then ten standard curve points are prepared by mixing each short-chain fatty acid with an internal standard solution (25 mug/mL): 0.02. Mu.g/mL, 0.1. Mu.g/mL, 0.5. Mu.g/mL, 2. Mu.g/mL, 10. Mu.g/mL, 25. Mu.g/mL, 50. Mu.g/mL, 100. Mu.g/mL, 250. Mu.g/mL, 500. Mu.g/mL, and finally stored at-20℃for later use.

Metabolite extraction: taking a proper amount of samples, adding 15% phosphoric acid, 125 mu g/mL internal standard (4-methylpentanoic acid) solution and diethyl ether into the samples respectively at 50 mu L, 100 mu L and 400 mu L, homogenizing the samples for about 1min, centrifuging the samples for 10min at the temperature of 12000rpm at the temperature of 4 ℃, and finally taking the supernatant for machine-loading detection. The calculation formula is as follows: content = C0.5/sample size 1000; content unit: μg/g; c unit: μg/mL; sample amount unit: mg.

Chromatographic conditions: a Thermo Trace 1300 (Thermo Fisher Scientific, USA) gas phase system, the chromatographic column being an Agilent HP-INNOWAX capillary column (30 m x 0.25mm ID x 0.25 μm); and (3) split sample injection, wherein the sample injection amount is 1 mu L, and the split ratio is 10:1. The temperature of the sample inlet is 250 ℃; ion source temperature 300 ℃; the transmission line temperature was 250 ℃. The temperature programmed initial temperature is 90 ℃; then heating to 120 ℃ at 10 ℃/min; heating to 150 ℃ at a speed of 5 ℃/min; finally, the temperature is raised to 250 ℃ at 25 ℃ per minute for 2 minutes. The carrier gas was helium with a carrier gas flow rate of 1.0mL/min.

Mass spectrometry conditions: thermo ISQ 7000 mass spectrometer (Thermo Fisher Scientific, USA), electron bombardment ionization (EI) source, SIM scanning mode, electron energy 70eV.

EXAMPLE 3 experimental results

3.1 Effect of HQ-HH and FMT on the neuro-functional scoring of CI/RI rats

Rat neural behavior after CI/RI was evaluated using the method of Longa neural function scoring criteria. The results are shown in Table 2. The results show that: model group neurological scores were significantly elevated compared to Sham group (P < 0.01); HQ-HH and FMT groups showed significantly reduced rat neurological scores (P < 0.01) compared to Model groups, respectively, with significant statistical differences. The results show that: the CI/RI rat nerve function is seriously damaged, and the HQ-HH group and the FMT group can obviously improve the nerve function damage after CI/RI.

TABLE 2 influence of HQ-HH and FMT on CI/RI rat neuro-functional scoring

3.2 Effect of HQ-HH and FMT on CI/RI rat cerebral infarction volumes

As shown in fig. 1, the Model group had significantly increased infarct volume (P < 0.01) compared to Sham group; HQ-HH group and FMT group significantly reduced (P < 0.01) rat brain tissue infarct volume compared to Model group, with significant statistical differences; the results show that: both HQ-HH group and FMT group can obviously reduce the infarct volume of CI/RI rat brain tissue, and has obvious therapeutic effect.

3.3 Effect of HQ-HH and FMT on CI/RI rat brain tissue pathological lesions

The pathological changes of rat brain tissue after HQ-HH pair CI/RI were detected by Hematoxylin-Eosin (HE) staining, and the results are shown in FIG. 2. The rat brain cortex neuron cells of the Sham group are complete, the limit is clear, the cell nuclei are full and the arrangement is orderly. After CI/RI, the neurons are seriously damaged, the cell nuclei are contracted, the cell arrangement is sparse, the cell edges are blurred and gaps become large, and obvious brain tissue damage is shown. Whereas the HQ-HH group and the FMT group had less neuronal cell nucleus arrest and less cell gap than the Model group, and the neuronal injury and necrosis were lower than the Model group. The results show that: both the HQ-HH group and the FMT group were able to reduce the CI/RI induced nerve damage in rats.

3.4 Effect of HQ-HH and FMT on CI/RI rat intestinal flora changes

Collecting the feces of the rats before and after the antibiotic treatment, wherein the rats before the antibiotic treatment belong to SPF groups, the rats after the antibiotic treatment belong to PGF groups, extracting genome DNA by using a DNA extraction kit, and completing quantitative PCR by using primers in bacterial 16SV 3-V4 regions. As a result, as shown in FIG. 3, it was found that the bacterial removal rate of PGF group after antibiotic use was 90% or more as compared with SPF group. The results show that: the antibiotic treatment is carried out to successfully construct the pseudo-sterile rat, thus providing basis for subsequent experiments.

3.4.1 intestinal flora dilution curves

The dilution curve is utilized to obtain the sequencing depth condition of the sample. As shown in fig. 4, the results indicate that: the Shannon-Wiener lines of each group tended to be flat (see FIG. 4B) and the Rank-abundance lines tended to be gentle (see FIG. 4A), indicating that the sequencing data were large enough and the species were distributed more evenly, and the sequencing results could reflect the vast majority of microbiological information in the samples.

3.4.2 intestinal flora alpha-diversity variation

And evaluating the alpha-diversity of the sample by using a series of statistical analysis indexes, and reflecting the richness and diversity of microorganisms. Ace and Chao indices can estimate the index of the number of OTUs contained in the sample, reflecting the abundance of intestinal flora, as shown in fig. 5A, 5B. Shannon and Simpson indices were used to evaluate the diversity and uniformity of microorganisms in samples, as shown in FIGS. 5C and 5D. Results fig. 5 shows that: the Sham group rats have higher intestinal flora, and more concentrated diversity and uniformity. After CI/RI, the richness is reduced, the diversity and uniformity are more dispersed, and obvious separation phenomenon between the Sham group and the Model can be observed. Whereas the HQ-HH group and the FMT group have a tendency to aggregate in terms of richness, diversity and uniformity as compared to the Model group. The results show that: both the HQ-HH group and the FMT group were able to alter the reduction in alpha-diversity caused by CI/RI in rats.

3.4.3 beta-variational changes in intestinal flora

Beta-diversity analysis of intestinal bacterial communities was performed based on OTU abundance distribution in samples, observing the differences in community composition between groups. As shown in FIG. 6A, the Model group sample points are more scattered than the Sham group by using the principal coordinate analysis (Principal coordinates analysis, PCoA) of the unweighted_uniarray distance, indicating that the individual differences of the Model group sample flora are larger; HQ-HH and FMT groups were more aggregated than Model groups, indicating that HQ-HH and FMT groups had less individual differences than Model groups; sample points of the FMT group were closer to the Sham group on the PCoA plot, indicating that the FMT group flora composition was more similar to the Sham group than the other groups. As shown in the analysis results of anosims of fig. 6B, the group-to-group differences were significantly greater than the group-to-group differences, indicating significant differences in flora composition between the Sham group, the Model group, the HQ-HH group, and the FMT group.

3.4.4 analysis of intestinal flora species composition

Based on OTU annotation results, the relative abundance of species for each sample was counted and plotted at the phylum, class (class) classification level, respectively. As a result, as shown in FIG. 7, CI/RI changed the relative abundance of intestinal flora species composition, model group increased by Firmides (Firmides) and decreased by Bacteroides (Bactoidota) at the phylum level compared to the Sham group; the level of the class (Bacillus) is decreased, and the level of the class (Gamma-Proteobacteria) is increased; HQ-HH and FMT decreased in the phylum Firmicum (Firmicum) and increased in the Bacteroides phylum (Bactoidota) at the phylum level compared to the Model group; the class Bacillus (Bacilli) and the class gamma-proteobacteria (Gamma-proteobacteria) are increased at the class level. Indicating that HQ-HH group or transplanting the excrement rich in HQ-HH can regulate and control intestinal flora imbalance of rats.

3.4.5 analysis of intestinal flora species composition

Based on OTU annotation results and species relative abundance results at the phylum, class classification level, applicants further mapped the genus (genus) level in order to find the differential genus. As shown in FIG. 8, CI/RI changed the relative abundance of intestinal flora species composition, and the Model group was found to be a beneficial strain of Ranunculus at the genus level as compared to the Sham group

(Muribamulac), helicobacter (Lachnospiraceae_unclassified), oscilospiraceae (Oscilospiraceae), osciliatric, mycobacterium (Alistines) and Acremonium (Akkermansia) decrease, and Bacillus (Bacillus_unclassified), and Weiminococcus (Ruminococcus) increase; HQ-HH and FMT increased in genus levels, and harmful bacteria (Bacillus) decreased in genus, as compared to Model group, ranunculus (Muriba), spirochete (Lachnospiraceae_unclassified), oscilospiraceae (Oscilospiraceae), osciliatric, alistipes (Alistipes) and Acremonium (Akkermannia). It is shown that the Sham group, model group, HQ-HH group and FMT group can reduce harmful bacteria and increase beneficial bacteria, thereby regulating intestinal flora.

3.5 Effect of HQ-HH and FMT on short chain fatty acid content variation in CI/RI rats

Based on the 16s rRNA results, it was found that the differential flora of the intestinal flora after CI/RI has the capacity to produce SCFAs, suggesting that the CI/RI-induced intestinal flora disorders may be closely related to its metabolite SCFAs. Thus, applicants further analyzed the content of SCFAs, the intestinal flora metabolite in CI/RI rats, using GC/MS targeted metabonomics.

3.5.1 changes in short chain fatty acid content in rat feces

To investigate whether the variation of the SCFAs content in the faeces could be caused after CI/RI, the applicant performed a test analysis of the rat faeces. The linear regression equation for each material is shown in Table 3 below, linear R for all indices ² Greater than 0.99, indicating good linearity. According to the established metabolite correction curve, the concentration of 7 SCFAs in the sample is calculated, and the content of 7 SCFAs in each sample is calculated according to the actual sampling amount. As a result, as shown in FIG. 9, acetic acid was the SCFAs with the highest fecal content, followed by butyric acid, propionic acid, valeric acid, caproic acid, isobutyric acid and isovaleric acid. 7 SCFAs in the Model group rat feces compared to the Sham groupReduced content, wherein the content of propionic acid, butyric acid, isobutyric acid and valeric acid is significantly reduced, the difference being statistically significant (P<0.05 A) is provided; the 7 SCFAs content was increased in the rat feces of HQ-HH and FMT groups compared to Model group, with significantly increased propionic, butyric and isobutyric acid content, the difference being statistically significant (P<0.05). The above results indicate that CI/RI can cause metabolic disorders in fecal SCFAs, and that HQ-HH and FMT have a tendency to call back, with changes in propionic acid, butyric acid and isobutyric acid being particularly pronounced.

TABLE 3 Linear equation for 7 SCFAs in feces

3.5.2 changes in short chain fatty acid content in rat serum

To investigate whether changes in SCFAs content in serum could be caused after CI/RI, the applicant performed a test analysis on rat serum. The linear regression equation for each material is shown in Table 4 below, linear R for all indices ² Greater than 0.99, indicating good linearity. According to the established metabolite correction curve, the concentration of 7 SCFAs in the sample is calculated, and the content of 7 SCFAs in each sample is calculated according to the actual sampling amount. As shown in FIG. 10, acetic acid was the highest serum content of SCFAs followed by butyric acid, propionic acid, isobutyric acid, isovaleric acid, valeric acid and caproic acid. The 7 SCFAs in the faeces of rats from the Model group were reduced compared to the Sham group, with significantly lower levels of acetic acid, propionic acid, butyric acid and valeric acid, the differences being statistically significant (P<0.05 A) is provided; the 7 SCFAs content in the faeces of rats in the HQ-HH group and FMT group increased compared to the Model group, with significantly increased acetic acid and butyric acid content, the difference being statistically significant (P<0.05). The above results indicate that CI/RI can cause metabolic disorders in serum SCFAs, and that HQ-HH and FMT have a tendency to call back, with changes in acetate and butyrate being particularly pronounced.

TABLE 4 Linear equation for 7 SCFAs in serum

Variation of short chain fatty acid content in 3.5.3 rat brain tissue

To further investigate whether the CI/RI can lead to a change in the SCFAs content in brain tissue, the applicant performed a test analysis of rat brain tissue. The linear regression equation for each material is shown in Table 5 below, linear R for all indices ² Greater than 0.99, indicating good linearity. According to the established metabolite correction curve, the concentration of 7 SCFAs in the sample is calculated, and the content of 7 SCFAs in each sample is calculated according to the actual sampling amount. As shown in FIG. 11, acetic acid is the SCFAs with the highest brain tissue content, followed by propionic acid, butyric acid, caproic acid, isovaleric acid, isobutyric acid, and valeric acid. The 7 SCFAs were reduced in the brain tissue of rats in the Model group compared to the Sham group, with a significant reduction in butyrate, the difference being statistically significant (P<0.05 A) is provided; the 7 SCFAs content in the brain tissue of rats in HQ-HH and FMT groups increased, with a significant increase in butyrate and hexanoate content, compared to Model group, the difference being statistically significant (P<0.05). The above results indicate that CI/RI can cause metabolic disorders in serum SCFAs, and HQ-HH and FMT have a tendency to call back, with changes in butyrate being particularly pronounced.

TABLE 5 Linear equation for 7 SCFAs in brain tissue

In conclusion, CI/RI reduces the content of SCFAs in intestinal flora and feces, serum and brain tissue for producing SCFAs in intestinal tract; the relative abundance of bacillus and gastric tumor coccus can be obviously reduced after HQ-HH is given or HQ-HH is transplanted; the relative abundance of Ranunculus, helicobacter, oscillating bacteria, other arbuscular bacteria and Acremonium is increased, so that the species composition of SCFAs produced by CI/RI intestinal tracts is increased, the content change of SCFAs at each part in the body is further increased, the stable state of intestinal flora is maintained, and the effect of brain protection is achieved. Fully embody the interaction between the whole regulation theory of the traditional Chinese medicine and the balance regulation of intestinal flora. However, the action mechanism of HQ-HH for brain protection is complex, and the difficulty in elucidating the action mechanism of HQ-HH specific molecules is increased. In this example, applicants have found that HQ-HH may alleviate CI/RI by affecting the intestinal flora and its metabolites SCFAs, however the specific molecular mechanism of action of brain protection remains unsolved. Thus, the applicant will investigate in example 4 how HQ-HH exerts the mechanism of action of brain protection via the "brain-gut axis" pathway.

EXAMPLE 4 mechanism of action Studies

4.1 Effect of HQ-HH and FMT on CI/RI rat intestinal tissue pathological lesions

The pathological changes of the intestinal tissue of the rats of HQ-HH to CI/RI were detected by Hematoxylin-Eosin (HE) staining method, and the results are shown in FIG. 12. The Model group showed a reduced number of goblet cells in intestinal tissue, a sparse arrangement, severe destruction of intestinal tissue structure, blurring of cell edges and appearance of local necrosis, inflammatory infiltrates, and significant intestinal tissue damage compared to Sham group. Whereas the HQ-HH group and FMT group showed significantly lower reduction in the number of cells, destruction of tissue structure, local necrosis and inflammatory infiltrate than the Model group, and the lesions were significantly better. The results show that: both the HQ-HH group and the FMT group were able to alleviate intestinal tissue damage caused by CI/RI in rats.

4.2 Effect of HQ-HH and FMT on CI/RI rat goblet cells

Since mucin contained in the goblet cell particles of intestinal tissue is a glycoprotein, goblet cells at different locations along the surface axis of the crypt contribute to the formation of a functional mucus barrier, thereby protecting the intestinal epithelium from microorganisms. The applicant then used PAS staining to detect changes in goblet cells in the intestinal tissue of SD rats after CI/RI by HQ-HH, and the results are shown in FIG. 13. The Model group showed significantly reduced numbers of mauve goblet cells and altered goblet cell morphology compared to the Sham group. While the HQ-HH group and FMT group had significantly increased numbers of mauve goblet cells compared to the Model group, the goblet cell morphology tended to improve. The results show that: both the HQ-HH group and the FMT group were able to alleviate the reduction in goblet cell numbers caused by CI/RI in rats, thereby protecting the intestinal mucosal barrier.

4.3 Effect of HQ-HH and FMT on CI/RI rat intestinal Barrier

As is evident from HE staining and PAS staining, the pathological structure of CI/RI intestinal tissue is significantly altered and exhibits inflammatory infiltrates and localized necrosis. In addition, the number of vacuolated goblet cells in HE staining and mauve goblet cells in PAS staining was found to be significantly reduced, indicating that the intestinal barrier may be damaged. Furthermore, it is well known that intestinal barrier disruption, intestinal metabolites and endotoxins enter the blood. To further confirm that the intestinal barrier was disrupted after CI/RI, plasma concentrations of LPS, LBP and D-Lac were measured by ELISA. As a result, as shown in FIG. 14, the concentrations of LPS, LBP and D-Lac were significantly increased in the Model group compared with the Sham group. While both the HQ-HH group and the FMT group were reduced to a different extent than the Model group. The results show that: both the HQ-HH group and the FMT group were able to alleviate the damage of the intestinal barrier caused by CI/RI in rats.

4.4 Effect of HQ-HH and FMT on SCFAS receptors in CI/RI rat intestinal tissue

SCFAs can regulate the activity of G protein coupled receptor, i.e. GPR receptor, and other inflammation related channels, reduce the release of pro-inflammatory factors, inhibit inflammatory reaction, and maintain immune balance. The applicant used immunohistochemical assay to detect SCFAs receptor expression in SD rat intestinal tissue of HQ-HH versus CI/RI, and the results are shown in fig. 15. After CI/RI, the SCFAs receptors GPR41, GPR43 and GPR109A were expressed in brain tissue in the Model group as compared to the Sham group. Whereas the HQ-HH and FMT groups showed significantly higher expression of SCFAs receptors GPR41, GPR43 and GPR109A compared to the Model group. The results show that: both the HQ-HH group and the FMT group increased the SCFAs receptor decrease by the rat CI/RI.

4.5 Effect of HQ-HH and FMT on the blood brain Barrier in CI/RI rats

The zonula occludens ZO-1, ocludin and Claudin-5 are closely related to the blood brain barrier. Applicants used immunohistochemistry to examine changes in HQ-HH to the blood brain barrier of CI/RI rats, and as shown in FIG. 16, the Model group showed reduced levels of zon-1, ocludin and Claudin-5 in brain tissue compared to the Sham group. While the HQ-HH group and FMT group were significantly elevated in ZO-1, ocludin and Claudin-5 compared to the Model group. The results show that: both the HQ-HH group and the FMT group were able to ameliorate the damage to the blood brain barrier caused by CI/RI in rats.

4.6 Effect of HQ-HH and FMT on SCFAS receptors in CI/RI rat brain tissue

SCFAs can regulate the activity of G protein coupled receptor, i.e. GPR receptor, and other inflammation related channels, reduce the release of pro-inflammatory factors, inhibit inflammatory reaction, and maintain immune balance. Applicants used immunohistochemistry and West Blot to examine SCFAs receptor expression in brain tissue of CI/RI rats by HQ-HH, and as a result, as shown in fig. 17, SCFAs receptor GPR41, GPR43 and GPR109A expression in brain tissue was reduced in Model group compared to Sham group. Whereas the HQ-HH and FMT groups showed significantly higher expression of SCFAs receptors GPR41, GPR43 and GPR109A compared to the Model group. The results show that: both the HQ-HH group and the FMT group increased the SCFAs receptor decrease by the rat CI/RI.

4.7 Effect of HQ-HH and FMT on CI/RI rat brain tissue inflammatory factors

After cerebral ischemia, the damaged brain cells produce a large amount of inflammatory mediators such as tumor necrosis factors, interleukins and the like, and the dynamic process of the interaction of various cells in the brain is destroyed, so that the second damage after cerebral ischemia can be caused. West Blot results showed that the expression of inflammatory and anti-inflammatory factors in SD rat brain tissue after CI/RI by HQ-HH was examined, and the results are shown in FIG. 18. After CI/RI, the inflammatory factors IL-1 beta, IL-6, IL-32 and TNF-alpha were significantly increased and the anti-inflammatory factor IL-10 was significantly decreased in the brain tissue in the Model group compared to the Sham group. Whereas the HQ-HH group and FMT group significantly decreased inflammatory factors IL-1β, IL-6, IL-32 and TNF- α and the anti-inflammatory factor IL-10 significantly increased compared to the Model group. The results show that: both the HQ-HH group and the FMT group can reduce the production of brain tissue inflammatory factors caused by CI/RI.

4.8 influence of HQ-HH and FMT on the M1/M2 microglial cells of CI/RI rats

Normally, microglial cells are in a resting state, and the brain microenvironment is constantly monitored. Upon occurrence of cerebral ischemia, microglial cells are activated, producing a dual role of neurotoxicity and neuroprotection. The balance between anti-inflammatory and pro-inflammatory responses is maintained by inhibiting the polarization of microglia to the M1 type and promoting the polarization of microglia to the M2 type, and is a potential new idea for treating ischemic stroke. The results of M1-type and M2-type microglial immunofluorescence are shown in FIGS. 19 and 20, IBA-1 is microglial cell specific binding protein, is a microglial localization marker, CD86 is a M1-type microglial marker, and CD206 is a M2-type microglial marker. The results show that the microglia of the Sham groups M1 and M2 are in a resting state, and after CI/RI, the Model group has significantly increased M1 microglia in brain tissue compared with the Sham group; the HQ-HH group and FMT group significantly reduced M1 microglial cells compared to the Model group. Model group M2 microglial cells were activated in brain tissue compared to Sham group; the HQ-HH group and the FMT group showed a significant increase in M2 microglial cells compared to the Model group. The results show that: both the HQ-HH group and the FMT group inhibit polarization of microglia to M1 and promote polarization thereof to M2.

In example 3 of the present application, the effect of HQ-HH on the CI/RI rat intestinal flora and its metabolite SCFAs was investigated. The research result shows that the CI/RI reduces the content of SCFA-producing intestinal flora in intestinal tracts and SCFA-producing intestinal flora metabolites in feces, serum and brain tissues; the relative abundance of harmful bacillus, gastric tumor coccus and clostridium can be obviously reduced after HQ-HH is given or HQ-HH is transplanted; increasing the relative abundance of beneficial bacteria such as Ranunculus, helicobacter, oscillating bacteria, acremodelling bacteria and Acremodelling bacteria, thereby regulating the species composition of SCFAs flora produced by CI/RI intestinal tracts, maintaining intestinal flora steady state, and further increasing the content variation of SCFAs at each part in the body. The HQ-HH can promote the increase of SCFAs producing bacteria by regulating the stable state of intestinal flora, and further can increase in vivo SCFAs, thereby playing a role in brain protection.

The mechanism of action of HQ-HH to improve CI/RI via the "brain-gut axis" was investigated in example 4 of the present application. Research results on intestinal barriers, blood brain barriers, SCFAs receptor expression and inflammatory reaction show that by transplanting HQ-HH-enriched fecal bacteria, HQ-HH can influence CR/RI rat intestinal flora, promote the relative abundance of SCFAs flora generated by the intestinal flora to be increased, activate GPRs receptor, promote the expression of SCFAs, repair intestinal barrier leakage and reduce systemic inflammatory reaction; and up-regulating the expression of the tight junction protein to enhance the integrity of the blood brain barrier, finely regulating and controlling M1/M2 microglial cells, reducing microglial cell-mediated neuroinflammation, and enhancing brain defense function so as to play a role in resisting CI/RI.

In conclusion, the application verifies that HQ-HH can regulate the CI/RI intestinal flora steady state through 16s rRNA and metabonomics, and promotes the production of SCFAs in vivo. Finally, in vivo experiments are utilized to carry out mechanism verification on the metabolic difference.

Based on the above, the intestinal flora and/or metabolites of the intestinal flora (such as propionic acid, butyric acid, isobutyric acid and other short chain fatty acids in serum and feces or butyric acid, caproic acid and the like in brain tissue) can be used as a cerebral ischemia reperfusion injury marker, applied to a cerebral ischemia reperfusion injury detection kit or applied to preparation of a composition for preventing and treating cerebral ischemia reperfusion injury.

The present disclosure is intended to embrace all such alternatives, modifications and variances which fall within the broad scope of the appended claims. Any omissions, modifications, equivalents, improvements, and the like, which are within the spirit and principles of the one or more embodiments of the disclosure, are therefore intended to be included within the scope of the disclosure.

Claims

1. Cerebral ischemia reperfusion injury markers, including intestinal flora, and/or metabolites of intestinal flora.

2. The marker of claim 1, wherein the metabolites of the intestinal flora comprise short chain fatty acids.

3. The marker of claim 1, wherein the short chain fatty acid is one or a combination of several of propionic acid, butyric acid, isobutyric acid.

4. The marker of claim 1, wherein the short chain fatty acid is one or a combination of two of butyric acid and caproic acid.

5. Use of a marker according to any one of claims 1-4 for the preparation of a kit for detection of cerebral ischemia reperfusion injury.

6. Use of a marker according to any one of claims 1-4 for the preparation of a composition for the prevention and treatment of cerebral ischemia reperfusion injury.