CN117024497A - RNA deprotection agent and application thereof - Google Patents
RNA deprotection agent and application thereof Download PDFInfo
- Publication number
- CN117024497A CN117024497A CN202310925922.2A CN202310925922A CN117024497A CN 117024497 A CN117024497 A CN 117024497A CN 202310925922 A CN202310925922 A CN 202310925922A CN 117024497 A CN117024497 A CN 117024497A
- Authority
- CN
- China
- Prior art keywords
- rna
- dimethylethanolamine
- pumping
- deprotection
- deprotection agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000010511 deprotection reaction Methods 0.000 title claims abstract description 67
- 239000003795 chemical substances by application Substances 0.000 claims abstract description 39
- ILZHHPCAMLILSP-UHFFFAOYSA-N 2-(dimethylamino)ethanol;hydrofluoride Chemical compound [F-].C[NH+](C)CCO ILZHHPCAMLILSP-UHFFFAOYSA-N 0.000 claims abstract description 21
- UEEJHVSXFDXPFK-UHFFFAOYSA-N N-dimethylaminoethanol Chemical compound CN(C)CCO UEEJHVSXFDXPFK-UHFFFAOYSA-N 0.000 claims abstract description 21
- 229960002887 deanol Drugs 0.000 claims abstract description 21
- 239000012972 dimethylethanolamine Substances 0.000 claims abstract description 21
- 238000006243 chemical reaction Methods 0.000 claims abstract description 20
- 238000001816 cooling Methods 0.000 claims abstract description 18
- 238000010438 heat treatment Methods 0.000 claims abstract description 18
- RBHJBMIOOPYDBQ-UHFFFAOYSA-N carbon dioxide;propan-2-one Chemical compound O=C=O.CC(C)=O RBHJBMIOOPYDBQ-UHFFFAOYSA-N 0.000 claims abstract description 12
- SECXISVLQFMRJM-UHFFFAOYSA-N N-Methylpyrrolidone Chemical compound CN1CCCC1=O SECXISVLQFMRJM-UHFFFAOYSA-N 0.000 claims abstract description 11
- KRHYYFGTRYWZRS-UHFFFAOYSA-N Fluorane Chemical compound F KRHYYFGTRYWZRS-UHFFFAOYSA-N 0.000 claims abstract description 9
- 229910000040 hydrogen fluoride Inorganic materials 0.000 claims abstract description 9
- 238000005086 pumping Methods 0.000 claims description 36
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 25
- 239000012043 crude product Substances 0.000 claims description 23
- 238000000034 method Methods 0.000 claims description 17
- 238000005915 ammonolysis reaction Methods 0.000 claims description 13
- LRHPLDYGYMQRHN-UHFFFAOYSA-N N-Butanol Chemical compound CCCCO LRHPLDYGYMQRHN-UHFFFAOYSA-N 0.000 claims description 12
- 230000002194 synthesizing effect Effects 0.000 claims description 12
- 239000000047 product Substances 0.000 claims description 9
- 239000007790 solid phase Substances 0.000 claims description 9
- -1 phosphoramidite triester Chemical class 0.000 claims description 8
- 238000001035 drying Methods 0.000 claims description 7
- 238000005360 mashing Methods 0.000 claims description 6
- LFETXMWECUPHJA-UHFFFAOYSA-N methanamine;hydrate Chemical compound O.NC LFETXMWECUPHJA-UHFFFAOYSA-N 0.000 claims description 6
- 239000006228 supernatant Substances 0.000 claims description 6
- 239000003153 chemical reaction reagent Substances 0.000 claims description 3
- 238000004090 dissolution Methods 0.000 claims description 2
- ZMANZCXQSJIPKH-UHFFFAOYSA-N Triethylamine Chemical compound CCN(CC)CC ZMANZCXQSJIPKH-UHFFFAOYSA-N 0.000 abstract description 33
- IKGLACJFEHSFNN-UHFFFAOYSA-N hydron;triethylazanium;trifluoride Chemical compound F.F.F.CCN(CC)CC IKGLACJFEHSFNN-UHFFFAOYSA-N 0.000 abstract description 10
- 230000006819 RNA synthesis Effects 0.000 abstract description 8
- 230000027832 depurination Effects 0.000 abstract description 7
- 239000006227 byproduct Substances 0.000 abstract description 5
- 239000002994 raw material Substances 0.000 abstract description 3
- 238000001668 nucleic acid synthesis Methods 0.000 abstract description 2
- 230000000052 comparative effect Effects 0.000 description 15
- BLRPTPMANUNPDV-UHFFFAOYSA-N Silane Chemical group [SiH4] BLRPTPMANUNPDV-UHFFFAOYSA-N 0.000 description 12
- 125000002887 hydroxy group Chemical group [H]O* 0.000 description 12
- QGZKDVFQNNGYKY-UHFFFAOYSA-N Ammonia Chemical compound N QGZKDVFQNNGYKY-UHFFFAOYSA-N 0.000 description 10
- 238000002156 mixing Methods 0.000 description 7
- 230000015572 biosynthetic process Effects 0.000 description 6
- 230000008569 process Effects 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000003786 synthesis reaction Methods 0.000 description 6
- 229910021529 ammonia Inorganic materials 0.000 description 5
- 239000002773 nucleotide Substances 0.000 description 5
- 125000003729 nucleotide group Chemical group 0.000 description 5
- 125000006239 protecting group Chemical group 0.000 description 5
- 238000003756 stirring Methods 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- ILMRJRBKQSSXGY-UHFFFAOYSA-N tert-butyl(dimethyl)silicon Chemical group C[Si](C)C(C)(C)C ILMRJRBKQSSXGY-UHFFFAOYSA-N 0.000 description 4
- OKKJLVBELUTLKV-UHFFFAOYSA-N Methanol Chemical group OC OKKJLVBELUTLKV-UHFFFAOYSA-N 0.000 description 3
- 108091034117 Oligonucleotide Proteins 0.000 description 3
- 230000009471 action Effects 0.000 description 3
- 230000008878 coupling Effects 0.000 description 3
- 238000010168 coupling process Methods 0.000 description 3
- 238000005859 coupling reaction Methods 0.000 description 3
- 239000007789 gas Substances 0.000 description 3
- 229910052757 nitrogen Inorganic materials 0.000 description 3
- 229910019142 PO4 Inorganic materials 0.000 description 2
- 150000007513 acids Chemical class 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- 238000003776 cleavage reaction Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000000132 electrospray ionisation Methods 0.000 description 2
- 125000003147 glycosyl group Chemical group 0.000 description 2
- 150000002500 ions Chemical class 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 239000012071 phase Substances 0.000 description 2
- NBIIXXVUZAFLBC-UHFFFAOYSA-K phosphate Chemical compound [O-]P([O-])([O-])=O NBIIXXVUZAFLBC-UHFFFAOYSA-K 0.000 description 2
- 239000010452 phosphate Substances 0.000 description 2
- 230000007017 scission Effects 0.000 description 2
- 238000007086 side reaction Methods 0.000 description 2
- GFFGJBXGBJISGV-UHFFFAOYSA-N Adenine Chemical compound NC1=NC=NC2=C1N=CN2 GFFGJBXGBJISGV-UHFFFAOYSA-N 0.000 description 1
- 229930024421 Adenine Natural products 0.000 description 1
- JLCPHMBAVCMARE-UHFFFAOYSA-N [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(6-aminopurin-9-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate Polymers Cc1cn(C2CC(OP(O)(=O)OCC3OC(CC3OP(O)(=O)OCC3OC(CC3O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)C(COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3CO)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)O2)c(=O)[nH]c1=O JLCPHMBAVCMARE-UHFFFAOYSA-N 0.000 description 1
- 229960000643 adenine Drugs 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- VZTDIZULWFCMLS-UHFFFAOYSA-N ammonium formate Chemical compound [NH4+].[O-]C=O VZTDIZULWFCMLS-UHFFFAOYSA-N 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 125000004122 cyclic group Chemical group 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 125000006575 electron-withdrawing group Chemical group 0.000 description 1
- 238000010828 elution Methods 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000004949 mass spectrometry Methods 0.000 description 1
- 125000002496 methyl group Chemical group [H]C([H])([H])* 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 239000000178 monomer Substances 0.000 description 1
- 125000004433 nitrogen atom Chemical group N* 0.000 description 1
- 238000007254 oxidation reaction Methods 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 238000011056 performance test Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- NTJBWZHVSJNKAD-UHFFFAOYSA-N triethylazanium;fluoride Chemical compound [F-].CC[NH+](CC)CC NTJBWZHVSJNKAD-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H1/00—Processes for the preparation of sugar derivatives
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Saccharide Compounds (AREA)
Abstract
The invention discloses an RNA deprotection agent and application thereof, belonging to the technical field of nucleic acid synthesis and comprising the following components in parts by volume: 60 parts of 1-methyl-2-pyrrolidone, 30 parts of dimethylethanolamine hydrofluoric acid salt and 40 parts of dimethylethanolamine; the dimethylethanolamine hydrofluoric acid salt comprises the following steps of: adding dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 10-20min, condensing and introducing anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10-15min at a heating rate of 0.5-1 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt. Compared with the RNA deprotection agent taking triethylamine trihydrofluoride and triethylamine as raw materials in the prior art, the RNA deprotection agent provided by the invention can reduce the degree of RNA depurination, reduce the generation of byproducts, improve the purity of RNA synthesis and improve the success rate of RNA synthesis.
Description
Technical Field
The invention belongs to the technical field of nucleic acid synthesis, and particularly relates to an RNA deprotection agent and application thereof.
Background
The synthesis of oligonucleotides generally employs a solid phase phosphoramidite triester method, wherein DNA is immobilized on a solid phase carrier, and the four-step cyclic reaction is carried out: deprotection, coupling, capping and oxidization are carried out, nucleotide monomers are connected one by one, and finally the synthesis of the DNA chain is completed.
Oligonucleotide deprotection can be divided into three parts: cleavage, phosphate deprotection, and base deprotection. Since RNA has one more hydroxyl group at the 2' -end of the glycosyl group than DNA, and this hydroxyl group is an active group, pre-protection must be performed during the synthesis process to avoid side reactions at the 2' -end during the synthesis process, and protecting groups for protecting the 2' -hydroxyl group, such as t-butyldimethylsilyl (TBDMS), triisopropylsiloxymethyl (TOM), etc., may generate great steric hindrance, resulting in a decrease in the coupling efficiency of RNA nucleic acid, and deprotection is also required.
Triethylamine trihydrofluoride is a common reagent for removing silane protecting groups, and is often used as an RNA deprotection agent by mixing 1-methyl-2-pyrrolidone, triethylamine trihydrofluoride and triethylamine which are based on a mixture of triethylamine trihydrofluoride, and the triethylamine trihydrofluoride reacts with a protecting group of a 2 'hydroxyl group to carry out deprotection to obtain the 2' hydroxyl group, but the added buffer solution triethylamine tends to depurination, so that excessive byproducts are generated, the complete structure of RNA is damaged, and RNA synthesis fails.
Oligonucleotide deprotection can be divided into three parts: cleavage, phosphate deprotection, and base deprotection. Since RNA has one more hydroxyl group at the 2' -end of the glycosyl group than DNA, and this hydroxyl group is an active group, pre-protection must be performed during the synthesis process to avoid side reactions at the 2' -end during the synthesis process, and protecting groups for protecting the 2' -hydroxyl group, such as t-butyldimethylsilyl (TBDMS), triisopropylsiloxymethyl (TOM), etc., may generate great steric hindrance, resulting in a decrease in the coupling efficiency of RNA nucleic acid, and deprotection is also required.
Triethylamine trihydrofluoride is a common reagent for removing silane protecting groups, and is often used as an RNA deprotection agent by mixing 1-methyl-2-pyrrolidone, triethylamine trihydrofluoride and triethylamine which are based on a mixture of triethylamine trihydrofluoride, and the triethylamine trihydrofluoride reacts with a protecting group of a 2 'hydroxyl group to carry out deprotection to obtain the 2' hydroxyl group, but the added buffer solution triethylamine tends to depurination, so that excessive byproducts are generated, the complete structure of RNA is damaged, and RNA synthesis fails.
The aim of the invention can be achieved by the following technical scheme:
an RNA deprotection agent comprises the following components in parts by volume: 60 parts of 1-methyl-2-pyrrolidone, 30 parts of dimethylethanolamine hydrofluoric acid salt and 40 parts of dimethylethanolamine; dimethylethanolamine hydrofluoric acid salts are acidic compounds with deprotection activity and can be used to deprotect 2 'hydroxyl groups to give 2' hydroxyl groups, and dimethylethanolamine is used to provide a suitable buffer environment.
As a further scheme of the invention, the dimethylethanolamine hydrofluoric acid salt comprises the following steps of:
adding dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 10-20min, condensing and introducing anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10-15min at a heating rate of 0.5-1 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt.
As a further scheme of the invention, the mass ratio of the dimethylethanolamine to the anhydrous hydrogen fluoride is 42.5:87.5-100.
As a further aspect of the present invention, the application of the RNA deprotection agent is applied to RNA deprotection, and comprises the following steps:
step one, synthesizing an RNA crude product: synthesizing RNA by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, pumping for 20min after the RNA is pumped, and ensuring no ammonia smell;
and step three, adding 1000 mu LRNA deprotection agent into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at 13000r/min for 20 minutes, removing supernatant, placing in a pumping machine for pumping, adding 200 mu LDEPC water for dissolution, obtaining RNA crude products with silane protecting groups at the 2' end removed, and finishing RNA deprotection.
As a further aspect of the present invention, the RNA deprotection agent of step three comprises the steps of: mixing and stirring 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid salt and dimethylethanolamine according to the volume ratio of 6:3:4 to obtain the RNA deprotection agent.
The invention has the beneficial effects that:
according to the invention, dimethylethanolamine and anhydrous hydrogen fluoride are used as raw materials to synthesize dimethylethanolamine hydrofluoric acid salt, the dimethylethanolamine hydrofluoric acid salt is used as an active compound for removing silane protecting groups at the 2 'end of RNA, the dimethylethanolamine hydrofluoric acid salt belongs to an acidic compound, has deprotection activity, can remove protecting groups of 2' hydroxyl to obtain 2 'hydroxyl, and provides a proper buffer environment by dimethylethanolamine, and 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid salt and dimethylethanolamine are mixed according to a volume ratio of 6:3:4 to prepare an RNA deprotection agent, and can be applied to deprotection of silane protecting groups at the 2' end of an RNA crude product synthesized by a solid-phase phosphoramidite triester method and subjected to water bath ammonolysis;
compared with the RNA deprotection agent taking triethylamine trihydrofluoride and triethylamine as raw materials in the prior art, the RNA deprotection agent provided by the invention can reduce the degree of RNA depurination, reduce the generation of byproducts, improve the purity of RNA synthesis and improve the success rate of RNA synthesis, and is mainly characterized by comprising the following components:
the methyl of triethylamine is electron-pushing group, so that the electron cloud density on nitrogen atom is larger, the alkalinity is stronger, and the oxygen on dimethylethanolamine is electron-withdrawing group, so that the alkalinity of dimethylethanolamine is weaker than that of triethylamine, the depurination degree can be reduced, the generation of byproducts is reduced, the purity of RNA synthesis is improved, and the success rate of RNA synthesis is improved.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Example 1
An RNA deprotection agent comprising the steps of:
adding 42.5g of dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 10min, condensing and introducing 87.5g of anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10min at a heating rate of 0.5 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt;
and step two, mixing and stirring 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid salt and dimethylethanolamine according to a volume ratio of 6:3:4 to obtain the RNA deprotection agent.
Example 2
An RNA deprotection agent comprising the steps of:
adding 42.5g of dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 20min, condensing and introducing 100g of anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10-15min at a heating rate of 0.5-1 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt;
and step two, mixing and stirring 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid salt and dimethylethanolamine according to a volume ratio of 6:3:4 to obtain the RNA deprotection agent.
Comparative example 1
An RNA deprotection agent comprising the steps of:
mixing and stirring 1-methyl-2-pyrrolidone, triethylamine hydrofluoric acid salt and triethylamine according to the volume ratio of 6:3:4 to obtain the RNA deprotection agent.
Comparative example 2
An RNA deprotection agent comprising the steps of:
adding 42.5g of dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 10min, condensing and introducing 87.5g of anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10min at a heating rate of 0.5 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt;
and step two, mixing and stirring 1-methyl-2-pyrrolidone, dimethylethanolamine hydrofluoric acid salt and triethylamine according to a volume ratio of 6:3:4 to obtain the RNA deprotection agent.
In this comparative example, as compared with example 1, only "dimethylethanolamine" was replaced with "triethylamine", and the remaining steps and parameters were the same.
Example 3
An RNA deprotection agent for use in RNA deprotection comprising the steps of:
step one, synthesizing an RNA crude product: synthesizing RNA (the nucleotide sequence of the RNA is UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, pumping for 20min after the RNA is pumped, and ensuring no ammonia smell;
adding 1000 mu L of the prepared RNA deprotection agent prepared in the embodiment 1 into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at a speed of 13000r/min for 20 minutes, removing supernatant, pumping in a pumping machine, adding 200 mu L of LDEPC water for dissolving, and obtaining a RNA crude product with a silane protecting group at the 2' end removed, thereby finishing RNA deprotection.
Example 4
An RNA deprotection agent for use in RNA deprotection comprising the steps of:
step one, synthesizing an RNA crude product: synthesizing RNA (the nucleotide sequence of the RNA is UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, pumping for 20min after the RNA is pumped, and ensuring no ammonia smell;
adding 1000 mu L of the prepared RNA deprotection agent prepared in the embodiment 2 into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at a speed of 13000r/min for 20 minutes, removing supernatant, pumping in a pumping machine, adding 200 mu L of LDEPC water for dissolving, and obtaining a RNA crude product with a silane protecting group at the 2' end removed, thereby finishing RNA deprotection.
Comparative example 3
An RNA deprotection agent for use in RNA deprotection comprising the steps of:
step one, synthesizing an RNA crude product: synthesizing RNA (the nucleotide sequence of the RNA is UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, pumping for 20min after the RNA is pumped, and ensuring no ammonia smell;
adding 1000 mu L of the prepared RNA deprotection agent prepared in the comparative example 1 into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at a speed of 13000r/min for 20 minutes, removing the supernatant, pumping in a pumping machine, adding 200 mu L of LDEPC water for dissolving, and obtaining a RNA crude product with a silane protecting group at the 2' end removed, thereby finishing RNA deprotection.
In this comparative example, as compared with example 3, only "1000. Mu.L of the now-prepared RNA deprotection agent of example 1" was replaced with "1000. Mu.L of the now-prepared RNA deprotection agent of comparative example 1", and the other steps and parameters were the same.
Comparative example 4
An RNA deprotection agent for use in RNA deprotection comprising the steps of:
step one, synthesizing an RNA crude product: synthesizing RNA (the nucleotide sequence of the RNA is UAUAUAUAUAUAUAGAGAUAUAUAUAUAUAUA) by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, pumping for 20min after the RNA is pumped, and ensuring no ammonia smell;
adding 1000 mu L of the prepared RNA deprotection agent prepared in the comparative example 2 into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at a speed of 13000r/min for 20 minutes, removing the supernatant, pumping in a pumping machine, adding 200 mu L of LDEPC water for dissolving, and obtaining a crude RNA product with a silane protecting group at the 2' end removed, thereby finishing RNA deprotection.
In this comparative example, as compared with example 3, only "1000. Mu.L of the now-formulated RNA deprotection agent of example 1" was replaced with "1000. Mu.L of the now-formulated RNA deprotection agent of comparative example 2", and the other steps and parameters were the same.
The following performance tests were performed on examples 3-4 and comparative examples 3-4:
the degree of adenine removed and the purity of the crude RNA from which the 2' -terminal silane protecting group was removed were determined using an UltivorUHPLC-QQQ/MS liquid chromatograph-triple quadrupole tandem mass spectrometer (Agilent Co., USA):
chromatographic conditions: zorbaxeclipse EPlus C18 column (100 mm. Times.2.1 mm,1.8 μm, agilent company); the guard column was a C18 guard column (5.0 mm. Times.2.1 mm,1.8 μm, agilent Co.); column temperature is 30 ℃; the sample injection volume is 1 mu L; mobile phase A is 20mmol/L ammonium formate, mobile phase B is methanol; the flow rate is 0.3mL/min; gradient elution procedure: 0-2.0min,5% B;2.0-2.5min,5% -12% B;2.5-5.0min,12% B;5.0-5.5min,12% -100% B;5.5-8.0min,100% B;8.0-8.1min,100% -5% B;8.1-8.4min,5% B.
Mass spectrometry conditions: the capillary voltage is 4.0kV; the gas temperature is 350 ℃; the drying gas is nitrogen, and the flow rate is 10L/min; the atomizing gas was nitrogen at a pressure of 30psi (1 psi=6.89 kPa); ionization mode is electrospray ionization (ESI), positive ion mode; the ion detection mode is a multi-reaction monitoring (MRM) mode.
The test results are shown in Table 1.
TABLE 1
| Project | Example 3 | Example 4 | Comparative example 3 | Comparative example 4 |
| Purity of crude RNA/% | 70.8 | 71.4 | 65.8 | 58.2 |
| Depurination duty cycle/% | 1.1 | 1.2 | 4.6 | 5.2 |
As can be seen from Table 1, the crude RNA products of examples 3 to 4 of the present invention from which the 2 '-terminal silane protecting group was removed had higher purity and lower depurination degree than the crude RNA products of comparative examples 3 to 4 from which the 2' -terminal silane protecting group was removed.
It is noted that relational terms such as first and second, and the like are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Moreover, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (4)
1. The RNA deprotection agent is characterized by comprising the following components in parts by volume: 60 parts of 1-methyl-2-pyrrolidone, 30 parts of dimethylethanolamine hydrofluoric acid salt and 40 parts of dimethylethanolamine.
2. An RNA deprotection agent according to claim 1, wherein said dimethylethanolamine hydrofluoric acid salt is synthesized by:
adding dimethylethanolamine into a sealed reaction container, cooling the reaction container in an acetone dry ice bath for 10-20min, condensing and introducing anhydrous hydrogen fluoride, and heating the reaction container in an acetone dry ice bath for 10-15min at a heating rate of 0.5-1 ℃/min to 25+/-2 ℃ to obtain dimethylethanolamine hydrofluoric acid salt.
3. The RNA deprotection reagent of claim 1, wherein the mass ratio of dimethylethanolamine to anhydrous hydrogen fluoride is 42.5:87.5-100.
4. Use of an RNA deprotection agent according to any one of claims 1-3, characterized in that it is applied for RNA deprotection, comprising the steps of:
step one, synthesizing an RNA crude product: synthesizing RNA by adopting a solid-phase phosphoramidite triester method to obtain a crude RNA product;
step two, water bath ammonolysis: mashing the RNA crude product into a threaded pipe, adding 400 mu L of 50% methylamine water solution by mass fraction, carrying out ammonolysis in a water bath at 65 ℃ for 1.5 hours, cooling to 25+/-5 ℃, transferring to a filter pipe, centrifuging at 13000r/min for 2min, transferring the filtered RNA crude product to a centrifuge tube, placing in a pumping machine for pumping, and pumping for 20min after the RNA is pumped;
and step three, adding 1000 mu LRNA deprotection agent into the centrifuge tube after the pumping and drying in the step two, heating in a water bath at 65 ℃ for 3 hours, cooling to 25+/-5 ℃, adding 1000 mu L of n-butanol, standing at 4 ℃ for 1 hour, centrifuging at 13000r/min for 20 minutes, removing supernatant, pumping in a pumping machine, adding 200 mu LDEPC water for dissolution, and finishing RNA deprotection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310925922.2A CN117024497A (en) | 2023-07-26 | 2023-07-26 | RNA deprotection agent and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310925922.2A CN117024497A (en) | 2023-07-26 | 2023-07-26 | RNA deprotection agent and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117024497A true CN117024497A (en) | 2023-11-10 |
Family
ID=88642128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310925922.2A Pending CN117024497A (en) | 2023-07-26 | 2023-07-26 | RNA deprotection agent and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117024497A (en) |
-
2023
- 2023-07-26 CN CN202310925922.2A patent/CN117024497A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6111086A (en) | Orthoester protecting groups | |
| Bean et al. | Glyoxylate as a backbone linkage for a prebiotic ancestor of RNA | |
| EP4201949A1 (en) | Ammonolysis solution and ammonolysis method | |
| CN1302005C (en) | Process for preparation of thiophosphate oligonucleotides | |
| CA2741959C (en) | Sequencing of nucleic acid molecules by mass spectrometry | |
| EP3044228A2 (en) | Highly efficient synthesis of long rna using reverse direction approach | |
| JP4705716B2 (en) | Oligonucleotide deprotection | |
| JP2010248084A (en) | Method of synthesizing oligonucleotide using novel cleaning solvent | |
| JP2002536381A5 (en) | ||
| WO2012024776A1 (en) | Block synthesis of oligoribonucleotides | |
| CN117024497A (en) | RNA deprotection agent and application thereof | |
| Biscans et al. | A versatile post-synthetic method on a solid support for the synthesis of RNA containing reduction-responsive modifications | |
| Vasseur et al. | Derivatization of oligonucleotides through abasic site formation | |
| CN113621014A (en) | Ammonolysis pretreatment solution and ammonolysis method for solid-phase synthesis of DNA | |
| Wang et al. | Enzymatic and NMR analysis of oligoribonucleotides synthesized with 2′-tert-butyldimethylsilyl protected cyanoethlphosphoramidite monomers | |
| AU2020292763B2 (en) | Process for the preparation of oligonucleotides using modified oxidation protocol | |
| Guzaev et al. | A novel solid support for synthesis of 3′-phosphorylated chimeric oligonucleotides containing internucleosidic methyl phosphotriester and methylphosphonate linkages | |
| CN114425443A (en) | Oligonucleotide synthesis catalyst | |
| CN117843696A (en) | Oligonucleotide primer synthesis process | |
| Nelson et al. | 3′-Terminal modification of oligonucleotides using a universal solid support | |
| CN115850350A (en) | Ammonolysis solution and ammonolysis method | |
| Takaku et al. | 4-chlorophenyl 5-chloro-8-quinolyl phosphorotetrazolide: a highly efficient phosphorylating agent for oligoribonucleotide synthesis | |
| CN117362372A (en) | Ammonolysis deprotection process for nucleic acid production | |
| Su | Solid-Phase Synthesis of Boranophosphate/Phosphorothioate/Phosphate Chimeric Oligonucleotides, and Oligonucleotides Containing Phosphorothioate, and 2′-Amino-5′‑S‑phosphorothiolate Linkages | |
| US20080119563A1 (en) | Methods for rna desilylation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |