CN117004647A - Method for obtaining rice root tissue specific proteome based on proximity marking technology and application - Google Patents

Method for obtaining rice root tissue specific proteome based on proximity marking technology and application Download PDF

Info

Publication number
CN117004647A
CN117004647A CN202310764178.2A CN202310764178A CN117004647A CN 117004647 A CN117004647 A CN 117004647A CN 202310764178 A CN202310764178 A CN 202310764178A CN 117004647 A CN117004647 A CN 117004647A
Authority
CN
China
Prior art keywords
rice
tissue specific
root tissue
rice root
proximity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310764178.2A
Other languages
Chinese (zh)
Inventor
王智烨
胡赛燕
石静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202310764178.2A priority Critical patent/CN117004647A/en
Publication of CN117004647A publication Critical patent/CN117004647A/en
Pending legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/62—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating the ionisation of gases, e.g. aerosols; by investigating electric discharges, e.g. emission of cathode
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223—Vegetative tissue-specific promoters
    • C12N15/8227—Root-specific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6848—Methods of protein analysis involving mass spectrometry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/415—Assays involving biological materials from specific organisms or of a specific nature from plants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2570/00—Omics, e.g. proteomics, glycomics or lipidomics; Methods of analysis focusing on the entire complement of classes of biological molecules or subsets thereof, i.e. focusing on proteomes, glycomes or lipidomes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Nutrition Science (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Electrochemistry (AREA)
  • Food Science & Technology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The application discloses a method for obtaining rice root tissue specific proteome based on a proximity marking technology and application thereof. The application provides a useful proximity labeling technology for researching the rice root tissue specific proteome.

Description

Method for obtaining rice root tissue specific proteome based on proximity marking technology and application
Technical Field
The application belongs to the technical field of research on rice tissue specific proteomics, and particularly relates to a method for acquiring a rice root tissue specific proteome based on a proximity marking technology and application thereof.
Background
The root system is an important organ for fixing rice in soil and carrying out substance exchange and signal communication, and is also a main part of the rice in response to stress. Therefore, the research on the root system structure of the rice and the response mechanism to the stress can improve and enhance the nutrient absorption efficiency and the stress resistance of the rice, and is an important target for improving crops.
Proteins are fundamental units of life activities, and play a central role in different life processes. The change mechanism of the root system structure of the rice is mainly regulated and controlled by protein. Therefore, the proteome characterizing the root system of rice helps to further explore its function. The root system of rice is composed of several tissues of epidermis, cortex, endothelial layer, central column, root tip meristem and root crown. However, at present, no good method for separating and purifying tissue-specific cells of the root system exists, so that the tissue-specific proteome of the root system is difficult to analyze.
The proximity labeling technique has been widely used in various fields of biology as a novel technique for studying proteins. The principle is that adjacent marker enzyme is expressed in vivo to realize biotinylation of adjacent proteins and molecules, and streptavidin is utilized to enrich the biotinylated proteins, and then the identification and analysis are carried out by combining a mass spectrometry technology.
The application constructs a rice root tissue specific proximity marking system and researches a root tissue specific protein group. The method does not need to separate the tissue specific cells of the rice root system sample, overcomes the difficulty that the tissue specific cells of the rice root system sample are difficult to separate, and also avoids the problems of inter-tissue pollution and the like caused by the separation and purification steps. The application provides reference for research of rice tissue specific proteome, and has important significance for rice improvement.
Disclosure of Invention
This section is intended to outline some aspects of embodiments of the application and to briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section as well as in the description of the application and in the title of the application, which may not be used to limit the scope of the application.
As one aspect of the application, the application provides a method for obtaining a rice root tissue specific proteome based on a proximity marking technology, which comprises the following steps of: extracting rice genome DNA, amplifying an OsPHO1 promoter by taking the rice genome DNA as a template, amplifying a TurbolD gene fragment by taking a TurbolD synthetic sequence as the template, performing codon optimization on the TurbolD gene fragment, and constructing a pBl101.3-OsPHO1pro-TurbolD-eGFP vector by taking pBl101.3-eGFP as an initial vector; transforming the vector into agrobacterium EHA105 by a freeze thawing method; constructing a rice transgenic strain;
establishment of a proximity label experiment method: adding roots of rice seedlings into a biotin solution, vacuumizing, incubating, washing, grinding the roots of the rice seedlings subjected to biotin treatment in liquid nitrogen, adding the ground powder into a protein extraction buffer solution, uniformly mixing, incubating, performing ultrasonic treatment, adding nuclease for incubation, and performing affinity purification on the obtained extraction solution to obtain the rice root center column tissue specific proteome.
As a preferable scheme of the method for acquiring the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: the roots of the rice seedlings are added into a biotin solution, and the concentration of the biotin solution is 100-200 mu M; the biotin solution and the solvent are water.
As a preferred scheme of the method for obtaining the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: and after vacuumizing, incubating for 0.5-1 hour, wherein the incubation temperature is 30 ℃.
As a preferable scheme of the method for acquiring the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: the ultrasonic treatment is carried out by taking ultrasonic for 30s and closing ultrasonic for 90s as one cycle for 12 cycles.
As a preferable scheme of the method for acquiring the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: the added nuclease is incubated at 4 ℃ for 2 hours.
As a preferred scheme of the method for obtaining the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: and the codon optimization is carried out on the TurbolD gene fragment, and the sequence of the optimized TurbolD gene fragment is shown as SEQ ID NO: 1.
As a preferable scheme of the method for acquiring the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: the primer sequence of the OsPHO1 promoter amplified by taking rice genome DNA as a template is as follows:
an upstream primer: 5'-gccaagcttgcatgcctgcaggtcgaccgtcatccgtatttgagtcggtt-3'
A downstream primer: 5'-tggcacggtgttatccttcatggatcccttcttcttcttcttcttcctcgttg-3'.
As a preferred scheme of the method for obtaining the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: the TurboD gene fragment is amplified by taking a TurboD synthetic sequence as a template, and the primer sequence is as follows:
an upstream primer: 5'-cgcggatccatgaaggataacaccgtgccactc-3'
A downstream primer: 5'-cggggtaccacttctcagcagatctgagagagatttc-3'.
As a preferable scheme of the method for acquiring the rice root tissue specific proteome based on the proximity labeling technology, the application comprises the following steps: and after the uniform mixing, incubating for 10-20 min, wherein the incubation temperature is 4 ℃.
The application has the beneficial effects that: first, the rice root system is composed of a plurality of tissues such as epidermis, cortex, endothelial layer, center pillar, root tip meristem, root cap and the like, the structure and the function of each tissue are unique and complex, and the separation and purification of each tissue are difficult. The application obtains the rice root tissue specific proteome on the premise of not damaging the integrity of the root tissue, overcomes the problem that the root tissue specific cells are difficult to purify, and also avoids the pollution in the tissue specific cell purification process. Secondly, constructing a Trubold vector specifically expressed by a root center column tissue, transferring the Trubold vector into a rice material, and identifying and obtaining a stable genetic strain OsPHO1pro-TurbolD-eGFP, wherein the in vivo adjacent marker system is proved to not influence the normal growth and development of the rice. Third, the present application determines the optimal biotin treatment conditions for rice root material, i.e., optimizes biotin treatment concentration, incubation temperature and time, and ATP concentration, and improves the affinity purification process of biotinylated proteins. The enriched protein is identified by mass spectrometry technology, and the construction of a rice root tissue proximity marker experimental system is proved to be successful.
The application establishes and optimizes a rice root tissue specific proximity marker system, and successfully obtains a center column tissue specific expression proteome by constructing an OsPHO1pro-TurbolD-eGFP material of the root center column specific expression. The application provides a useful proximity labeling technology for researching the rice root tissue specific proteome.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings that are needed in the description of the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art. Wherein:
FIG. 1 shows the optimal codon usage frequency for the TurbolD original sequence (left) and the optimized sequence (right).
FIG. 2 shows GC content of the TurbolD original sequence (left) and the optimized sequence (right).
FIG. 3 is a schematic diagram of pBl101.3-OsPHO1pro-TurbolD-eGFP vector.
FIG. 4 shows the predicted structure of a TurbolD-eGFP fusion expression protein.
FIG. 5 shows the PCR identification results of transgenic lines.
FIG. 6 shows the result of Western Blot identification of transgenic lines.
FIG. 7 shows the fluorescence observation result of OsPHO1 pro-TurbolD-eGFP#14GFP.
FIG. 8 shows the growth status of OsPHO1pro-TurbolD-eGFP compared with that of Nip.
FIG. 9 shows the results of biotin treatment.
FIG. 10 shows the effect of ATP concentration on the labelling reaction.
FIG. 11 is a graph showing the effect of different numbers of ultrasound cycles and nuclease incubation times on protein extraction efficiency.
FIG. 12 shows affinity purification efficiency.
FIG. 13 is a mass spectrum basal peak diagram.
Fig. 14 is an inter-group wien plot analysis.
FIG. 15 is a middle column expressed aquaporin OsPIP1;2.
fig. 16 is a GO analysis.
Detailed Description
In order that the above-recited objects, features and advantages of the present application will become more apparent, a more particular description of the application will be rendered by reference to specific embodiments thereof.
Example 1: construction of rice root center column specific expression vector and stable genetic strain
Plant material: the wild rice variety used in this experiment was japonica rice Nipponbare (Oryza sativa L. Ssp. Japonica Nipponbare). And (3) a carrier: pBl101.3-eGFP. Tool enzyme: high fidelity enzyme KOD Plus Neo (Toyobo); restriction enzymes BamHI, kpnl (Thermo Scientific); homologous recombination enzymes (NEB); PCR MiX (ABclonal). And (3) strain: coli DH 5. Alpha. And Agrobacterium EHA105 (stored in laboratory).
Culturing rice: setting environmental parameters of a rice artificial climate chamber: temperature: 30 ℃ in the daytime and 22 ℃ at night; relative humidity: 60 percent; illumination period: 7:00-19:00 illumination; darkness is 19:00-7:00 the next day; illumination intensity: 250-300 mu molm -2 S -1 。
Breaking dormancy and germination of seeds: soaking the dried rice seeds in a proper amount of 1% dilute nitric acid solution, standing at room temperature for 16-18h to break dormancy of the seeds, pouring out dilute nitric acid, washing with pure water once, soaking the seeds in a proper amount of pure water, placing in a 37 ℃ incubator, and culturing in darkness for 2-3 days until the seeds are exposed to white, wherein water is changed every 12 h.
Extracting rice genome DNA.
OsPHO7 promoter and TurbolD fragment (Branon et al, 2018) amplification:
DNA extracted by Plant DNAZol method is used as a template to amplify an OsPHO1 promoter in a rice genome, and a TurboD synthetic sequence is used as a template to amplify a TurboD fragment.
The primers were designed with reference to Primer 3, the sequences were as follows (5 '-3'):
OsPHO1pro-F：gccaagcttgcatgcctgcaggtcgaccgtcatccgtatttgagtcggtt
OsPHO1pro-R：tggcacggtgttatccttcatggatcccttcttcttcttcttcttcctcgttg
TurbolD-F：cgcggatccatgaaggataacaccgtgccactc
TurbolD-R：cggggtaccacttctcagcagatctgagagagatttc
PCR amplification system:
agarose gel electrophoresis and recovery (Northey product purification kit DC 301-01).
Construction of pBI101.3-TurbolD-eGFP vector:
the pBI101.3-eGFP vector and the TurbolD fragment were digested separately.
And (3) enzyme cutting system:
reagent(s) Volume 20. Mu.l
10x FastDigest Green Buffer 2μl
pBl101.3-eGFP plasmid/TurbolD fragment 0.5-1 μg each
BamHI/Kpnl 0.2 μl each
ddH 2 O Supplement to 20. Mu.l
And (5) recovering enzyme cutting products.
The connection system is as follows:
reagent(s) Volume 10. Mu.l
10x Ligase Buffer 1μl
Turbold fragment 0.3pmol
pBI101.3-eGFP vector 0.03pmol
T4DNA ligase 1μl
ddH 2 O Supplement to 10. Mu.l
The reaction was carried out at 16℃overnight.
Transformation of E.coli DH 5. Alpha:
melting Escherichia coli DH5 alpha competent cells stored at-80deg.C on ice, adding 5 μl of the ligation product, gently stirring, standing on ice for 30min, heat-shock for 90s at 42deg.C, rapidly standing on ice for 2min, adding 500 μl of non-antibiotic LB liquid medium, shake culturing at 37deg.C for 1 hr, centrifuging at 150rpm and 4000rpm for 1min, coating 50-100 μl of the resuspension bacteria liquid on kanamycin-resistant solid medium, and culturing in a 37 deg.C incubator for 12-16 hr.
Positive single colony verification:
the monoclonal colonies were picked up and dissolved in 20. Mu.l ddH 2 Colony PCR was performed in O.
TurbolD-870F：agaggcatcgataagcaggg
eGFP-141R：gaacttcagggtcagcttgc
The PCR product is verified by agarose gel electrophoresis, positive monoclonal colony is selected for amplification culture, plasmid is extracted for enzyme digestion verification and sequencing identification, and 50% glycerol is added and frozen at-80 ℃.
Construction of pBl101.3-OsPHO1pro-TurbolD-eGFP vector:
the constructed pBI101.3-TurbolD-eGFP vector is subjected to enzyme digestion and linearization, and then a target vector is constructed by a homologous recombination method.
The reaction system:
the reaction was carried out at 50℃for 30min.
The connection product is transformed into DH5 alpha competence of the escherichia coli, monoclonal bacterial colony is selected for PCR, enzyme digestion verification and sequencing, and the strain is preserved.
Transformation of Agrobacterium EHA105 by freeze thawing: the agrobacteria EHA105 stored at-80 ℃ is placed on ice for melting, 1 μl plasmid is added and gently blown and mixed uniformly, the mixture is placed on ice for 30min, frozen by liquid nitrogen for 5min, transferred to 37 ℃ water bath for 10min, taken out and placed on ice for 2min, 500 μl of non-anti-LB or YEP liquid medium is added, shake cultivation is carried out for 2h at 28 ℃, the rotation speed is 200rpm, 100 μl of bacterial liquid is absorbed and coated on solid medium containing kanamycin and streptomycin double-antibody, inversion cultivation is carried out for 2 days in a 28 ℃ incubator, positive clones are identified by colony PCR, and bacterial strain is stored at-80 ℃.
Construction of rice transgenic lines:
induction of callus: taking mature seeds, manually or mechanically dehulling, selecting full, smooth and sterile-spot seeds, placing the seeds into a 50ml sterilizing centrifuge tube, sterilizing with 70% alcohol for 2min, adding 30ml 30% sodium hypochlorite solution, soaking for 30min, cleaning with sterilized water for 4-5 times, and finally soaking for 30min. Spreading the sterilized seeds on sterilized filter paper, sucking to dry, placing the seeds into an induction culture medium with forceps for burning and sterilizing, sealing the culture dishes with air-permeable adhesive, and culturing at 28deg.C under illumination for 3 weeks.
And (3) subculture: the pale yellow callus with good growth state and compact sphere shape is picked and put into a secondary culture medium for illumination culture at 28 ℃ for 7-10 days.
Agrobacterium activation and co-cultivation: about 50. Mu.l of the stored Agrobacterium solution was added to 20ml of YEP culture solution, and the culture was performed at 28℃and 250rpm for 12-24 hours with the highest transformation efficiency when the OD600 of the solution was about 0.6. Centrifuging the bacterial liquid at 4 ℃ and 4000rmp for 10min, discarding the supernatant, adding 40ml of AAM bacteria sensing liquid, uniformly mixing for 40min on a horizontal shaking table to prepare suspension, and activating agrobacterium. About 100 pale yellow calli with good growth state and uniform size are selected, put into agrobacterium suspension and are incubated on a horizontal shaker for infection for 10min. Placing the callus on sterilized filter paper, draining for 30-40min, transferring to co-culture medium laid with a layer of filter paper, and culturing at 28deg.C for 2.5-3 days.
Selection and culture: taking out the co-cultured callus, placing the co-cultured callus into a sterilized 50ml centrifuge tube, adding 40ml of sterilized water for washing for 5-6 times, adding 40 μl of Carb mother liquor during the last washing, washing for 30min by a horizontal shaking table, taking out the callus, placing the callus on sterilized filter paper, draining for 1.5h, transferring into a first round of selection medium, culturing at 28 ℃ for 14 days in about 30 pieces per dish under illumination. The calli from the first selection round were transferred to the second selection round medium, and each dish was incubated at 28℃for 14 days with light.
Differentiation: transferring the callus after the first round of selection into a differentiation medium, placing 4 strains in 1 pot, waiting for the callus to differentiate into seedlings in a constant temperature culture room at 28 ℃ for about 35 days, taking out the seedlings from the differentiation pot, hardening the seedlings in a greenhouse for about 3 days, culturing in a rice nutrient solution for 1-2 weeks, and verifying positive seedlings by using PCR and Western Blot.
Experimental results:
turbo d codon optimization:
in order to make TurboD express better in rice, it is necessary to codon optimize the TurboD sequence,
FIG. 1 is the optimal codon usage frequency for the TurbolD original sequence (left) and the optimized sequence (right), with the abscissa being the grouping of codon usage frequencies and the ordinate being the percentage of codons. The codon usage frequency of the optimized sequence in rice is increased. The codon adaptation index (CAl) is a result of evaluating codon optimization, and the closer the CAI value is to 1, the higher the expression of the foreign gene in the host cell is. For highly expressed genes, CAI greater than 0.8 is considered to be easily expressed in the host cell, with an optimized CAI value of 0.81. FIG. 2 shows GC contents of the TurbolD original sequence (left) and the optimized sequence (right), wherein the abscissa shows codon distribution positions, the ordinate shows GC contents, the GC contents in the sequences also influence the expression efficiency of the exogenous genes in the host cells, the average GC content of the optimized sequence is reduced from 57.13% to 49.81%, and the optimized sequence is easier to express in the host cells.
The optimized TurbolD sequence is (SEQ ID NO: 1):
atgaaggataacaccgtgccactcaagttgatcgctctccttgccaacggagagttccactctggtgaacagttgggagaaacactcggcatgtctagagccgctatcaataagcatatccagacattgagggattggggtgtcgatgtgttcactgtccctggaaagggctactctctcccagagccaattccgctcttgaacgctaagcagattcttggtcagctcgatggtggatcagttgctgtcctcccagttgtggattcaaccaaccagtacctcttggatagaattggagagcttaagtcaggcgatgcttgcatcgctgagtatcagcaagctggaagaggttcaaggggaagaaagtggttttctcctttcggtgccaatctctacttgtctatgttctggagactcaagagaggcccagccgctattggccttggtccagttatcggcattgtgatggctgaggccttgaggaagctcggtgctgataaggtcagggttaagtggcctaacgatctttacctccaagataggaagcttgctggaattctcgtggagcttgctggtatcacaggcgatgccgctcaaatcgtgatcggagctggtatcaatgtcgctatgagaagggttgaggaatcagtggttaaccagggttggatcacccttcaggaggctggaattaacctcgatagaaatactcttgctgccacactcattagggaactcagagccgctttggagctctttgaacaagagggtcttgctccgtatctccctagatgggagaagctcgataacttcattaacagacctgtgaagcttattatcggagataaggagatcttcggcatctctagaggcatcgataagcagggtgctcttttgctcgagcaggatggtgttatcaagccatggatgggaggtgaaatctctctcagatctgctgagaag
pBl101.3-OsPHO1pro-TurbolD-eGFP vector map: through two rounds of connection reaction and sequencing verification, an in-vivo adjacent marker expression vector which takes a pBl101.3 vector as a framework, takes a sequence of about 2500bp upstream of an OsPHO1 gene as a promoter and fusion expresses a TurdolD-eGFP protein is constructed, the sequence is shown in figure 3, and in figure 3, kan: kanamycin resistance gene, G418: genetic mycin resistance gene.
Uploading the sequence of the TurboID-eGFP fusion expression protein to a Robetta website for structure prediction, and marking the predicted structure by using PyMOL software. As a result, as shown in FIG. 4, the left side is TurbolD protein, in which the black part is the N-terminal, the yellow part is the biotin-binding domain, and the red part is the ATP-binding domain, which constitute the reaction center, contributing to the synthesis of biotin-5' -AMP. The right side is fusion expressed eGFP, and the biotin labeling activity of the turbo ID protein is not affected in steric hindrance.
Transgenic T0 generation positive strain verification:
agarose gel electrophoresis results: FIG. 5 shows the results of PCR identification of transgenic lines, N represents wild type Nippon, and the numbers above the bands represent different T0 transgenic lines as negative controls (hereinafter). The size of the target fragment obtained by amplification according to the OsPHO1pro-616F and TurbolD-R primers is about 1600bp. As shown in FIG. 5, the PCR result proves that 14 out of the 23 transgenic T0 seedlings are transgenic positive rice seedlings integrated with the vector.
Western Blot results: the positive lines with clear bands in the electrophoresis result are subjected to Western Blot experiments again for verifying the expression condition of the TurbolD-eGFP fusion protein, and the result is shown in FIG. 6. FIG. 6 shows the result of Western Blot identification of transgenic lines, IB: GFP represents lmmunoblottin, i.e.immunoblotting with Anti-GFP as primary antibody, and the arrow indicates the band position of the TurbolD-eGFP fusion protein, ponceau is Ponceau stained as control. The size of the turbo D-eGFP fusion protein was predicted to be about 62.6kDa by SnapGene software. Firstly, the turbo D-eGFP fusion protein can be detected in most of the detected transgenic lines; secondly, under the condition that the loading amounts are relatively consistent, the band of the No. 14 strain is relatively bright, which indicates that the expression amount of the fusion protein is relatively high.
GFP fluorescence observations: the roots of line 14 were taken out of the above results, and GFP fluorescence was observed using a laser confocal microscope (LSM 710 nlo). GFP emits at a wavelength around 510nm and appears blue-green in lambda mode. As shown in FIG. 7, the center column of the young rice root appears bluish green, which is a true signal, while the cortex is a bluish green false signal. The fluorescence result shows that the TurbolD-eGFP is specifically expressed in the rice young root center tissue. The result is also consistent with the expression site of the OsPHO7 gene, which shows that the Trubold-eGFP driven by the constructed OsPHO1 promoter can be specifically expressed in root center column tissue without subcellular localization specificity. FIG. 7 shows the results of OsPHO1pro-TurbolD-eGFP#14GFP fluorescence, GFP fluorescence (left), bright (middle), merge (right), arrows indicating the center column.
Growth phenotype of transgenic lines: to further confirm whether exogenous transfer into TurbolD affects normal growth of rice, we performed phenotypic observations on transgenic rice. FIG. 8 shows that after 20 days of normal culture, nip was grown in a similar manner to OsPHO1pro-TurbolD-eGFP#14. Compared with wild Nip, the transgenic rice has no obvious difference in root length and plant height, and the leaf shape and root structure are normal. This suggests that the in vivo introduction of the proximity marker system does not affect the normal growth and development of rice. FIG. 8 shows the growth status of OsPHO1pro-TurbolD-eGFP compared with that of Nip, A: growth phenotype, B: quantitative comparison of plant height and root length (20 plants in one group, no significant difference).
In conclusion, through multiple identification, osPHO1pro-TurbolD-eGFP#14 is a transgenic positive strain, has good growth and development states, has no phenotype difference with Nip, and can be used for a large number of seed reproduction for subsequent experiments.
Example 2: establishment of proximity marker experimental method
Cleaning root of rice seedling about 20 days with pure water, wiping with paper towel, cutting into segments about 1cm, placing into 50ml centrifuge tube, adding 40ml biotin reaction solution with concentration of 100 μm or 200 μm, placing into vacuum pump, vacuumizing for 10min at 12psi, transferring into 30 deg.C constant temperature shaker at 120rpm, incubating for 0.5 hr or 1 hr, pouring out reaction solution, adding ice-cold pure water to wash off excessive reaction solution and stopping reaction, wiping with paper towel, packaging with tinfoil paper, grinding in liquid nitrogen, and performing affinity purification experiment on the ground powder. The ground powder was added to 2ml of protein extraction buffer, the mixture was transferred to a 2ml centrifuge tube after being stirred and mixed with a pipette, incubated for 10min at 4℃and the homogenate was dispensed into 1.5ml tubes dedicated to ultrasound, 300. Mu.l each tube, the switching parameters of ultrasound were set at 30 sOn/90 sOff (from Digenode Corp., model Biorupter Pico) for 12 cycles, and after the ultrasound was completed, 0.5. Mu.l nuclease was added and incubated for 2h at 4 ℃.
Then affinity purification is carried out according to a conventional method, specifically: centrifuging at 15000rpm for 15min at 4 ℃, transferring the supernatant to a pretreated Zaba desalting centrifugal column, taking 50 μl of supernatant, labeled Extract, precipitating labeled Pellet, slowly adding less than or equal to 2.5ml of supernatant to the compacted resin center with a pipette gun, adding about 200 μl of equilibration Buffer hydraulic layer, sleeving the column in a new 15ml centrifuge tube, centrifuging at 1000rpm for 2min at 4 ℃, collecting desalted sample, taking 50 μl of sample, labeled After Zaba, adding 30 μl of pretreated Anti-GFPBeads (ABCIonal), simultaneously adding a volume of PMSF and Complete Proteasome Inhibitor, allowing the final concentration to be 1×, incubating the centrifuge tube containing sample and Anti-GFP beans on a Rotor for 2h at 4 ℃, placing on a magnetic frame, allowing Anti-GFP beans to fully adsorb at 50 μl of supernatant labeled After GFP, adding the rest supernatant to a centrifuge tube containing Streptavidin Beads (Dynabe C1 and 35 h, simultaneously allowing the supernatant to be added to be completely adsorbed at 35 h, and allowing the supernatant to be completely adsorbed at 35 h by a centrifuge tube, simultaneously adding 50 μl of 50% of 50-GFP to be completely adsorbed at 35, and simultaneously allowing the centrifuge tube to be completely adsorbed at 35 h, allowing the final concentration to be removed to be kept overnight: pre-cooling the extraction buffer for 2 times; precooling 1M KCl,1 time; precooled 1mM Na 2 CO 3 1 time; 2M Urea at normal temperature, 1 time; pre-chilled equilibration buffer, 2 passes. Str loads were then stored at-80 ℃. TC (TC)The Beads were eluted by A precipitation.
Fig. 9 shows biotin treatment results, which show native biotinylated proteins, and arrows show TurboID-eGFP self-biotinylation. SA and GFP represent respectively the immunoblots with streptavidin and Anti-GFP as primary antibodies, ponceau was Ponceau stained as a loading control (same applies below). As shown by the Western Blot results in FIG. 9, osPHO1pro-TurbolD-eGFP transgenic material was more sensitive to biotin treatment than wild type Nip material. Under biotin treatment, the biotin signal of the whole lane of the OsPHO1pro-TurbolD-eGFP transgenic material became strong, but the wild-type Nip did not appear similar. The presence of endogenous biotin and biotin enzymes in rice also allows detection of biotinylated proteins without exogenous application of biotin. Furthermore, the longer the incubation time, the more biotinylated protein, the stronger the proximity label reaction, indicating that the proximity label reaction is the strongest when 100 μm biotin is incubated for 1h, the optimal treatment conditions.
Further, ATP at concentrations of 0,0.25mm,0.5mm,1mm,2.5mm,5mm, and the like were added to the biotin reaction solution, respectively, and Western Blot was performed under the same conditions as described above, and fig. 10 shows the effect of ATP concentration on the labeling reaction. In FIG. 10, whether biotin treatment is present and whether the exogenous application of ATP has no significant effect on biotinylation of the protein in wild-type Nip; however, in the OsPHO1pro-TurbolD-eGFP transgenic line, the proximity marker strength increased with increasing ATP concentration, and saturation was reached at an ATP concentration of 1 mM. Therefore, a 1mM ATP solution can be added to the biotin reaction solution as a suitable treatment condition.
To obtain as much biotinylated protein as possible in the supernatant, we further treated the crude rice root tissue extract with sonication techniques and digested the DNA and RNA in the cells with nucleases. For this reason, we optimized the cycle number of ultrasound disruption and the incubation time of nuclease, determined the appropriate conditions according to the Western Blot results, fig. 11 is the effect of different ultrasound cycle numbers and the incubation time of nuclease on protein extraction efficiency, we tried 6, 9 and 12 ultrasound disruption cycle numbers, and 1h and 2h of incubation time of nuclease, determined the optimal ultrasound cycle numbers and nuclease incubation time by comparing the protein content in Extract and Pellet, compared with the result of incubation for 1h, the higher Histone content in the protein Extract after 2h incubation, indicating that more protein bound to nucleic acid was extracted; whereas at a cycle number of 12, more biotinylated proteins were extracted from the cytoplasm. Therefore, incubation with 12 cycles of sonication and 2h nuclease was optimal.
Example 3: proximity label affinity purification mass spectrometry results
Plant material: japonica rice Nipponbare (Oryza sativa L. Ssp. Japonica arNipponbare); transgenic material OsPHO1pro-TurbolD-eGFP#14 with Japanese sunny background.
FIG. 12 shows affinity purification efficiency, pellet: precipitation, extract: extracting solution, after Zaba: desalted samples, super. Supernatant after Str Beads binding, eliate: eluted samples (same applies below). The right panel shows the result after the left panel is subjected to strong exposure. From the results of fig. 12, it is shown that, first, comparing Pellet with Extract, the content of biotinylated protein in the precipitate is small, and most of the protein is dissolved in the extraction buffer. Comparison of the supernatant (super) from which streptavidin Beads were incubated with the magnetoglobin Eluate (eliate) indicated that the biotinylated proteins were substantially all enriched by Str Beads and eluted. The results show that the biotinylated protein can be better extracted and enriched, and an affinity purification experimental system is successfully established.
Mass spectrometry identification results: to further verify whether tissue specific promoter driven TurbolD can identify tissue specific proteomes, we performed mass spectrometry on affinity purified proteins. Two samples of biotin-treated wild-type Nip sample (Nip biotin) and OsPHO1pro-TurbolD-eGFP sample (OsPHO 1pro-TurbolD-eGFP biotin) were selected for mass spectrometry. The base peaks obtained by mass spectrum are shown in figure 13, the maximum intensity values of the two samples are 8.40E9 and 8.92E9 respectively, the two samples belong to the normal response range, and the 9 th power of E indicates that the sample concentration is good; the absence of tailing in the mass spectrum peak diagram indicates that the enzymolysis of the sample is normal; the peak multiple signal intensities indicate high sample complexity. FIG. 13 is a mass spectrum basal peak diagram, nip biotin treatment (upper), osPHO1pro-TurbolD-eGFP biotin treatment (lower). The abscissa is the sample elution time, the label on each cluster peak is the corresponding exact retention time, and the ordinate is the corresponding relative intensity value.
Analysis of mass spectrometry results: the number of peptide fragments and the number of proteins in the mass spectrum results are shown in Table 1.
TABLE 1 number of peptide fragments and protein number in Mass Spectrometry results
Sample name Number of peptide fragments Protein quantity (number)
Nip biotin processing 3326 1038
OsPHO1pro-TurbolD-eGFP biotin treatment 3409 1003
Fig. 14 is an inter-group wien plot analysis. As shown in FIG. 14, the protein components identified between two samples, osPHO1pro-TurbolD-eGFP biotin and Nip bluetooth, were mostly different, with only about 20% of the same protein. The results show that rice material with a center column specific proximity marker system is specifically enriched to a different protein than the control, indicating that our tissue specific proximity marker system can identify tissue specific proteins.
TABLE 2 column-localized protein peptide fragments only in the OsPHO1pro-TurbolD-eGFP biotin column-enriched fraction
Protein name Total number of peptide fragments Number of unique peptide fragments
OsTUBB4 17 15
OsTUBB7 16 14
OsROMT9 6 6
OsPIP2；2 2 2
OsTIP1；1 2 1
OsVLN3 2 2
TABLE 3 center pillar localization protein peptide fragment in more enriched portion of OsPHO1pro-TurbolD-eGFP biotin center pillar
Subsequently, we found known proteins expressed in the middle column in the protein enriched in the strain in which OsPHO1pro-TurbolD-eGFP biotin was column-specifically expressed in the adjacent marker system. FIG. 15 is a middle column expressed aquaporin OsPIP1;2, as shown in fig. 15, the results from single cell sequencing database (plantascrnadb, chen et al, 2021) show that aquaporin OsPIP1;2 has higher expression in the center column tissue of rice roots. Also, many proteins specifically expressed in the center column were captured (Table 2), such as aquaporin OsTIP1; 1. tubulin OsTUBB4/7, flavonoid methyltransferase OsROMT9, and calcium-dependent binding protein OsVLN3, etc. In addition, compared with Nip biotin, the partial center column expressed proteins were more enriched in OsPHO1pro-TurbolD-eGFP biotin material (table 3), such as sucrose synthase SUS1/2, fructokinase OsFRK2, and cinnamic acid oxygenase OsC4 HL. This result demonstrates that our method can identify tissue specific proteins.
We further performed GO analysis on proteins identified by mass spectrometry of both samples. The results in FIG. 16 show that there are fewer proteins enriched to GO annotation in the Nip biotin sample, only 325, accounting for 31.2% of the total protein. The result shows that the protein identified by the Nip biotin sample has high randomness and is non-specific enrichment, and the enriched related biological pathway has no obvious specificity. However, in contrast to the Nip biotin control sample, the OsPHO1pro-TurbolD-eGFP biotin sample was annotated with GO for a large portion of 770 specific proteins. The GO results indicate that these enriched proteins are involved in various molecular functions, biological pathways and subcellular localization. FIG. 16 shows GO analysis, nlp biotin treated (upper), osPHO1pro-TurbolD-eGFP biotin treated enriched protein (lower). MF: molecular Function, molecular function; BP: biological Process, biological processes; CC: cell Component, cell fraction. FIG. 16 shows that the protein specifically enriched in OsPHO1 pro-TurbolD-eGFPbritin samples is involved in functions such as protein folding partners, translation factor activity, purine nucleotide binding activity and RNA helicity activity; biological processes involving translation, ATP metabolism, ribosome assembly, organic nitrogen compound biosynthesis, golgi-mediated vesicle transport, and the like; relates to the localization of different subcellular components such as cytoplasm, ribosome, microtubule, vacuole, membraneless organelle, and plasmodesmata. The result shows that most of the enriched proteins have specific functions or biological pathways, which implies strong enrichment specificity; and the resulting GO annotation types are also numerous, indicating that the proximity marker system is able to enrich for more functionally distinct proteins in rice.
The comprehensive mass spectrum peak diagram, comparison with published single cell sequencing results and GO analysis results show that the center column specific proximity marker system constructed by the experiment can actually capture the protein specifically expressed by the center column, and can be used for analysis of tissue specific proteome.
It should be noted that the above embodiments are only for illustrating the technical solution of the present application and not for limiting the same, and although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present application may be modified or substituted without departing from the spirit and scope of the technical solution of the present application, which is intended to be covered in the scope of the claims of the present application.

Claims (10)

1. A method for obtaining a rice root tissue specific proteome based on a proximity marking technology is characterized by comprising the following steps: comprising the steps of (a) a step of,
construction of rice root center column specific expression vector and stable genetic strain: extracting rice genome DNA, amplifying an OsPHO1 promoter by taking the rice genome DNA as a template, amplifying a TurboID gene fragment by taking a TurboID synthetic sequence as the template, performing codon optimization on the TurboID gene fragment, and constructing a pBI101.3-OsPHO1pro-TurboID-eGFP vector by taking pBl101.3-eGFP as an initial vector; transforming the vector into agrobacterium EHA105 by a freeze thawing method and constructing a rice transgenic strain;
obtaining rice root tissue specific proteome by proximity labeling: adding roots of rice seedlings into a biotin solution, vacuumizing, incubating, washing, grinding the roots of the rice seedlings subjected to biotin treatment in liquid nitrogen, adding the ground powder into a protein extraction buffer solution, uniformly mixing, incubating, performing ultrasonic treatment, adding nuclease for incubation, and performing affinity purification on the obtained extraction solution to obtain the rice root center column tissue specific proteome.
2. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1, wherein: the roots of the rice seedlings are added into a biotin solution, and the concentration of the biotin solution is 100-200 mu M; the biotin solution and the solvent are water.
3. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: and after vacuumizing, incubating for 0.5-1 hour, wherein the incubation temperature is 30 ℃.
4. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: the ultrasonic treatment is carried out by taking ultrasonic for 30s and closing ultrasonic for 90s as one cycle for 12 cycles.
5. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: the added nuclease is incubated at 4 ℃ for 2 hours.
6. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: and the codon optimization is carried out on the turboID gene fragment, and the sequence of the optimized turboID gene fragment is shown as SEQ ID NO: 1.
7. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: the primer sequence of the OsPHO7 promoter amplified by taking rice genome DNA as a template is as follows:
an upstream primer: 5'-gccaagcttgcatgcctgcaggtcgaccgtcatccgtatttgagtcggtt-3'
A downstream primer: 5'-tggcacggtgttatccttcatggatcccttcttcttcttcttcttcctcgttg-3'.
8. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: the TurboID gene fragment is amplified by taking the TurboID synthetic sequence as a template, and the primer sequence is as follows:
an upstream primer: 5'-cgcggatccatgaaggataacaccgtgccactc-3'
A downstream primer: 5'-cggggtaccacttctcagcagatctgagagagatttc-3'.
9. The method for obtaining rice root tissue specific proteome based on the proximity labeling technique according to claim 1 or 2, wherein: and after the uniform mixing, incubating for 10-20 min, wherein the incubation temperature is 4 ℃.
10. Use of the method of claim 1 for obtaining a rice root tissue specific proteome.
CN202310764178.2A 2023-06-27 2023-06-27 Method for obtaining rice root tissue specific proteome based on proximity marking technology and application Pending CN117004647A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310764178.2A CN117004647A (en) 2023-06-27 2023-06-27 Method for obtaining rice root tissue specific proteome based on proximity marking technology and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310764178.2A CN117004647A (en) 2023-06-27 2023-06-27 Method for obtaining rice root tissue specific proteome based on proximity marking technology and application

Publications (1)

Publication Number Publication Date
CN117004647A true CN117004647A (en) 2023-11-07

Family

ID=88560969

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310764178.2A Pending CN117004647A (en) 2023-06-27 2023-06-27 Method for obtaining rice root tissue specific proteome based on proximity marking technology and application

Country Status (1)

Country Link
CN (1) CN117004647A (en)

Similar Documents

Publication Publication Date Title
CN108623665A (en) Application of the GhHUB2 albumen in regulation and control cotton fiber length and intensity
CN110144004A (en) The application of Gmpplcyp8 albumen and its relevant biological material in regulation plant nitrogen fixing capacity
CN115058449A (en) Method for improving citrus canker resistance by CsWRKY43 interference
CN105566463A (en) Chlorophyll synthesis related protein, coding gene and application thereof
CN111543307A (en) Identification method for gene editing efficiency of Chinese cabbage or broccoli CRISPR-Cas9 gene editing system
CN103172717B (en) Plant low potassium stress resistant related protein GmWRKY50 as well as encoding gene and application thereof
CN117004647A (en) Method for obtaining rice root tissue specific proteome based on proximity marking technology and application
CN116083445A (en) CrBZR1 gene and application thereof
CN104805093B (en) Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants
CN107937358A (en) A kind of GAP-associated protein GAP TaPaO1 for inducing plant pollen abortion and its encoding gene and application
CN114480486A (en) Screening method and application of plant antiviral RNA silencing related transcription factors
CN114149993B (en) lncRNA for regulating and controlling content of soluble sugar in plants and application thereof
CN111500623B (en) Method for improving agrobacterium-mediated plant genetic transformation efficiency
CN112724215B (en) Gene and method for changing flowering period of corn
CN103834624B (en) The cold-resistant associated protein GST of plant and encoding gene thereof are applied with it
CN108192919A (en) A kind of method for cultivating drought resisting transgene cotton
WO2022078049A1 (en) Modified plant endosperm specific promoter and use thereof
WO2015196874A1 (en) Cotton plant event ac20-3 and primer and method for the detection thereof
CN117700510A (en) Application of TaPIF2 gene in regulation and control of wheat plant type
CN117866063A (en) Application of TaPIF3 gene in regulation and control of wheat plant type
Wang et al. Establishment of genetic transformation system of peach callus
CN117964727A (en) Application of TaPIF gene in regulation and control of wheat plant type
CN117700509A (en) Application of TaPIF5 gene in regulation and control of wheat plant type
CN104497111B (en) A kind of wheat richness proline albuminoid Tazmh122 and its encoding gene and application
CN115747227A (en) Tobacco NtGA3ox1 gene and application thereof in regulating and controlling epidermal glandular hair density

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination