CN117004584A - Lavender BAHD acyltransferase gene and application thereof in preparation of linalyl acetate - Google Patents

Abstract

The application relates to a lavender BAHD acyltransferase gene, a coded protein and application thereof in preparing linalyl acetate. The LaBAHD57 gene is cloned from Lavandula angustifolia 'Jinglave No. 2' glandula fudge for the first time, is a key enzyme gene for biosynthesis of ester compound linalyl acetate, and is an important gene for catalyzing and generating linalyl acetate which is first discovered in plants. Experiments prove that: the LaBAHD57 protein can catalyze Linalool (Linalool) to form Linalyl acetate, and has important theoretical and practical significance for synthesis research of Linalyl acetate in lavender, improvement, enrichment and perfection of quality of lavender essential oil, and physiological and ecological effects of ester compounds on plants.

Description

Lavender BAHD acyltransferase gene and application thereof in preparation of linalyl acetate

Technical Field

The application relates to the technical fields of plant molecular biology and genetic engineering, in particular to lavender LaBAHD57 acyltransferase protein, a coding gene and application thereof.

Background

Lavender (Lavandula angustifolia Mill.) is a perennial sub-shrub of Lavandula (Lavandula) of Labiatae, and contains about 39 species, 24 wild species, 16 hybrid species, and more than 400 species. The essential oil is mainly produced from Lavandula angustifolia (L.angustifolia), lavandula latifolia (L.latifolia) and natural hybrid Lavandula angustifolia (L.x. Inter media) of Lavandula angustifolia, wherein the essential oil of Lavandula angustifolia is the best. The essential oil extracted from Lavender has aromatic smell, is commonly used as raw material for aromatic, insect repellent and essence, and has effects of tranquilizing, hypnotizing, antiinflammatory, antioxidant, reducing blood lipid and blood pressure, resisting and inhibiting bacteria, relieving spasm, inhibiting tumor, and attracting/repelling insects.

As a well-known aromatic plant, lavender contains abundant secondary metabolites, among which monoterpene compounds, sesquiterpene compounds and ester compounds, which are the main components of essential oils, are particularly important. The characteristic aroma components of Lavender are linalyl acetate (linalyl acetate) and Linalool (linalol) etc. Linalyl acetate is elegant in fragrance, is an acetylation product of linalool, is an essential spice for preparing high-grade essence, and plays a very important role in daily chemicals, tobacco and food industries. Most of linalyl acetate used in the market at present is obtained through chemical synthesis, along with the enhancement of green and environmental protection consciousness of people, the demand for natural synthetic raw materials is greatly increased, and the linalyl acetate is difficult to completely replace natural linalyl acetate in special applications in daily chemicals, foods and the like. Chemical synthesis or extraction of natural linalyl acetate from plants faces the problems of difficult material acquisition, complicated steps, difficult extraction and separation, high cost, less research, environmental pollution and the like, and greatly limits the large-scale utilization of linalyl acetate. Therefore, the biological engineering technology is utilized to build a microbial factory to synthesize the natural linalyl acetate, and the method has great application prospect.

Acylation is an important process for modification of secondary metabolites during plant growth and development. As a clipping enzyme, BAHD acylases are ubiquitous in plants, animals and microorganisms, which contributes to the diversity of secondary metabolites, but in lavender, few studies have been made on BAHD acylases. It was found that the BAHD gene involved in volatile ester biosynthesis belongs to branches IIIa and Va and that lavender alcohol can be catalyzed by BAHD acetyl transferase (alcohol acetyltransferases, AAT) to form lavender acetate. Whereas the acetyl transferase catalyzing linalool to form linalyl acetate has not been reported so far. Cloning the BAHD gene in lavender and researching the function of the gene is beneficial to providing a theoretical basis for the formation of high-essential oil quality lavender, and simultaneously brings wide application space for producing natural linalyl acetate by utilizing a genetic engineering technology.

Disclosure of Invention

The application aims to provide LaBAHD57 protein of lavender BAHD acyltransferase for efficiently synthesizing linalyl acetate, a coding gene and application thereof.

The application firstly provides a protein, which comprises the following components 1) -3):

1) An amino acid sequence shown in SEQ ID NO. 2;

2) A sequence having the same function as the sequence represented by SEQ ID NO.2 and obtained by substituting, deleting or adding one or more amino acids;

3) And the fusion protein has the same function as the protein shown in SEQ ID NO.2, and is obtained by connecting a label to the N end or the C end. The protein label refers to a polypeptide or protein which is fused and expressed together with the target protein by utilizing a DNA in-vitro recombination technology so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

Also provided is a gene encoding the lavender LaBAHD57 protein, wherein the encoding gene is at least one of the following:

1) A nucleotide sequence shown as SEQ ID NO. 1;

2) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in 1) and which encodes said protein;

3) A nucleotide sequence having more than 90% identity to the nucleotide sequence defined in 1) or 2) and encoding said protein;

4) A sequence obtained by substitution, deletion or addition of a nucleotide from the sequence shown in SEQ ID NO. 1;

5) Different transcripts or homologous gene sequences are produced from the nucleotide sequence shown in SEQ ID No.1.

Also provides a recombinant vector, an expression cassette, recombinant bacteria and recombinant cells containing the coding gene.

Based on lavender whole genome data and different organ/tissue transcriptome differential expression analysis and analysis of phylogenetic evolutionary tree with BAHD acyltransferase protein with known functions, a nucleotide sequence shown in a LaBAHD gene SEQ ID NO.1 possibly involved in linalyl acetate synthesis is screened out, or the nucleotide sequence is recombined with an expression vector, and then introduced into a receptor microorganism, wherein the expression vector is specifically pATX-MBP, the receptor microorganism is specifically escherichia coli T7E, recombinant microorganism expressing LaBAHD57 protein or protein with the same function as the LaBAHD gene SEQ ID NO.1 is obtained, and the recombinant microorganism is cultured and expressed to obtain the protein.

Also provides an application of the protein in catalyzing and generating linalyl acetate by taking linalool as a substrate.

Also provides the application of the recombinant vector, the expression cassette, the recombinant bacterium and the recombinant cell in catalyzing linalool to generate linalyl acetate.

Also provides a primer for amplifying the gene, and the primer is shown as SEQ ID NO. 3-SEQ ID NO. 4.

Also provided is a method for preparing the 1) -3) protein, the method comprising: and (3) recombining the nucleotide sequence of the coding gene with an expression vector, introducing the recombined nucleotide sequence into a receptor microorganism to obtain a recombinant strain, culturing the recombinant strain, and expressing the recombinant strain to obtain the protein.

Also provided is a process for preparing linalyl acetate comprising catalyzing linalool with said protein to linalyl acetate. By passing throughMBP purifies LaBAHD57 protein, in-vitro enzymatic reaction of LaBAHD57 protein is carried out in buffer solution, and catalytic products of LaBAHD57 gene in-vitro of a prokaryotic expression system are detected by a solid-phase microextraction technology and a gas chromatography-mass spectrometry (GC-MS) technology, so that linalyl acetate serving as a catalytic product is obtained.

The application also provides a method for improving linalyl acetate of plants, which comprises the following steps:

1) Transforming a plant cell with an overexpression vector containing the gene;

2) The transformed plant cells are grown into plants.

Normally grown wild-type tobacco contains linalool but no linalyl acetate. LaBAHD57 was stably overexpressed in tobacco by leaf disc method, and it was found that linalyl acetate was produced in transgenic tobacco.

In the above method, the transgenic plant is understood to include not only the T1 generation transgenic plant obtained by transforming the target plant with the LaBAHD57 gene, but also the progeny thereof. For transgenic plants, including seeds, calli, whole plants or cells, the gene may be propagated in that species, or transferred to other species using conventional breeding techniques.

The LaBAHD57 acyltransferase is cloned from lavender, and the gene is a key enzyme gene for synthesizing important volatile ester compound linalyl acetate obtained from the lavender for the first time. Experiments prove that the LaBAHD57 provided by the application can catalyze linalool to form linalyl acetate, has an important effect on further analyzing the synthesis of ester compounds in lavender, and has an important significance on further improving the yield of linalyl acetate and improving the quality of essential oil.

Drawings

FIG. 1 shows a phylogenetic tree of LaBAHD genes candidate for Lavender and other identified BAHD genes

FIG. 2 shows the amounts of linalyl acetate and the expression levels of candidate LaBAHD57 genes in various tissues of Lavender. (A) Linalyl acetate content in different tissues of lavender. (B) Expression patterns of candidate LaBAHD57 gene in different tissues.

FIG. 3 shows the catalytic products detected by GC-MS in the LaBAHD57 in vitro expression system.

Fig. 4 shows a mass spectrum of the LaBAHD57 catalytic product with the standard ion peak at the upper end of the abscissa and the product ion peak at the lower end of the abscissa.

FIG. 5 shows the identification results of positive seedlings of transgenic plants.

FIG. 6 shows the GC-MS detected linalyl acetate content in LaBAHD57 overexpressing tobacco.

Detailed Description

The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application. It will be apparent that the described embodiments are only some, but not all, embodiments of the application. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

The reagents and methods used in the following examples were formulated and operated in conventional manner unless otherwise specified; the reagents used are all commercially available.

EXAMPLE 1LaBAHD Gene screening

1) Lavandula angustifolia Labahd gene family members are screened based on Lavandula angustifolia 'Jingfasu No. 2' whole genome data information and known BAHD gene family sequences and conserved domain features, and 166 LabaHD gene family members are totally identified in Lavandula angustifolia 'Jingfasu No. 2'.

2) The BAHD genes and LaBAHD genes of lavender of other species with identified functions are selected, a phylogenetic evolutionary tree is constructed by using MEGA software, 75 LaBAHD of catalytic volatile esters for synthesizing IIIa and Va branches are found, and candidate LaBAHD57 genes belong to IIIa families, as shown in figure 1.

3) The gene expression of LaBAHD57 in different tissues (root, stem, leaf, flower) and linalyl acetate content in different tissues of Lavender were determined. The qRT-PCR primer sequences of LaBAHD57 and the reference gene Actin are as follows:

LaBAHD57F:AGTTCGGCCTCTTCATTCCG；

LaBAHD57R:CTCACCCCGTCACTAGATGC；

ActinF:TGTGGATTGCCAAGGCAG；

ActinR:AATGAGCAGGCAGCAACA。

as a result, it was found that the content of linalyl acetate in flowers was high, and linalyl acetate was hardly contained in roots, stems, and leaves (FIG. 2A); laBAHD57 is also highly expressed in flowers and hardly expressed in roots, stems, leaves (FIG. 2B), and is closely correlated with changes in linalyl acetate content, suggesting that LaBAHD57 may catalyze the formation of linalyl acetate.

EXAMPLE 2LaBAHD57 Gene cloning and protein sequence encoded thereby

Primers were designed according to LaBAHD57 sequences in the Lavender genome, and amplification was performed using `Peking Lavender No. 2` Lavender (from northern resource plant key laboratory of China academy of sciences) glandular wool cDNA as a template, and the cloned primer sequences were as follows:

LaBAHD57F:ATGGCGATGATTATTACAAAACAA；

LaBAHD57R:TTAAGTATCCAATTTATTGTAATTGGC。

a nucleotide sequence with the length of 1254bp is obtained, and is shown as SEQ ID NO.1. The amino acid sequence coded by LaBAHD57 is obtained after translation according to the full-length cDNA sequence, and is shown as SEQ ID NO.2.

Example 3 in vitro catalytic reaction of LaBAHD57 and product detection

1) And (3) selecting BamHI/XhoI as an enzyme cutting site, carrying out enzyme cutting on the pATX-MBP vector, and connecting a target gene fragment LaBAHD57 into the enzyme cutting vector by using a seamless cloning kit to construct the pATX-MBP-LaBAHD57 gene expression vector.

2) pATX-MBP empty vector (control) and pATX-MBP-LaBAHD57 were transformed into T7E competent cells, respectively, and the transformed cells were plated on plates containing 50mg/L Kana (kanamycin) to screen positive clones. Selecting single colony, inoculating in LB liquid medium containing corresponding antibiotics, culturing overnight, transferring at 1:100, performing amplification culture, adding 0.5mM IPTG when OD600 of bacterial liquid reaches 0.8, and inducing in shaking table at 37 ℃/200rpm for 4 hr in dark place.

3) And (3) freezing and centrifuging the induced bacterial liquid and pATX-MBP empty carrier bacterial liquid at 10000rpm for 10min to obtain bacterial precipitate, adding 1ml of 1 XPBS buffer into the precipitate, performing ultrasonic cell lysis, and freezing and centrifuging at 10000rpm for 3min to obtain sample supernatant and control supernatant. 100ul of the supernatant was sampled, 25 ul of 5 Xreducing buffer was added to the sample, and after boiling for 10mins, SDS-PAGE was performed.

4) Sample supernatant was diluted with binding buffer (PBS, ph=7.5) and hung onAfter eluting the hetero protein with the binding buffer on MBP, the target protein is eluted with an elution buffer gradient containing 10, 30, 100, 200, 300mM Imidazole, and detected by SDS-PAGE electrophoresis, thereby obtaining purified protein LaBAHD57 at the optimal concentration of Imidazole. Protein concentration determination purified protein concentration was determined using Bradford method.

5) The in vitro enzyme activity of LaBAHD57 was assayed in 500. Mu.l buffer containing 10. Mu.g of purified protein, 10mM Tris-HCl pH=7.5, 0.2mM Acetyl CoA,1mM DTT and 1mM linalool as substrates, incubated at 30℃for 12 hours. Volatile products were detected by GC-MS method.

6) GC-MS detection results: laBAHD57 exhibits a single product linalyl acetate in an in vitro enzymatic reaction with linalool as substrate, as shown in FIG. 3, and a mass spectrum as shown in FIG. 4, relative to the control protein (pATX-MBP empty vector supernatant). The LaBAHD57 is proved to catalyze linalool to generate linalyl acetate in a prokaryotic expression system, and the LaBAHD57 is expected to be developed into functional protein for efficiently synthesizing linalyl acetate.

Example 4 functional analysis of LaBAHD57 transgenic plants to obtain and catalyze the production of linalyl acetate

1. Transgenic plant acquisition

1. Transformation

XhoI/SalI is selected as an enzyme cutting site, the pBI-121-GFP vector is subjected to enzyme cutting, and a target gene fragment LaBAHD57 is connected into the enzyme cutting vector by using a seamless cloning kit to construct a pBI-121-GFP-LaBAHD57 gene expression vector.

The empty vector (pBI-121-GFP) and the recombinant vector (pBI-121-GFP-LaBAHD 57) were transformed into Agrobacterium tumefaciens GV3101 by freeze thawing, respectively. Tobacco (N.tabacum) is infected by using an agrobacterium-mediated leaf disc method, and the specific steps are as follows:

1) Shaking the GV3101 agrobacterium solution containing the recombinant vector to about OD600 = 0.8, enriching the bacteria solution at normal temperature, discarding the supernatant, reversely buckling a centrifuge tube on sterile filter paper, and removing the supernatant as clean as possible.

2) The sediment of the bacterial liquid is suspended by MS liquid, and the bacterial liquid is shake activated and cultured for one hour in a shaking table after the suspension.

3) Bacterial liquid infects tobacco leaves: cutting the sterile tobacco leaves into 1x1 cm in an ultra-clean bench, infecting the cut tobacco leaves with the activated and cultured fungus night in the last step for 15-20 minutes, pouring out fungus liquid, sucking the fungus liquid remained on the surfaces of the tobacco leaves by using sterile filter paper, uniformly laying the leaves in an MS co-culture medium containing 3 mg/L6 BA and 0.2mg/L IBA, and culturing in the dark for 2-3d.

4) Co-cultivation: on the tobacco co-culture medium, leaf blades were observed for white fungus-like substances at the edges of leaf blades after 2-3 days of dark culture, and leaf blades were immediately removed to screening medium after the white fungus-like substances appeared.

5) Screening and culturing: the co-cultured tobacco leaves are transferred to tobacco MS screening culture medium (6 BA,3mg/L; IBA,0.2mg/L; tim,100mg/L; kana,50 mg/L), and then wound is fully contacted with the culture medium as much as possible, and after culturing for about 20 days under illumination condition, resistant buds are differentiated from a plurality of wound positions of the leaves, and then the culture medium is replaced every 2-3 weeks.

6) Rooting culture: after 4-5 weeks of sprouting, the growing resistant buds are transferred into rooting medium (1/2MS+100 mg/L Tim+50mg/L Kana) for rooting culture.

7) Transplanting tobacco seedlings in a field: taking each transgenic strain for rooting culture for about 15 days, and selecting and transplanting each strain into a culture pot, wherein the growth of each strain is consistent, and the water content is ensured to be sufficient.

2. Identification of positive seedlings of transgenic plants

And (3) extracting DNA of transgenic tobacco plant leaves by adopting a CTAB method. And respectively identifying whether the target genes are integrated into the genome of the tobacco by taking the extracted tobacco resistance seedling genome DNA as a template. As a result, 16 identified 18 LaBAHD57 transgenic lines are found to be positive seedlings; 18 of 20 empty tobacco plants transformed with pBI-121-GFP were positive seedlings (FIG. 5).

2. Detection of linalyl acetate content in over-expression LaBAHD57 tobacco

2g of the bloomed tobacco flowers were ground in liquid nitrogen and placed in 20mL headspace sample-loading vials. The content of linalyl acetate was detected by GC-MS method.

As a result, as shown in FIG. 6, linalyl acetate was successfully detected in LaBAHD57 overexpressing tobacco flowers, whereas linalyl acetate was not detected in WT tobacco and pBI-121-GFP empty vector transformed tobacco. The LaBAHD57 can catalyze linalool to generate linalyl acetate in a plant body, and the LaBAHD57 is expected to be developed into functional protein for efficiently synthesizing linalyl acetate.

In this specification, each embodiment is described in a progressive manner, and each embodiment is mainly described by a difference from other embodiments, and identical and similar parts between the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the application. Thus, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (9)

1. Labahd57 protein of lavender, characterized in that it is

1) A protein consisting of the amino acid sequence shown in SEQ ID No. 2;

2) A protein derived from 1) which has one or more amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID No.2 and has the same activity; or alternatively

3) And the fusion protein has the same function as the protein shown in SEQ ID NO.2, and is obtained by connecting a label to the N end or the C end.

2. A gene encoding the lavender LaBAHD57 protein of claim 1.

3. The gene of claim 2, which is at least one of the following:

1) A nucleotide sequence shown as SEQ ID NO. 1;

2) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in 1) and which encodes a protein according to claim 1;

3) A nucleotide sequence having more than 90% identity to the nucleotide sequence defined in 1) or 2) and encoding the protein of claim 1;

4) A sequence obtained by substitution, deletion or addition of a nucleotide from the sequence shown in SEQ ID NO. 1;

5) Different transcripts or homologous gene sequences were produced from the nucleotide sequence shown in SEQ ID No.1.

4. A recombinant vector, an expression cassette, a recombinant bacterium or a recombinant cell comprising the gene of claim 2 or 3.

5. Use of the protein of claim 1 or the gene of claim 2 or 3 for the catalytic production of linalyl acetate using linalool as substrate.

6. The recombinant vector, the expression cassette, the recombinant bacterium and the recombinant cell as claimed in claim 4, which are used for catalyzing linalool to generate linalyl acetate.

7. A method of preparing the protein of claim 1, comprising: the gene according to claim 2 or 3 is recombined with an expression vector and then introduced into a recipient microorganism to obtain a recombinant strain, and the recombinant strain is cultured and protein expression is induced.

8. A process for the preparation of linalyl acetate, characterized by: the method comprising catalyzing linalool to linalyl acetate using the protein of claim 1.

9. A method of increasing linalyl acetate in a plant comprising:

1) Transforming a plant cell with an overexpression vector comprising the gene of claim 2 or 3;

2) The transformed plant cells are grown into plants.