CN116997354A - Monoclonal antibodies against LILRB1 for diagnostic and therapeutic use - Google Patents

Abstract

Provided herein are antibodies that bind to LILRB1 and uses of the antibodies in the detection and treatment of cancer and autoimmune diseases.

Description

Monoclonal antibodies against LILRB1 for diagnostic and therapeutic use

Priority declaration

This application claims the benefit of priority to U.S. Provisional Application Serial Nos. 63/057,601 and 63/124,516, filed on July 28, 2020 and December 11, 2020, respectively, the entire contents of both applications are hereby incorporated by reference.

References to sequence listings

This application contains a sequence listing that has been submitted in ASCII format via EFS-Web and the sequence listing is hereby incorporated by reference in its entirety. The ASCII text created on July 23, 2021 is named UTFH_P0370WO_ST25.txt and is 319 kilobytes in size.

Field of the Invention

The present disclosure relates generally to the fields of medicine, oncology, immunology, and immuno-oncology. More specifically, the present disclosure relates to agonistic and antagonistic antibodies that bind to LILRB1 and methods of using the agonistic and antagonistic antibodies.

Background Art

NK cells play a key role in anticancer immunity, and the function of NK cells against cancer cells can be enhanced by engaging activating receptors or blocking inhibitory receptors 1. Among activating receptors, FcγRIII (CD16) plays a key role in antibody-dependent cellular cytotoxicity (ADCC) induced by therapeutic monoclonal antibodies for the treatment of hematological malignancies (rituximab for lymphoma and daratumumab for multiple myeloma) and metastatic solid cancers (cetuximab and trastuzumab) ^{2 3.} Antibodies that engage activating receptors such as NKG2D and NKp46 have also shown NK-dependent tumor immunity in preclinical studies ^{4 5.} Importantly, antibodies that block inhibitory receptors on NK cells such as KIR and NKG2A have also been shown to enhance NK cell function against cancer cells ^{6 7.} Therefore, the development of antibodies targeting immune receptors on NK cells may provide a novel cancer immunotherapy strategy.

LILRB1, an ITIM-containing receptor, is expressed on a variety of human immune cells. This includes all B cells, monocytes and macrophages, DCs, and subsets of NK cells and T cells. LILRB1 ligands, including MHC class I molecules, activate LILRB1 and transduce negative signals that downregulate immune responses8 ^. The percentage of LILRB1 ⁺ NK cells in patients with advanced prostate and breast cancer is significantly higher than that in ^healthy donors or patients with ^{localized cancer9-11. Using in vitro models, blocking LILRB1 signaling in immune cells can activate NK cell activity against solid tumors and leukemias10 12 , and} activate T cells or macrophages against solid ^tumors13-15 . However, it is unclear whether LILRB1 can be targeted to “turn on” immune cells in vivo for cancer treatment. In addition, there are reports that LILRB1 is expressed on some tumor cells and stimulates immune ^{responses16 17} . Therefore, it is unclear whether the net consequence of blocking LILRB1 signaling on tumor cells and immune cells is activation or inhibition of antitumor immune responses.

Summary of the invention

Thus, in one aspect, the present disclosure provides an isolated monoclonal antibody or antigen-binding fragment thereof, which specifically binds to LILRB1. In certain embodiments, the antibody or antigen-binding fragment, when bound to LILRB1, regulates the activation of LILRB1. In certain embodiments, the antibody or antigen-binding fragment, when bound to LILRB1, activates LILRB1. In certain embodiments, the antibody or antigen-binding fragment, when bound to LILRB1, inhibits the activation of LILRB1. In certain embodiments, the antibody or antigen-binding fragment, when bound to LILRB1, specifically blocks the binding of MHC and other ligands to LILRB1.

In one aspect, the isolated monoclonal antibody or antigen-binding fragment thereof comprises: a heavy chain (HC) variable region (VH) and a light chain (LC) variable region (VL), wherein the VH and the VL comprise the CDR sequences of the clone pairings shown in Tables 1 and 3; and variants thereof, wherein one or more of the LC-CDRs have one, two or three amino acid substitutions, additions, deletions or combinations thereof. The isolated monoclonal antibody or antigen-binding fragment thereof may be a murine antibody, a rodent antibody, a rabbit antibody, a chimeric antibody, a humanized antibody or a human antibody. The isolated monoclonal antibody or antigen-binding fragment thereof may have a VH chain and a VL chain, wherein the VH chain and the VL chain have amino acid sequences that are at least 90% or 95% identical to the sequences of the clone pairings of Tables 6 and 8, respectively. The isolated monoclonal antibody or antigen-binding fragment thereof may have a VH chain and a VL chain, wherein the VH chain and the VL chain are encoded by nucleic acid sequences that are at least 80% or 90% identical to the sequences of the clone pairings of Tables 5 and 7, respectively. The isolated monoclonal antibody or antigen-binding fragment thereof may have a VH chain and a VL chain, and the VH chain and the VL chain have amino acid sequences identical to the sequences of the clone pairings of Tables 6 and 8, respectively. The isolated monoclonal antibody or antigen-binding fragment thereof may have a VH chain and a VL chain, and the VH chain and the VL chain are encoded by nucleic acid sequences identical to the sequences of the clone pairings of Tables 5 and 7, respectively.

The variant may be one in which one or more of the HC-CDR or LC-CDR has one, two or three amino acid substitutions, additions, deletions or a combination thereof. In certain embodiments, each CDR is defined according to the Kabat definition, the Chothia definition, a combination of the Kabat definition and the Chothia definition, the AbM definition or a contact definition of a CDR.

In certain embodiments, the isolated monoclonal antibody described herein is a chimeric antibody, a humanized antibody or a human antibody. In certain aspects, the humanized antibody has a VH chain and a VL chain, and the VH chain and the VL chain have an amino acid sequence that is at least 90% or 95% identical to the sequence of the clone pairing of Hu-176 VH-1 and Hu-176-K as shown in Tables 6 and 8, respectively. In certain aspects, the VH chain and the VL chain have an amino acid sequence that is at least 90% or 95% identical to the sequence of the clone pairing of Hu-176 VH-1 and Hu-176-K as shown in Tables 6 and 8, respectively. In certain aspects, the humanized antibody has a VH chain and a VL chain, and the VH chain and the VL chain have an amino acid sequence that is at least 90% or 95% identical to the sequence of the clone pairing of Hu-176 VH-1 (W48L) and Hu-176-K as shown in Tables 6 and 8, respectively. In certain aspects, the VH chain and the VL chain have amino acid sequences identical to the sequences of the clone pairs of Hu-176 VH-1 (W48L) and Hu-176-K as shown in Tables 6 and 8, respectively.

In certain aspects, the isolated monoclonal antibodies described herein include amino acid modifications in the IgG Fc region. In certain aspects, the IgG Fc region includes amino acid modifications in one or more amino acid positions in amino acid positions 234, 235, 297, and 329. In some aspects, the IgG Fc region includes an amino acid substitution N to A at amino acid position 297. In some aspects, the IgG Fc region includes an amino acid substitution L to A at amino acid position 234, an amino acid substitution L to A at amino acid position 235, and an amino acid substitution P to G at amino acid position 329.

In another aspect, the present disclosure provides an isolated monoclonal antibody or antigen-binding fragment thereof, which competes for the same epitope with an antibody having a heavy chain CDR amino acid sequence and a light chain CDR amino acid sequence of a clonal pair from Table 1 and Table 3. In certain embodiments, the epitope bound by the antibody or antigen-binding fragment is located in the linker region between the D1 domain and the D2 domain of human LILRB1. In certain embodiments, the present disclosure provides an isolated monoclonal antibody or antigen-binding fragment thereof, wherein when bound to LILRB1, the monoclonal antibody binds to residues Y76 and R84 of LILRB1.

In certain embodiments, the isolated monoclonal antibodies described herein are of IgG1 type, IgG2 type, IgG3 type or IgG4 type. In certain embodiments, the antigen-binding fragments described herein are recombinant ScFv (single-chain fragment variable) antibodies, Fab fragments, F(ab')2 fragments or Fv fragments.

In certain aspects, the isolated monoclonal antibody or antigen-binding fragment thereof described herein is conjugated or fused to an imaging agent or cytotoxic agent. In certain aspects, the isolated monoclonal antibody or antigen-binding fragment thereof described herein is labeled with, for example, a fluorescent label, an enzymatic label, or a radioactive label.

In another aspect, a pharmaceutical composition is provided, comprising an isolated monoclonal antibody or antigen-binding fragment thereof as provided herein and at least one pharmaceutically acceptable carrier.

In another aspect, an isolated nucleic acid is provided, which encodes the isolated monoclonal antibody or antigen-binding fragment thereof as provided herein.

In another aspect, a vector is provided, comprising the isolated nucleic acid as provided herein.

On the other hand, a host cell is provided, the host cell comprising the vector as provided herein. The host cell may be a mammalian cell. The host cell may be a CHO cell.

In another aspect, a hybridoma is provided, which encodes or produces the isolated monoclonal antibody as provided herein.

In another aspect, a method for producing an antibody is provided. The method may include culturing the host cell as provided herein under conditions suitable for expressing the antibody and recovering the antibody.

In another aspect, a chimeric antigen receptor (CAR) protein is provided, comprising an antigen binding fragment as provided herein.

In another aspect, an isolated nucleic acid is provided, which encodes a CAR protein as provided herein.

In another aspect, an engineered cell is provided, comprising the isolated nucleic acid as provided herein. In certain embodiments, the cell is a T cell, a NK cell or a myeloid cell.

In another aspect, there is provided a method of treating cancer in a subject or ameliorating the effects of cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof as defined herein.

The method can reduce or eradicate the tumor burden of the subject, can reduce the number of tumor cells, can reduce tumor size, can reduce tumor infiltration, can reduce tumor metastasis, can eradicate the subject's tumor. The cancer can be a solid tumor or a hematological malignancy.

In certain embodiments, the cancer is a solid tumor including adrenal cancer, bile duct cancer, bone cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, colorectal cancer, esophageal cancer, eye cancer, stomach cancer, glioblastoma, head and neck cancer, kidney cancer, liver cancer, lung cancer, mesothelioma, melanoma, merkel cell cancer, nasopharyngeal cancer, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pineal tumor, prostate cancer, renal cell carcinoma, retinoblastoma, sarcoma, skin cancer, testicular cancer, thymic cancer, thyroid cancer, uterine cancer, and vaginal cancer.

In some embodiments, the cancer is a metastatic cancer, a recurrent cancer, or a drug-resistant cancer.

In some embodiments, the cancer is a hematologic malignancy including acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), B-cell leukemia, blastic plasmacytoid dendritic cell neoplasm (BPDCN), chronic lymphocytic leukemia (CLL), chronic myelomonocytic leukemia (CMML), chronic myeloid leukemia (CML), pre-B acute lymphocytic leukemia (pre-B ALL), diffuse large B-cell lymphoma (DLBCL), extranodal NK/T-cell lymphoma, hairy cell leukemia, HHV8-related primary effusion lymphoma, plasmablastic lymphoma, primary CNS lymphoma, primary mediastinal large B-cell lymphoma, T-cell/histiocyte-rich B-cell lymphoma, heavy chain disease, Hodgkin's lymphoma, non-Hodgkin's lymphoma lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma (MM), myelodysplastic syndrome (MDS), myeloproliferative neoplasms, and polycythemia vera.

The antibody or antigen-binding fragment thereof can be administered intravenously, intraarterially, intratumorally, or subcutaneously.

In some aspects, the subject's NK cells have been identified as expressing LILRB1. In some aspects, the subject's NK cells have been identified as expressing increased levels of LILRB1 relative to a reference level. The reference level can be an average level found in a portion of a healthy population. In some aspects, the subject's myeloma cells have been identified as not expressing LILRB1.

In certain embodiments, the method may further comprise administering to the subject one or more drugs selected from the group consisting of: topoisomerase inhibitors, anthracycline topoisomerase inhibitors, anthracyclines, daunorubicin, nucleoside metabolism inhibitors, cytarabine, hypomethylating agents, low-dose cytarabine (LDAC), a combination of daunorubicin and cytarabine, daunorubicin and cytarabine liposomes for injection, Azacytidine, decitabine, all-trans retinoic acid (ATRA), arsenic, arsenic trioxide, histamine dihydrochloride, Interleukin-2, aldesleukin, Gemtuzumab ozogamicin, FLT-3 inhibitors, midostaurin, Clofarabine, farnesyl transferase inhibitor, decitabine, IDH1 inhibitor, ivosidenib, IDH2 inhibitors, enasidenib, Smoothened (SMO) inhibitors, glasdegib, arginase inhibitors, IDO inhibitors, epacadostat, BCL-2 inhibitors, venetoclax, Platinum complex derivatives, oxaliplatin, kinase inhibitors, tyrosine kinase inhibitors, PI3 kinase inhibitors, BTK inhibitors, ibrutinib, acalabrutinib, Zanubrutinib, PD-1 antibody, PD-L1 antibody, CTLA-4 antibody, LAG3 antibody, ICOS antibody, TIGIT antibody, TIM3 antibody, CD40 antibody, 4-1BB antibody, CD47 antibody, SIRP1α antibody or fusion protein, CD70 antibody and CLL1 antibody, CD123 antibody, antagonist of E-selectin, antibody binding to tumor antigen, antibody binding to T cell surface marker, antibody binding to myeloid cell or NK cell surface marker, alkylating agent, nitrosourea agent, antimetabolite, antitumor antibiotic, alkaloid derived from plant, hormone therapy drug, hormone antagonist, aromatase inhibitor and P-glycoprotein inhibitor.

The isolated monoclonal antibody or antigen-binding fragment thereof may include an anti-tumor drug linked thereto. The anti-tumor drug may be linked to the antibody via a photolabile linker. The anti-tumor drug may be linked to the antibody via an enzymatically cleavable linker. The anti-tumor drug may be a toxin, a radioisotope, a cytokine, or an enzyme.

In another embodiment, a method for detecting cancer cells or cancer stem cells in a sample or subject is provided, the method comprising (a) contacting a subject or a sample from the subject with the antibody or its antigen-binding fragment as defined herein; and (b) detecting the binding of the antibody to cancer cells or cancer stem cells in the subject or sample. The sample may be a body fluid or biopsy, or blood, bone marrow, sputum, tears, saliva, mucus, serum, urine or feces. Detection may include immunohistochemistry, flow cytometry, immunoassay (including ELISA, RIA, etc.) or Western blot. The method may further include performing steps (a) and (b) a second time and determining the change in the detection level compared to the first time. The isolated monoclonal antibody or its antigen-binding fragment may further include a label, such as a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemiluminescent molecule or a dye. The isolated monoclonal antibody or its antigen-binding fragment may be conjugated to a liposome or a nanoparticle.

In another aspect, a method of treating an autoimmune disease in a subject or ameliorating the effects of an autoimmune disease in a subject is provided, the method comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof as defined herein. The antibody or antigen-binding fragment thereof may be administered intravenously, intraarterially, intratumorally or subcutaneously. The method may further comprise administering to the subject one or more drugs selected from the group consisting of a steroid or an NSAID. The autoimmune disease can be Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy, ankylosing spondylitis, psoriatic arthritis, enteropathic arthritis, reactive arthritis, undifferentiated spondyloarthropathies, juvenile spondyloarthropathies, Behcet's disease, enthesitis, ulcerative colitis, Crohn's disease, irritable bowel syndrome, inflammatory bowel disease, fibromyalgia, chronic fatigue syndrome, painful conditions associated with systemic inflammatory diseases, systemic lupus erythematosus, Sjogren's syndrome, rheumatoid arthritis, juvenile rheumatoid arthritis, juvenile onset diabetes (also known as type I diabetes), Wegener's granulomatosis, polymyositis, dermatomyositis, inclusion body myositis, multiple endocrine failure, Schmidt's syndrome, autoimmune uveitis, Addison's disease, Grave's Disease, Hashimoto's thyroiditis, autoimmune thyroid disease, pernicious anemia, gastric atrophy, chronic hepatitis, lupus hepatitis, atherosclerosis, multiple sclerosis, amyotrophic lateral sclerosis, hypoparathyroidism, Dressler's syndrome, myasthenia gravis, Eaton-Lambert syndrome syndrome), autoimmune thrombocytopenia, idiopathic thrombocytopenic purpura, hemolytic anemia, pemphigus vulgaris, pemphigus, dermatitis herpetiformis, alopecia, scleroderma, progressive systemic sclerosis, CREST syndrome (calcification, Raynaud's phenomenon, esophageal dysmotility, sclerodactyly, and telangiectasia), adult-onset diabetes mellitus (also called type 2 diabetes), mixed connective tissue disease, polyarteritis nodosa, systemic necrotizing vasculitis, glomerulonephritis, atopic dermatitis, atopic rhinitis, Goodpasture's syndrome syndrome), Chagas' disease, sarcoidosis, rheumatic fever, asthma, antiphospholipid syndrome, erythema multiforme, Cushing's syndrome, autoimmune chronic active hepatitis, allergic disease, allergic encephalomyelitis, transfusion reaction, leprosy, malaria, leishmaniasis, trypanosomiasis, Takayasu's arteritis, polymyalgia rheumatica, temporal arteritis, schistosomiasis, giant cell arteritis, eczema, lymphomatoid granulomatosis, Kawasaki's disease, endophthalmitis, psoriasis, erythroblastosis fetalis, eosinophilic fasciitis, Shulman's syndrome, Felty's syndrome, Fuchs' cyclitis, IgA nephropathy, Henoch-Schonlein purpura purpura), graft-versus-host disease, transplant rejection, tularemia, periodic fever syndromes, septic arthritis, familial Mediterranean fever, TNF receptor-associated periodic syndrome (TRAPS), Muckle-Wells syndrome, or hyper-IgD syndrome.

In another embodiment, provided herein is a method for increasing the immune function of NK cells in a subject, the method comprising administering to the subject an antibody or antigen-binding fragment thereof or an engineered cell as defined herein.

Other objects, features and advantages of the present invention will become clear from the following detailed description. However, it should be understood that although the detailed description and specific examples indicate the preferred embodiments of the present invention, they are given by way of illustration only, because various changes and modifications within the spirit and scope of the present invention will become obvious to those skilled in the art.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of this specification and are included to further demonstrate certain aspects of the present invention. The present invention may be better understood by referring to one or more of these drawings in conjunction with the detailed description of specific embodiments presented herein.

Figure 1A-C: Expression of LILRB1 on human peripheral blood NK cells. (Figure 1A) PBMCs were isolated from buffy coats of healthy donors or peripheral blood of patients with multiple myeloma (MM) or prostate cancer by density gradient centrifugation using Ficoll-Paque PLUS medium and then stained with anti-CD3-PE, anti-CD56-FITC, anti-LILRB1-APC, or isotype APC antibodies. NK cells were gated as SSC ^low FSC ^low CD56 ⁺ CD3-. LILRB1 expression on NK cells was gated according to isotype APC antibodies. Representative flow cytometry plots show that LILRB1 is primarily expressed on CD56 ^dark rather than CD56 ^bright NK cells. (Figure 1B) The percentage of LILRB1 + NK cells in CD56 dark NK cells from healthy donors (n=12), patients with stage 2b or 2c prostate cancer (n=16), and patients with stage 3b ^or 3c prostate cancer (n=17) was determined by ^flow cytometry. (FIG. 1C) The percentage of LILRB1 + NK cells from healthy donors (same as FIG. 1B), patients with newly diagnosed MM (n=10), and patients with MM with partial response or refractory disease to treatment (n=8) and patients with MM with a good response to treatment (CR+VGPR, n=9) was determined by flow ^cytometry . CR = complete remission, VGPR = very good partial remission. *P<0.05;***P<0.001.

Figure 2A-I: Generation and characterization of rabbit antagonistic anti-LILRB1 mAbs. (Figure 2A) Left panel: HLA-G expression on the surface of K562 and K562 cells overexpressed by HLA-G1 (K562-HLA-G) was stained with anti-HLA-G antibody (clone: MEM-G/9, Abcam) and analyzed by flow cytometry. Right panel: K562 or K562-HLA-G were co-cultured with LILRB1 reporter cells. K562/K562-HLA-G cells were stained with DDAOSE before co-culture with LILRB1 reporter cells. 24 hours after co-culture, the percentage of activated LILRB1 reporter cells (GFP) was analyzed by flow cytometry. (Figure 2B) The titer of antagonistic anti-LILRB1 mAbs blocking K562-HLA-G stimulated LILRB1 reporter cell activation. LILRB1 reporter cells were co-cultured with K562-HLA-G and incubated with different concentrations of antagonistic anti-LILRB1 mAb. (FIG. 2C) Representative flow cytometry graphs show that B1-176 specifically binds to LILRB1. LILR reporter cells were incubated with 0.5 μg/mL rabbit B1-176 at 4°C for 30 minutes. The reporter cells were then incubated with anti-rabbit IgGPE antibody (Jackson Laboratory) and analyzed by flow cytometry. (FIG. 2D) Binding specificity of B1-176 rabbit antibody to LILRB and LILRA as determined by ELISA. (FIG. 2E) Affinity for B1-176 by Octet RED96. (FIG. 2F) Screening of B1-176 binding to LILRB1-Fc fusion proteins with different domain deletions as determined by ELISA. (FIG 2G) Binding capacity of B1-176 to LILRB1-D1D2 Fc fusion proteins with different mutants as determined by ELISA (top panels). Two amino acids (Y76 and R84) in LILRB1 were identified as critical for the binding of B1-176 (bottom panels). (FIG 2H) Detailed binding surface of rabbit mAb B1-176 to LILRB1 generated by molecular docking using Discovery Studio. (FIG 2I) Cross-reactivity of B1-176 and commercially available anti-LILRB1 mAbs to LILR expressed on 2B4 cells, as obtained by flow cytometry.

Figure 3A-D: Humanization of anti-LILRB1 blocking antibody 176. (Figure 3A) The combined Kabat/IMGT/Chothia CDR transplantation strategy was used to humanize the rabbit antibody 176. The heavy and light chains of the rabbit antibody B1-176 are shown as Rab-176 VH and Rab-176 VL, respectively. The heavy and light chains of the human antibody framework are shown as Hu IGHV3-53*04 and Hu IGKV1-9*01. Amino acids close to the HCDR that differ from the rabbit original amino acids (shown in blue) are shown in green. The heavy chain of B1-176 is humanized based on the human antibody framework, shown as Hu-176 VH-1 or Hu-176 VH-2 (W48L), which has mutations marked with asterisks. The light chain of B1-176 is humanized based on the human antibody framework, shown as Hu-176 VL. (FIG. 3B) ELISA results show that the rabbit amino acid L48 (marked with an asterisk) in FR2 needs to remain in the same position to keep the binding activity of humanized B1-176 the same as that of rabbit B1-176. (FIG. 3C) Molecular docking data show that the structure of rabbit B1-176 is similar to that of humanized Hu B1-176-N297A. (FIG. 3D) Affinity of rabbit-human chimeric anti-LILRB1 antibody B1-176 N297A and humanized anti-LILRB1 antibodies expressed in human IgG1 with N297A or LALAPG mutations was determined by Octet RED96 or ELISA.

Figure 4A-C: Antagonistic LILRB1 mAbs can block the activation of LILRB1 receptor cells stimulated by hematological cancer and solid tumor cell lines. (Figure 4A) MHC class I levels of hematological cancer cell lines (left panel) or solid cancer cell lines (right panel) were detected by flow cytometry using anti-pan-MHC class I antibody (clone: HP-1F7, Santa Cruz Biotechnology). Cancer cell lines (prestained with DDAOSE) were co-cultured with LILRB1 reporter cells to test the ability of cancer cells to stimulate LILRB1. The percentage of activated LILRB1 reporter cells (GFP ⁺ ) was analyzed by flow cytometry. (Figure 4B) Rabbit B1-176 (left panel) and humanized Hu B1-176-N297A (right panel) can block the activation of LILRB1 receptor cells induced by hematological cancer cell lines in a dose-dependent manner. LILRB1 reporter cells were co-cultured with K562-HLA-G, multiple myeloma cell line KMS27, or pre-B leukemia cell line 697, and then incubated with anti-LILRB1 mAb. 24 hours after treatment, the activation of LILRB1 reporter cells was analyzed by flow cytometry. (FIG. 4C) Rabbit B1-176 (left panel) and humanized Hu B1-176-N297A (right panel) were titrated to block the activation of LILRB1 receptor cells by solid tumor cell lines. LILRB1 reporter cells were co-cultured with lung cancer cell line H460, melanoma cell line Malme-3m, or triple negative breast cancer cell line MDA-MB-231, and then incubated with anti-LILRB1 mAb. 24 hours after treatment, the activation of LILRB1 reporter cells was analyzed by flow cytometry.

Figure 5A-F: Antagonistic LILRB1 mAbs can modulate the function of NKL cell lines against cancer cells in vitro. (Figure 5A) Multiple myeloma cell line KMS27 was co-cultured with NKL and co-incubated with 10 μg/mL control human IgG (hIgG) or B1-176-N297A (left panel, n=3), Hu B1-176-N297A (middle panel, n=3), and Hu B1-176-LALAPG (right panel, n=2). After 4 hours, the cytotoxic activity of NKL against cancer cells was analyzed by flow cytometry. (Figure 5B) Multiple myeloma cell lines OPM2, RPMI8226 or acute T-cell leukemia Jurkat cells were co-cultured with NKL and incubated with 10 μg/mL B1-176-N297A or hIgG. n=3. (Fig. 5C) Pre-B leukemia 697 cells (left panel) or Burkitt lymphoma Raji cells (right) were overexpressed with MICA (697-MICA, Raji-MICA) and co-cultured with NKL. 10 μg/mL B1-176-N297A or hIgG was added to the culture. (Fig. 5D) 697-MICA was co-cultured with NKL (E:T=20) and incubated with different concentrations of B1-176-N297A. (Fig. 5E) Solid tumor cell lines MDA-MB-231 or MALME-3M were co-cultured with NKL and incubated with 10 μg/mL B1-176-N297A or hIgG. n=3. (FIG. 5F) KMS27, OPM2, RPMI8226, Jurkat cells, or 697/697MICA cells were co-cultured with NKL (E:T ratio = 1:1). 10 μg/mL control hIgG, B1-176-N297A (for RPMI8226, Jurkat, and 697/697MICA), or HuB1-176-N297A (for KMS27 and OPM2 treatments) were added to the cell cultures. IFN-γ levels in cell culture supernatants were determined by ELISA after 24 hours. n = 3-4, statistical significance between anti-LILRB1 antibody and hIgG was analyzed. *P<0.05; **P<0.01; ***P<0.001.

Figure 6A-B: Antagonistic LILRB1 mAbs can increase the cytotoxic activity of primary NK cells against cancer cells in vitro. (Figure 6A) Multiple myeloma cell lines KMS27 and OPM2, pre-B leukemia cell line 697, or lymphoma cell lines Raji and Daudi cells were co-cultured with FACS-sorted LILRB1 ⁺ NK cells isolated from PBMCs of healthy donors. 10 μg/mL control hIgG or B1-176N297A was added to the cell culture. n=3, except for Daudi cells n=2. (Figure 6B) KMS27 cells were co-cultured with NK cells from a multiple myeloma patient (E:T ratio = 2.5:1) and incubated with 10 μg/mL control hIgG or Hu B1-176-N297A. The cytotoxic activity of primary NK cells was analyzed by flow cytometry 4 hours after co-culture. n=3, ***P<0.001.

Figure 7A-C: Antagonistic LILRB1 mAb can increase the in vivo cytotoxic activity of NKL cells. (Figure 7A) A mixture of 5×10 ⁶ CFSE-stained 697 (NKL-resistant) and 697MICA (NKL-sensitive) cells was injected into the peritoneal cavity of NSG mice together with 5×10 ⁷ NKL cells. 10 mg/kg of control hIgG or B1-176-N297A was injected into mice retro-orbitally. After 24 hours, peritoneal cells were harvested and stained with anti-MICA-APC antibody. The ratio of 697-MICA to 697 cells was quantified by flow cytometry and representative flow plots. The ratio of 697-MICA to 697 was used to calculate the cytotoxic activity of NKL cells in vivo. n=3-4, *P<0.05. (Fig. 7B) 1×10 ⁶ cells overexpressing 697MICA luciferase (697MICA-luci) were mixed with 5×10 ⁶ NKL cells and injected subcutaneously into NSG mice. 10 mg/kg of control hIgG or B1-176-N297A was administered retroorbitally. Bioluminescence imaging (BLI) was performed 48 hours later. Quantification of BLI data (total flux (p/s)) from two independent experiments showed that mice receiving B1-176-N297 showed significantly lower tumor burden compared to mice treated with control hIgG, indicating that B1-176-N297 improved the cytotoxic function of NKL cells in vivo. n=8-10, **P<0.01. (Fig. 7C) NSG mice were sublethally irradiated and 5×10 ⁵ KMS27 and 5×10 ⁶ NKL cells overexpressing luciferase were injected through the tail vein on day 0. An additional 5×10 ⁶ NKL cells were injected into NSG mice via tail vein injection on day 14. Mice received 10 mg/kg of control hIgG or B1-176-N297A retro-orbitally on days 0, 3, and 7, then once a week for an additional month. BLI was performed on days 28 and 35. The aggregated BLI data showed that B1-176-N297 significantly reduced tumor development in mice (left panel). n=4, data from one representative experiment. *P<0.05, statistical significance calculated by one-tailed unpaired t test. Survival analysis of multiple myeloma mouse xenografts showed that B1-176-N297-treated mice had significantly increased survival compared to control hIgG-treated mice (right panel). n=9-10, pooled data from two representative experiments. ***P<0.001.

Figure 8A-D: Antagonistic LILRB1 mAb can modulate the function of NK92mi cell lines against cancer cells in vitro. (Figure 8A-C) Leukemia cell lines (RS4-11, MHHCALL2, MOLM13, THP-1, 697, 697MICA), solid tumor cell lines (MDA-MB-231, SW480, MALEM-3M) or multiple myeloma cell lines (RMPI8226) were co-cultured with NK92mi and incubated with 10μg/mL control human IgG (hIgG), B1-#3 or B1-176. Four hours later, the cytotoxic activity of NKL against cancer cells was analyzed by flow cytometry. (Figure 8D) Two primary leukemia cells were co-cultured with NK92mi and incubated with 10μg/mL control human IgG (hIgG) or B1-#3N297A. Four hours later, the cytotoxic activity of NK92mi against cancer cells was analyzed by flow cytometry.

Figure 9: Agonistic LILRB1 mAbs can activate LILRB1 receptor cells. LILRB1.LILRB1 reporter cells were co-cultured with K562 cells and treated with agonistic LILRB1 mAbs B1-7 or B1-41. After 24 hours, the percentage of GFP ⁺ reporter cells was analyzed by flow cytometry. The N297A mutation in the Fc abolished, while the S267E mutation in the Fc enhanced the activity of the agonistic LILRB1 mAbs.

Figure 10A-D: Agonistic LILRB1 mAb can inhibit the cytotoxic activity of NK cells against cancer cells in vitro. NK92mi cells were co-cultured with 697 (Figure 10A) or THP1 cells (Figure 10B) and treated with anti-LILRB1 mAb. Antagonistic B1-3 increased, while agonistic B1-7 inhibited the cytotoxic activity of NK92mi against 697 and THP-1 cells. (Figure 10C) NKL cells were co-cultured with 697/697-MICA and treated with anti-LILRB1 mAb. Antagonistic B1-3 increased, while agonistic B1-7 inhibited the cytotoxic activity of NKL against 697-MICA. (Figure 10D) NKL cells were co-cultured with 697-MICA and treated with B1-7 and B1-7 with mutations in Fc (N297A, S267E). The N297A mutation in Fc abolished the activity of agonistic B1-7. Four hours after co-culture, cytotoxic activity was analyzed by flow cytometry.

Figure 11: Agonistic LILRB1 mAb can inhibit IFN-γ secretion from NKL cells. NKL cells were co-cultured with 697-MICA cells and treated with anti-LILRB1 mAb. Antagonistic B1-3 increased, while agonistic B1-7 inhibited IFN-γ secretion from NKL cells. 24 hours after co-culture, culture supernatants were collected and IFN-γ levels were determined by ELISA.

Figure 12A-G: Screening for the generation of anti-LILRB1 mAbs. (Figure 12A) Anti-LILRB1-specific rabbit memory B cell isolation, in vitro culture and cloning strategy for the generation of anti-LILRB1 mAbs. After 14 days of culture in 96-well plates with rabbit CD40L feeder cells and rabbit cytokine cocktail, B cell supernatants were screened for binding to LILRB1 in ELISA. The antibody heavy chain variable gene and light chain variable gene were then cloned into a rabbit IgG expression vector and recombinant antibodies were produced using a transient HEK293 Expi-F cell expression system. (Figure 12B) Flow chart for the screening of anti-LILRB1 mAbs. (Figure 12C) EC ₅₀ determination of 44 anti-LILRB1 rabbit mAbs by ELISA. (Figure 12D) 12 epitope bins of 44 anti-LILRB1 rabbit mAbs were determined using a classic sandwich epitope binning assay (Octet RED96). (FIG. 12E) To screen for antagonistic anti-LILRB1 antibodies, LILRB1 reporter cells were co-cultured with K562-HLA-G cells and incubated with anti-LILRB1 mAbs (10 μg/mL) for 24 hours. (FIG. 12F) Left panel: Homology of LILRB1 with other receptors in the LILR family. Phylogenetic tree of D1-D2 encoding amino acid sequences from all LILRs, except for the D1 domain selected only for LILRB4, was generated by MEGA version 7.0 using the maximum likelihood method. Right table: Specificity of anti-LILRB1 mAbs, analyzed by Octet RED96. (FIG. 12G) Affinity of commercial anti-LILRB1 monoclonal antibodies HP-F1 and GHI/75, analyzed by Octet RED96.

Figures 13A-B: Characterization of B1-176. Fusion proteins of LILRB1 ECD mutants and the Fc of hIgG1 were generated to characterize the binding epitope of B1-176. (Figure 13A) Schematic diagram of LILRB1-fc mutations. (Figure 13B) Single or multiple mutations of LILRB1 amino acids.

Figures 14A-D: Expression of LILRB1 on the cell surface. (Figure 14A) A representative flow chart of LILRB1 expression on NKL cells. (Figure 14B) The representative flow chart shows that multiple myeloma cell lines do not express LILRB1 on the cell surface. (Figure 14C) The representative flow chart shows that the majority of malignant plasma cells from patients with MM do not express LILRB1 on the cell surface. (Figure 14D) The representative flow chart shows that pre-B ALL cell lines 697, MHHCALL2, RS4;11, RCHACV, REH; acute monocytic leukemia cell lines THP-1, MOLM13, MV4-11; and Raji cells express LILRB1 on the cell membrane, while T cell leukemia Jurkat cells and chronic myeloid leukemia cell line K562 do not express LILRB1. Cells were incubated with anti-LILRB1-APC (clone: HP-F1, eBioscience) for 30 min on ice and analyzed by flow cytometry.

DETAILED DESCRIPTION

LILRB1, a member of the LILR receptor family containing ITIM, plays a key role in the regulation of innate and adaptive immunity. The LILRB1 is expressed on various types of immune cells including NK cells and acts as an immune checkpoint protein. The expression of LILRB in myeloid-derived suppressor cells (MDSC) can promote tumor growth and lead to an inhibitory immune microenvironment for tumor progression and metastasis. On the other hand, the use of agonistic antibodies to activate LILRB1 signaling may reduce tissue inflammation and can be used for the management of autoimmune diseases. Provided herein are agonistic and antagonistic human LILRB1 monoclonal antibodies with specific targeting properties for regulating LILRB1 signaling. These LILRB1 antibodies can be used to treat human diseases including cancer and autoimmune diseases.

I. Aspects of the Disclosure

LILRB1 is expressed on T cells and NK cell subsets. LILRB1 is mainly expressed on CD56 ^dark NK cells from healthy donors and patients with different malignancies. In addition, the percentage of LILRB1 ⁺ NK cells from the peripheral blood of patients with multiple myeloma (MM) with persistent disease during treatment was significantly higher than the percentage of LILRB1 ⁺ NK cells from healthy donors or patients with minimal disease or complete response. The percentage of LILRB1 ⁺ NK cells in the peripheral blood of patients with advanced prostate cancer (stages 3B and 3C) was also significantly higher than the percentage of LILRB1 ⁺ NK cells from healthy donors. These results are consistent with previous studies showing that peripheral blood CD56 ^dark NK cells have higher LILRB1 levels compared to CD56 ^bright NK cells ^40. Other previous studies have also reported that the percentage of LILRB1 ⁺ NK cells in the peripheral blood of patients with metastatic prostate cancer and breast cancer is significantly higher than that of NK cells from healthy donors or patients with localized cancer ^{9 10} . Previous studies have also reported a strong correlation between the percentage of circulating CD8 ⁺ LILRB1 T cells and the risk of recurrence in non-muscle-invasive bladder cancer ⁴¹ . In summary, LILRB1 expression on NK cells and T cells has prognostic value. Although the exact mechanism of LILRB1 polymorphisms in human NK cells is unknown, LILRB1 expression on NK cells is associated with specific haplotypes and polymorphic regulatory regions ⁴² . Increased LILRB1 ⁺ NK cells from certain patients with cancer have been well documented. NK cells upregulate LILRB1 expression when cultured with cancer cells in vitro ⁹ . HLA-G and soluble HLA-G have been reported to upregulate LILRB1 expression on NK cells, T cells, and antigen-presenting cells ⁴³ . Patients with elevated plasma soluble HLA-G may have high LILRB1 expression on NK cells ¹⁰ . Terminally differentiated NK cells, marked by the expression of CD57 or multiple KIRs, have high LILRB1 expression and poor proliferation capacity ⁴⁴ . High numbers of circulating CD57 ⁺ NK cells are associated with resistance to HER2-specific therapeutic antibodies in patients with primary breast cancer ⁴⁵ , which may explain the increase in LILRB1 ⁺ NK cells in patients with cancer who have a poor response to treatment.

Importantly, blocking LILRB1 with an antagonistic monoclonal antibody increased the immune function of NK cells against multiple myeloma cells in vitro and in vivo. In an earlier study, Heidenreich and colleagues reported that blocking LILRB1 on the NK92 cell line did not increase their cytotoxic activity against multiple myeloma cell lines ⁴⁶ . This difference may be related to the use of the NK92 cell line, which may have stronger cytotoxic activity than the NKL cell line and primary NK cells used in this article ⁴⁷ . MHC class I, the ligand of LILRB1, is strongly expressed in advanced MM cell lines, where the expression level is directly correlated with the clinical stage of the disease ⁴⁸ . The cell line RPMI8226 and other MM cell lines used in the study of ⁴⁶ express high levels of MHC class I molecules at the cell surface and have a strong ability to activate LILRB1 reporter cells. These data suggest that MM cells may become resistant to NK cells by activating LILRB1 on NK cells by engaging with MHC class I molecules expressed by MM cells.

NK cell function depends on the balance of various activating and inhibitory signals in the cell. Targeting multiple immune receptors can optimize NK cell function against cancer cells. Combined blockade of LILRB1 and activation of the NKG2D receptor (via its ligand MICA) act synergistically to increase NK cell cytotoxic function. These results are consistent with previous reports showing that overexpression of HLA-G on the MICA-expressing M8 melanoma cell line blocked the cytotoxic activity of NKL cells against cancer cell lines via activation of LILRB1 ⁴⁹ . Several approaches are being developed for increasing the surface abundance of MICA on cancer cells ^{4 19} . Other studies have reported the combined effects of LILRB1 blockade with KIR-blocking or ADCC-inducing mAbs in vitro ^{10 12} . Adoptively transferred allogeneic haploidentical NK cells are thought to have improved function due to the mismatch of MHC class I molecules and KIRs ^{1 50} . As LILRB1 may still be activated on these allogeneic NK cells, there may be a combined effect of LILRB1 blockade and adoptive transfer of allogeneic NK cells.

Interestingly, there are reports that LILRB1 on cancer cells ^{, such as transformed B lymphoma cells and MGUS cells, may activate immune responses16 17 .} LILRB1 is expressed on pre-B leukemia cells and Burkitt lymphoma Raji cells. However, administration of anti-LILRB1 blocking antibodies increased NK cell function against LILRB1-positive cell lines 697 cells and Raji cells, which is consistent with previous reports that LILRB1 blockade increased NK cell cytotoxic activity against pre-B- ^ALL12 . These results suggest that the immunostimulatory function of LILRB1 may be context-dependent. As LILRB1 expression on NK cells was significantly higher in patients with persistent disease after treatment, LILRB1 blockade may increase NK cell function in patients with persistent MM. However, LILRB1 expression levels on myeloma cells and NK cells should be monitored before and during anti-LILRB1 antibody treatment. To minimize the risk of modulation of the LILRB1 receptor on myeloma cells, anti-LILRB1 antibody treatment should be prioritized for patients who have high LILRB1 expression levels on NK cells and no LILRB1 expression on myeloma cells.

In conclusion, blockade of LILRB1 by antagonistic antibodies has the potential as an immunotherapy approach to treat patients with various types of cancer, especially those with high LILRB1 levels expressed on NK cells.

II. Monoclonal Antibodies and Their Production

Monoclonal antibodies described herein can be prepared using standard methods, followed by screening, characterization and functional assessment. The variable region can be sequenced, and then subcloned into a human expression vector to produce a chimeric antibody gene, which is then expressed and purified. These chimeric antibodies can be tested for antigen binding, signal transduction blocking and xenotransplantation experiments. Monoclonal antibodies described herein can also be prepared using phage display methods, wherein a large library of people's scFv displayed by a large amount of phages is selected for the target protein. The people's scFv selected to be specifically bound to the target protein can be sequenced, and then subcloned into a human expression vector to produce the desired human antibody.

A. General Methods

It will be appreciated that monoclonal antibodies that bind to LILRB1 will have several applications. These applications include the production of diagnostic kits for detecting and diagnosing cancer and for cancer therapy. In these contexts, such antibodies can be linked to diagnostic or therapeutic agents, which are used as capture agents or competitors in competitive assays, or used alone without the need for additional reagents. Antibodies can be mutated or modified, as discussed further below. Methods for preparing and characterizing antibodies are well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; U.S. Pat. No. 4,196,265).

The classical method for generating monoclonal antibodies (MAbs) generally begins along the same route as the method for preparing polyclonal antibodies. The first step of both methods is to immunize an appropriate host. As is well known in the art, the immunogenicity of a given composition for immunization may vary. Therefore, it is generally necessary to enhance the host immune system, such as by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Methods for conjugating polypeptides to carrier proteins are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis-nitrobenzidine. As is well known in the art, the immunogenicity of a particular immunogenic composition can be enhanced by using a non-specific stimulator of the immune response, known as an adjuvant. Exemplary and preferred adjuvants include complete Freund's adjuvant (a nonspecific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvant, and aluminum hydroxide adjuvant.

The amount of the immunogenic composition used to produce polyclonal antibodies is different due to the nature of the immunogen and the animal used for immunization. Various approaches can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies can be monitored by sampling the blood of the immunized animal at different points after immunization. A second booster injection can also be given. Repeat the process of boosting and titering until a suitable titer is reached. When the immunogenicity of the desired level is obtained, the immunized animal can be bled, and the serum can be separated and stored, and/or the animal can be used to produce MAbs.

After immunization, somatic cells with the potential to produce antibodies, particularly B lymphocytes (B cells) are selected for MAb production schemes. These cells can be obtained from the spleen or lymph nodes of a biopsy, or from circulating blood. Then, the B lymphocytes producing antibodies from the immunized animal are fused with cells of immortal myeloma cells, which are usually one of the species identical to the immunized animal or human or human/mouse chimeric cells. The myeloma cell line suitable for the fusion program for producing hybridomas preferably does not produce antibodies, has high fusion efficiency and lacks enzymes, so that it is then impossible to grow in certain selective culture media that only support the growth of the desired fusion cell (hybridoma). Any of a variety of myeloma cells can be used, as known to those skilled in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984).

Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells generally involve mixing somatic cells with myeloma cells in a 2:1 ratio, but the ratio can vary from about 20:1 to about 1:1, respectively, in the presence of one or more agents (chemical or electrical) that promote cell membrane fusion. Kohler and Milstein (1975; 1976) described fusion methods using Sendai virus, and Gefter et al. (1977) described fusion methods using polyethylene glycol (PEG), such as 37% (v/v) PEG. The use of electrically induced fusion methods is also suitable (Goding, pp. 71-74, 1986). Fusion procedures generally produce viable hybrids at low frequencies, about 1× ^10-6 to 1× ^10-8 . However, this does not pose a problem because viable fused hybrids differentiate from parental, injected cells (particularly injected myeloma cells, which usually continue to divide indefinitely) by culturing in a selective medium. Selective culture medium is generally a culture medium containing a medicament for the de novo synthesis of nucleotides in a tissue culture medium. Exemplary and preferred medicaments are aminopterin, methotrexate and azaserine. Aminopterin and methotrexate block the de novo synthesis of purines and pyrimidines, while azaserine only blocks the synthesis of purines. In the case of using aminopterin or methotrexate, hypoxanthine and thymidine are supplemented in the culture medium as the source of nucleotides (HAT culture medium). In the case of using azaserine, the culture medium is supplemented with hypoxanthine. If the B cell source is the human B cell line transformed by Epstein-Barr virus (Epstein-Barrvirus, EBV), ouabain is added to eliminate the EBV transformation system that is not fused with myeloma.

Preferred selective culture medium is HAT or HAT with ouabain. Only cells that can operate the nucleotide salvage pathway can survive in the HAT culture medium. Myeloma cells have defects in the key enzymes of the salvage pathway, such as hypoxanthine phosphoribosyltransferase (HPRT), so the myeloma cells cannot survive. B cells can operate this pathway, but their life span in culture is limited, and they usually die in about two weeks. Therefore, the only cells that can survive in the selective culture medium are those hybrids formed by myeloma and B cells. When the B cell source for fusion is a B cell line transformed by EBV, as in this, ouabain is also used for drug selection of hybrids, because the B cells transformed by EBV are easily killed by drugs, and the myeloma partner used is selected to be resistant to ouabain.

Cultivation provides a hybridoma colony from which a specific hybridoma is selected. Typically, the selection of hybridomas is carried out by diluting culture cells in a microtiter plate by monoclonal dilution, and then testing the desired reactivity of a single clone supernatant (about two to three weeks later). The assay should be sensitive, simple and fast, such as radioimmunoassay, enzyme immunoassay, cytotoxicity assay, plaque assay, dot immunobinding assay, etc. The selected hybridoma is then serially diluted or sorted by flow cytometry and cloned into a single cell line that produces antibodies, and then the clone can be propagated indefinitely to provide mAb. Cell lines can be used to produce MAbs in two basic ways. Samples of hybridomas can be injected (usually into the peritoneal cavity) into animals (e.g., mice). Optionally, animals are sensitized with hydrocarbons, particularly oils such as pristane (tetramethylpentadecane) before injection. When using human hybridomas in this way, it is best to inject immunocompromised mice such as SCID mice to prevent tumor rejection. The injected animal produces a tumor that secretes a specific monoclonal antibody produced by the fused cell hybrid. Body fluids of the animal, such as serum or ascites, can then be extracted to provide high concentrations of MAbs. Individual cell lines can also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained at high concentrations. Alternatively, human hybridoma cell lines can be used in vitro to produce immunoglobulins in the cell supernatant. The cell lines can be adapted to grow in serum-free medium to optimize the ability to recover highly purified human monoclonal immunoglobulins.

If desired, the MAbs produced by either method can be further purified using filtration, centrifugation, and various chromatographic methods such as FPLC or affinity chromatography. Monoclonal antibody fragments of the present disclosure can be obtained from purified monoclonal antibodies by methods including digestion with enzymes such as pepsin or papain and/or cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present disclosure can be synthesized using an automated peptide synthesizer.

It is also considered that molecular cloning methods can be used to produce monoclones. For this reason, RNA can be isolated from hybridoma cell lines, and antibody genes are obtained by RT-PCR, and the antibody genes are cloned into immunoglobulin expression vectors. Alternatively, a combined immunoglobulin phagemid library is prepared by RNA isolated from a cell line, and the phagemid expressing a suitable antibody is selected by panning with viral antigens. Compared with conventional hybridoma technology, the advantage of this method is that approximately 10 ⁴ times of antibodies can be produced and screened in a single round, and new specificity is produced by combining H chain and L chain, which further increases the chance of finding a suitable antibody.

Recently, additional methods for generating mAbs, such as scFv phage display, have been developed (see CM Hammers and JR Stanley, Antibody phage display: technique and applications, J Invest Dermatol (2014) 134:e17). Typically, a panel of human mAbs that bind to a target protein (e.g., human LILRB1) is generated by panning a large number of different human scFv phage-displayed antibody libraries.

To generate human scFv phage displayed antibody libraries, RNA is extracted from selected cell sources, such as peripheral blood mononuclear cells. The RNA is then reverse transcribed into cDNA, which is used for PCR of the VH and VL chains of the encoded antibodies. Specific primer sets specific to different VH and VL chain region gene families allow amplification of all transcribed rearranged variable regions within a given immunoglobulin repertoire, reflecting all antibody specificities of a particular individual.

The VH and VL PCR products representing the antibody repertoire were ligated into a phage display vector engineered to express the VH and VL as scFv fused to the pilli minor capsid protein of the filamentous phage of Escherichia coli (E. coli), originally derived from the M13 phage. This generates a library of phages, each of which expresses the scFv on its surface and carries a vector with the corresponding nucleotide sequence therein.

Then by the technology called biological panning, the library is screened for the phages that are bound to the target antigen by the surface scFv expressed by it. In short, the target protein is coated on a solid phase for incubation with the phage library. After washing and elution, the phages rich in antigen are recovered and used for the next round of phage panning. After at least three rounds of phage panning, single bacterial colonies are picked for phage ELISA and other functional/genetic analysis.

Positive hits in the scFv region were sequenced and converted into fully human IgG heavy and light chain constructs, which were used to generate the mAb of interest using the methods disclosed above. For example, the IgG expression plasmid was co-transfected into Expi293 cells using the transfection reagent PEI. After 7 days of expression, the supernatant was harvested and the antibody was purified by affinity chromatography using protein A resin.

Other U.S. patents (each incorporated herein by reference) that teach the production of antibodies useful in the present disclosure include U.S. Patent 5,565,332, which describes the use of combinatorial methods to produce chimeric antibodies; U.S. Patent 4,816,567, which describes recombinant immunoglobulin preparations; and U.S. Patent 4,867,973, which describes antibody therapeutic conjugates.

B. Antibodies of the Disclosure

1. Antibodies against LILRB1

In the first case, an antibody or antigen-binding fragment thereof according to the present disclosure can be defined by its binding specificity, in this case to LILRB1. One skilled in the art can determine whether such an antibody falls within the scope of the present claims by assessing the binding specificity/affinity of a given antibody using techniques well known to those skilled in the art.

On the one hand, antibodies and antigen-binding fragments that specifically bind to LILRB1 are provided. In some embodiments, such antibodies regulate the activation of LILRB1 when bound to LILRB1. In certain embodiments, the antibody or antigen-binding fragment activates LILRB1 when bound to LILRB1. In certain embodiments, the antibody or antigen-binding fragment inhibits the activation of LILRB1 when bound to LILRB1. In certain embodiments, the antibody or antigen-binding fragment can specifically interfere with, block or reduce the interaction between LILRB1 and its binding partner when bound to LILRB1. In certain embodiments, the antibodies or antigen-binding fragments provided herein specifically or selectively bind to human LILRB1.

In some embodiments, the antibody or antigen-binding fragment specifically binds to human LILRB1 and/or substantially inhibits the binding of human LILRB1 to MHC class I molecules, such as HLA-G, by at least about 20% to 40%, 40% to 60%, 60% to 80%, 80% to 85% or more. In some embodiments, the antibody or antigen-binding fragment has a Kd of less than (binds more tightly) ^10-6 , ^10-7 , ^10-8 , ^10-9 , ^10-10 , ^10-11 , ^10-12 , ^10-13 M. In some embodiments, the IC50 of the antibody or antigen-binding fragment for blocking the binding of MHC class I molecules such as HLA-G to LILRB1 is less than 10uM, 10uM to 1uM, 1000nM to 100nM, 100nM to 10nM, 10nM to 1nM, 1000pM to 500pM, 500pM to 200pM, less than 200pM, 200pM to 150pM, 200pM to 100pM, 100pM to 10pM, 10pM to 1pM.

In some embodiments, provided herein are antibodies or antigen-binding fragments having CDRs with the clone pairs shown in Tables 1 and 3.

In some embodiments, antibody can be defined by the variable sequence of antibody, and described variable sequence comprises other " framework " district.Antibody is characterized by heavy chain amino acid sequence and light chain amino acid sequence of clone pairing from table 6 and table 8.In addition, antibody sequence can be different from these sequences, particularly in the region outside CDR.For example, amino acid can be different from above listed amino acid by given percentage, for example 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology, or amino acid can be different from above listed amino acid by allowing conservative substitution (discussed below).Each of the aforementioned is applicable to the amino acid sequence of table 6 and table 8.In another embodiment, antibody derivative of the present disclosure comprises VL and VH domains having at most 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more conservative or non-conservative amino acid substitutions while still showing desired combination and functional properties.

Although the antibodies disclosed herein are produced as IgG, it may be useful to modify the constant region to change its function. The constant region of an antibody usually mediates the combination of the antibody with a host tissue or factor, including different cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Therefore, the term "antibody" includes complete immunoglobulins of IgA, IgG, IgE, IgD, IgM types (and their subtypes), wherein the light chain of the immunoglobulin can be a κ or λ type. In the light chain and heavy chain, the variable region and the constant region are connected by 35 "J" regions with about 12 or more amino acids, wherein the heavy chain also includes a "D" region with about 10 more amino acids. Generally, see "Fundamental Immunology" Chapter 7 (Paul, W. ed., 2nd edition, Raven Press, N.Y., New York) (1989).

The present disclosure further includes nucleic acids that hybridize to nucleic acids encoding antibodies disclosed herein. Typically, nucleic acids hybridize to nucleic acids encoding antibodies disclosed herein and also encoding antibodies that retain the ability to specifically bind to LILRB1 under medium or high stringency conditions. A first nucleic acid molecule is "hybridizable" with a second nucleic acid molecule when a single-stranded form of the first nucleic acid molecule can anneal to a second nucleic acid molecule under appropriate conditions of temperature and solution ionic strength (see Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 2001). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. Typical medium stringency hybridization conditions are 40% formamide with 5X or 6X SSC and 0.1% SDS at 42°C. High stringency hybridization conditions are 50% formamide, 5X or 6X SSC (0.15M NaCl and 0.015M sodium citrate) at 42°C, or optionally at higher temperatures (e.g., 57°C, 59°C, 60°C, 62°C, 63°C, 65°C or 68°C). Hybridization requires that the two nucleic acids contain complementary sequences, but depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The higher the degree of similarity or homology between the two nucleotide sequences, the higher the stringency with which the nucleic acids can hybridize. For hybrids greater than 100 nucleotides in length, equations for calculating melting temperatures have been derived (see Sambrook et al., supra). In order to hybridize with shorter nucleic acids (e.g., oligonucleotides), the position of the mismatch becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra).

Table 1. Amino acid sequences of the heavy chain CDRs of LILRB1 (B1) mAb

Table 2. Nucleic acid sequences of the heavy chain CDRs of LILRB1 (B1) mAb

Table 3. Amino acid sequences of the light chain CDRs of LILRB1 (B1) mAb

Table 4. Nucleic acid sequences of LILRB1 (B1) mAb CDRs

Table 5. LILRB1 mAb heavy chain variable region nucleotide sequences

Table 6. LILRB1 mAb heavy chain variable region amino acid sequence

Table 7. LILRB1 mAb light chain variable region nucleotide sequences

Table 8. LILRB1 mAb light chain variable region amino acid sequences

2. Exemplary Epitopes and Competing Antigen Binding Proteins

In another aspect, the present disclosure provides epitopes to which anti-LILRB1 antibodies bind. In some embodiments, the epitopes bound by the antibodies described herein are useful. In certain embodiments, the epitopes provided herein can be used to isolate antibodies or antigen-binding proteins that bind to LILRB1. In certain embodiments, the epitopes provided herein can be used to produce antibodies or antigen-binding proteins that bind to LILRB1. In certain embodiments, the epitopes or sequences comprising the epitopes provided herein can be used as immunogens to produce antibodies or antigen-binding proteins that bind to LILRB1. In certain embodiments, the epitopes described herein or sequences comprising the epitopes described herein can be used to interfere with the biological activity of LILRB1.

In some embodiments, antibodies or antigen-binding fragments thereof that bind to any of the epitopes are particularly useful. In some embodiments, the epitopes provided herein modulate the biological activity of LILRB1 when bound by an antibody. In some embodiments, the epitopes provided herein activate LILRB1 when bound by an antibody. In some embodiments, the epitopes provided herein inhibit the activation of LILRB1 when bound by an antibody. In some embodiments, the epitopes provided herein block the interaction between LILRB1 and its binding partner when bound by an antibody.

In some embodiments, domains/regions containing residues that are in contact with or buried by the antibody can be identified by mutating specific residues in LILRB1 and determining whether the antibody can bind to the mutated LILRB1 protein. By making many individual mutations, residues that play a direct role in binding or are close enough to the antibody that mutation can affect the binding between the antibody and the antigen can be identified. From the knowledge of these amino acids, domains or regions of the antigen that contain residues that are in contact with or covered by the antibody can be elucidated. Such domains can include binding epitopes for antigen binding proteins.

In another aspect, the present disclosure provides antigen binding proteins that compete with one of the exemplified antibodies or antigen binding fragments that bind to an epitope described herein for specific binding to LILRB1. Such antigen binding proteins may also bind to the same epitope or overlapping epitope as one of the antibodies or antigen binding fragments exemplified herein. It is expected that antigen binding proteins that compete with or bind to the same epitope as the exemplified antibodies show similar functional properties. Exemplified antibodies include those described above, including those having heavy chain variable regions and light chain variable regions and CDRs included in Tables 1 and 3, heavy chains and light chains shown in Tables 6 and 8, and heavy chain and light chain coding regions shown in Tables 5 and 7.

C. Engineering of Antibody Sequences

In various embodiments, the sequence of an identified antibody may be selected for engineering for various reasons, such as improved expression, improved cross-reactivity, or reduced off-target binding. The following is a general discussion of techniques related to antibody engineering.

Hybridomas can be cultured, then cells lysed and total RNA extracted. Random hexamers can be used with RT to generate cDNA copies of RNA, followed by PCR using a multiplex mix of PCR primers expected to amplify all human variable gene sequences. PCR products can be cloned into pGEM-T Easy vectors and then sequenced by automated DNA sequencing using standard vector primers. Binding and neutralization assays can be performed using antibodies collected from hybridoma supernatants and purified by FPLC using a protein G column. Recombinant full-length IgG antibodies can be produced by subcloning the heavy and light chain Fv DNA from the cloning vector into an IgG plasmid vector, transfecting into 293 Freestyle cells or CHO cells, and collecting purified antibodies from 293 or CHO cell supernatants.

The rapid availability of antibodies produced in the same host cells and cell culture process as the final cGMP manufacturing process has the potential to reduce the duration of process development programs. Lonza has developed a general method for the rapid production of small quantities (up to 50 g) of antibodies in CHO cells using pooled transfectants grown in CDACF medium. Although slightly slower than true transient systems, advantages include higher product concentrations and the use of the same host and process as the production cell line. Growth and productivity example of GS-CHO pools expressing model antibodies in disposable bioreactors: In disposable bag bioreactor cultures (5 L working volume) operated in batch feeding mode, a harvested antibody concentration of 2 g/L was achieved within 9 weeks of transfection.

Antibody molecules will include fragments produced, for example, by proteolytic cleavage of mAbs (e.g., F(ab'), F(ab') ₂ ) or single chain immunoglobulins that can be produced, for example, by recombinant means. Such antibody derivatives are monovalent. In one embodiment, such fragments can be combined with each other, or with other antibody fragments or receptor ligands to form "chimeric" binding molecules. Importantly, such chimeric molecules may contain substituents that are capable of binding to different epitopes of the same molecule.

1. Antigen Binding Modification

In a related embodiment, the antibody is a derivative of the disclosed antibody, for example, an antibody comprising a CDR sequence identical to the CDR sequence in the disclosed antibody (e.g., a chimeric antibody or a CDR-grafted antibody). Alternatively, it may be desirable to modify, such as introducing conservative changes into the antibody molecule. When making such changes, the hydropathic index of the amino acid may be considered. The importance of the hydropathic amino acid index in conferring interactive biological functions on proteins is generally understood in the art (Kyte and Doolittle, 1982). It is understood that the relative hydrophilicity of amino acids contributes to the secondary structure of the resulting protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, etc.

It is also understood in the art that substitutions of similar amino acids can be effectively made based on hydrophilicity. U.S. Pat. No. 4,554,101 (incorporated herein by reference) states that the maximum local average hydrophilicity of a protein, governed by the hydrophilicity of the adjacent amino acids of the protein, correlates with the biological properties of the protein. As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartic acid (+3.0±1), glutamic acid (+3.0±1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2); Amide (+0.2) and threonine (-0.4); sulfur-containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, non-aromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5±1), alanine (-0.5) and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5) and tyrosine (-2.3).

It is understood that an amino acid can be substituted for another amino acid of similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, substitution of amino acids whose hydrophilicity values are within ±2 is preferred, substitution of amino acids whose hydrophilicity values are within ±1 is particularly preferred, and substitution of amino acids whose hydrophilicity values are within ±0.5 is even more particularly preferred.

As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, such as their hydrophobicity, hydrophilicity, charge, size, etc. Exemplary substitutions taking into account various of the above characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine.

The present disclosure also contemplates isotype modification. By modifying the Fc region to have a different isotype, different functions can be achieved. For example, changing to _IgG1 can increase antibody-dependent cellular cytotoxicity, changing to class A can improve tissue distribution, and changing to class M can improve valency.

Modified antibodies can be prepared by any technique known to those skilled in the art, including expression by standard molecular biology techniques or chemical synthesis of polypeptides. Methods for recombinant expression are discussed elsewhere in this document.

2. Fc region modification

The antibodies disclosed herein can also be engineered to include modifications within the Fc region, typically to change one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding and/or effector function (e.g., antigen-dependent cellular toxicity). In addition, the antibodies disclosed herein can be chemically modified (e.g., one or more chemical moieties can be attached to the antibody) or modified to change its glycosylation to again change one or more functional properties of the antibody. Each of these embodiments is described in further detail below. The numbering of the residues in the Fc region is the numbering of the EU index of Kabat. The antibodies disclosed herein also include antibodies with modified (or blocked) Fc regions to provide altered effector functions. See, e.g., U.S. Patent No. 5,624,821; WO2003/086310; WO2005/120571; WO2006/0057702. Such modifications can be used to enhance or inhibit various responses of the immune system, which may have a beneficial effect on diagnosis and therapy. Changes in the Fc region include amino acid changes (substitutions, deletions, and insertions), glycosylation or deglycosylation, and the addition of multiple Fcs. Changes in the Fc can also change the half-life of the antibody in the therapeutic antibody, thereby achieving a lower dosing frequency, and thus increasing convenience and reducing the use of materials. It is reported that this mutation eliminates the heterogeneity of the inter-heavy chain disulfide bonds in the hinge region.

In one embodiment, the hinge region of CH1 is modified so that the number of cysteine residues in the hinge region is increased or decreased. This method is further described in U.S. Patent No. 5,677,425. The number of cysteine residues in the hinge region of CH1 is changed to, for example, promote the assembly of light and heavy chains or to increase or reduce the stability of the antibody. In another embodiment, the antibody is modified to increase its biological half-life. Various methods are possible. For example, one or more of the following mutations can be introduced: T252L, T254S, T256F, as described in U.S. Patent No. 6,277,375. Alternatively, in order to increase the biological half-life, the antibody can be changed in the CH1 or CL region to contain a salvage receptor binding epitope of two loops of the CH2 domain taken from the Fc region of IgG, as described in U.S. Patent Nos. 5,869,046 and 6,121,022. In yet other embodiments, the Fc region is changed to change the effector function of the antibody by replacing at least one amino acid residue with a different amino acid residue. For example, one or more amino acids selected from amino acid residues 234, 235, 236, 237, 297, 318, 320 and 322 can be substituted with different amino acid residues so that the antibody has an altered affinity for an effector ligand, but retains the antigen binding ability of the parent antibody. The effector ligand to which affinity is altered can be, for example, an Fc receptor or the C1 component of complement. This method is further described in detail in U.S. Patents 5,624,821 and 5,648,260.

In another example, one or more amino acid residues within amino acid positions 231 and 239 are altered to thereby alter the ability of the antibody to fix complement. This method is further described in PCT Publication WO 94/29351. In yet another example, the Fc region is modified to increase or decrease the ability of the antibody to mediate antibody-dependent cellular cytotoxicity (ADCC) and/or to increase or decrease the affinity of the antibody for Fcγ receptors by modifying one or more amino acids at the following positions: 238, 239, 243, 248, 249, 252, 254, 255, 256, 258, 264, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315 90, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 309, 312, 315, 320, 322, 324, 326, 327, 329, 330, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398, 414, 416, 419, 430, 434, 435, 437, 438 or 439. This approach is further described in PCT Publication WO 00/42072. In addition, the binding sites on human IgG1 for FcγR1, FcγRII, FcγRIII and FcRn have been mapped, and variants with improved binding have been described. Specific mutations at positions 256, 290, 298, 333, 334 and 339 are shown to improve binding to FcγRIII. In addition, the following combination mutants are shown to improve FcγRIII binding: T256A/S298A, S298A/E333A, S298A/K224A and S298A/E333A/K334A.

In one embodiment, the Fc region is modified to reduce the ability of the antibody to mediate effector functions and/or increase anti-inflammatory properties by modifying residues 243 and 264. In one embodiment, the Fc region of the antibody is modified by changing the residues at positions 243 and 264 to alanine. In one embodiment, the Fc region is modified to reduce the ability of the antibody to mediate effector functions and/or increase anti-inflammatory properties by modifying residues 243, 264, 267 and 328.

In one embodiment, the Fc region is modified to eliminate the ability of the antibody to mediate effector function by modifying residues 234, 235, and 329 to alanine or glycine (L234A-L235A-P329G).

In one embodiment, the Fc region is modified to eliminate the ability of the antibody to mediate effector function by modifying residue 297 to alanine (N234A).

In still another embodiment, the antibody comprises a specific glycosylation pattern. For example, a deglycosylated antibody (i.e., the antibody lacks glycosylation) can be prepared. The glycosylation pattern of the antibody can be changed, for example, to increase the affinity or avidity of the antibody to the antigen. Such modifications can be accomplished by, for example, changing one or more glycosylation sites in the glycosylation site within the antibody sequence. For example, one or more amino acid substitutions can be performed, which results in the removal of one or more variable region framework glycosylation sites in the variable region framework glycosylation site, so as to eliminate glycosylation at the site. Such deglycosylation can increase the affinity or avidity of the antibody to the antigen. See, for example, U.S. Patents 5,714,350 and 6,350,861.

Antibodies can also be prepared in which the glycosylation pattern includes low-fucosylated or afucosylated glycans, such as low-fucosylated antibodies or afucosylated antibodies with reduced amounts of fucosyl residues on the glycans. Antibodies can also include glycans with an increased amount of bisecting GlcNac structures. It has been demonstrated that such altered glycosylation patterns improve the ADCC ability of the antibody. Such modifications can be accomplished, for example, by expressing the antibody in a host cell in which the glycosylation pathway is genetically engineered to produce glycoproteins with a specific glycosylation pattern. These cells have been described in the art and can be used as host cells in which the recombinant antibodies of the present invention are expressed to thereby produce antibodies with altered glycosylation. For example, the cell lines Ms704, Ms705, and Ms709 lack the fucosyltransferase gene FUT8 (α(1,6)-fucosyltransferase), such that antibodies expressed in the Ms704, Ms705, and Ms709 cell lines lack fucose on their carbohydrates. Ms704, Ms705 and Ms709 FUT8-/- cell lines were generated by targeted disruption of the FUT8 gene in CHO/DG44 cells using two alternative vectors (see U.S. Patent Publication No. 20040110704). For example, EP 1 176 195 describes a cell line with a functionally disrupted FUT8 gene encoding a fucosyltransferase, such that antibodies expressed in such cell lines exhibit low fucosylation by reducing or eliminating α-1,6 bond-related enzymes. EP 1176 195 also describes a cell line with low enzymatic activity for adding fucose to N-acetylglucosamine bound to the Fc region of an antibody or having no enzymatic activity, such as the rat myeloma cell line YB2/0 (ATCC CRL 1662). PCT Publication WO 03/035835 describes a variant CHO cell line, Lec13 cells, which has a reduced ability to attach fucose to Asn(297)-linked carbohydrates, also resulting in hypofucosylation of antibodies expressed in the host cells. Antibodies with modified glycosylation profiles can also be produced in eggs, as described in PCT Publication WO 06/089231. Alternatively, antibodies with modified glycosylation profiles can be produced in plant cells such as Lemna (U.S. Patent 7,632,983). Methods for producing antibodies in plant systems are disclosed in U.S. Patents 6,998,267 and 7,388,081. PCT Publication WO 99/54342 describes a cell line engineered to express a glycoprotein-modifying glycosyltransferase (e.g., β(1,4)-N-acetylglucosaminyltransferase III (GnTIII)) such that antibodies expressed in the engineered cell line exhibit increased bisecting GlcNac structures, which results in increased ADCC activity of the antibody.

Alternatively, the fucose residues of the antibody can be removed using a fucosidase, for example, fucosidase α-L-fucosidase removes fucosyl residues from the antibody. The antibodies disclosed herein further include antibodies produced in lower eukaryotic host cells, specifically fungal host cells, such as yeast and filamentous fungi, which have been genetically engineered to produce glycoproteins with mammalian or human-like glycosylation patterns. Compared to currently used mammalian cell lines, a specific advantage of these genetically modified host cells is the ability to control the glycosylation profile of glycoproteins produced in the cell, so that a composition of glycoproteins can be produced in which a specific N-glycan structure is dominant (see, for example, U.S. Patents 7,029,872 and 7,449,308). These genetically modified host cells have been used to produce antibodies that predominantly have a specific N-glycan structure.

In addition, since fungi such as yeast or filamentous fungi lack the ability to produce fucosylated glycoproteins, antibodies produced in such cells will lack fucose unless the cells are further modified to include an enzymatic pathway for producing fucosylated glycoproteins (see, e.g., PCT Publication WO 2008112092). In certain embodiments, the antibodies disclosed herein further include those produced in lower eukaryotic host cells, and the antibodies include fucosylated and non-fucosylated hybrid and complex N-glycans, including bisected and multiantennary species, including but not limited to N-glycans such as GlcNAc(1-4)Man3GlcNAc2; Gal(1-4)GlcNAc(1-4)Man3GlcNAc2; NANA(1-4)Gal(1-4)GlcNAc(1-4)Man3GlcNAc2. In a specific embodiment, the antibody compositions provided herein may include an antibody having at least one hybrid N-glycan selected from the group consisting of: GlcNAcMan5GlcNAc2; GalGlcNAcMan5GlcNAc2 and NANAGalGlcNAcMan5GlcNAc2. In a specific aspect, the hybrid N-glycan is the predominant N-glycan species in the composition. In a further aspect, the hybrid N-glycan is a specific N-glycan species comprising about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% of the hybrid N-glycan in the composition.

In a specific embodiment, the antibody composition provided herein includes an antibody having at least one complex N-glycan selected from the group consisting of: GlcNAcMan3GlcNAc2; GalGlcNAcMan3GlcNAc2; NANAGalGlcNAcMan3GlcNAc2; GlcNAc2Man3GlcNAc2; GalGlcNAc2Man3GlcNAc2; Gal2GlcNAc2Man3GlcNAc2; NANAGal2GlcNAc2Man3GlcNAc2 and NANA2Gal2GlcNAc2Man3GlcNAc2. In a specific aspect, the complex N-glycan is the main N-glycan species in the composition. In another aspect, the complex N-glycan is a specific N-glycan species that includes about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% of the complex N-glycan in the composition. In a specific embodiment, the N-glycan is fucosylated. Typically, fucose is linked to GlcNAc at the reducing end of the N-glycan through an α1,3-linkage; linked to GlcNAc at the reducing end of the N-glycan through an α1,6-linkage; linked to Gal at the non-reducing end of the N-glycan through an α1,2-linkage; linked to GlcNac at the non-reducing end of the N-glycan through an α1,3-linkage; or linked to GlcNAc at the non-reducing end of the N-glycan through an α1,4-linkage.

Thus, in a specific aspect of the above glycoprotein composition, the glycoform is in an α1,3-linked or α1,6-linked fucose to produce a glycoform selected from the group consisting of: Man5GlcNAc2(Fuc), GlcNAcMan5GlcNAc2(Fuc), Man3GlcNAc2(Fuc), GlcNAcMan3GlcNAc2(Fuc), GlcNAc2Man3GlcNAc2(Fuc), GalGlcNAc2Man3GlcNAc2(Fuc), Gal2GlcNAc2Man3GlcNAc2(Fuc), NANAGal2GlcNAc2Man3GlcNAc2(Fuc), and NANA2Gal2GlcNAc2Man3GlcNAc2(Fuc); and in an α1,3-linked or α1,4-linked fucose to produce a glycoform selected from the group consisting of: GlcNAc(Fuc)Man5GlcNAc2, GlcNAcMan5GlcNAc2(Fuc), Man3GlcNAc2(Fuc), GlcNAcMan3GlcNAc2(Fuc), GlcNAc2Man3GlcNAc2(Fuc); lcNAc(Fuc)Man3GlcNAc2, GlcNAc2(Fuc1-2)Man3GlcNAc2, GalGlcNAc2(Fuc1-2)Man3GlcNAc2, Gal2GlcNAc2(Fuc1-2)Man3GlcNAc2, NANAGal2GlcNAc2(Fuc1-2)Man3GlcNAc2 and NANA2Gal2GlcNAc2(Fuc1-2 )Man3GlcNAc2; or in an α1,2-linked fucose to produce a glycoform selected from the group consisting of Gal(Fuc)GlcNAc2Man3GlcNAc2, Gal2(Fuc1-2)GlcNAc2Man3GlcNAc2, NANAGal2(Fuc1-2)GlcNAc2Man3GlcNAc2 and NANA2Gal2(Fuc1-2)GlcNAc2Man3GlcNAc2.

In other aspects, antibodies include high mannose N-glycans, including but not limited to Man8GlcNAc2, Man7GlcNAc2, Man6GlcNAc2, Man5GlcNAc2, Man4GlcNAc2, or N-glycans composed of Man3GlcNAc2 N-glycan structures. In the above-mentioned other aspects, complex N-glycans further include fucosylated and non-fucosylated bisected and multi-antennary species. As used herein, the terms "N-glycans" and "glycoforms" are used interchangeably and refer to oligosaccharides connected to N-, for example, oligosaccharides connected to the asparagine residues of a polypeptide by an asparagine-N-acetylglucosamine bond. N-connected glycoproteins contain N-acetylglucosamine residues connected to the amide nitrogen of asparagine residues in proteins.

D. Single-chain antibody

Single chain variable fragment (scFv) is the fusion of the variable region of the heavy chain and light chain of immunoglobulin, connected together by short (usually serine, glycine) joints. This chimeric molecule retains the specificity of the original immunoglobulin, although the constant region is removed and a linker peptide is introduced. This modification usually keeps the specificity unchanged. These molecules were produced in order to promote phage display in history, where it is very convenient to express the antigen binding domain as a single peptide. Alternatively, scFv can be directly produced by the heavy chain and light chain of the subclone derived from a hybridoma. Single chain variable fragments lack the constant Fc region found in the complete antibody molecule, and therefore lack the common binding site (e.g., protein A/G) for purifying antibodies. These fragments can usually be purified/fixed using protein L, because protein L interacts with the variable region of κ light chain.

Flexible linkers typically include amino acid residues that promote helices and turns, such as alanine, serine, and glycine. However, other residues may also play a role. Tang et al. (1996) used phage display as a means to rapidly select custom linkers for single-chain antibodies (scFv) from a library of protein linkers. A random linker library was constructed in which the genes for the heavy and light chain variable domains were linked by segments encoding 18 amino acid polypeptides of variable composition. The scFv library (approximately 5×10 ⁶ different members) was displayed on filamentous phage and affinity selected with haptens. The population of selected variants exhibited a significant increase in binding activity, but retained considerable sequence diversity. Screening of 1054 individual variants subsequently produced catalytically active scFvs that were efficiently produced in a soluble form. Sequence analysis revealed the conserved proline in the two residues after the V _H C-terminus in the linker and a large number of arginines and prolines at other positions as the only common features of the selected tethers.

The recombinant antibodies of the present disclosure may also be directed to sequences or portions that allow dimerization or multimerization of receptors. Such sequences include sequences derived from IgA that allow binding to J chains to form multimers. Another multimerization domain is the Gal4 dimerization domain. In other embodiments, the chains may be modified with agents such as biotin/avidin that allow the combination of two antibodies.

In a separate embodiment, single-chain antibodies can be produced by connecting receptor light chains and heavy chains using non-peptide linkers or chemical units. Typically, light chains and heavy chains will be produced, purified, and then connected together in a suitable manner (i.e., the N-terminal of the heavy chain is connected to the C-terminal of the light chain by a suitable chemical bridge).

Cross-linking agents are used to form molecular bridges that connect the functional groups of two different molecules, such as stabilizers and coagulants. However, it is contemplated that dimers or multimers of the same analog or heteromeric complexes including different analogs may be produced. In order to connect two different compounds in a stepwise manner, heterobifunctional cross-linking agents may be used to eliminate unwanted homopolymer formation.

Exemplary heterobifunctional cross-linkers include two reactive groups: one reactive group that reacts with primary amine groups (e.g., N-hydroxysuccinimide) and another reactive group that reacts with thiol groups (e.g., pyridyl disulfide, maleimide, halogen, etc.) Through the primary amine-reactive group, the cross-linker can react with lysine residues of one protein (e.g., a selected antibody or fragment), and through the thiol-reactive group, the cross-linker already attached to the first protein reacts with cysteine residues (free sulfhydryl groups) of the other protein (e.g., the selection agent).

It is preferred to use a cross-linking agent that has reasonable stability in blood. Many types of disulfide-containing linkers are known to be successfully used to conjugate targeting agents and therapeutic/prophylactic agents. Linkers containing sterically hindered disulfide bonds may provide greater stability in vivo, thereby preventing the targeting peptide from being released before reaching the site of action. Therefore, these linkers are a group of linkers.

Another cross-linking reagent is SMPT, which is a bifunctional cross-linker comprising a disulfide bond that is "sterically hindered" by adjacent benzene rings and methyl groups. It is believed that the steric hindrance of the disulfide bond serves to protect the bond from attack by thiol anions such as glutathione, which may be present in tissues and blood, and thereby helps prevent decoupling of the conjugate prior to delivery of the attached agent to the target site.

Like many other known cross-linking reagents, SMPT cross-linking reagents have the ability to cross-link functional groups, such as the SH of cysteine or primary amines (e.g., the epsilon amino group of lysine). Another possible type of cross-linking reagent includes heterobifunctional photoactive phenyl azides containing cleavable disulfide bonds, such as sulfosuccinimidyl-2-(p-azidosalicylamido)ethyl-1,3'-dithiopropionate. The N-hydroxy-succinimidyl group reacts with primary amino groups, and the phenyl azide (upon photolysis) reacts non-selectively with any amino acid residue.

In addition to sterically hindered cross-linkers, non-sterically hindered linkers may also be used in accordance with the present invention. Other useful cross-linkers that are not believed to include or generate protected disulfides include SATA, SPDP, and 2-iminothiolane (Wawrzynczak and Thorpe, 1987). The use of such cross-linkers is well known in the art. Another embodiment involves the use of flexible linkers.

U.S. Patent No. 4,680,338 describes bifunctional linkers that can be used to produce conjugates of ligands with amine-containing polymers and/or proteins, particularly for forming antibody conjugates with chelators, drugs, enzymes, detectable labels, and the like. U.S. Patent Nos. 5,141,648 and 5,563,250 disclose cleavable conjugates containing labile bonds that are cleavable under various mild conditions. Such linkers are particularly useful because the agent of interest can be directly bonded to the linker, where cleavage results in the release of the active agent. Specific uses include adding free amino groups or free sulfhydryl groups to proteins, such as antibodies or drugs.

U.S. Patent No. 5,856,456 provides peptide linkers for connecting polypeptide components to prepare fusion proteins, such as single-chain antibodies. The linker is up to about 50 amino acids in length, includes at least one occurrence of a charged amino acid (preferably, arginine or lysine), followed by a proline, and is characterized by greater stability and reduced aggregation. U.S. Patent No. 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separation techniques.

E. Purification

In certain embodiments, the antibodies of the present disclosure may be purified. As used herein, the term "purified" is intended to refer to a composition that can be separated from other components, wherein the protein is purified to any degree relative to its naturally available state. Therefore, a purified protein also refers to a protein that is not affected by the environment in which it may naturally occur. When the term "substantially purified" is used, this name will refer to a composition in which a protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the protein in the composition.

Protein purification techniques are well known to those skilled in the art. These techniques involve, at one level, the crude fractionation of the cellular environment into polypeptide and non-polypeptide parts. After the polypeptide is separated from other proteins, the polypeptide of interest can be further purified using chromatography and electrophoresis techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suitable for preparing pure peptides are ion exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include precipitation with ammonium sulfate, PEG, antibodies, etc. or by thermal denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxyapatite and affinity chromatography; and combinations of such and other techniques.

In purifying the antibodies of the present disclosure, it may be necessary to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. Affinity columns that bind to the labeled portion of the polypeptide may be used to purify the polypeptide from other cellular components. As is known in the art, it is believed that the order in which the various purification steps are performed may be changed, or certain steps may be omitted, and still result in a suitable method for preparing a substantially purified protein or peptide.

Typically, intact antibodies are graded using an agent (i.e., protein A) that is bound to the Fc portion of the antibody. Alternatively, the antigen can be used to purify and select the appropriate antibody simultaneously. Such methods typically utilize a selection agent that is bound to a carrier, such as a column, filter, or pearl. The antibody is bound to a support, contaminants are removed (e.g., washed off), and the antibody is released by applying conditions (salt, heat, etc.).

In view of the present disclosure, those skilled in the art will be used for the various methods of quantifying the degree of purification of proteins or peptides. These methods include, for example, determining the specific activity of the active fraction or analyzing and evaluating the amount of polypeptides in the fraction by SDS/PAGE. Another method for evaluating the purity of the fraction is to calculate the specific activity of the fraction, to compare the specific activity with the specific activity of the initial extract, and therefore calculate the purity. Of course, the actual unit used to represent the amount of activity will depend on the specific assay technique selected for purification and whether the expressed protein or peptide exhibits detectable activity.

It is known that the migration of polypeptides can vary with different conditions of SDS/PAGE, sometimes significantly (Capaldi et al., 1977). It should therefore be understood that the apparent molecular weight of a purified or partially purified expression product may vary under different electrophoretic conditions.

III. LILRB1-related diseases

LILRB1, a member of the LILR receptor family containing ITIM, plays a key role in the regulation of innate and adaptive immunity. The LILRB1 is expressed on various types of immune cells including NK cells and acts as an immune checkpoint protein. The expression of LILRB in myeloid-derived suppressor cells (MDSC) can promote tumor growth and lead to an inhibitory immune microenvironment for tumor progression and metastasis. On the other hand, the use of agonistic antibodies to activate LILRB1 signaling may reduce tissue inflammation and can be used for the management of autoimmune diseases. Provided herein are agonistic and antagonistic human LILRB1 monoclonal antibodies with specific targeting properties for regulating LILRB1 signaling. These LILRB1 antibodies can be used to treat human diseases including cancer, autoimmune diseases and inflammatory conditions.

Although hyperproliferative disorders may be associated with any disease that causes cells to begin to multiply uncontrollably, the classic example is cancer.

Examples of cancer can generally be classified into solid tumors and hematologic malignancies. Solid tumors include, but are not limited to, adrenal cancer, bile duct cancer, bone cancer, brain cancer (e.g., astrocytoma, brain stem glioma, craniopharyngioma, ependymoma, hemangioblastoma, medulloblastoma, meningioma, oligodendroglioma, spinal axis tumors), breast cancer (including acoustic neuroma, basal breast cancer, ductal carcinoma, and lobular breast cancer), cervical cancer, choriocarcinoma, colon cancer, colorectal cancer, esophageal cancer, eye cancer, gastric cancer, glioblastoma, head and neck cancer, renal cancer (including Wilms tumors), ovarian cancer, cervical cancer, ovarian cancer, esophage ... The invention relates to cancer of the lungs, including ovarian cancer, pancreatic cancer, fibrosarcoma, leiomyosarcoma, liposarcoma, myxosarcoma, osteoblastic sarcoma, rhabdomyosarcoma, synovial sarcoma, skin cancer, including basal cell carcinoma, sebaceous gland carcinoma, squamous cell carcinoma, testicular cancer, including seminoma, thymic cancer, thyroid cancer (e.g., medullary thyroid cancer, papillary thyroid cancer), uterine cancer, and vaginal cancer.

Hematologic malignancies include, but are not limited to, blastic plasmacytoid dendritic cell neoplasms (BPDCN), heavy chain disease, leukemia (including, but not limited to, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML) (including, but not limited to, acute promyelocytic leukemia (APL) or M3 AML, acute myelomonocytic leukemia or M4 AML, acute monocytic leukemia or M5 AML), B-cell leukemia, chronic lymphocytic leukemia (CLL), chronic myelomonocytic leukemia (CMML), chronic myeloid leukemia (CML), pre-B acute lymphocytic leukemia (pre-B ALL), diffuse large B-cell lymphoma (DLBCL), extranodal NK/T-cell lymphoma, hairy cell leukemia, HHV8-related primary effusion lymphoma, plasmablastic lymphoma, primary CNS lymphoma, primary mediastinal large B-cell lymphoma, T-cell/histiocyte-rich B-cell lymphoma), lymphoma (including but not limited to Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia), multiple myeloma (MM), myelodysplastic syndrome (MDS), myeloproliferative neoplasms and polycythemia vera.

Immunotherapy has great hope for achieving lasting anti-tumor effect. Immune checkpoint PD-1 and CTLA-4 blocking therapy have successfully treated some types of cancers instead of other types of cancers. These immunotherapy targets inhibitory molecules on T cells to reactivate dysfunctional T cells in the tumor microenvironment (TME). Other immune cell populations, including monocytes, are present in TME in even larger quantities than T cells. In fact, monocyte-derived macrophages are the most abundant immune cell populations in tumor tissues. Although these innate cells have the ability to kill tumor cells and trigger or reactivate T cells, the innate cells become dysfunctional in TME and become MDSC and tumor-associated macrophages (TAMs) that support tumor development and suppress immune monitoring and attack. MDSCs including monocytic MDSCs (M-MDSCs) and polymorphonuclear MDSCs (PMN-MDSCs) represent heterogeneous populations of immature myeloid cells that fail to terminally differentiate. TAMs are mixed macrophage populations in TME. TAMs are anti-inflammatory and are associated with poor prognosis. Despite their phenotypic plasticity, MDSCs and TAMs are defined by their immunosuppressive functions. Removing, reprogramming, or blocking the trafficking of these immunosuppressive monocytes is becoming an attractive anticancer therapeutic strategy.

LILRB1 is expressed on MDSCs and TAMs in the TME. Therapeutic blockade of LILRB1 has the potential to reactivate or enhance antitumor immune responses in patients presenting with disease that is unresponsive/relapsed to T cell checkpoint inhibitors.

LILRB1 expression on myeloid cells may regulate systems involved in autoimmune and inflammatory diseases. Therapeutic activation or agonism of LILRB1 has the potential to treat autoimmune or inflammatory diseases.

Autoimmune or inflammatory diseases include, but are not limited to, acquired immunodeficiency syndrome (AIDS, which is a viral disease with an autoimmune component), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy, sprue-dermatitis herpetiformis, chronic fatigue immune dysfunction syndrome (CFS), and inflammatory bowel disease. FIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), cicatricial pemphigoid, cold agglutinin disease, crest syndrome, Crohn's disease, Degos' disease, juvenile dermatomyositis, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease Myasthenia gravis, myasthenia gravis, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, systemic scleroderma, progressive systemic sclerosis (PSS), systemic sclerosis (SS), Sjögren's syndrome, stiff-man syndrome, systemic lupus erythematosus (SLE), high Andersen's arteritis, temporal arteritis/giant cell arteritis, inflammatory bowel disease (IBD), ulcerative colitis, Cohen's disease, intestinal mucosal inflammation, wasting disease associated with colitis, uveitis, vitiligo and Wegener's granulomatosis, Alzheimer's disease, asthma, atopic allergy, allergies, atherosclerosis, bronchial asthma, eczema, glomerulonephritis, graft-versus-host disease, hemolytic anemia, osteoarthritis, sepsis, stroke, tissue and organ transplantation, vasculitis, diabetic retinopathy, ventilator-induced lung injury, viral infections, autoimmune diabetes, etc. Inflammatory disorders include, for example, chronic and acute inflammatory disorders.

IV. Treatment of Diseases

A. Formulation and Administration

The present disclosure provides pharmaceutical compositions comprising anti-LILRB antibodies and antigens for producing the antibodies. Such compositions comprise a preventively or therapeutically effective amount of the antibody or fragment thereof and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopoeia for use in animals and more specifically in humans. The term "carrier" refers to a diluent, excipient or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. When the pharmaceutical composition is administered intravenously, water is a specific carrier. Saline solutions and aqueous solutions of glucose and glycerol can also be used as liquid carriers, especially liquid carriers for injectable solutions. Other suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, ethylene glycol, water, ethanol and the like.

If necessary, the composition may also contain a small amount of wetting agent or emulsifier or pH buffer. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations, etc. Oral formulations may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable medicaments are described in Remington's Pharmaceutical Sciences. Such compositions will contain a preventive or therapeutically effective amount of an antibody or fragment thereof (preferably in purified form) together with a suitable amount of carrier to provide a form suitable for application to a patient. The formulation should be suitable for administration, which may be oral, intravenous, intraarterial, buccal, intranasal, atomized, bronchial inhalation, or delivered by mechanical ventilation.

As described herein, the antibodies of the present disclosure can be formulated for parenteral administration, for example, for injection by intradermal, intravenous, intraarterial, intramuscular, subcutaneous, intratumoral or even intraperitoneal routes. Alternatively, the antibody can be directly applied to the mucosa by a local route, for example, by nasal drops, inhalation or by a nebulizer. Pharmaceutically acceptable salts include acid salts, and the pharmaceutically acceptable salts are formed with inorganic acids such as hydrochloric acid or phosphoric acid or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. The salts formed by the free carboxyl group can also be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide) and organic bases (such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine (procaine) etc.).

The passive transfer of antibodies, referred to as artificially acquired passive immunity, will generally involve the use of intravenous injection. The form of the antibodies can be human or animal plasma or serum, as mixed human immunoglobulins for intravenous (IVIG) or intramuscular (IG) use, as high titer human IVIG or IG from immunized or from donors recovering from the disease, and as monoclonal antibodies (MAbs). This immunity generally lasts only a short period of time, and there is also a potential risk of hypersensitivity and serum sickness, especially gamma globulins of non-human origin. However, passive immunity provides immediate protection. The antibodies will be deployed in a carrier suitable for injection (i.e., sterile and injectable).

Typically, the components of the compositions of the present disclosure are provided separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or anhydrous concentrate in an airtight container such as an ampoule or a sachet indicating the amount of active agent. When the composition is administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the components can be mixed prior to administration.

The compositions of the present disclosure may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

B. Cell therapy

On the other hand, the present disclosure provides immune cells expressing chimeric antigen receptors (CAR). In some embodiments, CAR includes an antigen binding fragment provided herein. In one embodiment, the CAR protein includes from N-terminus to C-terminus: a leader peptide, an anti-LILRB1 heavy chain variable domain, a linker domain, an anti-LILRB1 light chain variable domain, a human IgG1-CH2-CH3 domain, a spacer region, a CD28 transmembrane domain, a 4-1BB intracellular costimulatory signaling, and a CD3ζ intracellular T cell signaling domain.

Also provided is a method for immunotherapy, comprising administering an effective amount of immune cells of the present disclosure. In one embodiment, a medical disease or condition is treated by transferring a population of immune cells that causes an immune response. In certain embodiments of the present disclosure, cancer or infection is treated by transferring a population of immune cells that causes an immune response. Provided herein is a method for treating cancer in an individual or delaying the progression of cancer, comprising administering an effective amount of antigen-specific cell therapy to the individual.

Immune cells can be T cells (e.g., regulatory T cells, CD4+T cells, CD8+T cells, or γ-δT cells), NK cells, constant NK cells, NKT cells, or macrophages. Also provided herein are methods for producing immune cells and engineering them, as well as methods for using and administering cells for adoptive cell therapy, in which case the cells can be autologous or allogeneic. Therefore, immune cells can be used as immunotherapy, such as targeting cancer cells.

Immune cells can be separated from subjects, specifically human subjects. Immune cells can be obtained from healthy human subjects, healthy volunteers or healthy donors. Immune cells can be obtained from subjects of interest, such as subjects suspected of having a specific disease or condition, subjects suspected of having susceptibility to a specific disease or condition, or subjects receiving therapy for a specific disease or condition. Immune cells can be collected from any position in the subject where immune cells are present, including but not limited to blood, cord blood, spleen, thymus, lymph nodes and bone marrow. The separated immune cells can be used directly, or the separated immune cells can be stored for a certain period of time, such as by freezing.

Immune cells can be enriched/purified from any tissue where immune cells are located, and the tissue includes but is not limited to blood (including blood collected by a blood bank or cord blood bank), spleen, bone marrow, tissue taken out and/or exposed during surgery, and tissue obtained by biopsy. Tissue/organs from which immune cells are enriched, separated and/or purified can be separated from both living and non-living subjects, wherein non-living subjects are organ donors. In a specific embodiment, immune cells are separated from blood such as peripheral blood or cord blood. In some aspects, the immune cells separated from cord blood have enhanced immunomodulatory ability, such as measured by CD4 or CD8 positive T cell suppression. In a specific aspect, immune cells are separated from the blood collected, particularly the cord blood collected, to enhance immunomodulatory ability. The blood collected can come from 2 or more sources, such as 3, 4, 5, 6, 7, 8, 9, 10 or more sources (e.g., donor subjects).

Immune cell colonies can be obtained from subjects who need therapy or who suffer from diseases associated with reduced immune cell activity. Therefore, cells will be autologous for subjects who need therapy. Alternatively, immune cell colonies can be obtained from donors, preferably donors of tissue compatibility matching. Immune cell colonies can be collected from peripheral blood, cord blood, bone marrow, spleen or any other organ/tissue in which immune cells are present in the subject or donor. Immune cells can be separated from a group of subjects and/or donors, such as from collected cord blood.

When the immune cell population is obtained from a donor different from the subject, the donor is preferably allogeneic, provided that the obtained cells are compatible with the subject, because the cells can be introduced into the subject. The allogeneic donor cells may or may not be compatible with human leukocyte antigens (HLA). To make them compatible with the subject, the allogeneic cells can be treated to reduce immunogenicity.

Immune cells can be genetically engineered to express antigen receptors such as engineered TCRs and/or chimeric antigen receptors (CARs). For example, host cells (e.g., autologous or allogeneic T cells) are modified to express T cell receptors (TCRs) that are antigen-specific for cancer antigens. In a particular embodiment, NK cells are engineered to express TCRs. NK cells can be further engineered to express CARs. Multiple CARs and/or TCRs, such as for different antigens, can be added to a single cell type, such as a T cell or a NK cell.

Suitable modification methods are known in the art. See, e.g., Sambrook et al., supra; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, 1994. For example, cells can be transduced to express a T cell receptor (TCR) with antigen specificity for a cancer antigen using the transduction techniques described in Heemskerk et al. (2008) and Johnson et al. (2009).

In some embodiments, the cell includes one or more nucleic acids encoding one or more antigen receptors introduced by genetic engineering, and the genetically engineered products of such nucleic acids. In some embodiments, the nucleic acid is heterologous, that is, it is not usually present in the cell or in a sample obtained from the cell, such as a sample obtained from another organism or cell, for example, it is not usually found in the engineered cell and/or the organism from which such cell is derived. In some embodiments, the nucleic acid is not naturally occurring, such as a nucleic acid not found in nature (e.g., chimeric).

C. Combination therapy

It may also be desirable to provide combination therapies using the antibodies of the present disclosure in combination with additional anti-cancer therapies. These therapies will be provided in a combined amount effective to reduce one or more disease parameters. This process can involve contacting the cell/subject with two agents/therapies simultaneously, e.g., using a single composition or pharmacological formulation comprising the two agents, or by contacting the cell/subject with two different compositions or formulations simultaneously, wherein one composition comprises the antibody and the other composition comprises another agent.

Alternatively, the antibody can be spaced a few minutes to a few weeks before or after other treatments. It will generally be ensured that no significant time period will be exceeded between each delivery time, so that the therapy will still be able to exert a favorable combination effect on cells/subjects. In such cases, it is considered that cells are contacted in two ways within about 12 hours to 24 hours, within about 6 hours to 12 hours, or only about 12 hours of delay time. In some cases, it can be expected to significantly extend the treatment period; however, wherein several 10 (2, 3, 4, 5, 6 or 7) days to several (1, 2, 3, 4, 5, 6, 7 or 8) weeks are required between the corresponding administrations.

It is also contemplated that it will be desirable to administer an anti-LILRB1 antibody or other therapy more than once. Various combinations may be employed where the antibody is "A" and the other therapy is "B", as exemplified below:

A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B

A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A

A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B

Other combinations are contemplated. In order to kill cells, inhibit cell growth, inhibit metastasis, inhibit angiogenesis, or otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, target cells or sites may be contacted with antibodies and at least one other therapy. These therapies will be provided in a combined amount that is effective in killing cancer cells or inhibiting cancer cell proliferation. This process may involve contacting cells/sites/subjects with agents/therapies simultaneously.

Specific agents contemplated for combination therapy with the antibodies of the present disclosure include chemotherapy and hematopoietic stem cell transplantation. Chemotherapy may include cytarabine (ara-C) and anthracyclines (most commonly daunorubicin), high-dose cytarabine alone, all-trans retinoic acid (ATRA) in addition to induction chemotherapy, usually anthracyclines, histamine dihydrochloride (Ceplene) and interleukin 2 (Proleukin) after completion of consolidation therapy, gemtuzumab ozogamicin (Mylotarg) for patients over 60 years of age with relapsed AML who are not candidates for high-dose chemotherapy, clofarabine, and targeted therapies such as kinase inhibitors, farnesyl transferase inhibitors, decitabine, and inhibitors of MDR1 (multidrug resistance protein) or arsenic trioxide or relapsed acute promyelocytic leukemia (APL).

In certain embodiments, the agent of the combination therapy is one or more drugs selected from the group consisting of: topoisomerase inhibitors, anthracycline topoisomerase inhibitors, anthracyclines, daunorubicin, nucleoside metabolic inhibitors, cytarabine, hypomethylating agents, low-dose cytarabine (LDAC), a combination of daunorubicin and cytarabine, daunorubicin and cytarabine liposomes for injection, Azacytidine, Decitabine, all-trans retinoic acid (ATRA), arsenic, arsenic trioxide, histamine dihydrochloride, Interleukin-2, Aldesleukin, Gemtuzumab ozogamicin, FLT-3 inhibitors, midostaurin, Clofarabine, farnesyl transferase inhibitors, decitabine, IDH1 inhibitors, ivosidenib, IDH2 inhibitors, enasidenib, Smoothened (SMO) inhibitors, glasdegib, arginase inhibitors, IDO inhibitors, epacadostat, BCL-2 inhibitors, venetoclax, Platinum complex derivatives, oxaliplatin, kinase inhibitors, tyrosine kinase inhibitors, PI3 kinase inhibitors, BTK inhibitors, ibrutinib, acalabrutinib, Zanubrutinib, PD-1 antibody, PD-L1 antibody, CTLA-4 antibody, LAG3 antibody, ICOS antibody, TIGIT antibody, TIM3 antibody, CD40 antibody, 4-1BB antibody, CD47 antibody, SIRP1α antibody or fusion protein, CD70 antibody and CLL1 antibody, CD123 antibody, antagonist of E-selectin, antibody binding to tumor antigen, antibody binding to T cell surface marker, antibody binding to myeloid cell or NK cell surface marker, alkylating agent, nitrosourea agent, antimetabolite, antitumor antibiotic, alkaloid derived from plant, hormone therapy drug, hormone antagonist, aromatase inhibitor and P-glycoprotein inhibitor.

V. Antibody Conjugates

The antibodies disclosed herein can be connected to at least one agent to form an antibody conjugate. In order to improve the efficacy of the antibody molecule as a diagnostic or therapeutic agent, it is usually connected or covalently bound or compounded to at least one desired molecule or part. Such molecules or parts can be but are not limited to at least one effector or reporter molecule. Effector molecules include molecules with desired activity, such as cytotoxic activity. Non-limiting examples of effector molecules that have been connected to antibodies include toxins, antitumor agents, therapeutic enzymes, radionuclides, antiviral agents, chelators, cytokines, growth factors and oligonucleotides or polynucleotides. In contrast, reporter molecules are defined as any part that can be detected using an assay. Non-limiting examples of reporter molecules that have been conjugated to antibodies include enzymes, radioactive labels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, photoaffinity molecules, colored particles or ligands, such as biotin.

Antibody-drug conjugates have emerged as a breakthrough approach to developing cancer treatments. Antibody-drug conjugates (ADCs) consist of a monoclonal antibody (MAb) covalently linked to a cell-killing drug. This approach combines the high specificity of a MAb for its antigen target with a highly potent cytotoxic drug, resulting in an “armed” MAb that delivers the payload (drug) to tumor cells with enriched antigen levels. Targeted delivery of the drug can also minimize its exposure to normal tissues, thereby reducing toxicity and increasing the therapeutic index. The FDA approved two ADC drugs: (brentuximab vedotin) and in 2013 The approval of trastuzumab emtansine (trastuzumab emtansine or T-DM1) validates the approach. Currently, more than 30 ADC drug candidates are in various stages of clinical trials for cancer treatment (Leal et al., 2014). As antibody engineering and linker-payload optimization become more mature, the discovery and development of new ADCs increasingly rely on the identification and validation of new targets suitable for this approach and the generation of targeted MAbs. Two criteria for ADC targets are upregulated/high levels of expression in tumor cells and robust internalization.

Antibody conjugates are also preferably used as diagnostic agents. Antibody diagnostics are generally divided into two categories, one for in vitro diagnosis, such as various immunoassays, and the other for in vivo diagnostic protocols, commonly referred to as "antibody-directed imaging". Many suitable imaging agents are known in the art, and methods for their attachment to antibodies are also known (see, e.g., U.S. Patents 5,021,236, 4,938,948, and 4,472,509). The imaging moieties used can be paramagnetic ions, radioisotopes, fluorescent dyes, NMR detectable substances, and X-ray imaging agents.

In the case of paramagnetic ions, ions such as chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and/or erbium (III) may be mentioned by way of example, with gadolinium being particularly preferred. Ions suitable for use in other contexts, such as X-ray imaging, include but are not limited to lanthanum (III), gold (III), lead (II), and especially bismuth (III).

In the case of radioisotopes for therapeutic and/or diagnostic applications, mention may be made of astatine ²¹¹ , ¹⁴ carbon, ⁵¹ chromium, ³⁶ chlorine, ⁵⁷ cobalt, ⁵⁸ cobalt, ⁶⁷ copper, ¹⁵² Eu, ⁶⁷ gallium, ³ hydrogen, ¹²³ iodine, 125 iodine, ¹³¹ iodine, ¹¹¹ indium, ⁵⁹ iron, ³² phosphorus, ¹⁸⁶ rhenium, ¹⁸⁸ rhenium, ⁷⁵ selenium, ³⁵ sulfur, technetium ^99m and/or ⁹⁰ yttrium. ¹²⁵ I is generally preferred for use in certain embodiments, while technetium ^99m and/or ^{indium 111 are} also generally preferred due to their low energy and suitability for long-range detection. The radiolabeled monoclonal antibodies disclosed herein can be produced according to methods well known in the art. For example, the monoclonal antibodies can be iodinated by contact with sodium iodide and/or potassium iodide and a chemical oxidant such as sodium hypochlorite or an enzymatic oxidant such as lactoperoxidase. Monoclonal antibodies according to the present disclosure can be labeled with technetium ^99m by a ligand exchange process, for example by reducing pertechnetate with a stannous solution, chelating the reduced technetium to a Sephadex column, and applying the antibody to the column. Alternatively, direct labeling techniques can be used, for example by incubating pertechnetate, a reducing agent such as SNCl ₂ , a buffer solution such as a sodium potassium phthalate solution, and the antibody. Intermediate functional groups commonly used to bind radioactive isotopes present as metal ions to antibodies are diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).

Fluorescent labels contemplated for use as conjugates include Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM, fluorescein isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, TAMRA, TET, tetramethylrhodamine, and/or Texas Red.

Another type of antibody conjugate considered in the present disclosure is an antibody conjugate intended to be primarily used in vitro, wherein the antibody is connected to a secondary binding ligand and/or an enzyme (enzyme tag) that will produce a colored product when in contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) catalase, or glucose oxidase. Preferred secondary binding ligands are biotin and avidin and streptavidin compounds. The use of such labels is well known to those skilled in the art and is described in, for example, U.S. Patents 3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149, and 4,366,241.

Yet another known method for site-specific attachment of molecules to antibodies involves the reaction of antibodies with hapten-based affinity tags. Essentially, hapten-based affinity tags react with amino acids in the antigen binding site, thereby destroying this site and blocking specific antigenic reactions. However, this may not be advantageous because it results in the antibody conjugate losing antigen binding.

Molecules containing an azide group can also be used to form covalent bonds with proteins via reactive nitrene intermediates generated by low-intensity ultraviolet light (Potter and Haley, 1983). Specifically, 2- and 8-azido analogs of purine nucleotides have been used as site-directed photoprobes to identify nucleotide-binding proteins in crude cell extracts (Owens and Haley, 1987; Atherton et al., 1985). 2- and 8-azido nucleotides have also been used to map nucleotide-binding domains of purified proteins (Khatoon et al., 1989; King et al., 1989; Dholakia et al., 1989) and can be used as antibody binders.

Several methods are known in the art for linking or conjugating an antibody to its conjugate moiety. Some methods of linking involve the use of metal chelate complexes using, for example, organic chelators such as diethylenetriaminepentaacetic acid (DTPA); ethylenetriaminetetraacetic acid; N-chloro-p-toluenesulfonamide; and/or tetrachloro-3α-6α-diphenylglycoluril-3 linked to an antibody (U.S. Pat. Nos. 4,472,509 and 4,938,948). Monoclonal antibodies can also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with isothiocyanates. In U.S. Pat. No. 4,938,948, imaging of breast tumors is achieved using a monoclonal antibody, and a detectable imaging moiety is bound to the antibody using a linker such as methyl paraben or N-succinimidyl-3-(4-hydroxyphenyl) propionate.

In other embodiments, it is contemplated to selectively introduce sulfhydryl groups in the Fc region of the immunoglobulin to derivatize the immunoglobulin using reaction conditions that do not alter the antibody binding site. Antibody conjugates produced according to this method are disclosed to exhibit improved lifespan, specificity, and sensitivity (U.S. Pat. No. 5,196,066, which is incorporated herein by reference). Site-specific attachment of effector or reporter molecules has also been disclosed in the literature (O'Shannessy et al., 1987), wherein the reporter or effector molecule is conjugated to a carbohydrate residue in the Fc region. It is reported that this method will produce antibodies with diagnostic and therapeutic prospects that are currently under clinical evaluation.

VI. Immunoassay Methods

In still further embodiments, the present disclosure relates to immunoassay methods for binding, purifying, removing, quantifying, and generally otherwise detecting LILRB-associated cancers. While such methods may be applied in the traditional sense, another use would be in the quality control and monitoring of vaccines and other viral stocks, where antibodies according to the present disclosure may be used to assess the amount or integrity (i.e., long-term stability) of the H1 antigen in the virus. Alternatively, the methods may be used to screen various antibodies for a suitable/desired response profile.

Some immunoassay methods include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluorescent immunoassay, chemiluminescent assay, bioluminescent assay and western blot, to name a few. In particular, competitive assays for detecting and quantifying LILRB are also provided. The procedures of various useful immunoassay methods have been described in the scientific literature, such as Doolittle and Ben-Zeev (1999); Gulbis and Galand (1993); DeJager et al. (1993) and Nakamura et al. (1987). Generally, the immunocombination method includes obtaining a sample suspected of containing a LILRB-associated cancer, and contacting the sample with a first antibody according to the present disclosure under conditions effective to allow the formation of an immune complex, as appropriate.

These methods include methods for detecting or purifying LILRB or LILRB-associated cancer cells from a sample. The antibody will preferably be attached to a solid support, such as in the form of a column matrix, and a sample suspected of containing LILRB-associated cancer cells will be applied to the immobilized antibody. Unwanted components will be washed away from the column, cells expressing LILRB will be immunocomplexed with the immobilized antibody, and the immobilized antibody will then be collected by removing the organism or antigen from the column.

Immunobinding methods also include methods for detecting and quantifying the amount of LILRB-associated cancer cells or associated components in a sample and detecting and quantifying any immune complexes formed during the binding process. Here, a sample suspected of containing LILRB-associated cancer cells is obtained and contacted with an antibody that binds LILRB or a component thereof, followed by detecting and quantifying the amount of immune complexes formed under specific conditions. In terms of antigen detection, the biological sample analyzed can be any sample suspected of containing LILRB-associated cancer, such as a tissue section or specimen, a homogenized tissue extract, a biological fluid including blood and serum, or a secretion such as feces or urine.

Contacting the selected biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) generally requires only adding the antibody composition to the sample and incubating the mixture for a period of time sufficient to allow the antibody to form an immune complex with the LILRB, i.e., to bind to the LILRB. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non-specifically bound antibody species, thereby detecting only those antibodies that are specifically bound within the primary immune complex.

Generally, the detection of immune complex formation is well known in the art and can be realized by using many methods. These methods are usually based on the detection of any of the marks or markers such as those of radioactivity, fluorescence, biology and enzyme labels. The patents related to the use of such marks include United States Patents 3,817,837,3,850,752,3,939,350,3,996,345,4,277,437,4,275,149 and 4,366,241. Of course, as known in the art, other advantages can be found by using secondary binding ligands such as second antibody and/or biotin/avidin ligand binding arrangements.

The antibody used in the detection itself can be connected with a detectable label, wherein this label can then be simply detected, so that the amount of the primary immune complex in the composition can be determined. Alternatively, the first antibody bound to the primary immune complex can be detected by a second binding ligand having a binding affinity to the antibody. In these cases, the second binding ligand can be connected with a detectable label. The second binding ligand itself is typically an antibody, so it can be referred to as a "secondary" antibody. The primary immune complex is contacted with a secondary binding ligand or antibody of the label under effective conditions and continues for a time period sufficient to allow the formation of a secondary immune complex. The secondary immune complex is then usually washed to remove any non-specifically bound labeled secondary antibodies or ligands, and then the remaining label in the secondary immune complex is detected.

Other methods include detecting primary immune complexes by a two-step method. As described above, a second binding ligand, such as an antibody with binding affinity to an antibody, is used to form a secondary immune complex. After washing, the secondary immune complex is contacted with a third binding ligand or antibody with binding affinity to the second antibody again under effective conditions for a time period sufficient to allow the formation of an immune complex (tertiary immune complex). The third ligand or antibody is connected to a detectable label, thereby allowing the detection of the tertiary immune complex thus formed. If desired, this system can provide signal amplification.

An immunodetection method uses two different antibodies. The first biotinylated antibody is used to detect the target antigen, and then the second antibody is used to detect the biotin connected to the composite biotin. In the method, the sample to be detected is first incubated in a solution containing the first step antibody. If the target antigen is present, a certain antibody in the antibody binds to the antigen to form a biotinylated antibody/antigen complex. The antibody/antigen complex is then amplified by incubation in a continuous solution of streptavidin (or avidin), biotinylated DNA and/or complementary biotinylated DNA, and each step adds additional biotin sites to the antibody/antigen complex. The amplification step is repeated until a suitable amplification level is reached, at which point the sample is incubated in a solution containing the second step anti-biotin antibody. This second step antibody is labeled, for example, with an enzyme that can be used to detect the presence of the antibody/antigen complex by tissue enzymology using a chromogenic substrate. By suitable amplification, a conjugate visible to the naked eye can be produced.

Another known immunoassay method utilizes an immuno-PCR (polymerase chain reaction) method. The PCR method is similar to the Cantor method, until incubated with biotinylated DNA, however, instead of using multiple rounds of streptavidin and biotinylated DNA incubations, the DNA/biotin/streptavidin/antibody complex is washed off with a low pH or high salt buffer that releases the antibody. The resulting washing solution is then used with appropriate primers and appropriate controls to perform a PCR reaction. At least in theory, the huge amplification capacity and specificity of PCR can be used to detect single antigen molecules.

A.ELISA

In the simplest and most direct sense of an immunoassay, an immunoassay is a binding assay. Certain preferred immunoassays are various types of enzyme-linked immunosorbent assays (ELISA) and radioimmunoassays (RIA) known in the art. Immunohistochemical detection using tissue sections is also particularly useful. However, it is readily appreciated that detection is not limited to such techniques, and Western blots, dot blots, FACS analysis, etc. may also be used.

In an exemplary ELISA, an antibody of the present disclosure is immobilized to a selected surface that exhibits protein affinity, such as a well in a polystyrene microtiter plate. A test composition suspected of containing LILRB-associated cancer cells is then added to the wells. After binding and washing to remove non-specifically bound immune complexes, the bound antigen can be detected. Detection can be achieved by adding another anti-LILRB antibody linked to a detectable label. This type of ELISA is a simple "sandwich ELISA". Detection can also be achieved by adding a second anti-LILRB1 antibody, followed by a third antibody that has binding affinity for the second antibody, wherein the third antibody is linked to a detectable label.

In another exemplary ELISA, a sample suspected of containing LILRB1-associated cancer cells is immobilized on a well surface and then contacted with an anti-LILRB1 antibody of the present disclosure. After binding and washing to remove non-specifically bound immune complexes, the bound anti-LILRB1 antibody is detected. In the case where the initial anti-LILRB1 antibody is linked to a detectable label, the immune complex can be detected directly. Similarly, the immune complex can be detected using a second antibody that has binding affinity for the first anti-LILRB1 antibody, wherein the second antibody is linked to a detectable label.

Regardless of the format used, ELISAs have certain common features, such as coating, incubation and binding, washing to remove non-specifically bound species, and detection of bound immune complexes. These are described below.

When coating a plate with an antigen or antibody, the wells of the plate are usually incubated with a solution of the antigen or antibody overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surface of the wells is then "coated" with a nonspecific protein that is antigenically neutral to the test antiserum. These nonspecific proteins include bovine serum albumin (BSA), casein, or milk powder solutions. The coating allows the nonspecific adsorption sites on the fixed surface to be blocked, and therefore reduces the background caused by the nonspecific binding of the antiserum to the surface.

In ELISA, it may be more customary to use secondary or tertiary detection means rather than direct procedures. Thus, after the protein or antibody is bound to the wells, coated with a non-reactive material to reduce background, and washed to remove unbound material, the fixed surface is contacted with the biological sample to be tested under conditions effective to allow the formation of immune complexes (antigen/antibody). Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and the secondary binding ligand or antibody in combination with the labeled tertiary antibody or third binding ligand.

"Under conditions effective to allow immune complex (antigen/antibody) formation" means that the conditions preferably include diluting the antigen and/or antibody with a solution such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS)/Tween. These added agents also help to reduce nonspecific background.

"Suitable" conditions also mean that the temperature or time period of incubation is sufficient for effective binding. The incubation step is generally about 1 hour to 2 hours to 4 hours, preferably at a temperature of about 25°C to 27°C, or can be overnight at about 4°C.

After all incubation steps in ELISA, the contacted surfaces are washed to remove non-composite materials. Preferred washing procedures include washing with solutions such as PBS/Tween or borate buffer. After the formation of specific immune complexes between the test sample and the initially bound material and subsequent washing, the presence of even trace amounts of immune complexes can be determined.

In order to provide detection means, the second or third antibody will have a related label that allows detection. Preferably, this will be an enzyme that will produce color development when incubated with a suitable chromogenic substrate. Therefore, for example, it is desirable to contact or incubate the first and second immune complexes with an antibody that is conjugated to urease, glucose oxidase, alkaline phosphatase or catalase, the time period of the contact and incubation and the conditions being conducive to the development of further immune complex formation (for example, incubated 2 hours at room temperature in a solution containing PBS such as PBS-tween).

After incubation with the labeled antibody, and after washing to remove unbound material, the amount of label is quantified, for example by incubation with a chromogenic substrate such as urea or bromocresol purple or 2,2'-azido-bis-(3-ethyl-benzothiazoline-6-sulfonic acid) (ABTS) or H ₂ O ₂ in the case of peroxidase as an enzyme label. Quantification is then achieved by measuring the degree of color produced, for example using a visible spectrum spectrophotometer.

B. Western Blot

Western blotting (alternatively, Western immunoblotting) is an analytical technique used to detect specific proteins in a given sample of tissue homogenate or extract. Western blotting uses gel electrophoresis to separate native or denatured proteins based on the length of the polypeptide (denaturing conditions) or the 3-D structure of the protein (native/non-denaturing conditions). The proteins are then transferred to a membrane (usually nitrocellulose or PVDF) where they are probed (detected) using antibodies specific for the target protein.

Samples can be taken from whole tissue or cell culture. In most cases, solid tissue is first mechanically disrupted using a blender (for larger sample volumes), using a homogenizer (for smaller volumes), or by ultrasound. Cells can also be broken by one of the mechanical methods mentioned above. However, it should be noted that bacteria, viruses, or environmental samples may be sources of proteins, so Western blotting is not limited to cell studies. Various detergents, salts, and buffers can be used to promote cell lysis and solubilize proteins. Protease and phosphatase inhibitors are usually added to prevent the sample from being digested by its own enzymes. Tissue preparation is usually performed at low temperatures to avoid protein denaturation.

Gel electrophoresis is used to separate the proteins of a sample. The proteins can be separated by isoelectric point (pI), molecular weight, charge, or a combination of these factors. The nature of the separation depends on the treatment of the sample and the nature of the gel. This is a very useful method for determining the proteins. Two-dimensional (2-D) gels can also be used, which spread the proteins in a single sample in two dimensions. The proteins are separated in the first dimension according to their isoelectric point (the pH at which they have a neutral net charge), and in the second dimension according to their molecular weight.

In order to enable protein to be detected by antibodies, the protein is moved from the gel to a membrane made of nitrocellulose or polyvinylidene fluoride (PVDF). The membrane is placed on the top of the gel, and a stack of filter paper is placed on the top of the gel. The whole stack is placed in a buffer solution, and the buffer solution moves on the paper by capillary action, so that the protein moves with the buffer solution. Another method for transferring protein is called electroblotting, and an electric current is used to pull the protein from the gel into a PVDF or nitrocellulose membrane. The protein moves from the gel to the membrane while keeping the organization of the protein in the gel. Due to this blotting process, the protein is exposed to a thin surface layer for detection (see below). These two membranes are selected because of their non-specific protein binding properties (that is, the binding of all proteins is equally good). Protein binding is based on hydrophobic interactions, and charged interactions between membrane and protein. Nitrocellulose membrane is cheaper than PVDF, but more fragile, and cannot withstand repeated detection well. The uniformity and overall efficiency of protein transfer from the gel to the membrane can be checked by staining the membrane with Coomassie Brilliant Blue or Ponceau S. Once transferred, the proteins are detected using either a labeled primary antibody or an unlabeled primary antibody followed by indirect detection using labeled protein A or a secondary labeled antibody that binds to the Fc region of the primary antibody.

C. Immunohistochemistry

The antibodies disclosed herein can also be used in conjunction with fresh frozen and/or formalin fixed, paraffin embedded tissue blocks prepared for immunohistochemistry (IHC) studies. Methods for preparing tissue blocks from these particle samples have been successfully used in previous IHC studies of various prognostic factors and are well known to those skilled in the art (Brown et al., 1990; Abbondanzo et al., 1990; Allred et al., 1990).

Briefly, cryosections can be prepared by rehydrating 50 ng of frozen "crushed" tissue in phosphate buffered saline (PBS) at room temperature in a small plastic capsule; pelleting the pellet by centrifugation; resuspending the pellet in a viscous embedding medium (OCT); inverting the capsule and/or pelleting again by centrifugation; snap freezing in -70°C isopentane; cutting the plastic capsule and/or removing the frozen cylinder of tissue; securing the tissue cylinder to a cryostat microtome chuck; and/or cutting 25 to 50 serial sections from the capsule. Alternatively, the entire frozen tissue sample can be used for serial section cutting.

Permanent sections can be prepared by a similar method involving rehydrating 50 mg of sample in a plastic microcentrifuge tube; pelleting; resuspending in 10% formalin for 4 hours of fixation; washing/pelleting; resuspending in warm 2.5% agar; pelleting; cooling in ice water to harden agar; removing tissue/agar block from tube; infiltrating and/or embedding block in paraffin; and/or cutting up to 50 consecutive permanent sections. Likewise, the entire tissue sample can be substituted.

D. Immunoassay kit

In still other embodiments, the present disclosure relates to an immunoassay kit for use with the immunoassay methods described above. Since antibodies can be used to detect LILRB-associated cancer cells, the antibodies can be included in the kit. Thus, the immunoassay kit will include a first antibody that binds to LILRB, and optionally an immunoassay reagent, in a suitable container device.

In certain embodiments, the antibody can be pre-bound to a solid support, such as a column matrix and/or the wells of a microtiter plate. The immunodetection reagents of the kit can take any of a variety of forms, including those detectable labels associated or linked to a given antibody. Detectable labels associated or linked to a secondary binding ligand are also contemplated. Exemplary secondary ligands are those secondary antibodies that have binding affinity for the first antibody.

Other suitable immunodetection reagents for use in this kit include two-component reagents including a secondary antibody having binding affinity to the first antibody, and a third antibody having binding affinity to the second antibody, the third antibody being linked to a detectable label. As described above, many exemplary labels are known in the art, and all such labels can be used in conjunction with the present disclosure.

The kit may further include appropriate aliquots of the LILRB composition, either labeled or unlabeled, for use in preparing a standard curve for a detection assay. The kit may contain the antibody-label conjugate in fully conjugated form, in intermediate form, or as a separate part to be conjugated by the user of the kit. The components of the kit may be packaged in aqueous media or in lyophilized form.

The container means of the test kit generally includes at least one vial, test tube, flask, bottle, syringe or other container means in which the antibody can be placed, or preferably suitably aliquoted. The test kit of the present disclosure will also generally include a device for containing the antibody, antigen and any other reagent containers in a tightly closed manner for commercial sale. Such containers may include injection or blow-molded plastic containers in which the desired vials are retained.

E. Flow Cytometry and FACS

The antibodies disclosed herein can also be used in flow cytometry or FACS. Flow cytometry is a laser or impedance-based technique used in many detection assays, including cell counting, cell sorting, biomarker detection, and protein engineering. The technique suspends cells in a fluid stream and passes the cells through an electronic detection device, allowing multi-parameter analysis of the physical and chemical properties of up to thousands of particles per second simultaneously. Flow cytometry is commonly used to diagnose diseases, especially blood cancers, but has many other applications in basic research, clinical practice, and clinical trials.

Fluorescence activated cell sorting (FACS) is a special type of cytometry. Fluorescence activated cell sorting provides a method for sorting a heterogeneous mixture of biological cells into two or more containers one cell at a time based on the specific light scattering and fluorescence properties of each cell. Generally, the technique involves a cell suspension sandwiched in the center of a narrow, fast-flowing liquid stream. The liquid stream is arranged so that there is a large separation between cells relative to their diameter. A vibrating mechanism causes the cell stream to break into individual droplets. Just before the stream breaks into droplets, the stream passes through a fluorescence measurement station where the fluorescence of each cell is measured. A charging ring is placed at the point where the stream breaks into droplets. Just before the fluorescence intensity is measured, a charge is placed on the ring, and when the droplets break from the stream, the opposite charge is captured on the droplets. The charged droplets then fall through an electrostatic deflection system that transfers the droplets into containers based on their charge.

In certain embodiments, for use in flow cytometry or FACS, the antibodies of the disclosure are labeled with a fluorophore and then allowed to bind to cells of interest, which are analyzed in a flow cytometer or sorted by a FACS machine.

VII. Kit

In various aspects of the embodiments, kits containing therapeutic agents and/or other therapeutic agents and delivery agents are envisioned. In some embodiments, a kit for preparing and/or administering the therapy of the embodiments is provided. The kit may include one or more sealed vials containing any of the pharmaceutical compositions of the present embodiments. The kit may include, for example, at least one LILRB1 antibody or LILRB1-specific CAR construct, and reagents for preparing, formulating and/or administering the components of the embodiments or performing one or more steps of the method of the present invention. In some embodiments, the kit may also include a suitable container, which is a container that will not react with the components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle or a tube. The container may be made of a sterilizable material such as plastic or glass.

The kit may further include instructions outlining the procedural steps of the methods described herein, and will follow substantially the same procedures as described herein or known to those of ordinary skill in the art. The instruction information may be in a computer-readable medium containing machine-readable instructions that, when executed using a computer, result in a display of a real or virtual procedure for delivering a pharmaceutically effective amount of a therapeutic agent.

VIII. Definitions

It should be understood that the foregoing general description and the following detailed description are only exemplary and illustrative and are not limitations on the claimed invention. In this application, unless otherwise specifically stated, the use of the singular includes the plural. In this application, unless otherwise specified, the use of "or" means "and/or". In addition, the use of the term "including" and other forms such as "includes" and "included" are not restrictive. In addition, unless otherwise specifically stated, terms such as "element" or "component" cover both elements and components including one unit and elements and components including more than one subunit. In addition, the use of the term "portion" may include a portion of a portion or the entire portion.

As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

As used herein, the term "about" is intended to cover the maximum ± 10% variation of the specified value when referring to measurable values such as amount, duration, etc. Unless otherwise specified, all numbers used in this specification and claims to represent the amount of components, properties (such as molecular weight, reaction conditions), etc. should be understood to be modified by the term "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values that can be changed according to the desired characteristics sought to be obtained by the disclosed subject matter. At least, and not attempting to limit the application of the principle of equivalents to the scope of the claims, each numerical parameter should at least be interpreted according to the number of reported significant figures and by applying ordinary rounding techniques. Although the numerical ranges and parameters setting forth the wide range of the present invention are approximate values, the numerical values set forth in the specific examples are reported as accurately as possible. However, any numerical value inherently contains certain errors caused by the standard deviation found in its corresponding test measurement.

The term "antibody" refers to a complete immunoglobulin of any isotype or a fragment thereof that can compete with a complete antibody for specific binding to a target antigen, and includes, for example, chimeric antibodies, humanized antibodies, fully human antibodies, and bispecific antibodies. "Antibody" is an antigen binding protein. A complete antibody will generally include at least two full-length heavy chains and two full-length light chains, but may include fewer chains in some cases, such as naturally occurring antibodies in Camelidae, which may include only heavy chains. An antibody may be derived only from a single source, or may be "chimeric", i.e., different parts of an antibody may be derived from two different antibodies, as further described below. Antigen binding proteins, antibodies, or binding fragments may be produced in a hybridoma by recombinant DNA technology or by enzymatic or chemical cleavage of a complete antibody. Unless otherwise indicated, the term "antibody" includes derivatives, variants, fragments, and mutant proteins thereof, except antibodies including two full-length heavy chains and two full-length light chains, examples of which are described below. In addition, unless explicitly excluded, antibodies include monoclonal antibodies, bispecific antibodies, miniantibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), and fragments thereof, respectively. In some embodiments, the term also encompasses peptibodies.

Naturally occurring antibody structural units generally include tetramers. Each such tetramer is generally composed of two pairs of identical polypeptide chains, each pair having a full-length "light" chain (in some embodiments, about 25 kDa) and a full-length "heavy" chain (in some embodiments, about 50 kDa to 70 kDa). The amino terminal portion of each chain generally includes a variable region of about 100 to 110 or more amino acids that is generally responsible for antigen recognition. The carboxyl terminal portion of each chain generally defines a constant region that can be responsible for effector function. Human light chains are generally classified as kappa and lambda light chains. Heavy chains are generally classified as μ, δ, γ, α or ε, and the isotypes of antibodies are defined as IgM, IgD, IgG, IgA and IgE, respectively. IgG has several subclasses, including but not limited to IgG1, IgG2, IgG3 and IgG4. IgM has subclasses, including but not limited to IgM1 and IgM2. IgA is similarly divided into subclasses, including but not limited to IgA1 and IgA2. In full-length light and heavy chains, the variable and constant regions are typically connected by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 or more amino acids. See, e.g., Basic Immunology, Chapter 7 (Paul, W., ed., 2nd ed., Raven Publishers, New York (1989)) (incorporated herein by reference in its entirety for all purposes). The variable regions of each light/heavy chain pair typically form an antigen binding site.

The term "variable region" or "variable domain" refers to a portion of the light and/or heavy chains of an antibody, generally including the amino-terminal 120 to 130 amino acids in the heavy chain and the amino-terminal 100 to 110 amino acids in the light chain. In certain embodiments, the variable regions of different antibodies vary greatly in amino acid sequence, even among antibodies of the same species. The variable region of an antibody generally determines the specificity of a particular antibody for its target.

The variable region usually exhibits the same general structure of relatively conservative framework regions (FRs) connected by three hypervariable regions (also called complementarity determining regions or CDRs). The CDRs from the two chains of each pair are usually aligned by framework regions, which can bind to specific epitopes. From N-terminal to C-terminal, both the light chain variable region and the heavy chain variable region usually include domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain generally conforms to the definition of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987), or Chothia et al., Nature, 342:878-883 (1989).

In some embodiments, the antibody heavy chain binds to the antigen in the absence of the antibody light chain. In some embodiments, the antibody light chain binds to the antigen in the absence of the antibody heavy chain. In some embodiments, the antibody binding region binds to the antigen in the absence of the antibody light chain. In some embodiments, the antibody binding region binds to the antigen in the absence of the antibody heavy chain. In some embodiments, a single variable region specifically binds to the antigen in the absence of other variable regions.

In some embodiments, the clear description of CDR and the identification of residues including antibody binding site are completed by analyzing the structure of the antibody and/or analyzing the structure of the antibody-ligand complex. In some embodiments, this can be completed by any technology in a variety of technologies known to those skilled in the art, such as X-ray crystallography. In some embodiments, various analytical methods can be used to identify or simulate CDR regions. Examples of such methods include but are not limited to Kabat definition, Chothia definition, AbM definition and contact definition.

The Kabat definition is a standard for numbering residues in antibodies and is commonly used to identify CDR regions. See, for example, Johnson and Wu, Nucleic Acids Res., 28:214-8 (2000). The Chothia definition is similar to the Kabat definition, but the Chothia definition takes into account the position of certain structural loop regions. See, for example, Chothia et al., Journal of Molecular Biology, 196:901-17 (1986); Chothia et al., Nature, 342:877-83 (1989). The AbM definition uses an integrated suite of computer programs produced by the Oxford Molecular Group to model antibody structures. See, e.g., Martin et al., Proc Natl Acad Sci (USA), 86:9268-9272 (1989); "AbM ^TM , A Computer ^Program for Modeling Variable Regions of Antibodies", Oxford, UK; Oxford Molecular, Ltd. The AbM definition uses a combination of knowledge databases and ab initio methods to model the tertiary structure of antibodies from primary sequences, such as those described in Samudrala et al., "Ab Initio Protein Structure Prediction Using a Combined Hierarchical Approach", PROTEINS, Structure, Function and Genetics Supplement, 3:194-198 (1999). Contact definitions are based on analysis of available complex crystal structures. See, e.g., MacCallum et al., J. Molecular Biology, 5:732-45 (1996).

By convention, the CDR regions in the heavy chain are usually referred to as H1, H2 and H3, and are numbered sequentially from the amino terminus to the carboxyl terminus. The CDR regions in the light chain are usually referred to as L1, L2 and L3, and are numbered sequentially from the amino terminus to the carboxyl terminus.

The term "light chain" includes full-length light chains and fragments thereof having sufficient variable region sequences to confer binding specificity. A full-length light chain includes a variable region domain VL and a constant region domain CL. The variable region domain of the light chain is located at the amino terminus of the polypeptide. Light chains include kappa chains and lambda chains.

The term "heavy chain" includes full-length heavy chains and fragments thereof having sufficient variable region sequences to confer binding specificity. Full-length heavy chains include variable region domains VH and three constant region domains CH1, CH2, and CH3. The VH domain is located at the amino terminus of the polypeptide, and the CH domain is located at the carboxyl terminus, with CH3 being closest to the carboxyl terminus of the polypeptide. The heavy chain can be of any isotype, including IgG (including IgG1, IgG2, IgG3, and IgG4 subtypes), IgA (including IgA1 and IgA2 subtypes), IgM, and IgE.

"Back mutation" is a mutation introduced in the nucleotide sequence encoding a humanized antibody, and the mutation results in an amino acid corresponding to an amino acid in a parent antibody (e.g., a donor antibody, such as a rabbit antibody). During the humanization of the antibody of the present invention, certain framework residues from the parent antibody can be retained so as to substantially retain the binding properties of the parent antibody while minimizing the potential immunogenicity of the resulting antibody. In one embodiment of the invention, the parent antibody is from a mouse. For example, a back mutation changes a human framework residue into a parent mouse residue. Examples of framework residues that can be back mutated include, but are not limited to, canonical residues, interface stacking residues, unusual parent residues near the binding site, residues in the "vernier region" (forming a platform on which CDR is stored) (Foote and Winter, 1992, Journal of Molecular Biology 224, 487-499) and those residues near CDR H3.

Bispecific or bifunctional antibodies are generally artificial hybrid antibodies with two different heavy chain/light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety of methods, including but not limited to fusion hybridomas or connection of Fab' fragments. See, for example, Songsivilai et al., Clin. Exp. Immunol., 79: 315-321 (1990); Kostelny et al., J. Immunol., 148: 1547-1553 (1992).

The term "antigen" refers to a substance that can induce an adaptive immune response. Specifically, an antigen is a substance that is used as a target of an adaptive immune response receptor. Typically, an antigen is a molecule that binds to an antigen-specific receptor but cannot induce an immune response in vivo. Antigens are typically proteins and polysaccharides, and less commonly lipids. Suitable antigens include, but are not limited to, parts of bacteria (capsids, capsules, cell walls, flagella, pili, and toxins), viruses, and other microorganisms. Antigens also include tumor antigens, for example, antigens produced by mutations in tumors. As used herein, antigens also include immunogens and haptens.

As used herein, "antigen binding protein" ("ABP") means any protein that binds to a specific target antigen. In the present application, the specific target antigen is LILRB protein or a fragment thereof. "Antigen binding protein" includes, but is not limited to, antibodies and antigen binding fragments thereof. Peptibodies are another example of antigen binding proteins.

As used herein, the term "antigen binding fragment" refers to a part of a protein that can specifically bind to an antigen. In some embodiments, an antigen binding fragment is derived from an antibody comprising one or more CDRs, or any other antibody fragment that binds to an antigen but does not include a complete native antibody structure. In some embodiments, an antigen binding fragment is not derived from an antibody but from a receptor. Examples of antigen binding fragments include, but are not limited to, bifunctional antibodies, Fab, Fab', F(ab') ₂ , Fv fragments, disulfide-stabilized Fv fragments (dsFv), (dsFv) ₂ , bispecific dsFv (dsFv-dsFv'), disulfide-stabilized bifunctional antibodies (ds bifunctional antibodies), single-chain antibody molecules (scFv), scFv dimers (bivalent bifunctional antibodies), multispecific antibodies, single domain antibodies (sdAb), camelized antibodies or nano antibodies, domain antibodies, and bivalent domain antibodies. In some embodiments, an antigen binding fragment can bind to the same antigen to which a parent antibody binds. In some embodiments, Fab may include one or more CDRs from a specific human antibody that is grafted to a framework region from one or more different human antibodies. In some embodiments, Fab is derived from a receptor and contains one or more mutations. In some embodiments, Fab does not bind to the natural ligand of the receptor from which the Fab is derived.

"Fab fragment" includes one light chain and the CH1 and variable region of one heavy chain. The heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.

A "Fab'fragment" includes one light chain and a portion of one heavy chain, wherein the portion of one heavy chain contains the VH domain and the CH1 domain and also contains the region between the CH1 domain and the _CH2 domain, so that an interchain disulfide bond can be formed between the two heavy chains of the two Fab' fragments to form a F(ab')2 molecule.

A "F(ab') ₂ fragment" contains two light chains and two heavy chains, which contain a portion of the constant region between the CH1 domain and the CH2 domain, such that an interchain disulfide bond is formed between the two heavy chains. Thus, a F(ab') ₂ fragment is composed of two Fab' fragments held together by a disulfide bond between the two heavy chains.

The "Fc" region includes two heavy chain fragments, which include the CH1 domain and the CH2 domain of the antibody. The two heavy chain fragments are held together by two or more disulfide bonds and by hydrophobic interactions of the CH3 domain.

The "Fv region" includes the variable regions from both the heavy and light chains but lacks the constant regions.

"Single-chain antibodies" are Fv molecules in which the heavy chain variable region and the light chain variable region are connected by a flexible linker to form a single polypeptide chain that forms an antigen binding region. Single-chain antibodies are discussed in detail in International Patent Application Publication No. WO 88/01649 and U.S. Patents Nos. 4,946,778 and 5,260,203, the disclosures of which are incorporated by reference.

"Domain antibodies" are immunologically functional immunoglobulin fragments that contain only the variable region of the heavy chain or the variable region of the light chain. In some cases, two or more VH regions are covalently linked with a peptide linker to produce a bivalent domain antibody. The two VH regions of a bivalent domain antibody can target the same or different antigens.

A "bivalent antigen binding protein" or "bivalent antibody" comprises two antigen binding sites. In some cases, the two binding sites have the same antigen specificity. Bivalent antigen binding proteins and bivalent antibodies can be bispecific, see below. In certain embodiments, bivalent antibodies other than "multispecific" or "multifunctional" antibodies are generally understood to have each of their binding sites identical.

A "multispecific antigen binding protein" or "multispecific antibody" is an antibody that targets more than one antigen or epitope.

"Bispecific", "dual-specific" or "bifunctional" antigen binding proteins or antibodies are hybrid antigen binding proteins or antibodies that each have two different antigen binding sites. Bispecific antigen binding proteins and antibodies are a type of multispecific antigen binding protein antibody and can be produced by a variety of methods, including but not limited to fusion of hybridomas or connection of Fab' fragments. See, e.g., Songsivilai and Lachmann, 1990, Clinical and Experimental Immunology 79:315-321; Kostelny et al., 1992, Journal of Immunology 148:1547-1553. The two binding sites of a bispecific antigen binding protein or antibody will bind to two different epitopes, which may reside on the same or different protein targets.

"Binding affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity of a 1:1 interaction between members (e.g., an antibody and an antigen) that reflects binding. The affinity of a molecule X to its partner Y can generally be represented by a dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies will generally bind to the antigen slowly and tend to dissociate easily, while high-affinity antibodies will generally bind to the antigen faster and tend to maintain longer binding. A variety of methods for measuring binding affinity are known in the art, and any of the methods described can be used for purposes of the present invention. Specific illustrative embodiments and exemplary embodiments for measuring binding affinity are described below.

An antibody that "specifically binds" or is "specific for" a specific polypeptide or an epitope on a specific polypeptide is an antibody that binds to the specific polypeptide or an epitope on a specific polypeptide without substantially binding to any other polypeptide or polypeptide epitope. For example, the LILRB1-specific antibody of the present invention is specific for LILRB1. In some embodiments, the dissociation constant (Kd) of the antibody that binds to LILRB1 is ≦100 nM, ≦10 nM, ≦1 nM, ≦0.1 nM, ≦0.01 nM, or ≦0.001 nM (e.g., 10 ^-8 M or less, e.g., 10 ^-8 M to 10 ^-13 M, e.g., 10 ^-9 M to 10 ^-13 M). The dissociation constant Kd used herein refers to the ratio of the dissociation rate to the association rate (k _off / _kon ), which can be determined using any conventional method known in the art, including but not limited to surface plasmon resonance, microthermophoresis, HPLC-MS, and flow cytometry (e.g., FACS). In certain embodiments, Kd values may be suitably determined by using flow cytometry.

The term "competition" when used in the context of antigen binding proteins (e.g., antibodies or antigen binding fragments thereof) competing for the same epitope means competition between antigen binding proteins as determined by an assay in which the antigen binding protein (e.g., antibody or antigen binding fragment thereof) being tested prevents or inhibits (e.g., reduces) specific binding of a reference antigen binding protein (e.g., ligand or reference antibody) to a common antigen (e.g., LILRB or fragment thereof). Various types of competitive binding assays can be used to determine whether one antigen binding protein competes with another antigen binding protein, for example: solid phase direct or indirect radioimmunoassays (RIA), solid phase direct or indirect enzyme immunoassays (EIA), sandwich competition assays (see, e.g., Stahli et al., 1983, Methods in Enzymology). solid phase direct biotin-avidin EIA (see, e.g., Kirkland et al., 1986, Journal of Immunology, 137:3614-3619), solid phase direct labeled assays, solid phase direct labeled sandwich assays (see, e.g., Harlow and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Press); solid phase direct labeled RIA using 1-125 labeling (see, e.g., Morel ... et al., 1988, Molec. Immunol. 25:7-15); solid phase direct biotin-avidin EIA (see, e.g., Cheung et al., 1990, Virology 176:546-552); and direct labeling RIA (Moldenhauer et al., 1990, Scandinavian Journal of Immunology 32:77-82). Typically, such assays involve the use of purified antigens bound to a solid surface or cells carrying any of these, unlabeled test antigen binding proteins, and labeled reference antigen binding proteins. Competitive inhibition is measured by determining the amount of labeling bound to a solid surface or cells in the presence of a test antigen binding protein. Typically, the test antigen binding protein is present in excess. The antigen-binding proteins (competing antigen-binding proteins) identified by competitive assays include antigen-binding proteins that bind to the same epitope as the reference antigen-binding proteins, and antigen-binding proteins that bind to adjacent epitopes, and the epitopes to which the adjacent epitopes bind to the reference antigen-binding proteins are close enough to occur steric hindrance. Examples herein provide additional detailed information on the method for determining competitive binding. Typically, when there is an excess of competing antigen-binding proteins, the competing antigen-binding proteins will inhibit (e.g., reduce) the specific binding of the reference antigen-binding proteins to the common antigen by at least 40% to 45%, 45% to 50%, 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75% or 75% or more. In some cases, the binding is inhibited by at least 80% to 85%, 85% to 90%, 90% to 95%, 95% to 97% or 97% or more.

As used herein, the term "epitope" refers to a specific group of atoms or amino acids on an antigen to which an antibody binds. An epitope can be a linear epitope or a conformational epitope. A linear epitope is formed by a continuous amino acid sequence of an antigen and interacts with an antibody based on its primary structure. On the other hand, a conformational epitope is composed of discontinuous segments of the amino acid sequence of an antigen and interacts with an antibody based on the 3D structure of the antigen. Typically, an epitope is about five or six amino acids in length. If two antibodies exhibit competitive binding to an antigen, the two antibodies may bind to the same epitope within the antigen.

As used herein, a "cell" can be prokaryotic or eukaryotic. Prokaryotic cells include, for example, bacteria. Eukaryotic cells include, for example, fungi, plant cells, and animal cells. Types of animal cells (e.g., mammalian cells or human cells) include, for example, cells from the circulation/immune system or organs, such as B cells, T cells (cytotoxic T cells, natural killer T cells, regulatory T cells, T helper cells), natural killer cells, granulocytes (e.g., basophils, eosinophils, neutrophils, and hypersegmented neutrophils). from the endocrine system or organs, for example, thyroid cells (e.g., thyroid epithelial cells, parafollicular cells), parathyroid cells (e.g., parathyroid chief cells, eosinophils), adrenal cells (e.g., chromaffin cells), and pineal cells (e.g., pinealocytes); from the nervous system or organs, for example, glial cells (e.g., astrocytes and oligodendrocytes), microglia, magnocellular neurosecretory cells, stellate cells, Boettcher cells, and pituitary cells (e.g., gonadotrophs, adrenocorticotrophs, thyrotropes, somatotrophs, and lactotrophs); from the respiratory system or organs, for example, lung cells (type I pneumocytes and type II pneumocytes), Clara cells (Clara cells). cells), goblet cells, and alveolar macrophages; cells from the circulatory system or organs (e.g., cardiomyocytes and pericytes); cells from the digestive system or organs, for example, gastric mucosal chief cells, parietal cells, goblet cells, Paneth cells, G cells, D cells, ECL cells, I cells, K cells, S cells, enteroendocrine cells, enterochromaffin cells, APUD cells, and liver cells (e.g., hepatocytes and Kupffer cells). cell); cells from the skin system or organ, for example, bone cells (e.g., osteoblasts, osteocytes and osteoclasts), tooth cells (e.g., cementoblasts and ameloblasts), cartilage cells (e.g., chondroblasts and chondrocytes), skin/hair cells (e.g., hair cells, keratinocytes and melanocytes (nevus cells), muscle cells (e.g., myocytes), adipocytes, fibroblasts and tendon cells); cells from the urinary system or organ (e.g., podocytes, juxtaglomerular cells, intraglomerular mesangial cells, extraglomerular mesangial cells, renal proximal brush border cells and macula densa cells); and cells from the reproductive system or organ (e.g., sperm, Sertoli cell, Leydig cell, egg, oocyte). The cell can be a normal, healthy cell; or a diseased or unhealthy cell (e.g., a cancer cell). The cell further includes a mammalian fertilized egg or stem cell, which includes an embryonic stem cell, a fetal stem cell, an induced pluripotent stem cell and an adult stem cell. Stem cells are cells that can undergo a cycle of cell division while maintaining an undifferentiated state and differentiating into specialized cell types. Stem cells can be omnipotent stem cells, pluripotent stem cells, multipotent stem cells, oligopotent stem cells, and unipotent stem cells, any of which may be induced by somatic cells. Stem cells can also include cancer stem cells. Mammalian cells can be rodent cells, for example, mouse cells, rat cells, hamster cells. Mammalian cells can be rabbit cells, for example, rabbit cells. Mammalian cells can also be primate cells, for example, human cells.

The term "chimeric antigen receptor" or "CAR" as used herein refers to an artificially constructed hybrid protein or polypeptide containing an antigen binding domain (e.g., single chain variable fragment (scFv)) of an antibody connected to a domain or signaling (e.g., T cell signaling or T cell activation domain) that activates immune cells (e.g., T cells or NK cells), (see, e.g., Kershaw et al., supra, Eshhar et al., Proceedings of the National Academy of Sciences of the United States of America, 90 (2): 720-724 (1993) and Sadelain et al., Current Immunology Perspectives (Curr. Opin. Immunol.) 21 (2): 215-223 (2009)). CAR is able to utilize the antigen binding properties of monoclonal antibodies to redirect immune cell specificity and responsiveness to selected targets in a non-MHC restricted manner. Non-MHC restricted antigen recognition enables immune cells expressing CAR to recognize antigens independent of antigen processing, thereby bypassing the main mechanism of tumor escape. Additionally, when expressed in T cells, the CAR advantageously does not dimerize with endogenous T cell receptor (TCR) α and β chains.

The term "host cell" means a cell that has been transformed or is capable of being transformed with a nucleic acid sequence and thereby expressing a gene of interest. The term includes the offspring of a parent cell, whether or not the offspring is identical to the original parent cell in morphology or genetic makeup, as long as the gene of interest is present.

The term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by alignment and comparison of sequences. "Identity percentage" means the percentage of identical residues between amino acids or nucleotides in the compared molecules, and is calculated based on the size of the smallest molecule in the compared molecules. For these calculations, preferably, gaps (if any) in the alignment are resolved by a specific mathematical model or computer program (i.e., an "algorithm"). Methods that can be used to computationally align nucleic acids or polypeptides for identity include those described in Computational Molecular Biology, (Lesk, A.M., ed.), 1988, New York: Oxford University Press; Biocomputing Informatics and Genome Projects, (Smith, D.W., ed.), 1993, New York: Academic Press; Computer Analysis of Sequence Data, Part I, (Griffin, A.M. and Griffin, H.G., eds.), 1994, New Jersey: Humana Press; von Heinje, G., 1987, Sequence Analysis in Molecular Biology, New York: Academic Press; Sequence Analysis Primers, 1993, New York: Academic Press; Primer, (Gribskov, M. and Devereux, J., eds.), 1991, New York: M. Stockton Press; and Carillo et al., 1988, SIAM J. Applied Math. 48:1073.

When calculating the percent identity, the compared sequences are usually aligned in a manner that maximizes the match between the sequences. An example of a computer program that can be used to determine the percent identity is the GCG program package, which includes GAP (Devereux et al., 1984, "Nucleic Acids Research" 12:387; Genetics Computer Group, University of Wisconsin, Madison, Wis.). The computer algorithm GAP is used to compare two polypeptides or polynucleotides to determine the percent sequence identity. Sequences are aligned to achieve the best match ("matching range" as determined by the algorithm) of their corresponding amino acids or nucleotides. Gap open penalty (which is calculated as 3×average diagonal, where “average diagonal” is the average of the diagonals of the comparison matrix used; “diagonal” is the score or number assigned to each perfect amino acid match by a particular comparison matrix) and gap extension penalty (which is typically 1/10 times the gap open penalty) and comparison matrices such as PAM 250 or BLOSUM 62 are used with the algorithm. In certain embodiments, standard comparison matrices (see, e.g., Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5:345-352 for the PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad. Sci. USA 89:10915-10919 for the BLOSUM 62 comparison matrix) are also used by the algorithm.

Examples of parameters that can be used to determine percent identity of polypeptide or nucleotide sequences using the GAP program can be found in Needleman et al., 1970, J. Molecular Biology 48:443-453.

Certain alignment schemes used to align two amino acid sequences may result in only a short region matching in the two sequences, and this small aligned region may have a high degree of sequence identity, although there is no significant relationship between the two full-length sequences. Therefore, if desired, the selected alignment method (GAP program) can be adjusted to produce an alignment of at least 50 or other numbers of consecutive amino acids across the target polypeptide.

As used herein, the term "linked" refers to association through intramolecular interactions, such as covalent bonds, metallic bonds, and/or ionic bonds, or intermolecular interactions, such as hydrogen bonds or non-covalent bonds.

Leukocyte immunoglobulin-like receptor subfamily B, member 2 (LILRB1) is a protein encoded by the LILRB1 gene in humans. This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is present in a gene cluster in the chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors, which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen presenting cells and transduces negative signals that inhibit the stimulation of the immune response. The receptor is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity.

The term "operably linked" refers to an arrangement of elements in which the components described in this manner are configured to perform their usual functions. Thus, a given signal peptide operably linked to a polypeptide directs secretion of the polypeptide from a cell. In the case of a promoter, a promoter operably linked to a coding sequence will direct the expression of the coding sequence. A promoter or other control element need not be contiguous with a coding sequence, as long as the promoter or other control element serves to direct its expression. For example, an intermediate, untranslated, but still transcribed sequence may be present between a promoter sequence and a coding sequence, and the promoter sequence may still be considered to be "operably linked" to the coding sequence.

The term "polynucleotide" or "nucleic acid" includes both single-stranded nucleotide polymers and double-stranded nucleotide polymers. The nucleotides comprising the polynucleotides can be ribonucleotides or deoxyribonucleotides or modified forms of any nucleotide type. The modifications include base modifications such as bromouracil nucleoside and inosine derivatives, ribose modifications such as 2', 3'-dideoxyribose and internucleotide linkage modifications such as thiophosphates, dithiophosphates, selenophosphates, diselenphosphates, thioanilide phosphates (phosphoroanilothioate), aniline phosphates (phoshoraniladate) and aminophosphorophosphates.

The term "polypeptide" or "protein" means a macromolecule having the amino acid sequence of a native protein, i.e., a protein produced by naturally occurring and non-recombinant cells; or the protein is produced by genetically engineered or recombinant cells and includes molecules having the amino acid sequence of a native protein or molecules having one or more amino acids deleted, added and/or substituted from the native sequence. The term also includes amino acid polymers, in which one or more amino acids are chemical analogs of the corresponding naturally occurring amino acids, as well as polymers. The terms "polypeptide" and "protein" specifically encompass LILRB antigen binding proteins, antibodies, or sequences having one or more amino acids deleted, added and/or substituted from the antigen binding protein. The term "polypeptide fragment" refers to a polypeptide having an amino terminal deletion, a carboxyl terminal deletion and/or an internal deletion compared to the full-length native protein. Such fragments may also contain modified amino acids compared to the native protein. In certain embodiments, the fragments are about five to 500 amino acids in length. For example, the length of the fragment can be at least 5, 6, 8, 10, 14, 20, 50, 70, 100, 110, 150, 200, 250, 300, 350, 400 or 450 amino acids. Useful polypeptide fragments include immunologically functional fragments of antibodies, including binding domains. In the case of LILRB binding antibodies, useful fragments include, but are not limited to, CDR regions, variable domains of heavy and/or light chains, a portion of an antibody chain or its variable region including only two CDRs, etc.

Pharmaceutically acceptable carriers useful in the present invention are conventional. E.W.Martin, "Remington's Pharmaceutical Sciences", Mack Publishing Co., Easton, PA, 15th edition (1975) describes compositions and formulations suitable for drug delivery of fusion proteins disclosed herein. Generally, the nature of the carrier will depend on the specific mode of administration adopted. For example, parenteral formulations generally include injectable fluids, which include pharmaceutically and physiologically acceptable fluids, such as water, saline, balanced salt solutions, aqueous glucose solutions, glycerol, etc. as vehicles. For solid compositions (e.g., powders, pills, tablets or capsule forms), conventional non-toxic solid carriers may include, for example, pharmaceutical grade mannitol, lactose, starch or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical composition to be applied may contain a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives and pH buffers, etc., for example, sodium acetate or sorbitan monolaurate.

As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include prenatal and postnatal forms. In many embodiments, the subject is a human. The subject may be a patient, which refers to a person presented to a medical provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient". A subject may suffer from or be susceptible to a disease or condition, but may or may not exhibit symptoms of the disease or condition.

As used herein, the term "therapeutically effective amount" or "effective dose" refers to a dose or concentration of a drug that is effective for treating a disease or condition. For example, with respect to the use of the monoclonal antibodies or antigen-binding fragments thereof disclosed herein for treating cancer, a therapeutically effective amount is a dose or concentration of a monoclonal antibody or antigen-binding fragment thereof that is capable of reducing tumor volume, eradicating all or part of a tumor, inhibiting or slowing tumor growth or infiltration of cancer cells into other organs, inhibiting the growth or proliferation of cells that mediate cancerous conditions, inhibiting or slowing tumor cell metastasis, improving any symptoms or markers associated with a tumor or cancerous condition, preventing or delaying the development of a tumor or cancerous condition, or some combination thereof.

As used herein, "treating" or "treatment" of a condition includes preventing or alleviating the condition, slowing the rate of onset or development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, alleviating or ending symptoms associated with the condition, causing complete or partial regression of the condition, curing the condition, or some combination thereof.

As used herein, "vector" refers to a nucleic acid molecule introduced into a host cell to thereby produce a transformed host cell. The vector may include a nucleic acid sequence that allows it to replicate in the host cell, such as an origin of replication. The vector may also include one or more therapeutic genes and/or selectable marker genes and other genetic elements known in the art. The vector may transduce, transform or infect cells, thereby causing the cells to express nucleic acids and/or proteins other than nucleic acids and/or proteins that are native to the cell. The vector optionally includes materials that help to achieve entry of nucleic acids into cells, such as viral particles, liposomes, protein coatings, etc.

As used herein, "substantially free" with respect to a specified component is used herein to mean that the specified component is not intentionally formulated into the composition and/or is present only as a contaminant or in trace amounts. Thus, the total amount of the specified component resulting from any unintended contamination of the composition is much less than 0.05%, preferably less than 0.01%. Most preferred are compositions in which the amount of the specified component cannot be detected using standard analytical methods.

Unless explicitly indicated to refer to only alternatives or the alternatives are mutually exclusive, the term "or" is used in the claims to mean "and/or", but the present disclosure supports definitions referring to only alternatives as well as referring to "and/or". As used herein, "another" may mean at least a second or more.

IX. Examples

The following examples are included to illustrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors to work well in the practice of the present invention and therefore can be considered to constitute preferred modes of practice of the present invention. However, it will be appreciated by those skilled in the art, based on this disclosure, that many changes may be made to the specific embodiments disclosed and still obtain the same or similar results without departing from the spirit and scope of the present invention.

Example 1 - Materials and Methods

Mice. Female NOD-SCID IL2Rγ-null (NSG) mice, 6-8 weeks old (weighing approximately 20 g) were purchased from the Animal Core Facility of the University of Texas Southwestern Medical Center (UT Southwestern). The mice were housed in a specific pathogen-free (SPF) room with a 12-hour light/dark cycle, controlled room temperature, and ad libitum access to food and water. Mice were randomly assigned to each treatment group for the experiment.

Cell lines and primary samples. Expi293F (Catalog No. A14528) was obtained from Life Technologies (Carlsbad). Hematologic cancer cell lines 697, MHH-CALL-2, OPM2 were purchased from DSMZ (Braunschweig, Germany). KMS27, KMS26, KMS12PE, and KMS20 were purchased from the Japan Health Sciences Foundation Health Sciences Research Resources Bank (HSRRB). LILRB1 reporter cells were previously described ¹⁸ . Unless otherwise noted, all other cell lines were purchased from ATCC. Hematologic cancer cell lines were maintained in RPMI 1640 (Sigma Aldrich) (R10) supplemented with 10% heat-inactivated FBS. Solid tumor cell lines were maintained in DMEM with 10% heat-inactivated FBS, except for H460 and H1299 which were maintained in R10. NKL cells were cultured as previously described ¹⁹ . All cell culture media were supplemented with +1% penicillin and streptomycin.

Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of healthy donors (Interstate Blood Bank) by gradient centrifugation using Ficoll medium (GE Lifesciences). To isolate LILRB1-positive NK cells, PBMCs were incubated with anti-human CD56 microbeads (Miltenyi Biotech) and isolated using the AutoMACS Pro separation system. The isolated CD56 ⁺ cells were then stained with anti-CD3-PE (clone: HIT3a, BioLegend), anti-CD56-FITC (clone: TULY56, eBioscience), anti-LILRB1-APC (clone: HP-F1, eBioscience) or mouse IgG1κ isotype control-APC (eBioscience). LILRB1 ⁺ NK cells (CD56 ^{+ CD3-} ) were sorted using the FACSAria I system. Sorted LILRB1 ⁺ NK cells were maintained in the same medium as NKL cells for 2-3 days. Cancer patient samples were obtained from the University of Texas Southwestern Medical Center (UTSW) and the Hematological Malignancy Tissue Bank at UTSW. Patient NK cells were isolated using the same protocol, except that AutoMACS-isolated NK cells were cultured, activated, and used for cytotoxicity assays without FACS.

Anti-LILRB1 monoclonal antibodies (mAbs) were generated. Two New Zealand white rabbits were immunized subcutaneously with 0.5 mg recombinant human LILRB1 protein (unlabeled ECD, Sino Biological). After the initial immunization, four booster immunizations were given at three-week intervals. Serum anti-LILRB1 titers were assessed by indirect enzyme-linked immunosorbent assay (ELISA). Single LILRB1-positive memory B cells enriched using antigen pull-down were cultured in 96-well plates for 14 days, and the culture supernatants were analyzed for antibody binding to LILRB1 by ELISA. Antibody variable region genes were cloned from those positive B cells and sequenced.

Expression and purification of mAb. Heavy and light chain expression constructs were co-transfected into HEK293 cells using ExpiFectamine ^™ 293 transfection kit (Catalog Number: A14528, Gibco), producing full-length IgG in human embryonic kidney Expi293F cells. After 7 days of batch fed culture, culture supernatant was collected, and antibody was purified by affinity chromatography using protein A resin (Catalog Number: 10-2001-XM, Repligen).

Epitope binning and affinity measurements were performed using biolayer interferometry. Classic sandwich epitope binning experiments were performed on an 8-channel Octet RED96 system. First, a baseline was established in kinetic buffer (Catalog No. 18-1105, ForteBio) for 3 minutes. The antibody (30 μg/mL) was then captured by a protein A biosensor (Catalog No. 18-5010, ForteBio) for 4 minutes. The remaining Fc binding sites on the biosensor were then blocked with an irrelevant rabbit antibody (200 μg/ml) for 4 minutes, followed by soaking the biosensor in kinetic buffer for 10 seconds. The biosensor was exposed to recombinant LILRB1 (25 μg/mL) for 4 minutes and then incubated with a secondary antibody (40 μg/mL). The surface was regenerated in 100 mM glycine (pH 2.6) for 45 seconds. Competitive binding of antibody pairs was evaluated. The additional binding signal observed for the secondary antibody indicates an unoccupied epitope (non-competitor). The lack of secondary antibody binding (blocked by first antibody binding) indicates that the two antibodies compete for similar epitopes (competitors).

For antibody affinity measurement, the antibody (analyte, 30 μg/mL) was loaded onto a protein G biosensor (Catalog No. 18-5082, Fudi Biotech) for 4 minutes. After a short baseline in the kinetic buffer for 20 seconds, the loaded biosensor was exposed to a solution of recombinant LILRB1 within a certain concentration range (0-500nM). After subtracting the background, the data was fitted to a 1:1 binding model to extract the association rate ( _kon ) and dissociation rate ( _koff ). KD was calculated using the ratio _koff / _kon . The kinetic constant range of the OctetRED96 system is between 1mM and 10pM. Therefore, an affinity greater than 10pM will be shown as KD<10pM. All experiments were performed under an oscillation of 1,000rpm. All raw data were processed using Fudi Biotech Octet data analysis software 9.0.

Generation of LILRB1-Fc, mutant-Fc and LILRB-Fc fusion proteins. The Ig-like C2-type domain (D) including the D1, D2, D3, and D4 domains of LILRB1 was cloned by PCR for expression. The motif between D4 and the transmembrane domain was defined as the stem region or linker region. Different mutants of LILRB1 were used The Lightning Site-Directed Mutagenesis Kit (Agilent, catalog number 210519) was generated using the LILRB1 wild-type DNA construct as a template. The LILRB ECD, LILRB1 mutants and different domains were cloned in an expression vector and the Fc portion of human IgG1 by Fc fusion. The expression and purification of the LILRB Fc fusion protein was performed using the same procedure as described above for the antibodies.

ELISA. LILRB1 recombinant protein (50 ng/well, 100 μL/well) was coated on Corning 96-well ELISA plates at 37°C for 4 hours. The plates were blocked with 5% skim milk at 37°C for 2 hours. After washing with PBST, 100 μL of serially diluted anti-LILRB1 antibodies were added and incubated at 37°C for 60 minutes. Subsequently, the plates were washed 5 times with PBST and incubated with anti-rabbit or anti-human F(ab')2 HRP-conjugated antibodies (Jackson ImmunoResearch Inc., catalog number 111-036-003 and catalog number 109-036-003) for 30 minutes. The plates were again washed an additional five times with PBST, and the immunoreaction was then developed with TMB substrate (Sigma, Cat. No. T0440) and stopped by the _addition of 2M _H2SO4 before the plates were read at 450 nm.

Humanization of rabbit mAbs. Anti-LILRB1 rabbit antibodies were humanized by CDR grafting into human germline matching frameworks. Briefly, the CDRs in the rabbit antibody heavy and light chains were defined by a combination of three online programs: Kabat, IMGT, and Paratome. The parental rabbit mAb and the most homologous human germline sequence were aligned, and residues with known structures that were not critical or not subject to change during the in vivo maturation process were identified in a mutational pedigree-guided analysis and humanized. DNA sequences encoding humanized VK and VH were synthesized (GENEWIZ), and human IgG signal peptides and Kozak sequences were engineered at the 5' end of the VK and VH sequences. The humanized VK and VH fragments were then cloned to be fused to intact human constant regions.

Lentivirus/retrovirus infection. HLA-G-1 cDNA with signal peptide mutants ²³ was cloned into pLentiLox3.7-PuroR plasmid. As previously described, lentivirus plasmids pLentiLox3.7-luciferase-PuroR, pLentiLox3.7-HLA-G-PuroR and pLVX-MICA-ZsGreen plasmids were used to overexpress target proteins in cell lines ²⁴ . Infected cells that overexpress luciferase or HLA-G were enriched by selection with 1 μg/mL puromycin. MICA-positive cells were enriched three times by FACS (clone: 6D4, Biogen). According to previous reports, LILRB2-5 reporter cells and LILRA1-6 reporter cells were made by retroviral infection ^{18 25} .

In vitro killing assay based on flow cytometry. Carboxyfluorescein succinimidyl ester (CFSE, Thermo Fisher Scientific) labeling of target cells and propidium iodide (PI) staining of bound dead cells is a reliable method to measure in vitro cell killing by flow cytometry ^26-28 . Briefly, NK cells were co-cultured with CFSE-labeled leukemia cells in U-bottom 96-well plates for 4 hours. Each sample was then mixed with PI and analyzed by FACSCalibur. Cell lysis was calculated by the percentage of PI-positive leukemia cells among total leukemia cells. Spontaneous cell death in the absence of NK cells was less than 5%, and spontaneous cell death in the absence of NK cells was subtracted from the total killing.

Cytokine measurement. A total of 5×10 ⁴ NKL cells were co-cultured with 5×10 ⁴ cancer cells in a U-bottom 96-well plate for 24 hours. IFN-γ release was detected in the culture supernatant by ELISA (Bio-Gene Biotech) according to the manual provided by the supplier.

In vivo killing assay. A total of 5×10 ⁶ (CFSE) labeled 697 (NKL resistant) and 697-MICA (NKL sensitive) cells were mixed and injected intraperitoneally (IP) into NSG mice in combination with 5×10 ⁷ NKL. Anti-LILRB1 antibody (10 mg/kg) or control human IgG (hIgG) was administered retro-orbitally. After 24 hours, cells from the peritoneal cavity of mice were harvested and stained with anti-MICA antibody and analyzed by FACS Calibur1 (BD Biosciences). The in vivo cytotoxic activity of NKL was calculated as follows:

NK = ratio of 697-MICA/697 in mice receiving 697, 697-MICA cells and NKL cells.

CN = ratio of 697-MICA/697 in mice receiving 697 and 697-MICA cells.

In vivo cytotoxic activity % = (1-NK/CN)*100.

The in vivo cytotoxic activity of NKL cells against 697-MICA was also tested subcutaneously in NSG mice. A total of 1×10 ⁶ luciferase-expressing 697-MICA (697MICA-luci) cells were mixed with 5×10 ⁶ NKL cells and injected subcutaneously (sc) into mice. Anti-LILRB1 antibody (10 mg/kg) or control hIgG was administered retro-orbitally to each mouse. Bioluminescence imaging (BLI) was performed 48 hours later to monitor the remaining 697-MICA cells in the mice.

Multiple myeloma xenografts. 6-8 week old NSG mice were sublethally irradiated with 200 cGy X-rays on day -1. On day 0, 5×10 ⁵ KMS27-luci and 5×10 ⁶ NKL cells were given to each mouse by tail vein injection. Anti-LILRB1 antibody (10 mg/kg) or control hIgG was administered retro-orbitally on days 0, 3, and 7, then once a week for one month. An additional 5×10 ⁶ NKL cells were injected on day 14. A total of 10,000 IU human IL2 was administered to each mouse by IP injection every other day. BLI was evaluated on days 28 and 35.

Statistical analysis. Data are presented as mean ± SE (standard deviation). Unless otherwise stated, statistical significance between two groups was calculated by two-tailed unpaired t test. Kaplan-Meier survival curves were analyzed using log-rank test. Differences were considered statistically significant if p < 0.05.

Antibody structure modeling. The antibody structure modeling of 176Fv was performed using Discovery Software2017R2 (DS) was generated. The homologous template structures of the best hits predicted by the identification framework template protocol were selected. These structures were used as input structures and became the basis for the model antibody framework protocol to build chimeric antibody Fab structures. The model antibody ring building method uses a hidden Markov model (HMM) to identify templates and make models for CDRs. This method is used to rebuild CDR loops. Finally, the homology model of 176Fv was subjected to energy minimization using the CHARMM force field. In this way, a minimum energy structure was developed for docking and further analysis.

Antibody docking. The structure of LILBR1 (PDB ID: 5KNM) was retrieved from the Protein Data Bank (PDB) and subjected to energy minimization by structure preparation using the CHARMm force field. Rigid body docking of 176 and LILRB1 was performed using the ZDock algorithm as described (Chen and Weng, 2002). Next, a hierarchical set of clusters with different docking poses was generated based on the antibody position. The poses were rescored using the ZRank scoring function based on electrostatics, van der Waals, and desolvation energy terms.

The docking poses were filtered based on the identified ligand binding sites Arg-84 and Tyr-76. Next, 56 ranked poses with a ZRank score below -55 were selected from the largest ten clusters. These were input into the RDock program. The input docking structure was improved by eliminating small steric hindrances and optimizing polar and charge interactions, and then re-ranked according to electrostatic and solvation energy terms (Chen et al., 2003). All 56 docking poses were performed by RDock using default parameters.

Binding interaction analysis. The purpose of using RDock was to identify residues at the antibody-antigen interface and calculate the binding energy between the 176 antibody and LILBR1. Interaction analysis was performed using DS and PyMOL. Nonpolar interaction energy was calculated by the calculation interaction energy protocol implemented in DS. Complexes with higher binding affinity between Tyr-76 and Arg-84 of LILBR1 and 176Fv were considered to present a favorable docking conformation.

The structure of h176 was predicted using DS. The docking of LILRB1-D1D2 with h176 Fab was performed using the ZDOCKpro module of the Insight II package. The general protocol for running ZDOCK includes two consecutive computational steps, which are described as geometry search in ZDOCK and energy search in RDOCK, respectively. The crystal structure of LILRB1-D1D2 was obtained from the PDB database. RDOCK was used to improve the optimal ZDOCK pose. Poses with high scores in both ZDOCK and RDOCK were selected as candidate complexes.

Sequence alignment and phylogenetic analysis. The D1 and D2 amino acid sequences of all LILRA and LILRB family members were analyzed. LILRB4 was an exception, for which the D1 domain was analyzed. The accession numbers of the proteins in GenBank are as follows: LILRB1, Q8NHL6; LILRB2, Q8N423; LILRB3, O75022; LILRB4, Q8NHJ6; LILRB5, O75023; LILRA1, O75019; LILRA2, Q8N149; LILRA3, Q8N6C8; LILRA4, P59901; LILRA5, A6NI73; LILRA6, Q6PI73. The D1 region was defined as position 27 to position 115, and D2 was defined as position 116 to position 221. Multiple alignments of all D1D2 sequences were performed using ClustalX (version 2.1). MEGA (version 7.0) was used to generate the phylogenetic tree.

Example 2 - LILRB1 is highly expressed on NK cells in the peripheral blood of patients with MM and prostate cancer

The functions of LILRB family immunosuppressive receptors and immune activating receptor NKG2D in cancer development have been characterized ^1-8 . To investigate whether LILRB1 could be a molecular target for cancer immunotherapy, LILRB1 expression on NK cells of patients with cancer was determined and compared with that of healthy donors. LILRB1 was expressed primarily on CD56 ^dark NK cells, but not CD56 ^bright NK cells, from healthy donors and patients with cancer ( FIG1A ). The percentage of NK cells expressing LILRB1 in CD56 ^dark NK cells from peripheral blood of patients with prostate cancer or multiple myeloma (MM) was assessed. The percentage of LILRB1 ⁺ NK cells (in CD56 ^dark NK) in the blood of patients with advanced prostate cancer (3b and 3c) was significantly higher than that in the blood of healthy donors ( FIG1B , Table 9). In addition, the percentage of LILRB1 ⁺ NK cells (CD56 ^dark NK) in the peripheral blood of NK cells from MM patients with persistent disease during treatment was higher ^{than that from healthy donors or patients with mild disease to complete response (Figure 1C, Table 10). These results suggest that the percentage of LILRB1+ NK} cells is significantly higher in patients with advanced cancer or poor prognosis, and LILRB1 may be a molecular target for immunotherapy for these patients.

Table 9. Clinical characteristics of patients with prostate cancer before treatment

Table 10. Responses to treatment in patients with multiple myeloma

Example 3 - Generation and characterization of antagonistic and agonistic monoclonal antibodies against LILRB1

To evaluate the therapeutic potential of anti-LILRB1 mAbs in activated NK cells, a panel of anti-LILRB1 mAbs was generated by screening individual memory B clones, cloning antibody genes, and evaluating the blocking activity of recombinant mAbs (Figures 12A-B) ^32-34 . A total of 229 anti-LILRB1-specific single B cell clones were generated from 384 LILRB1 B cell culture wells and evaluated by ELISA (Table 11). Of these, 174 single B cell clones were identified that produced mAbs that bound to LILRB1, which was expressed on the cell surface of LILRB1 NFAT-GFP reporter cells (Table 12), expressing GFP when cell surface LILRB1 was cross-linked ¹⁸ . Sixty binders were selected for further cloning and expression, and 44 of them were found to have EC50s in the low nanomolar range (0.05-3nM) (Figure 12C). Estimated EC50s based on antibody concentration titration binding curves are provided in Table 13. To group the 44 mAbs according to binding epitopes, a classical sandwich epitope binning assay was performed using Octet RED96, and twelve epitope bins were identified for these 44 high binders ( FIG. 12D ).

Table 11. Binding of mAbs in supernatants of 229 B cell clones as determined by ELISA

Table 12. Binding of mAbs in supernatants of 229 B cell clones to LILRB1 on the cell surface of reporter cells. Anti-mAbs in supernatants were immobilized by protein A coated cell culture plates. 96-well cell culture plates were coated with phosphate buffered saline (PBS) containing 5 μg/mL protein A at 37°C for 2 hours. After washing 3 times with PBS, the plates were incubated with supernatants of 229 B cell clones at 4°C overnight. LILRB1 reporter cells were cultured in the plates for 24 hours. The percentage of GFP reporter cells was analyzed by flow cytometry.

Table 13. _EC50 estimated based on antibody concentration titration binding curves

mAbs _EC50 (ng/mL) mAbs _EC50 (ng/mL) B1-#202-2 59.39 B1-#79 15.36 B1-#204 7.366 B1-#15 9.303 B1-#176 2.237 B1-#173-2 6.565 B1#56 43.8 B1-#28 24.24 B1#3 11.92 B1-#41-1 94.38 B1#5 6.024 B1-#72-1 10.97 B1-#190 6.777 B1-#74 130.1 B1-#220 10.62 B1-#22 29.19 B1-#175 5.296 B1-#93 482.5 B1#58-1 17.1 B1-#160 28.52 B1#27 7.941 B1-#189 14.46 B1#38 181.2 B1-#224 10.95 B1#83 15.55 B1-#198 9.422 B1#76 28.41 B1-#115 52.03 B1#25 13.24 B1-#98 38.03 B1-#166 8.614 B1-#19 19.58 B1-#226 8.261 B1-#10 20.94 B1-#179 6.467 B1-#128 40.02 B1-#125 7.603 B1-#205 98.6 B1-#7 15.93 B1-#209 11 B1-#18 18.19 B1-#196-2 151.5 B1-#178-2 14.25 B1-#14-2 21.45 B1-#110 17.77

To screen for antagonistic anti-LILRB1 mAbs, LILRB1 receptor cells were co-cultured with K562 cells (K562-HLA-G) overexpressing HLA-G1, the MHC class I molecule with the highest affinity for LILRB1 (Figure 2A). LILRB1 reporter cells were activated by K562-HLA-G cells, but not by parental K562 cells (MHC class I negative) (Figure 2A). All antibodies were screened using this reporter assay. Antibodies in bins 1, 7, 8, and 9 showed antagonistic effects (Figure 12E). Antibodies in bins 2, 3, 4, 5, 6, 10, 11, and 12 showed agonistic effects (Figures 12D-E). Cross-binding of B1-176 and other commercial anti-LILRB1 was analyzed by flow cytometry (Figure 2I).

Among the agonistic antibodies, the antibodies from box 1 showed the strongest blocking efficacy (Figure 2B). B1-176 in box 1 showed specific binding to LILRB1 by flow cytometry (Figure 2C), ELISA (Figure 2D) and Octet RED96 (Figure 12F; Table 14). B1-176 showed high affinity for LILRB1, with a KD value of approximately 10 pM (Figure 2E), significantly higher than the affinity of two commercial anti-LILRB1 monoclonal antibodies HP-F1 and GHI/75 (Figure 12G). Therefore, B1-176 was selected to further evaluate its function of binding epitopes and regulating NK cell activation.

Table 14. Binding affinity of LILRB1 monoclonal antibodies measured using the Octet 96Red instrument

mAbs KD(M) kon(1/millisecond) kdis(1/second) Full R^2 B1-#3 5.05E-10 1.12E+05 5.63E-05 0.9974 B1-#176 6.19E-10 9.03E+04 5.59E-05 0.996 B1-#27 1.27E-09 1.27E+05 1.61E-04 0.9993 B1-#178-2 1.59E-09 1.72E+05 2.73E-04 0.9992 B1-#41-1 1.58E-08 3.20E+05 5.06E-03 0.8535 B1-#173-2 1.37E-09 1.92E+05 2.62E-04 0.9983 B1-#72-1 3.14E-09 7.57E+04 2.37E-04 0.9982 B1-#22 6.11E-10 1.41E+05 8.62E-05 0.9971 B1-#74 1.61E-08 8.99E+04 1.45E-03 0.948 B1-#93 8.54E-09 3.96E+04 3.38E-04 0.9772 B1-#198 2.72E-11 2.18E+05 5.92E-06 0.999 B1-#209 3.03E-09 6.89E+04 2.09E-04 0.9993

To understand the mechanism by which B1-176 blocks LILRB1 activation, its binding epitope was determined. As evaluated by ELISA (Figure 2F), B1-176 showed specific binding to the D1D2 region of LILRB1 (Figure 13A), but not to other domains. A series of amino acid mutations were performed in the D1D2 region of LILRB1 to determine the key amino acids for B1-176 binding (Figure 13B). Two amino acids (R84 and Y76; corresponding to positions 107 and 99 of SEQ ID NO: 1, respectively) were found to contribute to the interaction between LILRB1 and B1-176 (Figure 2G). Molecular docking of B1-176 was performed using Discovery Studio 2017. Based on the PDB structure of the LILRB1 D1D2 region (PDBID: 1UFU) and the modeled structure of B1-176 using two key amino acids R84 and Y76, the most likely binding model was determined. In this model, the long HCDR3 of B1-176 is inserted into the narrow ligand-binding pocket on the D1 domain of LILRB1. Arg-84 of LILRB1 may interact with Tyr-102, Glu-103, and Asp-109 from the HCDR3 loop through hydrogen bonds and electrostatic interactions. Tyr-76 of LILRB1 may form a hydrogen bond with Asp-104 from HCDR3 (Figure 2H).

Example 4 - Humanization of rabbit anti-LILRB1 mAb

In order to minimize the immunogenicity of B1-176 for clinical application, B1-176 was humanized and molecular engineering was performed to optimize the antibody sequence. According to the method described previously, the Kabat/IMGR/Paratome combination CDR ²⁰ in the B1-176 heavy chain and light chain was identified. The CDR sequence here is shown to be as short as the HCDR and LCDR. Human germline IGHV3-53*04 and IGKV1-9*01 were selected as the skeleton. The heavy chain Hu-176 VH-1 and the light chain Hu-176 VL were produced by CDR transplantation. However, antibodies with humanized heavy chain sequence VH-1 showed reduced binding to LILRB1 (Figure 3B). After multiple rounds of single back mutations in VH-1, mutation assessment showed that amino acid L48 in FR2 was important for restoring binding activity (Figures 3A and 3B). Molecular docking showed that the Fab of humanized and rabbit B1-176 had similar superposition structures (Figure 3C).

Considering the widespread expression of LILRB1 on normal immune cells, rabbit B1-176 was expressed as human IgG1 with N297A mutation (B1-176-N297A), and humanized B1-176 was expressed as human IgG1 with N297A mutation (Hu B1-176-N297A) or with L234A, L235A, and P329G mutations (Hu B1-176-LALAPG) to eliminate Fc-mediated immune effector function ^{35 36.} All B1-176 with Fc mutants maintained strong affinity for LILRB1 (Figure 3D).

Example 5 - Antagonistic anti-LILRB1 mAbs block activation of LILRB1 reporter cells by cancer cells

Cancer cell lines that can activate LILRB1 were identified by co-culturing cancer cells with LILRB1 reporter cells (FIG. 4A). Flow cytometry was used to evaluate the expression of MHC class I molecules (antibody clone: HP-1F7, Santa Cruz), i.e., the ligand of LILRB1, on the cell surface of blood and solid cancer cell lines (FIG. 4A). Most cancer cell lines express MHC class I molecules and stimulate the activation of LILRB1 reporter cells. K562, DLD1, and Daudi cells were the exceptions, which do not express MHC class I molecules on their cell surfaces. Therefore, the ability of cancer cells to activate LILRB1 reporter cells is positively correlated with their MHC class I expression levels. B1-176 and Hu B1-176-N297A blocked the activation of LILRB1 reporter cells stimulated by blood cancer cell lines (FIG. 4B) and solid tumor cell lines (FIG. 4C). These results indicate that rabbit and humanized versions of B1-176 can block LILRB1 activation induced by HLA-G and other MHC class I molecules. Notably, LILRB1 binds to the conserved α3 domain of MHC class I. ³⁷ This may explain why antagonistic anti-LILRB1 antibodies screened from K562-HLA-G cells can block LILRB1 activation in other cancer cell lines.

Example 6 - In vitro function of antagonistic anti-LILRB1 mAbs on NK cells

The in vitro efficacy of anti-LILRB1 mAbs was evaluated using the NK cell line NKL. NKL cells express high levels of LILRB1 on the surface (Figure 14A). Treatment with different versions of anti-LILRB1 mAbs: B1-176-N297A, Hu B1-176-N297A, and HuB1-176-LALAPG increased the cytotoxic activity of NKL cells against the MM cell line KMS27 at similar levels (Figure 5A). The anti-LILRB1 antibody also increased the cytotoxic activity of NKL against other MM cell lines OPM2 and RPMI8226 and the T cell leukemia cell line Jurkat (Figure 5B). By flow cytometry, LILRB1 was found to be expressed on the cell surface of certain leukemia and lymphoma cell lines such as 697 and Raji cells, but not on MM cell lines, Jurkat cells, or most malignant plasma cells of patients with MM (Figures 14B-D). Since the N297A mutation or LALAPG on the Fc abolishes the ADCC function of the antibody, these results suggest that antagonistic anti-LILRB1 antibodies increase the natural cytotoxic activity of NKL cells against MM cell lines. Interestingly, the pre-B cell leukemia cell line 697 and the Burkitt lymphoma cell line Raji were resistant to NKL cytotoxicity even when treated with anti-LILRB1 antibodies (Figure 5C). Previous studies have reported that MHC class I chain-associated gene AB (MICA/B), a ligand for the NK cell activating receptor NKG2D, is expressed on NK-sensitive acute lymphoblastic leukemia (ALL) cells but absent on NK-resistant ALL cells ^38. To sensitize 697 cells and Raji, MICA was overexpressed on 697 and Raji cells. As expected, MICA on the surface of cancer cells stimulated the cytotoxic activity of NKL cells against these cells, and anti-LILRB1 antibodies further increased the cytotoxic activity of NKL cells (Figures 5C-D). These results suggest that LILRB1 blockade and NKG2D activation synergistically increase the cytotoxic activity of NKL cells. In addition to hematological cancer cells, anti-LILRB1 antibodies also stimulated NKL cells to kill solid tumor cancer cell lines, such as the breast cancer cell line MDA-MB-231 and the melanoma cell line MALME-3M (Figure 5E).

NK cells can also enhance the response of other immune cells to cancer cells by secreting cytokines. Anti-LILRB1 antibodies increased IFN-γ secretion from NKL cells stimulated by T cell leukemia Jurkat cells and MM cell lines RPMI8226, OPM2 cells and KMS27 (Figure 5F). Anti-LILRB1 antibodies increased IFN-γ secretion from NKL cells induced by 697-MICA but not 697. This result indicates that LILRB1 blockade and NKG2D activation synergistically stimulate IFN-γ from NKL cells (Figure 5F). The function of antagonistic anti-LILRB1 antibodies was also confirmed using another NK cell line NK92m. Antagonistic anti-LILRB1 antibodies increased the cytotoxic activity of NK92mi against leukemia cell lines (Figures 8A-B), solid tumor cell lines (Figure 8B), multiple myeloma cell lines (Figure 8C) and primary leukemia cells (Figure 8D).

In addition, the functionality of the anti-LILRB1 antibody was confirmed using primary NK cells. Primary NK cells from buffy coats of healthy donors were isolated, and LILRB1 ⁺ NK cells were enriched by FACS. The anti-LILRB1 antibody increased the cytotoxic activity of primary LILRB1 ⁺ NK cells from healthy donors against multiple myeloma cell lines (KMS27 and OPM2), 697 cells, or Raji cells, but did not increase the cytotoxic activity against Daudi cells that do not express the LILRB1 ligand MHC class I (Figure 6A). Since NK cells also express MHC class I, this result indicates that MHC class I or cis-MHC class I on neighboring NK cells does not inhibit the cytotoxic activity of NK cells against cancer cells. Here, 697 and Raji cells are sensitive to the cytotoxic activity of primary NK cells, which may be due to the fact that the cytotoxic activity of primary NK cells is stronger than that of NKL cells. A previous publication also reported that activated primary NK cells showed stronger cytotoxic activity than NKL cells, which may be due to the relatively high levels of cytotoxic receptors and NK94 on primary NK cells ^39. NK cells were also isolated from the peripheral blood of a patient with MM, about 80% of whose NK cells were LILRB1 positive, and the NK cells of the patient were used for cytotoxicity assays. Anti-LILRB1 mAb increased the cytotoxic activity of the patient's NK cells against the MM cell line KMS27 (Figure 6B).

Example 7 - In vivo function of antagonistic anti-LILRB1 mAbs on NK cells

The in vivo function of anti-LILRB1 antibodies was tested using NSG mice. A mixture of NKL-resistant 697 cells and NKL-sensitive 697MICA was injected into the peritoneal cavity of NSG mice together with NKL cells. After 24 hours, the ratio of 697-MICA/697 was analyzed and calculated as the cytotoxic activity of NKL cells in vivo (Figure 7A). These results indicate that anti-LILRB1 antibodies increase the in vivo cytotoxic activity of NKL cells against 697-MICA cells. The cytotoxic activity of NKL cells was also tested in vivo by subcutaneously injecting a mixture of NKL and luciferase-overexpressing 697-MICA cells into NSG mice. After 48 hours, bioluminescence imaging (BLI) showed that the tumor burden of mice receiving anti-LILRB1 antibodies was significantly reduced compared with mice treated with control hIgG (Figure 7B). In summary, anti-LILRB1 antibodies can improve the in vivo cytotoxic function of NKL cells.

The efficacy of anti-LILRB1 antibodies in preventing the development of multiple myeloma was further evaluated in a xenograft mouse model. NSG mice were implanted with KMS27 cells and NKL cells via their tail veins and administered control IgG or anti-LILRB1 antibodies, with cancer development monitored by BLI. Mice receiving NKL cells and anti-LILRB1 antibodies had significantly lower disease burden and longer survival time compared to mice receiving NKL cells and control IgG or mice receiving phosphate-buffered saline (PBS) alone (Figure 7C). In summary, these results suggest that antagonistic anti-LILRB1 antibodies can enhance the function of NKL cells in inhibiting the development of multiple myeloma in vivo.

Example 8 - In vitro function of agonistic anti-LILRB1 mAbs

B1-7 and B1-41 were selected to determine the function of agonistic LILRB1. B1-7 and B1-41 showed agonistic function on LILRB1 reporter cells co-cultured with K562 cells (Figure 9). In the absence of K562 cells, B1-7 and B1-41 did not activate LILRB1 reporter cells. Considering that K562 cells have Fc receptors, this result indicates that agonistic LILRB1 mAb only works when Fc binds to Fc receptors in the environment. To confirm this, N297A or S267E was introduced into the Fc of the agonistic LILRB1 mAb to eliminate or enhance the binding of Fc to Fc receptors, respectively. The results showed that N297A eliminated, while S267E enhanced the activation of LILRB1 reporter cells induced by B1-7 and B1-41 (Figure 9). These results indicate that the agonistic effect of anti-LILRB1 is Fc-dependent. Agonistic LILRB1 mAb inhibited the cytotoxic activity of NK92mi (Figures 10A-B) and NKL (Figure 10C) cells against cancer cells in vitro. The N297A mutation in the Fc abolished the activity of agonistic B1-7 (Figure 10D). Agonistic LILRB1 mAb also inhibited IFN-γ secretion by NKL cells (Figure 11).

**********

According to the present disclosure, all methods disclosed and claimed herein can be prepared and performed without undue experimentation. Although the compositions and methods of the present invention have been described according to preferred embodiments, it will be apparent to those skilled in the art that the steps or sequence of steps of the methods and methods described herein can be changed without departing from the concept, spirit and scope of the present invention. More specifically, it will be apparent that certain agents related to chemistry and physiology can replace the agents described herein while achieving the same or similar results. All such similar substitutions and modifications apparent to those skilled in the art are considered to be within the spirit, scope and concept of the present invention as defined by the appended claims.

References

The following references are specifically incorporated herein by reference, to the extent they provide exemplary procedural or other details supplementary to those set forth herein.

Chen R, Weng ZP. Docking unbound proteins using shape complementarity, desolvation, and electrostatics. Proteins 2002; 47: 281-94.

Chen R, Li L, Weng ZP. ZDOCK: An initial-stage protein-docking algorithm. Proteins 2003; 52: 80-87.

1. Guillerey C, Huntington ND, Smyth MJ. Targeting natural killer cells in cancer immunotherapy. Nat Immunol 2016; 17: 1025-36. doi: 10.1038/ni.3518

2. Weiner LM, Surana R, Wang S. Monoclonal antibodies: versatile platforms for cancer immunotherapy. Nature Immunology 2010;10:317-27.doi:10.1038/nri2744

3. de Weers M, Tai YT, van der Veer MS, et al. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors. Journal of Immunology 2011; 186: 1840-48. doi: 10.4049/jimmunol.1003032

4. Ferrari de Andrade L, Tay RE, Pan D, et al. Antibody-mediated inhibition of MICA and MICB shedding promotes NK cell-driven tumor immunity. Science 2018; 359: 1537-42. doi: 10.1126/science.aao0505

5. Gauthier L, Morel A, Anceriz N, et al. Multifunctional Natural Killer Cell Engagers Targeting NKp46 Trigger Protective Tumor Immunity. Cell, 2019; 177: 1701-13e16. doi: 10.1016/j.cell.2019.04.041

6. Romagne F, Andre P, Spee P, et al. Preclinical characterization of 1-7F9, a novel human anti-KIR receptor therapeutic antibody that augments natural killer-mediated killing of tumor cells. Blood 2009; 114: 2667-77. doi: 10.1182/blood-2009-02-206532

7. Andre P, Denis C, Soulas C, et al. Anti-NKG2A mAb Is a Checkpoint Inhibitorthat Promotes Anti-tumor Immunity by Unleashing Both T and NK Cells. Cell 2018;175:1731-43.doi:10.1016/j.cell.2018.10.014

8. Kang X, Kim J, Deng M, et al. Inhibitory leukocyte immunoglobulin-like receptors: immune checkpoint proteins and tumor sustaining factors. Cell Cycle, 2016; 15: 25-40. doi: 10.1080/15384101.2015.1121324

9. Pasero C, Gravis G, Guerin M, et al. Inherent and Tumor-Driven Immune Tolerance in the Prostate Microenvironment Impairs Natural Killer Cell Antitumor Activity. Cancer Res 2016;76:2153-65.doi:10.1158/0008-5472.CAN-15-1965

10. Roberti MP, Julia EP, Rocca YS, et al. Overexpression of CD85j in TNBC patients inhibits Cetuximab-mediated NK-cell ADCC but can be restored with CD85j functional blockade. European journal of immunology 2015;45:1560-69. doi:10.1002/eji.201445353

11. Mamessier E, Sylvain A, Thibult ML, et al. Human breast cancer cells enhance self tolerance by promoting evasion from NK cell antitumor immunity. The Journal of clinical investigation 2011; 121: 3609-22. doi: 10.1172/JCI45816

12. Godal R, Bachanova V, Gleason M, et al. Natural killer cell killing of acute myelogenous leukemia and acute lymphoblastic leukemia blasts by killer cell immunoglobulin-like receptor-negative natural killer cells after NKG2A and LIR-1 blockade. Biology of blood and marrow transplantation: journal of the American Society for Blood and Marrow Transplantation. 2010;16:612-21. doi:10.1016/j.bbmt.2010.01.019

13. Lesport E, Baudhuin J, Sousa S, et al. Inhibition of human V gamma 9V delta 2T-cell antitumor activity through HLA-G: implications for immunotherapy of cancer. Cell Mol Life Sci 2011; 68: 3385-99. doi: 10.1007/s00018-011-0632-7

14. Kim A, Han CJ, Driver I, et al. LILRB1 Blockade Enhances Bispecific T Cell Engager Antibody-Induced Tumor Cell Killing by Effector CD8(+) T Cells. J Immunol. 2019;4:1076-87.doi:10.4049/jimmunol.1801472

15. Barkal AA, Weiskopf K, Kao KS, et al. Engagement of MHC class I by the inhibitory receptor LILRB1 suppresses macrophages and is a target of cancer immunotherapy. Nature Immunology 2018;19:76-84.doi:10.1038/s41590-017-0004-z

16. Harly C, Peyrat M-A, Netzer S, et al. Up-regulation of cytolytic functions of human Vδ2-γδT lymphocytes through engagement of ILT2 expressed by tumor target cells. Blood 2011; 117: 2864-73. doi: 10.1182/blood-2010-09-309781

17. Lozano E, Diaz T, Mena MP, et al. Loss of the Immune Checkpoint CD85j/LILRB1 on Malignant Plasma Cells Contributes to Immune Escape in Multiple Myeloma. J Immunol. 2018;200:2581-91. doi:10.4049/jimmunol.1701622

18. Shiroishi M, Kuroki K, Ose T, et al. Efficient leukocyte Ig-like receptor signaling and crystal structure of disulfide-linked HLA-G dimer. The Journal of biological chemistry 2006; 281: 10439-47. doi: 10.1074/jbc.M512305200

19. Zou YZ, Luo WG, Guo J, et al. NK cell-mediated anti-leukemia cytotoxicity is enhanced using a NKG2D ligand MICA and anti-CD20 scfv chimeric protein. Eur J Immunol 2018;48:1750-63. doi:10.1002/eji.201847550

20. Gui X, Deng M, Song H, et al. Disrupting LILRB4/APOE Interaction by an Effective Humanized Antibody Reverses T-cell Suppression and Blocks AML Development. Cancer Immunol Res 2019;7:1244-57.doi:10.1158/2326-6066.CIR-19-0036

21. Chapman TL, Heikema AP, West AP, Jr. et al. Crystal structure and ligand binding properties of the D1D2 region of the inhibitory receptor LIR-1 (ILT2). Immunity 2000; 13: 727-36. doi: 10.1016/s1074-7613(00)00071-6

22. Meng W, Li L, Xiong W, et al. Efficient generation of monoclonal antibodies from single rhesus macaque antibody secreting cells. MAb 2015; 7: 707-18. doi: 10.1080/19420862.2015.1051440

23.Navarro F, Llano M, Bellon T et al. The ILT2(LIR1)and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target cells. European Journal of Immunology 1999;29:277-83.doi:10.1002/(SICI)1521-4141(199901)29:01&#60;277::AID-IMMU277&#62;3.0.CO;2-4

24. Kang X, Lu Z, Cui C, et al. The ITIM-containing receptor LAIR1 is essential for acute myeloid leukaemia development. Nature Cell Biology, 2015; 17: 665-77. doi: 10.1038/ncb3158

25. Deng M, Lu ZG, Zheng JK, et al. A motif in LILRB2 critical for Angptl2 binding and activation. Blood 2014;124:924-35. doi:10.1182/blood-2014-01-549162

26. Dumitriu IE, Mohr W, Kolowos W et al. 5,6-carboxyfluorescein diacetate succinimidyl ester-labeled apoptotic and necrotic as well as detergent-treated cells can be traced in composite cell samples. Analytical biochemistry 2001; 299: 247-52. doi: 10.1006/abio.2001.5415

27. Aktas E, Kucuksezer UC, Bilgic S et al. Relationship between CD107a expression and cytotoxic activity. Cellular immunology 2009; 254: 149-54. doi: 10.1016/j.cellimm.2008.08.007

28. Schonberg K, Hejazi M, Uhrberg M. Protocol for the clonal analysis of NK cell effector functions by multi-parameter flow cytometry. Methods Mol Biol. 2012; 903: 381-92. doi: 10.1007/978-1-61779-937-2_26

29. Zheng J, Umikawa M, Cui C, et al. Inhibitory receptors bind ANGPTLs and support blood stem cells and leukaemia development. Nature 2012; 485: 656-60. doi: 10.1038/nature11095

30. Deng M, Gui X, Kim J, et al. LILRB4 signalling in leukaemia cells mediates T cell suppression and tumour infiltration. Nature 2018;562:605-09. doi:10.1038/s41586-018-0615-z

31. John S, Chen H, Deng M, et al. A novel anti-LILRB4 CAR-T cell for the treatment of monocytic AML. Mol Ther 2018;26:2487-95.doi:10.1016/j.ymthe.2018.08.001

32. Freed DC, Tang Q, Tang AM et al. Pentameric complex of viral glycoprotein H is the primary target for potent neutralization by a human cytomegalovirus vaccine. Proceedings of the National Academy of Sciences of the United States of America, 2013; 110: E4997-05. doi: 10.1073/pnas.1316517110

33. Seeber S, Ros F, Thorey I, et al. A Robust High Throughput Platform to Generate Functional Recombinant Monoclonal Antibodies Using Rabbit B Cells from Peripheral Blood. PLoS One 2014;9:e86184. doi:ARTNe8618410.1371/journal.pone.0086184

34. Yu Y, Lee P, Ke Y, et al. A humanized anti-VEGF rabbit monoclonal antibody inhibits sangiogenesis and blocks tumor growth in xenograft models. PLoS One 2010;5:e9072.doi:10.1371/journal.pone.0009072

35. Ha S, Ou Y, Vlasak J, et al. Isolation and characterization of IgG1 with asymmetrical Fc glycosylation. Glycobiology 2011; 21: 1087-96. doi: 10.1093/glycob/cwr047

36. Lo M, Kim HS, Tong RK et al. Effector-attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice. Journal of Biological Chemistry 2017; 292: 3900-08. doi: 10.1074/jbc.M116.767749

37. Chapman TL, Heikeman AP, Bjorkman PJ. The inhibitory receptor LIR-1 uses a common binding interaction to recognize class I MHC molecules and the viral homolog UL18. Immunity 1999; 11: 603-13. doi: 10.1016/s1074-7613(00)80135-1

38. Romanski A, Bug G, Becker S et al. Mechanisms of resistance to natural killer cell-mediated cytotoxicity in acute lymphoblastic leukemia. Exp Hematol 2005; 33: 344-52. doi: 10.1016/j.exphem.2004.11.006

39. Gross C, Schmidt-Wolf IGH, Nagaraj S et al. Heat shock protein 70-reactivity is associated with increased cell surface density of CD94/CD56 on primary natural killer cells. Cell Stress Chaperon 2003;8:348-60.doi:10.1379/1466-1268(2003)008<0348:Hspria>2.0.Co;2

40. Morandi F, Ferretti E, Castriconi R, et al. Soluble HLA-G dampens CD94/NKG2A expression and function and differentially modulates chemotaxis and cytokine and chemokine secretion in CD56bright andCD56dim NK cells. Blood 2011;118:5840-50.doi:10.1182/blood-2011-05-352393

41. Desgrandchamps F, LeMaoult J, Goujon A, et al. Prediction of non-muscle-invasive bladder cancer recurrence by measurement of checkpoint HLAG's receptor ILT2 on peripheral CD8(+)T cells. Oncotarget 2018; 9:33160-69. doi:10.18632/oncotarget.26036

42. Yu K, Davidson CE, Burshtyn DN. LILRB1 Intron 1 Has a Polymorphic Regulatory Region That Enhances Transcription in NK Cells and Recruits YY1. J Immunol 2020;204:3030-41. doi:10.4049/jimmunol.2000164

43. LeMaoult J, Zafaranloo K, Le Danff C, et al. HLA-G up-regulates ILT2, ILT3, ILT4, and KIR2DL4 in antigen presenting cells, NK cells, and T cells. FASEB journal: official publication of the Federation of American Societies for Experimental Biology 2005; 19: 662-4. doi: 10.1096/fj.04-1617fje

44. Bjorkstrom NK, Riese P, Heuts F, et al. Expression patterns of NKG2A, KIR, and CD57 define a process of CD56dim NK-cell differentiation uncoupled from NK-cell education. Blood 2010;116:3853-64. doi:10.1182/blood-2010-04-281675

45. Muntasell A, Servitja S, Cabo M, et al. High Numbers of Circulating CD57(+)NK Cells Associate with Resistance to HER2-Specific Therapeutic Antibodies in HER2(+) Primary Breast Cancer. Cancer Immunol Res 2019;7:1280-92.doi:10.1158/2326-6066.CIR-18-0896

46. Heidenreich S, Zu Eulenburg C, Hildebrandt Y, et al. Impact of the NK cell receptor LIR-1 (ILT-2/CD85j/LILRB1) on cytotoxicity against multiple myeloma. Clinical & Developmental Immunology, 2012; 2012: 652130. doi: 10.1155/2012/652130

47. Suck G, Odendahl M, Nowakowska P, et al. NK-92: an 'off-the-shelf therapeutic' for adoptive natural killer cell-based cancer immunotherapy. Cancer Immunol Immunol 2016;65:485-92.doi:10.1007/s00262-015-1761-x

48. Carbone E, Neri P, Mesuraca M et al. HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood 2005; 105: 251-58. doi: 10.1182/blood-2004-04-1422

49. Menier C, Riteau B, Carosella ED, et al. MICA-triggered signal for NK cell tumor lysis is counteracted by HLA-G1-mediated inhibitory signal. Int J Cancer 2002; 100: 63-70. doi: 10.1002/ijc.10460

50. Miller JS, Soignier Y, Panoskaltsis-Mortari A, et al. Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer. Blood 2005; 105: 3051-57. doi: 10.1182/blood-2004-07-2974

Sequence Listing

<110> Board of Regents, The University of Texas System

<120> Monoclonal antibodies against LILRB1 for diagnostic and therapeutic use

<130> UTFH.P0370WO

<140> Not yet assigned

<141> 2021-07-26

<150> 63/057,601

<151> 2020-07-28

<150> 63/124,516

<151> 2020-12-11

<160> 875

<170> PatentIn Version 3.5

<210> 1

<211> 650

<212> PRT

<213> Homo sapiens

<400> 1

Met Thr Pro Ile Leu Thr Val Leu Ile Cys Leu Gly Leu Ser Leu Gly

1 5 10 15

Pro Arg Thr His Val Gln Ala Gly His Leu Pro Lys Pro Thr Leu Trp

20 25 30

Ala Glu Pro Gly Ser Val Ile Thr Gln Gly Ser Pro Val Thr Leu Arg

35 40 45

Cys Gln Gly Gly Gln Glu Thr Gln Glu Tyr Arg Leu Tyr Arg Glu Lys

50 55 60

Lys Thr Ala Leu Trp Ile Thr Arg Ile Pro Gln Glu Leu Val Lys Lys

65 70 75 80

Gly Gln Phe Pro Ile Pro Ser Ile Thr Trp Glu His Ala Gly Arg Tyr

85 90 95

Arg Cys Tyr Tyr Gly Ser Asp Thr Ala Gly Arg Ser Glu Ser Ser Asp

100 105 110

Pro Leu Glu Leu Val Val Thr Gly Ala Tyr Ile Lys Pro Thr Leu Ser

115 120 125

Ala Gln Pro Ser Pro Val Val Asn Ser Gly Gly Asn Val Ile Leu Gln

130 135 140

Cys Asp Ser Gln Val Ala Phe Asp Gly Phe Ser Leu Cys Lys Glu Gly

145 150 155 160

Glu Asp Glu His Pro Gln Cys Leu Asn Ser Gln Pro His Ala Arg Gly

165 170 175

Ser Ser Arg Ala Ile Phe Ser Val Gly Pro Val Ser Pro Ser Arg Arg

180 185 190

Trp Trp Tyr Arg Cys Tyr Ala Tyr Asp Ser Asn Ser Pro Tyr Glu Trp

195 200 205

Ser Leu Pro Ser Asp Leu Leu Glu Leu Leu Val Leu Gly Val Ser Lys

210 215 220

Lys Pro Ser Leu Ser Val Gln Pro Gly Pro Ile Val Ala Pro Glu Glu

225 230 235 240

Thr Leu Thr Leu Gln Cys Gly Ser Asp Ala Gly Tyr Asn Arg Phe Val

245 250 255

Leu Tyr Lys Asp Gly Glu Arg Asp Phe Leu Gln Leu Ala Gly Ala Gln

260 265 270

Pro Gln Ala Gly Leu Ser Gln Ala Asn Phe Thr Leu Gly Pro Val Ser

275 280 285

Arg Ser Tyr Gly Gly Gln Tyr Arg Cys Tyr Gly Ala His Asn Leu Ser

290 295 300

Ser Glu Trp Ser Ala Pro Ser Asp Pro Leu Asp Ile Leu Ile Ala Gly

305 310 315 320

Gln Phe Tyr Asp Arg Val Ser Leu Ser Val Gln Pro Gly Pro Thr Val

325 330 335

Ala Ser Gly Glu Asn Val Thr Leu Leu Cys Gln Ser Gln Gly Trp Met

340 345 350

Gln Thr Phe Leu Leu Thr Lys Glu Gly Ala Ala Asp Asp Pro Trp Arg

355 360 365

Leu Arg Ser Thr Tyr Gln Ser Gln Lys Tyr Gln Ala Glu Phe Pro Met

370 375 380

Gly Pro Val Thr Ser Ala His Ala Gly Thr Tyr Arg Cys Tyr Gly Ser

385 390 395 400

Gln Ser Ser Lys Pro Tyr Leu Leu Thr His Pro Ser Asp Pro Leu Glu

405 410 415

Leu Val Val Ser Gly Pro Ser Gly Gly Pro Ser Ser Pro Thr Thr Gly

420 425 430

Pro Thr Ser Thr Ser Gly Pro Glu Asp Gln Pro Leu Thr Pro Thr Gly

435 440 445

Ser Asp Pro Gln Ser Gly Leu Gly Arg His Leu Gly Val Val Ile Gly

450 455 460

Ile Leu Val Ala Val Ile Leu Leu Leu Leu Leu Leu Leu Leu Leu Phe

465 470 475 480

Leu Ile Leu Arg His Arg Arg Gln Gly Lys His Trp Thr Ser Thr Gln

485 490 495

Arg Lys Ala Asp Phe Gln His Pro Ala Gly Ala Val Gly Pro Glu Pro

500 505 510

Thr Asp Arg Gly Leu Gln Trp Arg Ser Ser Pro Ala Ala Asp Ala Gln

515 520 525

Glu Glu Asn Leu Tyr Ala Ala Val Lys His Thr Gln Pro Glu Asp Gly

530 535 540

Val Glu Met Asp Thr Arg Ser Pro His Asp Glu Asp Pro Gln Ala Val

545 550 555 560

Thr Tyr Ala Glu Val Lys His Ser Arg Pro Arg Arg Glu Met Ala Ser

565 570 575

Pro Pro Ser Pro Leu Ser Gly Glu Phe Leu Asp Thr Lys Asp Arg Gln

580 585 590

Ala Glu Glu Asp Arg Gln Met Asp Thr Glu Ala Ala Ala Ser Glu Ala

595 600 605

Pro Gln Asp Val Thr Tyr Ala Gln Leu His Ser Leu Thr Leu Arg Arg

610 615 620

Glu Ala Thr Glu Pro Pro Pro Ser Gln Glu Gly Pro Ser Pro Ala Val

625 630 635 640

Pro Ser Ile Tyr Ala Thr Leu Ala Ile His

645 650

<210> 2

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 2

Gly Phe Asp Phe Ser Ser Asp Ala

1 5

<210> 3

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 3

Ile Tyr Asn Gly Asp Glu Ile

1 5

<210> 4

<211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 4

Ala Arg Ala Val Tyr Ser Asp Gly Gly Ala Gly Tyr Pro Tyr Met Tyr

1 5 10 15

Gly Met Asp Leu

20

<210> 5

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 5

Gly Phe Asp Phe Ser Gly Ile Tyr Trp

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 6

Phe Asp Ala Glu Arg Thr Gly Asn Thr

1 5

<210> 7

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 7

Ala Arg Ser Tyr Tyr Met

1 5

<210> 8

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 8

Glu Leu Ser Phe Ser Ser Ala Tyr Tyr

1 5

<210> 9

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 9

Ile Tyr Ser Gly Asp Gly Asp

1 5

<210> 10

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 10

Ala Arg Ala Leu Asp Ser His Tyr Ser Ser Phe Asp Leu

1 5 10

<210> 11

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 11

Gly Phe Ser Leu Asn Ser Tyr Ala

1 5

<210> 12

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 12

Ile Asp Thr Gly Ala Ser Ile

1 5

<210> 13

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 13

Ala Arg Gly Phe Ser Met Phe Lys Leu

1 5

<210> 14

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 14

Gly Leu Asp Phe Ser Ser Ser Tyr Trp

1 5

<210> 15

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 15

Ile Asp Thr Gly Ser Ser Gly Ser Thr

1 5

<210> 16

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 16

Ala Ser Thr Pro Asn Ser Leu Gly Tyr Asp Leu

1 5 10

<210> 17

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 17

Gly Phe Ser Ser Ser Ser Ser Ala Tyr

1 5

<210> 18

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 18

Ile Phe Ile Gly Ser Gly Ser Asp Ser

1 5

<210> 19

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 19

Ala Arg Asn Thr Tyr Asp Trp Asn Gly Tyr Ile Tyr Gly Pro Cys Tyr

1 5 10 15

Phe Gly Leu

<210> 20

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 20

Gly Phe Ser Leu Ser Arg Tyr Ala

1 5

<210> 21

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 21

Ile Asp Thr Ser Ser Gly Asn

1 5

<210> 22

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 22

Ala Arg Gly Phe Ser Met Phe Lys Leu

1 5

<210> 23

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 23

Gly Leu Asp Phe Ser Ser Ser Tyr Trp

1 5

<210> 24

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 24

Ile Asp Val Gly Ser Ser Gly Gly Ser

1 5

<210> 25

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 25

Ala Ser Thr Thr Thr Asn Val Phe Gly Tyr Asp Leu

1 5 10

<210> 26

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 26

Gly Phe Asp Phe Ser Ser Asn Asp Tyr

1 5

<210> 27

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 27

Ile Tyr Gly Gly Asp Gly His Thr

1 5

<210> 28

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 28

Arg Gly Tyr Ser Tyr Gly Asp Thr Gly Tyr Ala Asp Ala Ile Leu Thr

1 5 10 15

Leu Asp Leu

<210> 29

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 29

Phe Asn Tyr Tyr Asn Tyr Tyr Tyr

1 5

<210> 30

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 30

Met Ser Thr Ala Ser Ala Asn

1 5

<210> 31

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 31

Ala Lys Ser His Gly Gly Asp Gly Gly Tyr Gly Val Val Leu

1 5 10

<210> 32

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 32

Gly Phe Ser Phe Ser Gly Ser Tyr Trp

1 5

<210> 33

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 33

Ile Tyr Gly Asp Ser Ile Ala

1 5

<210> 34

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 34

Ala Arg Asp Arg Asn Gly Gly Ser Gly Ala Tyr Gly Trp Asp Leu

1 5 10 15

<210> 35

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 35

Gly Phe Ser Phe Ser Ser Asp Tyr Asp

1 5

<210> 36

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 36

Ile Val Thr Gly Phe Ser Gly Arg Ile

1 5

<210> 37

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 37

Ala Arg Asp Ser Gly Asn Tyr Asn Trp Asp Leu

1 5 10

<210> 38

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 38

Gly Phe Ser Phe Ser Asn Asp Tyr Trp

1 5

<210> 39

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 39

Gly His Ile Gly Ser Phe Arg Thr Thr

1 5

<210> 40

<211> 16

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 40

Ala Arg Ser Pro Tyr Asp Asp Gly Tyr Gly Gly Phe Thr Phe Asn Leu

1 5 10 15

<210> 41

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 41

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 42

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 42

Ile Tyr Ala Gly Ser Ser Gly Ser Thr

1 5

<210> 43

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 43

Ala Arg Ser Thr Ser Gly Ser Tyr Gly Ala Gly Leu Gly Leu

1 5 10

<210> 44

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 44

Gly Phe Ser Phe Ser Ile Asn Leu Tyr

1 5

<210> 45

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 45

Ile Tyr Gly Asn Asn Asn Ala Asn Thr

1 5

<210> 46

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 46

Ala Arg Asp Thr Ala Ala Tyr Tyr Ala Phe Ser Leu

1 5 10

<210> 47

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 47

Ser Gly Phe Thr Phe Ser Gly Tyr Tyr

1 5

<210> 48

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 48

Ile Tyr Val Gly Ser Gly Gly Ser Thr

1 5

<210> 49

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 49

Ala Arg Gly Val Asn Asp Tyr Gly Trp Ala Leu Lys Leu

1 5 10

<210> 50

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 50

Ala Phe Ser Phe Ser Ser Ser Ser Ser Trp

1 5

<210> 51

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 51

Ile Tyr Gly Gly Ser Val Gly Thr Thr

1 5

<210> 52

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 52

Ala Thr Asn Thr Asp Ser Ser Arg Ser Tyr Tyr Asn Leu

1 5 10

<210> 53

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 53

Gly Ile Asp Leu Ser Asn Tyr Trp Tyr

1 5

<210> 54

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 54

Val Ala Thr Asp Ser Ser Arg Thr

1 5

<210> 55

<211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 55

Arg Gly Ser Gly Ala Ser Thr Asn Gly Val Trp Trp Val Met Gly Asp

1 5 10 15

Gly Met Asp Leu

20

<210> 56

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 56

Gly Phe Ser Leu Asn Arg Tyr Tyr

1 5

<210> 57

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 57

Ile Tyr Ser Gly Ser Gly Ser

1 5

<210> 58

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 58

Gly Arg Leu Asp Tyr Arg Val Ile Tyr Ala Phe Asn Leu

1 5 10

<210> 59

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 59

Gly Phe Ser Phe Ser Gly Ser Cys Asp

1 5

<210> 60

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 60

Ile Val Leu Ser Asn Gly Asn

1 5

<210> 61

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 61

Ala Arg Glu Arg Tyr Pro Gly Ala Phe Ser Ser Gly Leu Asp Leu

1 5 10 15

<210> 62

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 62

Gly Phe Ser Phe Ser Ser Ser Trp Tyr

1 5

<210> 63

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 63

Ile Tyr Thr Leu Arg Ser Gly Ala Ala

1 5

<210> 64

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 64

Ala Arg Ala Thr Tyr Ala Tyr Ala Gly Ala Gly Asp Leu

1 5 10

<210> 65

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 65

Ala Phe Ser Phe Ser Ser Ser Ser Ser Trp

1 5

<210> 66

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 66

Ile Tyr Gly Gly Ser Val Ala Thr Thr

1 5

<210> 67

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 67

Ala Thr Asn Thr Asp Ser Ser Arg Ser Tyr Tyr Asn Leu

1 5 10

<210> 68

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 68

Gly Phe Ser Phe Ser Gly Asn Thr

1 5

<210> 69

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 69

Ile Tyr Pro Ser Ser Thr Ser Ile

1 5

<210> 70

<211> 17

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 70

Ala Arg Arg Tyr Ala Ala Phe Leu Thr Tyr Gly Ser Gly Ala Phe Asp

1 5 10 15

Pro

<210> 71

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 71

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 72

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 72

Val Ala Thr Gly Ser Gly Thr

1 5

<210> 73

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 73

Ala Arg Ile Gly Ala Phe Tyr Ser Phe Arg Leu

1 5 10

<210> 74

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 74

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 75

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 75

Ile Tyr Ala Gly Asn Ser Ala Asn Thr

1 5

<210> 76

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 76

Ala Ser Arg Asn Gly Gly Ala Pro Asp Gly Leu Asn Leu

1 5 10

<210> 77

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 77

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 78

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 78

Ile Ala Thr Gly Thr Gly Ser

1 5

<210> 79

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 79

Ala Arg Gly Gly Gly Tyr Trp Ser Phe Ser Leu

1 5 10

<210> 80

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 80

Gly Phe Ser Phe Ser Ser Ser Tyr Tyr

1 5

<210> 81

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 81

Ile Tyr Thr Gly Ser Asp Ser Thr

1 5

<210> 82

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 82

Gly Asp Trp Asp Tyr Ala Asp Ala Ala Gly Tyr Tyr Val Ala Arg Gly

1 5 10 15

Phe Asn Leu

<210> 83

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 83

Gly Phe Ser Phe Thr Lys Asn Tyr Tyr

1 5

<210> 84

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 84

Ile Tyr Ala Gly Ser Thr Asn Thr

1 5

<210> 85

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 85

Arg Asp Phe Val Ser Tyr Leu Asn Leu

1 5

<210> 86

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 86

Gly Ile Asp Leu Ser Asn Phe Tyr Tyr

1 5

<210> 87

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 87

Val Ala Ser Asp Ser Ser Arg

1 5

<210> 88

<211> 21

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 88

Ala Arg Gly Ser Gly Ala Ser Thr Asn Gly Val Trp Trp Val Met Gly

1 5 10 15

Asp Gly Met Asp Leu

20

<210> 89

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 89

Gly Phe Ser Phe Ser Ser Gly His Tyr

1 5

<210> 90

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 90

Ile Tyr Ala Gly Ser Asp Thr Gly Ser

1 5

<210> 91

<211> 16

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 91

Cys Ala Arg Ser Ser Asn Ser Tyr Gly Asn Tyr Gly Val Ser Asn Leu

1 5 10 15

<210> 92

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 92

Gly Ile Asp Phe Ser Ser Gly Tyr Trp

1 5

<210> 93

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 93

Ile Phe Thr Ser Ser Gly Thr Thr

1 5

<210> 94

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 94

Arg Asp Ile Tyr Ser Tyr Gly Met Asp Leu

1 5 10

<210> 95

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 95

Gly Ile Asp Phe Ser Ser Ala Tyr

1 5

<210> 96

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 96

Met Arg Ile Asn Asp Arg Ser

1 5

<210> 97

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 97

Ala Arg Ile Ala Thr Gly Thr Asn Val Asp Asp Phe

1 5 10

<210> 98

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 98

Gly Phe Ser Phe Ser Ser Lys Gln Tyr

1 5

<210> 99

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 99

Ile Val Thr Val Asn Asn Lys

1 5

<210> 100

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 100

Ala Arg Trp Arg Thr Phe Gly Leu

1 5

<210> 101

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 101

Arg Phe Ser Leu Ser Asn Met Asn Val

1 5

<210> 102

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 102

Ile Asn Ile Gly Gly Thr Asn

1 5

<210> 103

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 103

Ala Arg Ser Tyr Ile Thr Asp Arg Ile Tyr Asp Tyr Asp Phe

1 5 10

<210> 104

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 104

Gly Phe Asp Phe Ser Ser Lys Tyr Tyr

1 5

<210> 105

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 105

Ile Tyr Gly Gly Ser Ser Asp Ser Thr

1 5

<210> 106

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 106

Gly Arg Val Ile Asp Gly Ala Cys Gly Tyr Asp Leu

1 5 10

<210> 107

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 107

Gly Phe Asp Phe Ser Ser Asn Ala Tyr

1 5

<210> 108

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 108

Ile Tyr Asp Gly Thr Ser Gly Asp Thr

1 5

<210> 109

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 109

Ala Arg Asp Thr Arg Ser Ser Asn Tyr Tyr Phe Asn Leu

1 5 10

<210> 110

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 110

Asn Ser Tyr Lys Tyr Tyr Tyr Met

1 5

<210> 111

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 111

Ser Thr Ala Ser Arg Asn Ile

1 5

<210> 112

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 112

Ala Lys Ser His Gly Gly Asp Gly Gly Tyr Gly Val Val Leu

1 5 10

<210> 113

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 113

Gly Phe Ser Phe Ser Ser Ser Tyr Cys

1 5

<210> 114

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 114

Ile Tyr Thr Asp Ser Ser Gly Ala Thr

1 5

<210> 115

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 115

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

1 5 10 15

Phe Ser Leu

<210> 116

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 116

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 117

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 117

Ile Tyr Ala Gly Ser Ser Gly Ser Thr

1 5

<210> 118

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 118

Ala Arg Gly Gly Thr Ser Tyr Arg Leu Asp Leu

1 5 10

<210> 119

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 119

Gly Phe Ser Phe Ser Ser Lys Gln Tyr

1 5

<210> 120

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 120

Ile Val Thr Val Asn Asn Lys

1 5

<210> 121

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 121

Thr Arg Trp Arg Thr Phe Gly Leu

1 5

<210> 122

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 122

Gly Ile Asp Phe Asn Asn Asp Tyr Asn

1 5

<210> 123

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 123

Ile Tyr Thr Gly Ser Asp Ser Thr

1 5

<210> 124

<211> 17

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 124

Ala Arg Asp Leu Val Thr Gly Tyr Ala Thr Tyr Gly Tyr Gly Phe Ile

1 5 10 15

Leu

<210> 125

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 125

Ser Ser Ser Tyr Trp Ile Cys Trp

1 5

<210> 126

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 126

Gly Ile Gly Ser Ser Gly Thr Thr

1 5

<210> 127

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 127

Ala Arg Val Gly Gly Tyr Trp Thr Phe Asp Leu

1 5 10

<210> 128

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 128

Gly Phe Ser Phe Ser Ser Asp Tyr Trp

1 5

<210> 129

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 129

Ile Tyr Thr Gly Asp Asp Asp

1 5

<210> 130

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 130

Ala Arg Gly Leu Thr Ile Gly Thr Ala Glu Leu Tyr Phe

1 5 10

<210> 131

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 131

Gly Phe Ser Phe Thr Lys Asn Tyr Tyr

1 5

<210> 132

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 132

Ile Tyr Ala Gly Ser Thr Asn

1 5

<210> 133

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 133

Ala Arg Asp Phe Val Ser Tyr Leu Asn Leu

1 5 10

<210> 134

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 134

Gly Phe Asp Leu Ser Asn Asn Tyr Tyr

1 5

<210> 135

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 135

Val Asp Ser Asp Leu Thr Asp Ser Ala

1 5

<210> 136

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 136

Ala Gly Ser Gly Ser Gly Tyr Tyr Tyr Tyr Tyr Tyr Gly Met Asp Leu

1 5 10 15

<210> 137

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 137

Gly Phe Ser Phe Asn Gly Asp Tyr Tyr

1 5

<210> 138

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 138

Ile Tyr Ala Ala Gly Asp Asp

1 5

<210> 139

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 139

Ala Arg Asp Gln Ala Asp Ser Tyr Ala Phe Gly Leu

1 5 10

<210> 140

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 140

Gly Phe Ser Phe Ser Ser Ser Tyr Trp

1 5

<210> 141

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 141

Ile Tyr Ala Gly Ser Ser Gly Ser Thr

1 5

<210> 142

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 142

Ala Arg Gly Phe Ser Met Phe Lys Leu

1 5

<210> 143

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 143

Gly Phe Ser Phe Ser Ser Ser Tyr Cys

1 5

<210> 144

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 144

Ile Tyr Thr Asp Ser Ser Gly Ala Thr

1 5

<210> 145

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 145

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

1 5 10 15

Phe Ser Leu

<210> 146

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 146

Arg Ile Asp Leu Asn Asn Tyr Tyr Tyr

1 5

<210> 147

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 147

Val Ala Thr Asp Ser Ser Val Thr

1 5

<210> 148

<211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 148

Arg Gly Ser Gly Ala Ala Thr Asn Gly Val Trp Trp Val Met Gly Asp

1 5 10 15

Gly Met Asp Leu

20

<210> 149

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 149

Gly Ile Asp Leu Ser Ser Tyr Ala

1 5

<210> 150

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 150

Ile Gly Lys Ser Gly Thr Thr

1 5

<210> 151

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 151

Ala Arg Ala Gly Ala Ser Arg Ser Ile Tyr Tyr Asp Leu

1 5 10

<210> 152

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 152

Gly Phe Ser Phe Ser Gly Ile Val Tyr

1 5

<210> 153

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 153

Ala Phe Val Gly Ser Gly Gly Ser Thr

1 5

<210> 154

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 154

Ala Lys Ser Tyr Asn Tyr Asn Gly Leu Gly Leu

1 5 10

<210> 155

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 155

Gly Phe Ser Phe Ser Ser Ser Tyr Tyr

1 5

<210> 156

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 156

Ile Tyr Gly Gly Ser Thr Gly Thr Thr

1 5

<210> 157

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 157

Ala Arg Ser Tyr Asn Ser Ala Ser Ser Gly Tyr Tyr Trp Asp Leu

1 5 10 15

<210> 158

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 158

Gly Ile Asp Phe Ser Ser Gly Ala Trp

1 5

<210> 159

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 159

Ile Phe Thr Thr Ser Gly Phe Thr

1 5

<210> 160

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 160

Arg Asp Ile Tyr Ser Tyr Gly Met Asp Leu

1 5 10

<210> 161

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 161

Gly Phe Ser Phe Ser Ser Arg Gln Tyr

1 5

<210> 162

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 162

Ile Val Thr Val Asn Asn Lys

1 5

<210> 163

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 163

Ala Arg Trp Arg Thr Phe Gly Leu

1 5

<210> 164

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 164

Gly Phe Ser Phe Ser Ser Ser Tyr Cys

1 5

<210> 165

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 165

Ile Tyr Thr Asp Ser Ser Gly Ala Thr

1 5

<210> 166

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 166

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

1 5 10 15

Phe Ser Leu

<210> 167

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 167

cagaacatttacagctac 18

<210> 168

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 168

aaggcatcc 9

<210> 169

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 169

gcgagagctg tctatagtga tggtggtgct ggttatcctt atatgtatgg catggacctc 60

<210> 170

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 170

cagagtcttt ataatgcgaa cgac 24

<210> 171

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 171

tgggcatcc 9

<210> 172

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 172

gcgagatcat attatatg 18

<210> 173

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 173

cagagcattt acaggtac 18

<210> 174

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 174

tatggatcc 9

<210> 175

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 175

gcgagggctc tggatagtca ttatcttcc tttgacttg 39

<210> 176

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 176

cagagtgttt atggtaacaa ccgc 24

<210> 177

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 177

ctggcatcc 9

<210> 178

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 178

gcgaggggtttttcgatgtt taagttg 27

<210> 179

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 179

cagaacattg tcagtaat 18

<210> 180

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 180

tatgcatcc 9

<210> 181

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 181

gcgagtactc ctaatagtct aggttacgac tta 33

<210> 182

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 182

cagagcattt acaactac 18

<210> 183

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 183

gatgtatcc 9

<210> 184

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 184

gcgagaaata cttatgattg gaatggttat atttatggcc cgtgttattt tggcttg 57

<210> 185

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 185

cagagtgttt ataataacaa caac 24

<210> 186

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 186

tctgcatcc 9

<210> 187

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 187

gcgagaggtttttctatgtt taagttg 27

<210> 188

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 188

cagaacattt acaacaat 18

<210> 189

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 189

tatgcatcc 9

<210> 190

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 190

gcgagcacta cgactaatgt tttcggttac gactta 36

<210> 191

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 191

cagactattg gtagctac 18

<210> 192

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 192

gaagcatcc 9

<210> 193

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 193

aggggatata gttatggtga tactggatat gctgatgcta ttctttacctt ggacttg 57

<210> 194

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 194

gagaccatta gtaataga 18

<210> 195

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 195

tctgcatcc 9

<210> 196

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 196

gcgaaatccc atggtggtga tggtggttat ggggttgtat ta 42

<210> 197

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 197

cagagcatta gtagttac 18

<210> 198

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 198

aaggcatcc 9

<210> 199

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 199

gcgagagatc gaaatggtgg ttctggtgct tatggttggg acttg 45

<210> 200

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 200

cagagcatta gtgattac 18

<210> 201

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 201

agggcatcc 9

<210> 202

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 202

gcgagagata gtggtaatta taattgggac ttg 33

<210> 203

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 203

cagagcattg gcaatgca 18

<210> 204

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 204

aaggcatcc 9

<210> 205

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 205

gcgaggtccc catatgatga tggttatggt ggtttcactt ttaattta 48

<210> 206

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 206

cagaacattt ataataac 18

<210> 207

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 207

ggtccatcc 9

<210> 208

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 208

gcgagatcga ctagtggtag ttatggtgcg ggtttgggct tg 42

<210> 209

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 209

cagagtattg gtagtaga 18

<210> 210

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 210

gaagcatcc 9

<210> 211

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 211

gcgagagata ctgctgctta ttacgccttt agctta 36

<210> 212

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 212

catatcatta ctaactac 18

<210> 213

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 213

gatgcatcg 9

<210> 214

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 214

gcgaggggtg ttaatgatta tggttgggcc cttaagttg 39

<210> 215

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 215

ccgagcatta gtacttac 18

<210> 216

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 216

agggcatcc 9

<210> 217

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 217

gcgaccaata cggatagtag taggtctttat tataatttg 39

<210> 218

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 218

cagagtattg gtagtggtaa t 21

<210> 219

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 219

ctggcatcc 9

<210> 220

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 220

agaggatccg gtgctagcac caatggtgtt tggtgggtaa tgggagacgg catggacctc 60

<210> 221

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 221

cagattgttg ctaacggccg c 21

<210> 222

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 222

gctacatcc 9

<210> 223

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 223

gggagattgg attattcgtgt tatttatgcc tttaatttg 39

<210> 224

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 224

gaggacattg ataggtat 18

<210> 225

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 225

gatgcatcc 9

<210> 226

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 226

gcgagagagc gctatcctgg tgctttttca agtggattgg atctc 45

<210> 227

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 227

catatcatta ctaactac 18

<210> 228

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 228

gatgcatcg 9

<210> 229

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 229

gcgagagcga cttatgctta tgctggtgct ggggacttg 39

<210> 230

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 230

gagagcattg gcagtgca 18

<210> 231

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 231

tctgcatcc 9

<210> 232

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 232

gcgaccaata cggatagtag taggtctttat tataatttg 39

<210> 233

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 233

cagagcattt acaactac 18

<210> 234

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 234

tctgcatcc 9

<210> 235

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 235

gcgcgaagat atgctgcttt tcttacttat ggtagtgggg cttttgatcc c 51

<210> 236

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 236

ctgaacatta atagttgg 18

<210> 237

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 237

tatacatcc 9

<210> 238

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 238

gcgagaattg gtgcttttta ttcctttaga tta 33

<210> 239

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 239

gaggacattt atagcaat 18

<210> 240

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 240

ggtgcaacc 9

<210> 241

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 241

gcgagccgaa atggtggtgc gcctgatggt ttgaacttg 39

<210> 242

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 242

gaggatattt atagtaat 18

<210> 243

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 243

aaggcatcc 9

<210> 244

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 244

gcgagaggtg gtggttattg gtcttttagt ttg 33

<210> 245

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 245

cagagtgttt ataataagaa ctac 24

<210> 246

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 246

tatgcttcc 9

<210> 247

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 247

ggagaggattggg attatgctga tgctgctggt tattatgttg cgagaggttt taacttg 57

<210> 248

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 248

cagagcatta gtagttac 18

<210> 249

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 249

aaggcatcc 9

<210> 250

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 250

agagatttcg ttagttattt gaatttg 27

<210> 251

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 251

cagagcatta gttatactac 18

<210> 252

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 252

aaggcatcc 9

<210> 253

<211> 63

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 253

gcgagaggat ccggtgctag taccaatggt gtttggtggg taatgggaga cggcatggac 60

ctc 63

<210> 254

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 254

cagagtatta gtagtagcta c 21

<210> 255

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 255

tctgcgtcc 9

<210> 256

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 256

tgtgcgagat ctagtaatag ttatggtaat tatggtgttt ctaacttg 48

<210> 257

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 257

cagagtgttt atagtaacaa ctgg 24

<210> 258

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 258

aaggcatcc 9

<210> 259

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 259

agagatatct attcctacgg catggacctc 30

<210> 260

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 260

cagactattt ataataacaaaaat 24

<210> 261

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 261

caggcatcc 9

<210> 262

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 262

gcgagaatcg ctactggtac taatgttgat gacttc 36

<210> 263

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 263

gagaacattt atagctac 18

<210> 264

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 264

tctgcatcc 9

<210> 265

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 265

gcgagatggc ggacttttgg cttg 24

<210> 266

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 266

cagaccgttc ataataatca atgg 24

<210> 267

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 267

gatgcatcc 9

<210> 268

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 268

gcgagatcat atattactga tcgtattttat gattacgact tt 42

<210> 269

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 269

caaagtgttg ataacaacaa acaa 24

<210> 270

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 270

tctgcatcc 9

<210> 271

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 271

gggagagtaa ttgatggtgc ttgtggttat gacttg 36

<210> 272

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 272

gagaccatta gtaataga 18

<210> 273

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 273

tctgcatcc 9

<210> 274

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 274

gcgagggata ctcggagtag taattattat tttaatttg 39

<210> 275

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 275

cagaccattt ataccaat 18

<210> 276

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 276

gctgcatcc 9

<210> 277

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 277

gcgaaatccc atggtggtga tggtggttat ggggttgtgt ta 42

<210> 278

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 278

gataatgttt atagtaataa ctac 24

<210> 279

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 279

tatgcggcc 9

<210> 280

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 280

gcgagggggt gggattacga ggatcctggt tatactgata ctacctactt ttccttg 57

<210> 281

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 281

gataatgttt atagtaataa ctac 24

<210> 282

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 282

tatgcggcc 9

<210> 283

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 283

gcgagaggtg gtactagtta ccgccttgat ttg 33

<210> 284

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 284

gaggatatta gtagtaat 18

<210> 285

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 285

ggtgcatcc 9

<210> 286

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 286

acgagatggc ggacttttgg cttg 24

<210> 287

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 287

cagagcatta gcaatgaa 18

<210> 288

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 288

ctggcatcc 9

<210> 289

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 289

gccagagatc ttgttatactgg ttatgctact tatggttatg gatttatctt a 51

<210> 290

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 290

caaagtgttt acaataacaa ccaa 24

<210> 291

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 291

ggtgcatcc 9

<210> 292

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 292

gcgagagttg gtggttatactg gacttttgac ttg 33

<210> 293

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 293

cagagtattg gtagctat 18

<210> 294

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 294

tatgcttcc 9

<210> 295

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 295

gcgagaggac tcactattgg tactgctgag ttgtacttc 39

<210> 296

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 296

cagaacattt acagcaat 18

<210> 297

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 297

tctgcatcc 9

<210> 298

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 298

gcgagagatt tcgttagtta tttgaatttg 30

<210> 299

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 299

cagagcattg gtagctac 18

<210> 300

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 300

aaggcatcc 9

<210> 301

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 301

gcgggaagtg ggagtggtta ttattattac tacggcatgg atctc 45

<210> 302

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 302

gaggacattg ataggtat 18

<210> 303

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 303

agggcatcc 9

<210> 304

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 304

gcgagagatc aggctgacag ttatgccttt ggtttg 36

<210> 305

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 305

cagagcatta gtagttac 18

<210> 306

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 306

aaggcttcc 9

<210> 307

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 307

gcgaggggtttttcgatgtt taagttg 27

<210> 308

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 308

cagaccattt ataccaat 18

<210> 309

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 309

gctgcatcc 9

<210> 310

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 310

gcgagggggt gggattacga ggatcctggt tatactgata ctacctactt ttccttg 57

<210> 311

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 311

gagagtgttt atggtaacaa ccgt 24

<210> 312

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 312

caggcttcc 9

<210> 313

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 313

agaggatccg gtgctgctac taatggtgtt tggtgggtga tgggagacgg catggacctc 60

<210> 314

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 314

cagagcatta ccaatgca 18

<210> 315

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 315

agggcatcc 9

<210> 316

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 316

gccagggcag gtgctagtag gagtatttat tatgacttg 39

<210> 317

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 317

cagagcatta gtagtagcta c 21

<210> 318

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 318

tctgcatcc 9

<210> 319

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 319

gcgaaatctt ataattataa tggtttaggc ttg 33

<210> 320

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 320

cagagcattg gtagtaat 18

<210> 321

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 321

aaggcatcc 9

<210> 322

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 322

gcgagatcat ataatagtgc tagtagtggt tattattggg acttg 45

<210> 323

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 323

gagaatgttt atagtaataa ctac 24

<210> 324

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 324

tatgcggcc 9

<210> 325

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 325

agagatatct attcctacgg catggacctc 30

<210> 326

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 326

cagagcattg ctagcgac 18

<210> 327

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 327

gctgcatcc 9

<210> 328

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 328

gcgagatggc ggacttttgg cttg 24

<210> 329

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 329

ggattctccttcagtagcagctactgt 27

<210> 330

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 330

atttatactg atagtagtgg tgccact 27

<210> 331

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 331

gcgagggggt gggattacga ggatcctggt tatactgata ctacctactt ttccttg 57

<210> 332

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 332

Gln Asn Ile Tyr Ser Tyr

1 5

<210> 333

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 333

Lys Ala Ser

1

<210> 334

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 334

Gln Thr Asn Tyr Phe Ser Ser Thr Ser His Phe Gly Val Phe Thr

1 5 10 15

<210> 335

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 335

Gln Ser Leu Tyr Asn Ala Asn Asp

1 5

<210> 336

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 336

Trp Ala Ser

1

<210> 337

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 337

Leu Gly Glu Phe Ser Cys Ser Ser Ser Phe Asp Cys His Val

1 5 10

<210> 338

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 338

Gln Ser Ile Tyr Arg Tyr

1 5

<210> 339

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 339

Tyr Gly Ser

1

<210> 340

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 340

Gln Thr Thr Tyr Asp Asp Tyr His Asn Gly Trp Ala

1 5 10

<210> 341

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 341

Gln Ser Val Tyr Gly Asn Asn Arg

1 5

<210> 342

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 342

Leu Ala Ser

1

<210> 343

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 343

Ala Gly Gly Tyr Ala Gly Asn Phe Asn Ala

1 5 10

<210> 344

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 344

Gln Asn Ile Val Ser Asn

1 5

<210> 345

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 345

Tyr Ala Ser

1

<210> 346

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 346

Gln Asn Asn Ala Gly Ile Tyr Gly Asn Tyr Gly His Gly

1 5 10

<210> 347

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 347

Gln Ser Ile Tyr Asn Tyr

1 5

<210> 348

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 348

Asp Val Ser

1

<210> 349

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 349

Gln Ser Tyr Tyr Gly Asn Thr Val Ser Phe Thr

1 5 10

<210> 350

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 350

Gln Ser Val Tyr Asn Asn Asn Asn

1 5

<210> 351

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 351

Ser Ala Ser

1

<210> 352

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 352

Ala Gly Gly Tyr Thr Tyr Asn Ile Asn Ile

1 5 10

<210> 353

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 353

Gln Asn Ile Tyr Asn Asn

1 5

<210> 354

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 354

Tyr Ala Ser

1

<210> 355

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 355

Gln Asn Asn Ala Gly Ile Tyr Gly Gly Tyr Gly His Gly

1 5 10

<210> 356

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 356

Gln Thr Ile Gly Ser Tyr

1 5

<210> 357

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 357

Glu Ala Ser

1

<210> 358

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 358

Gln Ser Asn Tyr Tyr Arg Ala Gly Gly Asn Tyr Gly Gly Ala

1 5 10

<210> 359

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 359

Glu Thr Ile Ser Asn Arg

1 5

<210> 360

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 360

Ser Ala Ser

1

<210> 361

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 361

Gln Ser Ile Arg Ser Ser Ser Gly Ile Val His Pro Asn Thr

1 5 10

<210> 362

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 362

Gln Ser Ile Ser Ser Tyr

1 5

<210> 363

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 363

Lys Ala Ser

1

<210> 364

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 364

Gln Ser Tyr Tyr Tyr Ile Ser Ala Thr Val Asp Asn Thr

1 5 10

<210> 365

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 365

Gln Ser Ile Ser Asp Tyr

1 5

<210> 366

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 366

Arg Ala Ser

1

<210> 367

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 367

Gln Ser Asn Tyr Tyr Gly Ser Gln Gly Cys Thr

1 5 10

<210> 368

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 368

Gln Ser Ile Gly Asn Ala

1 5

<210> 369

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 369

Lys Ala Ser

1

<210> 370

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 370

Gln Asn Tyr Tyr Tyr Ser Asn Thr Asn Ser

1 5 10

<210> 371

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 371

Gln Asn Ile Tyr Asn Asn

1 5

<210> 372

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 372

Gly Pro Ser

1

<210> 373

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 373

Gln Ser Asp Asp Trp Met Ser Ile Ser Pro Asp Ile Val

1 5 10

<210> 374

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 374

Gln Ser Ile Gly Ser Arg

1 5

<210> 375

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 375

Glu Ala Ser

1

<210> 376

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 376

Gln Cys Thr Tyr Tyr Glu Ser Ser Ser Gly Gly Gly

1 5 10

<210> 377

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 377

Pro Ser Ile Ser Thr Tyr

1 5

<210> 378

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 378

Arg Ala Ser

1

<210> 379

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 379

Gln Asn Asn Tyr His Ser Gly Ser Ser Ser Asn Gly Gly Gly Val Ala

1 5 10 15

<210> 380

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 380

Gln Ser Ile Gly Ser Gly Asn

1 5

<210> 381

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 381

Leu Ala Ser

1

<210> 382

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 382

Gln Tyr Thr Tyr Tyr Gly Thr Thr Tyr Tyr Asp Asn Ala

1 5 10

<210> 383

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 383

Gln Ile Val Ala Asn Gly Arg

1 5

<210> 384

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 384

Ala Thr Ser

1

<210> 385

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 385

Gln Gly Ala Tyr Ser Ser Gly Asp Val Arg Thr

1 5 10

<210> 386

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 386

Glu Asp Ile Asp Arg Tyr

1 5

<210> 387

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 387

Asp Ala Ser

1

<210> 388

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 388

Gln Ser Tyr Asp Asn Ser Asp Asn Asn Gly

1 5 10

<210> 389

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 389

His Ile Ile Thr Asn Tyr

1 5

<210> 390

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 390

Asp Ala Ser

1

<210> 391

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 391

Gln Asn Tyr Leu Tyr Phe Ser Ser Gly Asp Trp Asn Val

1 5 10

<210> 392

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 392

Glu Ser Ile Gly Ser Ala

1 5

<210> 393

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 393

Ser Ala Ser

1

<210> 394

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 394

Gln Ser Tyr Tyr Gly Ser Gly Thr Thr Ala Leu Asp Thr

1 5 10

<210> 395

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 395

Gln Ser Ile Tyr Asn Tyr

1 5

<210> 396

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 396

Ser Ala Ser

1

<210> 397

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 397

Gln Asn Asn Tyr Gly Ile Gly Ser Asn Tyr Gly Pro Gly

1 5 10

<210> 398

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 398

Leu Asn Ile Asn Ser Trp

1 5

<210> 399

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 399

Tyr Thr Ser

1

<210> 400

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 400

Gln Thr Thr Tyr Phe Gly Thr Asn Gly Gly Gly

1 5 10

<210> 401

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 401

Glu Asp Ile Tyr Ser Asn

1 5

<210> 402

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 402

Gly Ala Thr

1

<210> 403

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 403

Gln Ala Glu Ser Asn Asp Val Trp Ala

1 5

<210> 404

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 404

Gln Ser Val Tyr Asn Lys Asn Tyr

1 5

<210> 405

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 405

Tyr Ala Ser

1

<210> 406

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 406

Ala Ala Tyr Lys Gly Val Ser Asp Asp Gly Ile Ser

1 5 10

<210> 407

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 407

Gln Ser Ile Ser Ser Tyr

1 5

<210> 408

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 408

Lys Ala Ser

1

<210> 409

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 409

Gln Asn Asn Tyr His Ser Gly Ser Ser Ser Asn Gly Gly Gly Phe Ala

1 5 10 15

<210> 410

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 410

Gln Ser Ile Ser Tyr Tyr

1 5

<210> 411

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 411

Lys Ala Ser

1

<210> 412

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 412

Gln Ser Thr Tyr Gly Arg Asp Asn Asn Asp Leu Phe Phe Ala

1 5 10

<210> 413

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 413

Gln Ser Ile Ser Ser Ser Tyr

1 5

<210> 414

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 414

Ser Ala Ser

1

<210> 415

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 415

Gln Ser Thr Tyr Ile Ser Ser Ser Lys Tyr Gly Ala Val

1 5 10

<210> 416

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 416

Gln Ser Val Tyr Ser Asn Asn Trp

1 5

<210> 417

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 417

Lys Ala Ser

1

<210> 418

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 418

Ala Gly Gly Tyr Ser Gly Asp Leu Tyr Ala

1 5 10

<210> 419

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 419

Gln Thr Ile Tyr Asn Asn Lys Asn

1 5

<210> 420

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 420

Gln Ala Ser

1

<210> 421

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 421

Gln Gly Glu Phe Ser Cys Ser Ser Gly Asp Cys Thr Thr

1 5 10

<210> 422

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 422

Glu Asn Ile Tyr Ser Tyr

1 5

<210> 423

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 423

Ser Ala Ser

1

<210> 424

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 424

Gln Tyr Ser Asn Phe Arg Val Asn Asp Pro Ser Val

1 5 10

<210> 425

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 425

Gln Thr Val His Asn Asn Gln Trp

1 5

<210> 426

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 426

Asp Ala Ser

1

<210> 427

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 427

Gln Gly Gly Tyr Ser Tyr Gly Asp Val Tyr Gly

1 5 10

<210> 428

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 428

Gln Ser Val Asp Asn Asn Lys Gln

1 5

<210> 429

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 429

Ser Ala Ser

1

<210> 430

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 430

Ala Gly Tyr Tyr Tyr Ser Gly Ser Ala Thr Asp Ala Trp Ala

1 5 10

<210> 431

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 431

Glu Thr Ile Ser Asn Arg

1 5

<210> 432

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 432

Ser Ala Ser

1

<210> 433

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 433

Gln Ser Ile Arg Ser Ser Ser Gly Val Val His Pro Asn Thr

1 5 10

<210> 434

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 434

Gln Thr Ile Tyr Thr Asn

1 5

<210> 435

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 435

Ala Ala Ser

1

<210> 436

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 436

Gln Ser Tyr Tyr Gly Ser Ser Thr Thr Gly Asn Gly

1 5 10

<210> 437

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 437

Asp Asn Val Tyr Ser Asn Asn Tyr

1 5

<210> 438

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 438

Tyr Ala Ala

1

<210> 439

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 439

Ser Gly His Lys Asp Tyr Ser Asp Asp Gly Ser Thr

1 5 10

<210> 440

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 440

Asp Asn Val Tyr Ser Asn Asn Tyr

1 5

<210> 441

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 441

Tyr Ala Ala

1

<210> 442

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 442

Ser Gly His Lys Asp Tyr Ser Asp Asp Gly Ser Thr

1 5 10

<210> 443

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 443

Glu Asp Ile Ser Ser Asn

1 5

<210> 444

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 444

Gly Ala Ser

1

<210> 445

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 445

Gln Gly Ala Tyr Tyr Gly Ser Ser Tyr Gly

1 5 10

<210> 446

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 446

Gln Ser Ile Ser Asn Glu

1 5

<210> 447

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 447

Leu Ala Ser

1

<210> 448

<211> 14

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 448

Gln Ser His Tyr Tyr Gly Gly Ser Ser Asp Tyr Gly Trp Ala

1 5 10

<210> 449

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 449

Gln Ser Val Tyr Asn Asn Asn Gln

1 5

<210> 450

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 450

Gly Ala Ser

1

<210> 451

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 451

Gln Gly Ala Val Ser Ser Asp Tyr Tyr Pro

1 5 10

<210> 452

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 452

Gln Ser Ile Gly Ser Tyr

1 5

<210> 453

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 453

Tyr Ala Ser

1

<210> 454

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 454

Gln Ser Asn Arg Leu Ser Ser Ser Asp Val Asn Ala

1 5 10

<210> 455

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 455

Gln Asn Ile Tyr Ser Asn

1 5

<210> 456

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 456

Ser Ala Ser

1

<210> 457

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 457

Gln Ser Tyr Tyr Tyr Thr Ala Ser Ala Asp Thr Thr

1 5 10

<210> 458

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 458

Gln Ser Ile Gly Ser Tyr

1 5

<210> 459

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 459

Lys Ala Ser

1

<210> 460

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 460

Gln Tyr Thr Ser Tyr Ser Ser Gly Gly Ala

1 5 10

<210> 461

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 461

Glu Asp Ile Asp Arg Tyr

1 5

<210> 462

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 462

Arg Ala Ser

1

<210> 463

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 463

Gln Gly Asp Phe Ile Gly Ser Ser Tyr Gly Val Ala

1 5 10

<210> 464

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 464

Gln Ser Ile Ser Ser Tyr

1 5

<210> 465

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 465

Lys Ala Ser

1

<210> 466

<211> 15

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 466

Gln Asn Asn Tyr His Ser Gly Ser Ser Ser Asn Gly Gly Gly Phe Ala

1 5 10 15

<210> 467

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 467

Gln Thr Ile Tyr Thr Asn

1 5

<210> 468

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 468

Ala Ala Ser

1

<210> 469

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 469

Gln Ser Tyr Tyr Gly Ser Ser Thr Thr Gly Asn Gly

1 5 10

<210> 470

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 470

Glu Ser Val Tyr Gly Asn Asn Arg

1 5

<210> 471

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 471

Gln Ala Ser

1

<210> 472

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 472

Ala Gly His Lys Gly Thr Thr Asn Asp Gly Asn Asp

1 5 10

<210> 473

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 473

Gln Ser Ile Thr Asn Ala

1 5

<210> 474

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 474

Arg Ala Ser

1

<210> 475

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 475

Gln Cys Ser Tyr Tyr Gly Ser Thr Tyr Phe Gly Ser Pro

1 5 10

<210> 476

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 476

Gln Ser Ile Ser Ser Ser Tyr

1 5

<210> 477

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 477

Ser Ala Ser

1

<210> 478

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 478

Gln Ser Thr Tyr Ile Ser Ser Ser Asn Tyr Gly Ala Ala

1 5 10

<210> 479

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 479

Gln Ser Ile Gly Ser Asn

1 5

<210> 480

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 480

Lys Ala Ser

1

<210> 481

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 481

Gln Asn Asn Asn Tyr Trp Ser Asn Gly Asn His

1 5 10

<210> 482

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 482

Glu Asn Val Tyr Ser Asn Asn Tyr

1 5

<210> 483

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 483

Tyr Ala Ala

1

<210> 484

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 484

Ser Gly His Lys Asp Tyr Ser Asp Asp Gly Ser Thr

1 5 10

<210> 485

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 485

Gln Ser Ile Ala Ser Asp

1 5

<210> 486

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 486

Ala Ala Ser

1

<210> 487

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 487

Gln Ser Tyr Tyr Gly Ser Ser Thr Thr Gly Asn Gly

1 5 10

<210> 488

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 488

cagaacattt acagctac 18

<210> 489

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 489

aaggcatcc 9

<210> 490

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 490

caaaccaatt attttagtag tactagtcat tttggtgttt ttact 45

<210> 491

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 491

cagagtcttt ataatgcgaa cgac 24

<210> 492

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 492

tgggcatcc 9

<210> 493

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 493

ctaggcgaat ttagttgcag tagttttgat tgtcatgtt 39

<210> 494

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 494

cagagcattt acaggtac 18

<210> 495

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 495

tatggatcc 9

<210> 496

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 496

caaaccactt atgatgatta tcataatggt tgggct 36

<210> 497

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 497

cagagtgttt atggtaacaa ccgc 24

<210> 498

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 498

ctggcatcc 9

<210> 499

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 499

gcaggcggtt atgctgggaa tttcaatgct 30

<210> 500

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 500

cagaacattg tcagtaat 18

<210> 501

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 501

tatgcatcc 9

<210> 502

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 502

caaaacaatg ctggtattta tggtaattat ggtcatggt 39

<210> 503

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 503

cagagcattt acaactac 18

<210> 504

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 504

gatgtatcc 9

<210> 505

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 505

caaagttatttggtaatac tgtttctttt act 33

<210> 506

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 506

cagagtgttt ataataacaa caac 24

<210> 507

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 507

tctgcatcc 9

<210> 508

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 508

gcaggcggtt atacttacaa tatcaatatt 30

<210> 509

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 509

cagaacattt acaacaat 18

<210> 510

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 510

tatgcatcc 9

<210> 511

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 511

caaaacaatg ctggtattta tggtggttat ggtcatggt 39

<210> 512

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 512

cagactattg gtagctac 18

<210> 513

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 513

gaagcatcc 9

<210> 514

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 514

caaagcaatt attatcgtgc tggtggtaat tatggtggag ct 42

<210> 515

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 515

gagaccatta gtaataga 18

<210> 516

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 516

tctgcatcc 9

<210> 517

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 517

caaagtattc gtagtagtag tggtattgtt catccgaata ct 42

<210> 518

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 518

cagagcatta gtagttac 18

<210> 519

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 519

aaggcatcc 9

<210> 520

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 520

caaagctatt actatattag tgctactgtt gataatact 39

<210> 521

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 521

cagagcatta gtgattac 18

<210> 522

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 522

agggcatcc 9

<210> 523

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 523

caaagtaatt attatggtag tcagggttgt act 33

<210> 524

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 524

cagagcattg gcaatgca 18

<210> 525

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 525

aaggcatcc 9

<210> 526

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 526

caaaactatt attatagtaa tactaatagt 30

<210> 527

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 527

cagaacattt ataataac 18

<210> 528

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 528

ggtccatcc 9

<210> 529

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 529

caaagtgatg attggatgag tatcagtcctgatattgtt 39

<210> 530

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 530

cagagtattg gtagtaga 18

<210> 531

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 531

gaagcatcc 9

<210> 532

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 532

caatgtactt attatgaaag tagtagtggt ggtggt 36

<210> 533

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 533

catatcatta ctaactac 18

<210> 534

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 534

gatgcatcg 9

<210> 535

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 535

caaaactatctttattttag tagtggtgat tggaatgtt 39

<210> 536

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 536

ccgagcatta gtacttac 18

<210> 537

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 537

agggcatcc 9

<210> 538

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 538

caaaacaatt accatagtgg tagtagtaat ggtggtggtg ttgct 45

<210> 539

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 539

cagagtattg gtagtggtaa t 21

<210> 540

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 540

ctggcatcc 9

<210> 541

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 541

caatatactt attatggtac tacttatgat aatgct 36

<210> 542

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 542

cagattgttg ctaacggccg c 21

<210> 543

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 543

gctacatcc 9

<210> 544

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 544

caaggcgctt atagtagtgg ggatgttcgg act 33

<210> 545

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 545

gaggacattg ataggtat 18

<210> 546

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 546

gatgcatcc 9

<210> 547

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 547

caaagctatg ataatagtga taataatggt 30

<210> 548

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 548

catatcatta ctaactac 18

<210> 549

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 549

gatgcatcg 9

<210> 550

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 550

caaaactatctttattttag tagtggtgat tggaatgtt 39

<210> 551

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 551

gagagcattg gcagtgca 18

<210> 552

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 552

tctgcatcc 9

<210> 553

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 553

caaagttattggaagtgg tacgactgct ttagatact 39

<210> 554

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 554

cagagcattt acaactac 18

<210> 555

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 555

tctgcatcc 9

<210> 556

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 556

caaaacaatt atggtattgg tagtaattat ggtcctggt 39

<210> 557

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 557

ctgaacatta atagttgg 18

<210> 558

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 558

tatacatcc 9

<210> 559

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 559

caaaccacat attttggtac taatggtggt ggt 33

<210> 560

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 560

gaggacattt atagcaat 18

<210> 561

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 561

ggtgcaacc 9

<210> 562

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 562

caggccgaaa gtaatgatgtttgggct 27

<210> 563

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 563

gaggatattt atagtaat 18

<210> 564

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 564

aaggcatcc 9

<210> 565

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 565

cagactactt attggactac tactgatgat aatcct 36

<210> 566

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 566

cagagtgttt ataataagaa ctac 24

<210> 567

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 567

tatgcttcc 9

<210> 568

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 568

gcagcttata aaggtgttag tgatgatggt atttct 36

<210> 569

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 569

cagagcatta gtagttac 18

<210> 570

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 570

aaggcatcc 9

<210> 571

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 571

caaaacaatt atcatagtgg tagtagtaat ggtggtggtt ttgct 45

<210> 572

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 572

cagagcatta gttatactac 18

<210> 573

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 573

aaggcatcc 9

<210> 574

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 574

caaagcactt atggtaggga taataatgat ctttttttcg ct 42

<210> 575

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 575

cagagtatta gtagtagcta c 21

<210> 576

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 576

tctgcgtcc 9

<210> 577

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 577

caaagcactt atattagtag tagtaagtat ggtgctgtt 39

<210> 578

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 578

cagagtgttt atagtaacaa ctgg 24

<210> 579

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 579

aaggcatcc 9

<210> 580

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 580

gcaggcgggt atagtggtga tctttatgct 30

<210> 581

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 581

cagactattt ataataacaaaaat 24

<210> 582

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 582

caggcatcc 9

<210> 583

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 583

caaggcgaat ttagttgtag tagtggtgat tgtactact 39

<210> 584

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 584

gagaacattt atagctac 18

<210> 585

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 585

tctgcatcc 9

<210> 586

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 586

caatatagta attttagggt gaatgatcct agtgtt 36

<210> 587

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 587

cagaccgttc ataataatca atgg 24

<210> 588

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 588

gatgcatcc 9

<210> 589

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 589

caaggcggtt atagttatgg tgatgtgtat ggt 33

<210> 590

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 590

caaagtgttg ataacaacaa acaa 24

<210> 591

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 591

tctgcatcc 9

<210> 592

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 592

gcaggctatt attatagtgg tagtgccact gatgcgtggg ct 42

<210> 593

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 593

gagaccatta gtaataga 18

<210> 594

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 594

tctgcatcc 9

<210> 595

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 595

caaagtattc gtagtagtag tggtgttgtg catccaaata ct 42

<210> 596

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 596

cagaccattt ataccaat 18

<210> 597

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 597

gctgcatcc 9

<210> 598

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 598

caaagctatt atggtagtag tactactggt aatggt 36

<210> 599

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 599

gataatgttt atagtaataa ctac 24

<210> 600

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 600

tatgcggcc 9

<210> 601

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 601

tcaggccata aagattatag tgatgatggt agtact 36

<210> 602

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 602

gataatgttt atagtaataa ctac 24

<210> 603

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 603

tatgcggcc 9

<210> 604

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 604

tcaggccata aagattatag tgatgatggt agtact 36

<210> 605

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 605

gaggatatta gtagtaat 18

<210> 606

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 606

ggtgcatcc 9

<210> 607

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 607

caaggcgctt attatggtag tagttatggt 30

<210> 608

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 608

cagagcatta gcaatgaa 18

<210> 609

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 609

ctggcatcc 9

<210> 610

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 610

caaagtcatt attatggtgg tagtagtgat tatggatggg ct 42

<210> 611

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 611

caaagtgttt acaataacaa ccaa 24

<210> 612

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 612

ggtgcatcc 9

<210> 613

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 613

caaggcgctgttagtagtgattactatcct 30

<210> 614

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 614

cagagtattg gtagctat 18

<210> 615

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 615

tatgcttcc 9

<210> 616

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 616

caaagtaatc gtcttagtag tagtgacgtt aatgct 36

<210> 617

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 617

cagaacattt acagcaat 18

<210> 618

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 618

tctgcatcc 9

<210> 619

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 619

caaagctatt attatactgc tagtgctgat actact 36

<210> 620

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 620

cagagcattg gtagctac 18

<210> 621

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 621

aaggcatcc 9

<210> 622

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 622

caatatacta gttatagtag tggtggggct 30

<210> 623

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 623

gaggacattg ataggtat 18

<210> 624

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 624

agggcatcc 9

<210> 625

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 625

caaggcgatt ttatggtag tagttatggc gttgct 36

<210> 626

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 626

cagagcatta gtagttac 18

<210> 627

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 627

aaggcttcc 9

<210> 628

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 628

caaaacaatt atcatagtgg tagtagtaat ggtggtggtt ttgct 45

<210> 629

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 629

cagaccattt ataccaat 18

<210> 630

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 630

gctgcatcc 9

<210> 631

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 631

caaagctatt atggtagtag tactactggt aatggt 36

<210> 632

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 632

gagagtgttt atggtaacaa ccgt 24

<210> 633

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 633

caggcttcc 9

<210> 634

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 634

gcaggacata aaggaactac taatgatggg aatgat 36

<210> 635

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 635

cagagcatta ccaatgca 18

<210> 636

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 636

agggcatcc 9

<210> 637

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 637

caatgtagtt attatggtag tacttatttt gggagtcct 39

<210> 638

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 638

cagagcatta gtagtagcta c 21

<210> 639

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 639

tctgcatcc 9

<210> 640

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 640

caaagcactt atattagtag tagtaattat ggtgctgct 39

<210> 641

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 641

cagagcattg gtagtaat 18

<210> 642

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 642

aaggcatcc 9

<210> 643

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 643

caaaacaata attattggag taatggtaac cat 33

<210> 644

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 644

gagaatgttt atagtaataa ctac 24

<210> 645

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 645

tatgcggcc 9

<210> 646

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 646

tcaggccata aagattatag tgatgatggt agtact 36

<210> 647

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 647

cagagcattg ctagcgac 18

<210> 648

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 648

gctgcatcc 9

<210> 649

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 649

caaagctatt atggtagtag tactactggt aatggt 36

<210> 650

<211> 375

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 650

cagtcgttgg aggagtccga gggagacctg gtcaagcctg agggatccct gacactcacc 60

tgcaaagcct ctggattcga cttcagtagt gatgcaatgt gctgggtccg ccaggctcca 120

gggaaggggc tggagtggat cggatgcatt tataatggtg atgaaattac agaccacgcg 180

agctgggcga aaggccgatt caccatctcc aaaacctcgc cgaccacggt gactctgcaa 240

atgaccagtc tgacagtcgc ggacacggcc acctatttct gtgcgagagc tgtctatagt 300

gatggtggtg ctggttatcc ttatatgtat ggcatggacc tctggggccc agggaccctc 360

gtcaccgtctcttca 375

<210> 651

<211> 342

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 651

cgagcagtcg ggaaggagtc cgggggaggc ctggtcaagc ctggggcatc cctgacactc 60

acctgcaaag cctctggatt cgacttcagt ggcatttatt gggtatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgcg tgttttgatg ctgaaaggac tggtaacact 180

tattacgcga cctgggcgaa aggccgcttc accatctcca gaacctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacagccgcg gacacggcca cctatttctg tgcgagatca 300

tattatatgt ggggcccagg caccctggtc accgtctctt ca 342

<210> 652

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 652

gagcagtcgt tggagaggagtc cgggggagac ctggtcaagc ctgagggatc cctgacactc 60

acctgcacag cctctgaatt gtccttcagt agcgcctact acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcatttata gtggtgatgg tgacacttac 180

tacgcgaact gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agacgcggac acggccacct atttctgtgc gagggctctg 300

gatagtcatt attcttcctt tgacttgtgg ggcccaggca ccctggtcac catctcttca 360

<210> 653

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 653

gagcagtcgt tggaggagtc cgggggaggc ctggtcaagc ctggggcatc cctgacagtc 60

acctgcgcag tctctggatt ctccctcaat agctatgcaa taacttgggt ccgccaggct 120

ccagggaaag ggctggaata catcggatac attgatactg gtgctagtat cacagactac 180

gcgagctggg cgaaaggccg attcaccatc tccaaaacct cgtcgaccac ggtgactctg 240

gaaatgacca gtctgacaga cgcggacacg gccacctatt tctgtgcgag gggtttttcg 300

atgtttaagt tgtggggccc aggcaccctg gtcaccatct cttca 345

<210> 654

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 654

gagcagtcgg tggaggagtc cgggggaggc ctggtcaagc ctgagggatc cctgacactc 60

acctgcaaag cctctgggtt agacttcagt agcagctact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcattgata ctggtagtag tggtagcact 180

tactacgcga gctgggcgaa aggccgattc accgtctcca aaacctcgtc gaccacggtg 240

tctctgcaaa tgaccagtct gacagccgcg gacacggcca cctatttctg tgcgagtact 300

cctaatagtc taggttacga cttatggggc ccaggcaccc tggtcaccat ctcttca 357

<210> 655

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 655

gagcagtcgg tggaggagtc cgggggagac ctggtcaagc ctggggcatc cctgacactc 60

acctgcacag cctctggatt ctcctccagt agtagcgcct atatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgtattttta ttggtagtgg tagtgactct 180

tactacgcga cctgggcgaa aggccgattc accatctcca aaacctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacagccgcg gacacggcca cctatttctg tgcgagaaat 300

acttatgatt ggaatggtta tatttatggc ccgtgttatttggcttgtg gggcccaggc 360

accctggtca ccatctcctc a 381

<210> 656

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 656

gagcagtcgg tgaaggagtc cgggggaggc ctggtcaagc ctggaggaac cctgacactc 60

acctgcatag tctctggatt ctccctcagt aggtatgcag tcacctgggt ccgccaggct 120

ccagggaagg ggcctgagtg gatcggatac attgacacta gtagtggtaa caaagactac 180

gcgaactggg tgaatggccg attcaccatc tccaaaacct cgtcgaccac ggtgactctg 240

caaatgacca gtctgacagc cgcggacacg gccacctatt tctgtgcgag aggtttttct 300

atgtttaagt tgtggggccc aggcaccctg gtcaccatct cttca 345

<210> 657

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 657

gagcagtcgg tggaggagtc cgggggaggc ctggtcaagc ctgagggatc cctgacactc 60

acctgcaaag cctctggatt ggacttcagt agcagctatt ggagctgctg ggtccgccag 120

actccaggga gggggctgga gtggatcgga tgcattgatg ttggggagtag tggtggctca 180

tactacgcga gctgggcgag aggccgattc accgtctcca aaggctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacagccgcg gacacggcca cctatttctg tgcgagcact 300

acgactaatg ttttcggtta cgacttatgg ggcccaggca ctctggtcac cgtctcttca 360

<210> 658

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 658

gagcagtcgt tggaggagtc cgggggaggc ctggtcaagc ctggggcatc cctgacactc 60

acctgcaaag cctctggatt cgacttcagt agtaatgact acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcatttatg gtggtgatgg gcacacttac 180

tacgcgacct gggcgaaagg ccgattcacc atctccaaag cctcgtcgac cacggtgacg 240

ctgcaaatga ccagtctgac agccgcggac acggccagct atttctgtgc gaggggatat 300

agttatggtg atactggata tgctgatgct attctttacct tggacttgtg gggcccaggc 360

accctggtca ccgtctcttc a 381

<210> 659

<211> 369

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 659

gagcagtcgg tgaaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcaaag tctctggaat cgacttcaat tattacaact actactacat gtgctgggtc 120

cgccaggctc cagggaaggg gctggagtgg atcggatgca tgtccactgc cagtgcgaat 180

atttaccttg cgagctgggc gaaaggccga ttcaccatct ccgaggcctc gtcgaccacg 240

gtgactctgc aaatgaccag tctgacagcc gcggacacgg ccacctattt ctgtgcgaaa 300

tcccatggtg gtgatggtgg ttatggggtt gtattatggg gcccaggcac cctggtcacc 360

atctcctca 369

<210> 660

<211> 366

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 660

gagcagtcgg tgaaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag tctctggatt ctccttcagt ggcagctact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcatttatg gtgatagtat tgccacttac 180

tacccgaact gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctacaaatgg ccagtctgac aggcgcggac acggccacct atttctgtgc gagagatcga 300

aatggtggtt ctggtgctta tggttgggac ttgtggggcc caggcaccct ggtcaccatc 360

tcctca 366

<210> 661

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 661

gagcagtcgt tggaggagtc cgggggaggc ctggtcaagc ctggggcatc cctgacactc 60

acctgcaaag cctctggatt ctccttcagt agcgactatg acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcattgtga ctggttttag tggtcgtatt 180

tattacgcga cctgggcgag aggccgattc accttctcca gaacctcgtc gaccacgctg 240

actctgcaaa tgaccagtct gacagccgcg gacacggcca cttatttctg tgcgagagat 300

agtggtaatt ataattggga cttgtggggc ccaggcaccc tggtcaccat ctcttca 357

<210> 662

<211> 372

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 662

gagcagtcgg tggaggagtc cgagggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cttctggatt ctccttcagt aacgactact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcggacata taggtagttt tcgtaccact 180

tactacgcga gctgggcgaa aggccgattc agcatctcca aaacctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacaggcgcg gacacggcca cctatttctg tgcgaggtcc 300

ccatatgatg atggttatgg tggtttcact tttaatttat ggggcccagg caccctggtc 360

accatctctt ca 372

<210> 663

<211> 363

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 663

cagtcggtga aggagtccgg gggagacctg gtcaagcctg gggcatccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgga tatgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcatgc atttatgctg gtagtagtgg tagcacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagatcgact 300

agtggtagtt atggtgcggg tttgggcttg tggggcccag gcaccctggt caccatctcc 360

tca 363

<210> 664

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 664

cagtcgctgg aggagtccgg gggagacctg gtccagcctg agggatccct gacactcacc 60

tgcacagctt ctggattctc cttcagtatc aacttataca tgtgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcatgc atttatggta ataataatgc taacacttac 180

tacacaacct gggcgaaagg ccgattcacc atctccaaaa cctcgccgac cacggtgact 240

ctgcaaatga ccagtctgac aggcgcggac acggccacct atttctgtgc gagagatact 300

gctgcttatt acgcctttag cttatggggc ccaggcaccc tggtcaccat ctcctca 357

<210> 665

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 665

cagtcgttgg aggagtccgg gggtcgcctg gtcaatcctg acgaatccct gacactcacc 60

tgcacagcct ctggattcac cttcagtggc tactacatgt actgggtccg ccaggctcca 120

gggaaggggc tggagtggat cggatggatt tatgttggta gtggtggtag cacttactac 180

gcgagctggg cgaaaggccg attcaccatc tccaaaacct cgtcgaccac ggtgactctg 240

caaatgccca gtctgacagc cgcggacacg gccacctatt tctgtgcgag gggtgttaat 300

gattatggtt gggcccttaa gttgtggggc ccaggcactc tggtcaccgt ctcttca 357

<210> 666

<211> 363

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 666

gagcagtcgt tggaggagtc cgggggagac ctggtcaagc ctggggcatc cctgacactc 60

acctgcacag cttctgcgtt ctccttcagt agcagttcct ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcatttatg gtggtagtgt tggtactact 180

tactacgcga gttgggcgaa aggccgattc accatctcca aaccctcgtc gaccacggtg 240

actctgcaaa tgaccagtct ggcagccgcg gacacggcca cctatttctg tgcgaccaat 300

acggatagta gtaggtctta ttataatttg tggggcccag gcaccctggt caccatctcc 360

tca 363

<210> 667

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 667

cagtcggtga aggagtccgg gggaggcctg gtccagcctg agggatccct ggcactcacc 60

tgcaaagcct ctggaatcga cctcagtaac tattggtaca tgtgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcggatgc gttgctactg atagtagtcg cacgcattac 180

gcgacctggg cgaaaggccg attcaccgtc tccaagacct cgtcgaccac ggtgactctg 240

caaatgacca gtctgacagc ggcggacacg gccacctatt tctgtgcgag aggatccggt 300

gctagcacca atggtgtttg gtgggtaatg ggagacggca tggacctctg gggcccaggg 360

accctcgtca ccatctcctc a 381

<210> 668

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 668

cagtcgttgg aggagtccgg gggaggcctg gtcaagcctg gggcttccct gacactcacc 60

tgcacagctt ctggattcag cctcaataga tactatatgt gctgggtccg ccaggctcca 120

gggaaggggc tggagtggat cggatgcatt tattctggta gtggtagcac ttactacgcg 180

agctgggcga aaggccgatt caccatctcc aaaacctcgt cgaccacggt gactctgcaa 240

atgaccagtc tgccagccgc ggacacggcc acctatttct gtggggagatt ggattatcgt 300

gttatttatg cctttaattt gtggggccca ggcaccctgg tcaccatctc ctca 354

<210> 669

<211> 366

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 669

gagcagtcgg tggaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cttctggatt ctccttcagt ggcagctgcg acatgtcctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcatcgtgc ttagtaatgg taatacatac 180

tacgcgggct gggcgcaagg ccgattcacc atctccaaaa tctcgtcgac cacggtgact 240

ctggaaatga ccagtctgac agccgcggac acggccacgt atttctgtgc gagagagcgc 300

tatcctggtg ctttttcaag tggattggat ctctggggcc agggcaccct ggtcaccgtc 360

tcttca 366

<210> 670

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 670

cagtcgttgg aggagtccgg gggaggcctg gtccagcctg agggatccct gacactcacc 60

tgcacagtct ctggtttctc cttcagtagc agctggtaca tgtgctgggt ccgccaggct 120

ccagggaagg ggctggaatg gatcgcatgc atttatactc ttagaagtgg tgccgcgcat 180

tacgcgaact gggcgaaagg ccgattcacc atctccaaag cctcgtcgac cacggtgact 240

ctgcaaatga acagtctgac agccgcggac acggccacct atttctgtgc gagagcgact 300

tatgctttatg ctggtgctgg ggacttgtgg ggcccaggca ccctggtcac cgtctcttca 360

<210> 671

<211> 363

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 671

gagcagtcgt tgaaggagtc cgggggagac ctggtcaagc ctggggcatc cctgacactc 60

acctgcacag cttctgcgtt ctccttcagt agcagttcct ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcatttatg gtggtagtgt tgctactact 180

tactacgcga cttgggcgaa aggccgattc accatctcca aaccctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gccagccgcg gacacggcca cctatttctg tgcgaccaat 300

acggatagta gtaggtctta ttataatttg tggggcccag gcaccctggt caccgtctcc 360

tca 363

<210> 672

<211> 372

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 672

gagcagtcgg tggaggagtc cgggggagac ctggtcaagc ctgggacatc cctgacactc 60

acctgcacag cttctggatt ctccttcagt ggcaatacaa tttgctgggt ccgccaggct 120

ccagggaaga ggcctgaatg gatcgcatgc atttatccta gcagtacttc tattactacc 180

tacgcgacct gggcgaaagg ccgattcacc gtctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gcgaagatat 300

gctgcttttc ttactttatgg tagtggggct tttgatccct ggggcccagg caccctagtc 360

accatctctt ca 372

<210> 673

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 673

gagcagtcgt tggagaggagtc cgggggagac ctggtcaagc ctgagggatc cctgacactc 60

acctgcacag cctctggatt ctccttcagt agcagctact ggatatgctg ggtccgccag 120

gctccaggga agggactgga gtggatcgca tgcgttgcta ctggtagtgg taccactgac 180

tacgcgagct gggcgaaagg ccgattcacc atgtccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agtcgcggac acggccacct atttctgtgc gagaattggt 300

gctttttattcctttagatt atggggccca ggcaccctgg tcaccatctc ttca 354

<210> 674

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 674

cagtcgttgg aggagtccgg gggagacctg gtcaagcctg agggatccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgga tatgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcggatgc atttatgctg gtaatagtgc taacacttat 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaactga ccagtctgac agccgcggac acggccacct atttctgtgc gagccgaaat 300

ggtggtgcgc ctgatggttt gaacttgtgg ggcccaggca ccctggtcac catctcttca 360

<210> 675

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 675

gagcagtcgg tgaaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cttctggatt ctccttcagt agcagctact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcattgcta ctggtactgg tagcacttac 180

tacgcgaact gggtgaatgg ccgattcacc atgtccaaac cctcgtcgac cacggtgact 240

ctgcaaatga ccactctgac agccgcggac acggccacct atttctgtgc gagaggtggt 300

ggttatattggt cttttagttt gtggggccca ggcaccctgg tcaccatctc ttca 354

<210> 676

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 676

gagcagtcgt tggagaggagtc cgggggagac ctggtcaagc ctgagggatc cctgacactc 60

acctgcacag cctctggatt ctccttcagt agtagttatt atatgtgttg gatccgccag 120

cctccaggga gggggctgga gtggctcgca tgcatttata ctggtagtga tagcacttac 180

tacgcgccct gggcgaaagg ccgattcacc atctccagaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gggagatgg 300

gattatgctg atgctgctgg ttattatgtt gcgagaggtt ttaacttgtg gggcccaggc 360

accctggtca ccatctcctc a 381

<210> 677

<211> 351

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 677

gagcagtcgt tggaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cttctggatt ctccttcact aaaaactact acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcatttatg ctggtagtac taatacattt 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaag cctcgtcgac cacggtggat 240

ctgaaaatga ccagtctgac agtcgcggac acggccacct atttctgtgc gagagatttc 300

gttagttatttgaatttgtg gggcccaggc accctggtca ccgtctcttc a 351

<210> 678

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 678

cgagcagtcg ggaaggagtc cgggggagac ctggtcacgc ttgggggatc cctgaaactc 60

tcctgcaaag cctctggaat cgacctcagt aacttttat acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcgttgcta gtgatagtag ccgcacgcat 180

tacgcgacct ggccgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agcggcggac acggccacct atttctgtgc gagaggatcc 300

ggtgctagta ccaatggtgt ttggtgggta atgggagacg gcatggacct ctggggccca 360

gggacccctcg tcaccgtctc c 381

<210> 679

<211> 369

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 679

cagtcggtga aggagtccgg gggagacctg gtcaagcctg gggcatccct gacactcacc 60

tgcaaagcct ctggattctc cttcagtagc ggccactaca tgtactgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcatgt atttatgctg gtagtgatac tggtagcaca 180

tggtacgcga gctgggcgaa aggccgattc accatctcca aaacctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacagccgcg gatacggcca cctatttctg tgcgagatct 300

agtaatagtt atggtaatta tggtgtttct aacttgtggg gcccaggcac cctggtcacc 360

gtctcttca 369

<210> 680

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 680

caggagcagc tggtggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcaaag cctctggaat cgacttcagt agcggctact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga attgatcgca tgcattttta ctagtagtgg taccacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagagatatc 300

tattcctacg gcatggacct ctggggccca gggaccctcg tcaccgtctc ttca 354

<210> 681

<211> 351

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 681

cagtcggtga aggagtccga gggaggcctg gtccagcctg ggggatccct gacactctcc 60

tgcaaagcct ctggaatcga cttcagtagc gcctatatga gctgggtccg ccaggctcca 120

gggaaggggc tggagtggat cggaaagatg cgtattaatg atagaagtca ctacgcgaac 180

tgggtgaatg gccgattcac catctccaac cacaatgacc agaacacggt ggagctgcaa 240

ctgaacagtc tgacagccgc ggacacggcc acctatttct gtgcgagaat cgctactggt 300

actaatgttg atgacttctg gggcccaggc accctggtca ccatctcctc a 351

<210> 682

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 682

caggagcagc tggtggagtc cgggggaggc ctggtaacgc ctggaggatc cctgacactc 60

acctgcacag cctctggatt ctccttcagt agcaagcaat acatttcctg ggtccgccgg 120

gctccaggga aggggctgga gtggatcggg gccattgtca ctgttaataa taaagtccac 180

tacgcgaact gggcgaaagg ccggttcacc atctccgaag cctcgtcgac cacggtgact 240

ctacaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagatggcgg 300

acttttggct tgtggggccc aggcaccctg gtcaccgtct cttca 345

<210> 683

<211> 363

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 683

gagcagctga tggaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacgg cttctagatt ctccctcagt aacatgaacg tgatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcattaata ttggcggtac taatatatgg 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agtcgcggac acggccacct atttctgtgc gagatcatat 300

attactgatc gtatttatga ttacgacttt tggggcccag gcaccctggt caccatctct 360

tca 363

<210> 684

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 684

cagtcggtgg aggagtccgg gggaggcctg gtcaagcctg gggcatccct gacactctcc 60

tgcacagcct ctggattcga cttcagtagc aaatactaca tgtggtgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcgcgc atttatggtg gtagtagtga tagtacagac 180

tacgcgacct gggcgagagg ccggttcgcc atctccagaa cctcgtcgac cacggtgact 240

ctgcgaatga ccagtctgac agccgcggac acggccacct atttctgtgg gagagtaatt 300

gatggtgctt gtggttatga cttgtggggc ccaggcaccc tggtcaccgt ctcttca 357

<210> 685

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 685

cagtcggtgg aggagtccgg gggagacctg gtcaagcctg gggcatccct gacactcacc 60

tgcacagcct ctggattcga cttcagtagc aatgcctact tgtgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcggatgc atttatgatg gtacaagtgg tgacacttac 180

tacgcgaact gggcgaaagg ccgattcacc atctccagaa gttcgtcgac tacggtgact 240

ctccaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagggatact 300

cggagtagta attattattt taatttgtgg ggcccaggca ccctggtcac catctcttca 360

<210> 686

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 686

gagtccgagg gaggcctggt caagcctgga ggaaccctga cactcacctg caaagtctct 60

ggaatcgact tcaatagcta caagtactac tacatgtgct gggtccgcca ggctccaggg 120

aaggggctgg agtggatcgg atgcatgtcc actgccagtc gtaatattta ctacgcgagc 180

tgggcgaaag gccgattcac catctccgaa acctcgtcga cctcggtgac tctgcaaatg 240

accactctga cagccgcgga cacggccacc tatttctgtg cgaaatccca tggtggtgat 300

ggtggttatg gggttgtgtt atggggccca ggcaccctgg tcaccatctc ctca 354

<210> 687

<211> 378

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 687

cagtcgttgg aggagtccga gggaggcctg gtcaagcctg gaggaaccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgta tgtgttgggt ccgccaggct 120

ccagggaagg ggctggagtt gatcgcatgc atttatactg atagtagtgg tgccacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaagt cctcgtcgac cacgataact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagggggtgg 300

gattacgagg atcctggtta tactgatact acctactttt ccttgtgggg cccaggcacc 360

ctggtcaccg tctcttca 378

<210> 688

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 688

cagaagcagc tggtggagtc cgggggaggc ctggtccagc ctgagggatc cctggcactc 60

acctgcacag cttctggatt ctccttcagt agcagctact ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgca tgcatttatg ctggtagtag tggtagcact 180

tactacgcga gctgggtgaa tggccgattc accgtcttca aaacctcgtc gaccacggtg 240

actctgcaaa tgaccagtct gacagccgcg gacacggcca cctatttctg tgcgagaggt 300

ggtactagtt accgccttga tttgtggggc ccaggcaccc tggtcaccgt ctcttca 357

<210> 689

<211> 375

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 689

tcgcagcagc tgaaggagtc cgggggaggc ctggtcaagc ctggaggaac cctgacactc 60

acctgcaaag cctctggaat cgacttcaat aatgactata acatctgctg ggtccgccag 120

cctccaggga aggggctgga atggatcgga tgcatttata ctggtagtga tagtacagac 180

tacgcgagct gggtgaatgg ccgattcacc atctccgaaa gcaccagcct aaacacggtg 240

gatctgaaag tgaccagtct gacagacgcg gacacggcca cgtatttctg tgccagagat 300

cttgttatactg gttatgctac ttatggttat ggatttatct tatggggccc aggcaccctg 360

gtcaccgtct cctca 375

<210> 690

<400> 690

000

<210> 691

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 691

caggagcagc tgaaggagtc cgggggagac ctggtcaagc ctgagggatc cctgacactc 60

acctgcacag cctctggatt ctccttcagt agcgactatt gggtatgctg ggtccgccag 120

gctccaggga aggggccgga gtggatcgga tgcatttata ctggtgatga tgacacatac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctggaagtga ccagtctgac agccgcggac acggccacct atttctgtgc gagaggactc 300

actattggta ctgctgagtt gtacttctgg ggcccaggca ctgtggtcac cgtctcttca 360

<210> 692

<211> 351

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 692

caggagcagc tggtggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag attctggatt ctccttcact aaaaactact acatgtgctg ggtccgccag 120

gctccaggga aggggctgga gtggatcgga tgcatttatg ctggtagtac taatacattt 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaag cctcgtcgac cacggtggat 240

ctgaaaatga ccagtctgac agtcgcggac acggccacct atttctgtgc gagagatttc 300

gttagttatttgaatttgtg gggcccaggc accctggtca ccgtctcctc a 351

<210> 693

<211> 366

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 693

cagtcgttgg aggagtccgg gggtggcctg gtcaagcctg agggatccct gacactcacc 60

tgcacagcct ctggatttga cctcagtaac aactactaca tctgctgggt ccgccaggct 120

ccagggaagg ggctggaatt gatcgcatgt gttgattctg atcttactga tagtgcagac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gggaagtggg 300

agtggttatatt attattacta cggcatggat ctctggggcc cagggaccct cgtcaccatc 360

tcctca 366

<210> 694

<211> 358

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 694

tcgcagtcgt tggaggagtc cgggggaggc ctggtcaagc ctggggcatc cctgacactc 60

acctgcaaag gctctggatt ctccttcaat ggcgactatt atatgtgctg ggtccgccag 120

actccaggga aggggctgga gtggatcggg tgcatttatg ctgctggtga tgacacttac 180

tacgcgacct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttttgtgc gagagatcag 300

gctgacagtt atgcctttgg tttgtggggc ccaggcacac tggtcaccat ctcctcag 358

<210> 695

<211> 348

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 695

cagtcgttga aggagtccga gggagacctg gtcaagcctg gggcatccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgga tatgctgggt ccgccaggct 120

ccagggaagg ggctagagtg gatcgcatgc atttatgctg gtagtagtgg tagcacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctggaaatga ccagtctgac agacgcggac acggccacct atttctgtgc gaggggtttt 300

tcgatgttta agttgtgggg cccaggcacc ctggtcacca tctcttca 348

<210> 696

<211> 378

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 696

cagtcggtga aggagtccgg gggaggcctg gtcaagcctg gaggaaccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgta tgtgttgggt ccgccaggct 120

ccagggaagg ggctggagtt gatcgcatgc atttatactg atagtagtgg tgccacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaagt cctcgtcgac cacgataact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagggggtgg 300

gattacgagg atcctggtta tactgatact acctactttt ccttgtgggg cccaggcacc 360

ctggtcaccg tctcttca 378

<210> 697

<211> 384

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 697

tcgcagtcgg tggaggagtc cgggggagac ctggtcaagc ctggaggaac cctgacactc 60

acctgcacag cctctagaat cgacctcaac aactattatt acatatcctg ggtccgccag 120

gctccaggga agggactgga gtggatcgga gtcgttgcta ctgatagtag tgtcacatgg 180

tacgcgagct gggcgaaagg ccagttcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agcggcggac acggccacct atttctgtgc gagaggatcc 300

ggtgctgcta ctaatggtgt ttggtgggtg atgggagacg gcatggacct ctggggccca 360

gggacccctcg tcaccgtctc ttca 384

<210> 698

<211> 348

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 698

cagtcggtgg aggagtccga gggtcgcctg gtcacgcctg gaggatccct gacactcacc 60

tgcacagtct ctggaatcga cctcagtagc tatgcaatgg gctgggtccg ccaggctcca 120

gggaaggggc tggaatggat cggggtcatt ggtaaaagtg gaaccacata ctacgcgaac 180

tgggcgaaag gccgattcac catctccaag acctcgacca cggtggatct gcaaatcgcc 240

agtccgacaa ccgaggacac ggccacctat ttctgtgcca gggcaggtgc tagtaggagt 300

atttattatg acttgtgggg ccaaggcacc ctggtcacca tctcctca 348

<210> 699

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 699

cagtcggtgg aggagtccgg gggaggcctg gtccagcctg agggatccct gacactcacc 60

tgcacagctt ctggattctc cttcagtggc attgtctata tgtgttgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcatgt gcttttgttg gtagtggtgg tagcacttac 180

tacgcgacct gggcgacagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctacagatga ccagtctgac agccgcggac acggccacct atttctgtgc gaaatctttat 300

aattataatg gtttaggctt gtggggccca ggcaccctgg tcaccgtctc ctca 354

<210> 700

<211> 367

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 700

cagtcgttgg aggagtccgg gggagacctg gtcaagcctg gggcatccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactaca tgtgctgggt ccgccaggct 120

ccagggaagg ggctggagtg gatcgcatgc atttatggtg gtagtactgg taccacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac aggcgcagac acggccacct atttctgtgc gagatcatat 300

aatagtgcta gtagtggtta ttattgggac ttgtggggcc caggcacct ggtcaccgtc 360

tcttcag 367

<210> 701

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 701

gagcagtcgg tggaggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cctctggaat cgacttcagt agcggcgcct ggatatgctg ggtccgccag 120

gctccaggga aggggctgga gttgatcgca tgcattttta ctactagtgg tttcacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaaaa cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagagatatc 300

tattcctacg gcatggacct ctggggccca gggaccctcg tcaccatctc ttca 354

<210> 702

<211> 345

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 702

caggagcagc tggtggagtc cgggggaggc ctggtccagc ctgagggatc cctgacactc 60

acctgcacag cttctggatt ctccttcagt agcaggcaat acatttcctg ggtccgccgg 120

gctccaggga aggggctgga gtggatcggg gccattgtca ctgttaataa taaagtccac 180

tacgccaact gggcgaaagg ccggttcacc atctccgaag cctcgtcgac cacggtgact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagatggcgg 300

acttttggct tgtggggccc aggcaccctg gtcaccgtct cttca 345

<210> 703

<211> 378

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 703

cagtcggtga aggagtccgg gggaggcctg gtcaagcctg gaggaaccct gacactcacc 60

tgcacagcct ctggattctc cttcagtagc agctactgta tgtgttgggt ccgccaggct 120

ccagggaagg ggctggagtt gatcgcatgc atttatactg atagtagtgg tgccacttac 180

tacgcgagct gggcgaaagg ccgattcacc atctccaagt cctcgtcgac cacgataact 240

ctgcaaatga ccagtctgac agccgcggac acggccacct atttctgtgc gagggggtgg 300

gattacgagg atcctggtta tactgatact acctactttt ccttgtgggg cccaggcacc 360

ctggtcaccg tctcttca 378

<210> 704

<211> 125

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 704

Gln Ser Leu Glu Glu Ser Glu Gly Asp Leu Val Lys Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Lys Ala Ser Gly Phe Asp Phe Ser Ser Asp Ala

20 25 30

Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly

35 40 45

Cys Ile Tyr Asn Gly Asp Glu Ile Thr Asp His Ala Ser Trp Ala Lys

50 55 60

Gly Arg Phe Thr Ile Ser Lys Thr Ser Pro Thr Thr Val Thr Leu Gln

65 70 75 80

Met Thr Ser Leu Thr Val Ala Asp Thr Ala Thr Tyr Phe Cys Ala Arg

85 90 95

Ala Val Tyr Ser Asp Gly Gly Ala Gly Tyr Pro Tyr Met Tyr Gly Met

100 105 110

Asp Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 705

<211> 114

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 705

Arg Ala Val Gly Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Phe Asp Phe Ser Gly Ile

20 25 30

Tyr Trp Val Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Phe Asp Ala Glu Arg Thr Gly Asn Thr Tyr Tyr Ala Thr

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg Thr Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Ser Tyr Tyr Met Trp Gly Pro Gly Thr Leu Val Thr Val

100 105 110

Ser Ser

<210> 706

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 706

Glu Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Glu Leu Ser Phe Ser Ser Ala

20 25 30

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Ser Gly Asp Gly Asp Thr Tyr Tyr Ala Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Asp Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ala Leu Asp Ser His Tyr Ser Ser Phe Asp Leu Trp Gly Pro

100 105 110

Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 707

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 707

Glu Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Val Thr Cys Ala Val Ser Gly Phe Ser Leu Asn Ser Tyr

20 25 30

Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile

35 40 45

Gly Tyr Ile Asp Thr Gly Ala Ser Ile Thr Asp Tyr Ala Ser Trp Ala

50 55 60

Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr Leu

65 70 75 80

Glu Met Thr Ser Leu Thr Asp Ala Asp Thr Ala Thr Tyr Phe Cys Ala

85 90 95

Arg Gly Phe Ser Met Phe Lys Leu Trp Gly Pro Gly Thr Leu Val Thr

100 105 110

Ile Ser Ser

115

<210> 708

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 708

Glu Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Leu Asp Phe Ser Ser Ser

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Asp Thr Gly Ser Ser Ser Gly Ser Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Val Ser Lys Thr Ser Ser Thr Thr Val

65 70 75 80

Ser Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Ser Thr Pro Asn Ser Leu Gly Tyr Asp Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Ile Ser Ser

115

<210> 709

<211> 127

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 709

Glu Gln Ser Val Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Ser Ser Ser Ser

20 25 30

Ala Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Phe Ile Gly Ser Gly Ser Asp Ser Tyr Tyr Ala Thr

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Asn Thr Tyr Asp Trp Asn Gly Tyr Ile Tyr Gly Pro Cys

100 105 110

Tyr Phe Gly Leu Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120 125

<210> 710

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 710

Glu Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Thr Leu Thr Leu Thr Cys Ile Val Ser Gly Phe Ser Leu Ser Arg Tyr

20 25 30

Ala Val Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Ile

35 40 45

Gly Tyr Ile Asp Thr Ser Ser Gly Asn Lys Asp Tyr Ala Asn Trp Val

50 55 60

Asn Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr Leu

65 70 75 80

Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala

85 90 95

Arg Gly Phe Ser Met Phe Lys Leu Trp Gly Pro Gly Thr Leu Val Thr

100 105 110

Ile Ser Ser

115

<210> 711

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 711

Glu Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Leu Asp Phe Ser Ser Ser

20 25 30

Tyr Trp Ser Cys Trp Val Arg Gln Thr Pro Gly Arg Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Asp Val Gly Ser Ser Gly Gly Ser Tyr Tyr Ala Ser

50 55 60

Trp Ala Arg Gly Arg Phe Thr Val Ser Lys Gly Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Ser Thr Thr Thr Asn Val Phe Gly Tyr Asp Leu Trp Gly Pro

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 712

<211> 127

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 712

Glu Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Phe Asp Phe Ser Ser Asn

20 25 30

Asp Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Gly Gly Asp Gly His Thr Tyr Tyr Ala Thr Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ala Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Ser Tyr Phe Cys

85 90 95

Ala Arg Gly Tyr Ser Tyr Gly Asp Thr Gly Tyr Ala Asp Ala Ile Leu

100 105 110

Thr Leu Asp Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 713

<211> 123

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 713

Glu Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Val Ser Gly Ile Asp Phe Asn Tyr Tyr

20 25 30

Asn Tyr Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45

Glu Trp Ile Gly Cys Met Ser Thr Ala Ser Ala Asn Ile Tyr Leu Ala

50 55 60

Ser Trp Ala Lys Gly Arg Phe Thr Ile Ser Glu Ala Ser Ser Thr Thr

65 70 75 80

Val Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr

85 90 95

Phe Cys Ala Lys Ser His Gly Gly Asp Gly Gly Tyr Gly Val Val Leu

100 105 110

Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 714

<211> 122

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 714

Glu Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Phe Ser Gly Ser

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Tyr Gly Asp Ser Ile Ala Thr Tyr Tyr Pro Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Ala Ser Leu Thr Gly Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Arg Asn Gly Gly Ser Gly Ala Tyr Gly Trp Asp Leu Trp

100 105 110

Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 715

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 715

Glu Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Phe Ser Phe Ser Ser Asp

20 25 30

Tyr Asp Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Val Thr Gly Phe Ser Gly Arg Ile Tyr Tyr Ala Thr

50 55 60

Trp Ala Arg Gly Arg Phe Thr Phe Ser Arg Thr Ser Ser Thr Thr Leu

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Asp Ser Gly Asn Tyr Asn Trp Asp Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Ile Ser Ser

115

<210> 716

<211> 124

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 716

Glu Gln Ser Val Glu Glu Ser Glu Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Asn Asp

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Gly His Ile Gly Ser Phe Arg Thr Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Ser Ile Ser Lys Thr Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Gly Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Ser Pro Tyr Asp Asp Gly Tyr Gly Gly Phe Thr Phe Asn

100 105 110

Leu Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 717

<211> 121

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 717

Gln Ser Val Lys Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Ala Gly Ser Ser Gly Ser Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser Thr Ser Gly Ser Tyr Gly Ala Gly Leu Gly Leu Trp Gly

100 105 110

Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 718

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 718

Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Gln Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ile Asn Leu

20 25 30

Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Gly Asn Asn Asn Ala Asn Thr Tyr Tyr Thr Thr Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Pro Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Gly Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Thr Ala Ala Tyr Tyr Ala Phe Ser Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Ile Ser Ser

115

<210> 719

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 719

Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Asn Pro Asp Glu Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Thr Phe Ser Gly Tyr Tyr

20 25 30

Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly

35 40 45

Trp Ile Tyr Val Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Ser Trp Ala

50 55 60

Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr Leu

65 70 75 80

Gln Met Pro Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala

85 90 95

Arg Gly Val Asn Asp Tyr Gly Trp Ala Leu Lys Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 720

<211> 121

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 720

Glu Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Ala Phe Ser Phe Ser Ser Ser

20 25 30

Ser Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Tyr Gly Gly Ser Val Gly Thr Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Pro Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Ala Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Thr Asn Thr Asp Ser Ser Arg Ser Tyr Tyr Asn Leu Trp Gly

100 105 110

Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 721

<211> 127

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 721

Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly Ser

1 5 10 15

Leu Ala Leu Thr Cys Lys Ala Ser Gly Ile Asp Leu Ser Asn Tyr Trp

20 25 30

Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Cys Val Ala Thr Asp Ser Ser Arg Thr His Tyr Ala Thr Trp Ala

50 55 60

Lys Gly Arg Phe Thr Val Ser Lys Thr Ser Ser Thr Thr Val Thr Leu

65 70 75 80

Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala

85 90 95

Arg Gly Ser Gly Ala Ser Thr Asn Gly Val Trp Trp Val Met Gly Asp

100 105 110

Gly Met Asp Leu Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120 125

<210> 722

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 722

Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Asn Arg Tyr Tyr

20 25 30

Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly

35 40 45

Cys Ile Tyr Ser Gly Ser Gly Ser Thr Tyr Tyr Tyr Ala Ser Trp Ala Lys

50 55 60

Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Ser Thr Thr Val Thr Leu Gln

65 70 75 80

Met Thr Ser Leu Pro Ala Ala Asp Thr Ala Thr Tyr Phe Cys Gly Arg

85 90 95

Leu Asp Tyr Arg Val Ile Tyr Ala Phe Asn Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Ile Ser Ser

115

<210> 723

<211> 122

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 723

Glu Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Gly Ser

20 25 30

Cys Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Val Leu Ser Asn Gly Asn Thr Tyr Tyr Ala Gly Trp

50 55 60

Ala Gln Gly Arg Phe Thr Ile Ser Lys Ile Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Glu Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Glu Arg Tyr Pro Gly Ala Phe Ser Ser Gly Leu Asp Leu Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 724

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 724

Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Phe Ser Ser Ser Trp

20 25 30

Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Thr Leu Arg Ser Gly Ala Ala His Tyr Ala Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ala Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Asn Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ala Thr Tyr Ala Tyr Ala Gly Ala Gly Asp Leu Trp Gly Pro

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 725

<211> 121

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 725

Glu Gln Ser Leu Lys Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Ala Phe Ser Phe Ser Ser Ser

20 25 30

Ser Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Tyr Gly Gly Ser Val Ala Thr Thr Tyr Tyr Ala Thr

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Pro Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Pro Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Thr Asn Thr Asp Ser Ser Arg Ser Tyr Tyr Asn Leu Trp Gly

100 105 110

Pro Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 726

<211> 124

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 726

Glu Gln Ser Val Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Thr

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Gly Asn

20 25 30

Thr Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Arg Pro Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Pro Ser Ser Thr Ser Ile Thr Thr Tyr Ala Thr Trp

50 55 60

Ala Lys Gly Arg Phe Thr Val Ser Lys Thr Ser Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Arg Tyr Ala Ala Phe Leu Thr Tyr Gly Ser Gly Ala Phe Asp

100 105 110

Pro Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 727

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 727

Glu Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Val Ala Thr Gly Ser Gly Thr Thr Asp Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Met Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Val Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ile Gly Ala Phe Tyr Ser Phe Arg Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Ile Ser Ser

115

<210> 728

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 728

Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Cys Ile Tyr Ala Gly Asn Ser Ala Asn Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Leu Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Ser Arg Asn Gly Gly Ala Pro Asp Gly Leu Asn Leu Trp Gly Pro

100 105 110

Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 729

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 729

Glu Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Ala Thr Gly Thr Gly Ser Thr Tyr Tyr Tyr Ala Asn Trp

50 55 60

Val Asn Gly Arg Phe Thr Met Ser Lys Pro Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Thr Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Gly Gly Tyr Trp Ser Phe Ser Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Ile Ser Ser

115

<210> 730

<211> 127

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 730

Glu Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Tyr Met Cys Trp Ile Arg Gln Pro Pro Gly Arg Gly Leu Glu Trp

35 40 45

Leu Ala Cys Ile Tyr Thr Gly Ser Asp Ser Thr Tyr Tyr Ala Pro Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Arg Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Gly Asp Trp Asp Tyr Ala Asp Ala Ala Gly Tyr Tyr Val Ala Arg

100 105 110

Gly Phe Asn Leu Trp Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120 125

<210> 731

<211> 117

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 731

Glu Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Thr Lys Asn

20 25 30

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Ala Gly Ser Thr Asn Thr Phe Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ala Ser Ser Thr Thr Val Asp

65 70 75 80

Leu Lys Met Thr Ser Leu Thr Val Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Phe Val Ser Tyr Leu Asn Leu Trp Gly Pro Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

<210> 732

<211> 128

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 732

Arg Ala Val Gly Lys Glu Ser Gly Gly Asp Leu Val Thr Leu Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Lys Ala Ser Gly Ile Asp Leu Ser Asn Phe

20 25 30

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Val Ala Ser Asp Ser Ser Arg Thr His Tyr Ala Thr Trp

50 55 60

Pro Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Ser Gly Ala Ser Thr Asn Gly Val Trp Trp Val Met Gly

100 105 110

Asp Gly Met Asp Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 733

<211> 123

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 733

Gln Ser Val Lys Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Lys Ala Ser Gly Phe Ser Phe Ser Ser Gly His

20 25 30

Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Ala Gly Ser Asp Thr Gly Ser Thr Trp Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Ser Ser Asn Ser Tyr Gly Asn Tyr Gly Val Ser Asn Leu

100 105 110

Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 734

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 734

Gln Glu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Ala Ser Gly Ile Asp Phe Ser Ser Gly

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu

35 40 45

Ile Ala Cys Ile Phe Thr Ser Ser Gly Thr Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Ile Tyr Ser Tyr Gly Met Asp Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 735

<211> 117

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 735

Gln Ser Val Lys Glu Ser Glu Gly Gly Leu Val Gln Pro Gly Gly Ser

1 5 10 15

Leu Thr Leu Ser Cys Lys Ala Ser Gly Ile Asp Phe Ser Ser Ala Tyr

20 25 30

Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly

35 40 45

Lys Met Arg Ile Asn Asp Arg Ser His Tyr Ala Asn Trp Val Asn Gly

50 55 60

Arg Phe Thr Ile Ser Asn His Asn Asp Gln Asn Thr Val Glu Leu Gln

65 70 75 80

Leu Asn Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala Arg

85 90 95

Ile Ala Thr Gly Thr Asn Val Asp Asp Phe Trp Gly Pro Gly Thr Leu

100 105 110

Val Thr Ile Ser Ser

115

<210> 736

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 736

Gln Glu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Thr Pro Gly Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Lys

20 25 30

Gln Tyr Ile Ser Trp Val Arg Arg Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Ala Ile Val Thr Val Asn Asn Lys Val His Tyr Ala Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Glu Ala Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Trp Arg Thr Phe Gly Leu Trp Gly Pro Gly Thr Leu Val Thr

100 105 110

Val Ser Ser

115

<210> 737

<211> 121

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 737

Glu Gln Leu Met Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Arg Phe Ser Leu Ser Asn Met

20 25 30

Asn Val Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Asn Ile Gly Gly Thr Asn Ile Trp Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Val Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser Tyr Ile Thr Asp Arg Ile Tyr Asp Tyr Asp Phe Trp Gly

100 105 110

Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 738

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 738

Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Ser Cys Thr Ala Ser Gly Phe Asp Phe Ser Ser Lys Tyr

20 25 30

Tyr Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Arg Ile Tyr Gly Gly Ser Ser Asp Ser Thr Asp Tyr Ala Thr Trp

50 55 60

Ala Arg Gly Arg Phe Ala Ile Ser Arg Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Arg Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Gly Arg Val Ile Asp Gly Ala Cys Gly Tyr Asp Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 739

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 739

Gln Ser Val Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Asp Phe Ser Ser Asn Ala

20 25 30

Tyr Leu Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Cys Ile Tyr Asp Gly Thr Ser Gly Asp Thr Tyr Tyr Tyr Ala Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Arg Ser Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Thr Arg Ser Ser Asn Tyr Tyr Tyr Phe Asn Leu Trp Gly Pro

100 105 110

Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 740

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 740

Glu Ser Glu Gly Gly Leu Val Lys Pro Gly Gly Thr Leu Thr Leu Thr

1 5 10 15

Cys Lys Val Ser Gly Ile Asp Phe Asn Ser Tyr Lys Tyr Tyr Tyr Met

20 25 30

Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly Cys

35 40 45

Met Ser Thr Ala Ser Arg Asn Ile Tyr Tyr Ala Ser Trp Ala Lys Gly

50 55 60

Arg Phe Thr Ile Ser Glu Thr Ser Ser Thr Ser Val Thr Leu Gln Met

65 70 75 80

Thr Thr Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala Lys Ser

85 90 95

His Gly Gly Asp Gly Gly Tyr Gly Val Val Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Ile Ser Ser

115

<210> 741

<211> 126

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 741

Gln Ser Leu Glu Glu Ser Glu Gly Gly Leu Val Lys Pro Gly Gly Thr

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Cys Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Ile

35 40 45

Ala Cys Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ser Ser Ser Thr Thr Ile Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

100 105 110

Phe Ser Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 742

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 742

Gln Lys Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Ala Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Ala Cys Ile Tyr Ala Gly Ser Ser Gly Ser Thr Tyr Tyr Ala Ser

50 55 60

Trp Val Asn Gly Arg Phe Thr Val Phe Lys Thr Ser Ser Thr Thr Val

65 70 75 80

Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Gly Gly Thr Ser Tyr Arg Leu Asp Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 743

<211> 125

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 743

Ser Gln Gln Leu Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Thr Leu Thr Leu Thr Cys Lys Ala Ser Gly Ile Asp Phe Asn Asn Asp

20 25 30

Tyr Asn Ile Cys Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Thr Gly Ser Asp Ser Thr Asp Tyr Ala Ser Trp

50 55 60

Val Asn Gly Arg Phe Thr Ile Ser Glu Ser Thr Ser Leu Asn Thr Val

65 70 75 80

Asp Leu Lys Val Thr Ser Leu Thr Asp Ala Asp Thr Ala Thr Tyr Phe

85 90 95

Cys Ala Arg Asp Leu Val Thr Gly Tyr Ala Thr Tyr Gly Tyr Gly Phe

100 105 110

Ile Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 744

<400> 744

000

<210> 745

<211> 120

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 745

Gln Glu Gln Leu Lys Glu Ser Gly Gly Asp Leu Val Lys Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Asp

20 25 30

Tyr Trp Val Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Thr Gly Asp Asp Asp Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Glu Val Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Leu Thr Ile Gly Thr Ala Glu Leu Tyr Phe Trp Gly Pro

100 105 110

Gly Thr Val Val Thr Val Ser Ser

115 120

<210> 746

<211> 117

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 746

Gln Glu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Asp Ser Gly Phe Ser Phe Thr Lys Asn

20 25 30

Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Ala Gly Ser Thr Asn Thr Phe Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ala Ser Ser Thr Thr Val Asp

65 70 75 80

Leu Lys Met Thr Ser Leu Thr Val Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Phe Val Ser Tyr Leu Asn Leu Trp Gly Pro Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

<210> 747

<211> 122

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 747

Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Asp Leu Ser Asn Asn Tyr

20 25 30

Tyr Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Ile

35 40 45

Ala Cys Val Asp Ser Asp Leu Thr Asp Ser Ala Asp Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Gly Ser Gly Ser Gly Tyr Tyr Tyr Tyr Tyr Tyr Gly Met Asp Leu Trp

100 105 110

Gly Pro Gly Thr Leu Val Thr Ile Ser Ser

115 120

<210> 748

<211> 119

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 748

Ser Gln Ser Leu Glu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Leu Thr Leu Thr Cys Lys Gly Ser Gly Phe Ser Phe Asn Gly Asp

20 25 30

Tyr Tyr Met Cys Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Cys Ile Tyr Ala Ala Gly Asp Asp Thr Tyr Tyr Ala Thr Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Gln Ala Asp Ser Tyr Ala Phe Gly Leu Trp Gly Pro Gly

100 105 110

Thr Leu Val Thr Ile Ser Ser

115

<210> 749

<211> 116

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 749

Gln Ser Leu Lys Glu Ser Glu Gly Asp Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Ala Gly Ser Ser Gly Ser Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Glu Met Thr Ser Leu Thr Asp Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Phe Ser Met Phe Lys Leu Trp Gly Pro Gly Thr Leu Val

100 105 110

Thr Ile Ser Ser

115

<210> 750

<211> 126

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 750

Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Thr

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Cys Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Ile

35 40 45

Ala Cys Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ser Ser Ser Thr Thr Ile Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

100 105 110

Phe Ser Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 751

<211> 128

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 751

Ser Gln Ser Val Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly

1 5 10 15

Thr Leu Thr Leu Thr Cys Thr Ala Ser Arg Ile Asp Leu Asn Asn Tyr

20 25 30

Tyr Tyr Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Val Val Ala Thr Asp Ser Ser Val Thr Trp Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Gln Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Ser Gly Ala Ala Thr Asn Gly Val Trp Trp Val Met Gly

100 105 110

Asp Gly Met Asp Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 752

<211> 116

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 752

Gln Ser Val Glu Glu Ser Glu Gly Arg Leu Val Thr Pro Gly Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser Ser Tyr Ala

20 25 30

Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly

35 40 45

Val Ile Gly Lys Ser Gly Thr Thr Tyr Tyr Tyr Ala Asn Trp Ala Lys Gly

50 55 60

Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Gln Ile Ala

65 70 75 80

Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala Arg Ala Gly

85 90 95

Ala Ser Arg Ser Ile Tyr Tyr Asp Leu Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Ile Ser Ser

115

<210> 753

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 753

Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Gly Ile Val

20 25 30

Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ala Phe Val Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Thr Trp

50 55 60

Ala Thr Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Lys Ser Tyr Asn Tyr Asn Gly Leu Gly Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 754

<211> 122

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 754

Gln Ser Leu Glu Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Tyr Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Ala Cys Ile Tyr Gly Gly Ser Thr Gly Thr Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Gly Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Ser Tyr Asn Ser Ala Ser Ser Gly Tyr Tyr Trp Asp Leu Trp

100 105 110

Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 755

<211> 118

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 755

Glu Gln Ser Val Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Ile Asp Phe Ser Ser Gly

20 25 30

Ala Trp Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu

35 40 45

Ile Ala Cys Ile Phe Thr Thr Ser Gly Phe Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Asp Ile Tyr Ser Tyr Gly Met Asp Leu Trp Gly Pro Gly Thr

100 105 110

Leu Val Thr Ile Ser Ser

115

<210> 756

<211> 115

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 756

Gln Glu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly

1 5 10 15

Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Arg

20 25 30

Gln Tyr Ile Ser Trp Val Arg Arg Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Ala Ile Val Thr Val Asn Asn Lys Val His Tyr Ala Asn Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Glu Ala Ser Ser Thr Thr Val Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Trp Arg Thr Phe Gly Leu Trp Gly Pro Gly Thr Leu Val Thr

100 105 110

Val Ser Ser

115

<210> 757

<211> 126

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 757

Gln Ser Val Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Thr

1 5 10 15

Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Ser Ser Ser Tyr

20 25 30

Cys Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Ile

35 40 45

Ala Cys Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser Trp

50 55 60

Ala Lys Gly Arg Phe Thr Ile Ser Lys Ser Ser Ser Thr Thr Ile Thr

65 70 75 80

Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys

85 90 95

Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr Thr Tyr

100 105 110

Phe Ser Leu Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 758

<211> 128

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 758

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Cys Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Val Ser Cys Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg His Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr

100 105 110

Thr Tyr Phe Ser Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 759

<211> 128

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 759

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Cys Met Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu

35 40 45

Val Ser Cys Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg His Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr

100 105 110

Thr Tyr Phe Ser Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 760

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 760

gagctcgata tgacccagac tccagcctcc gtggaggcgg ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaacatttac agctacttag tctggtatca gcagaaacca 120

gggcagcctc ccaagctcct aatctcaaag gcatccactc tggcatctgg ggtctcatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcaacga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaacc aattatttta gtagtactag tcattttggt 300

gtttttactttcggcggagg gaccgagctg gaaatcaaa 339

<210> 761

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 761

gagctcgtgc tgacccagac tccatcccct gtgtctgcag ttgtggggagg ctcagtcacc 60

atcaattgcc agtccagtca gagtctttat aatgcgaacg acttatcctg gtatcagcag 120

aaaccagggc agcctcccaa gcaactgatc tactgggcat ccactctggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acacagttca ctctcagcat cagcgacgtg 240

cagtgtgacg atgctgccac ttaactactgt ctaggcgaat ttagttgcag tagttttgat 300

tgtcatgttt tcggcggagg gaccgaggtg gtggtcaaa 339

<210> 762

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 762

gagctcgata tgacccagac tccatcctcc gtgtctgcag ctgtgggaga cacagtcacc 60

atcaagtgcc aggccagtca gagcatttac aggtacttag cctggtatca acagaaacca 120

gggcagcgtc ccagcctcct aatatattat ggatccgatc tggcatctgg ggtcccatcg 180

cggttcagcg gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccagttaacta ctgtcaaacc acttatgatg attatcataa tggttgggct 300

ttcggcggag ggaccaatgt ggaaatcaac 330

<210> 763

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 763

gagctcgatc tgacccagac tccatcgtcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcagttgcc aggccagtca gagtgtttat ggtaacaacc gcttagcctg gtatcatcag 120

aaaccaggac agcctcccaa acgcctgatc tatctggcat ccactctgga ttctggggtc 180

ccatcacggt tcaaaggcgc tggatctggg acacagttca ctctcaccat cagcgacctg 240

gagtgtgacg atgctgccac ttactactgt gcaggcggtt atgctgggaa tttcaatgct 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 764

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 764

gagctcgatc tgacccagac tccagcctcc gtgtctgcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaacattgtc agtaatttag cctggtatca gcagaaacca 120

gggcagcgtc ccaagctcct gatctattat gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag tacactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaaac aatgctggta tttatggtaa ttatggtcat 300

ggtttcggcg gagggaccga gctggaaatc aaa 333

<210> 765

<211> 327

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 765

gagctcgatc tgacccagac tccatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcatttac aactacttag cctggtatca gcagaaacca 120

gggcactctc ctaagctcct gatctacgat gtatccaaat tggcatctgg ggtctcatcg 180

cggttcaaag gtagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ctgtcaaagt tattatggta atactgtttc ttttactttc 300

ggcggaggga ccgaggtgga aatcaaa 327

<210> 766

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 766

gagctcgtga tgacccagac tccatcgtcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcagttgcc aggccagtca gagtgtttat aataacaaca acttagcctg gtatcagcag 120

aaaccagggc agcctcccaa acgcctgatc tattctgcat ccactctgga ttctggggtc 180

ccatcgcggt tcagcggcag tggatctggg acacagttca ctctcaccat cagcgacctg 240

gagtgtgacg atgctgccac ttactattgt gcaggcggtt atacttacaa tatcaatatt 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 767

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 767

gagctcgatc tgacccagac accagcctct gtgtctgaac ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaacatttac aacaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattat gcatccactc tggcatctgg ggtcccaccg 180

cggttcagcg gcagtggatc tgggacagag tatactctca ccatcagcga cctcgagtgt 240

gacgatgctg ccacttacta ctgtcaaaac aatgctggta tttatggtgg ttatggtcat 300

ggtttcggcg gagggaccga ggtggtggtc aaa 333

<210> 768

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 768

gagctcgatc tgacccagac tccagcctcc gtagaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gactattggt agctacctat cctggtatca gcagaaacca 120

gggcagcgtc ccaaactcct gatctatgaa gcatccaaac tggcatctgg ggtcccatcg 180

tggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagc aattattatc gtgctggtgg taattatggt 300

ggagctttcg gcggagggac cgaggtggaa atcaaa 336

<210> 769

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 769

gagctcgatc tgacccagac tccattctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtga gaccattagt aatagattag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccactc tggaatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ttgtcaaagt attcgtagta gtagtggtat tgttcatccg 300

aatactttcg gcggagggac cgaggtggaa atcaaa 336

<210> 770

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 770

gagctcgatc tgacccagac tccagcctct gtgtctgaac ctgtgggagg cacagtcacc 60

atcacgtgcc aggccagtca gagcattagt agttactttat cctggtatca gcagacacca 120

gggcagcctc ccaagctcct aatctacaag gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagc tattactata ttagtgctac tgttgataat 300

actttcggcg gagggaccga ggtggaaatc aaa 333

<210> 771

<211> 327

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 771

gagctcgatc tgacccagac tccaacctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattagt gattacttat cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctacagg gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ttgtcaaagt aattattatg gtagtcaggg ttgtactttc 300

ggcggaggga ccgaggtgga aatcaaa 327

<210> 772

<211> 324

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 772

gagctcgata tgacccagac tccatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

gtcaagtgcc aggtcagtca gagcattggc aatgcaatag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctacaag gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagaa ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaaac tattattata gtaatactaa tagtttcggc 300

ggagggaccg aggtggtggt caaa 324

<210> 773

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 773

gagctcgata tgacccagac tgcatccccc gtgtctggag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaacatttat aataacatag ggtggtatca gcagaaacca 120

gggcagcctc ccaacctcct gatctatggt ccatcctatc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtagatc tgggacagag tacactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagt gatgattgga tgagtatcag tcctgatatt 300

gttttcggcg gagggaccga ggtggaaatc aaa 333

<210> 774

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 774

gagctcgtga tgacccagac accatcatcc tcgtctgcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagtattggt agtagattcg cctggtatca gcagaaacca 120

gggcagcgtc ccaagctcct gatctatgaa gcatccaaac tgccatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcacgctca ccatcagcga cctggagtgt 240

gccgatgctg ccatttatta ctgtcaatgt acttattatg aaagtagtag tggtggtggt 300

ttcggcggag ggaccgaggt ggtggtcaaa 330

<210> 775

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 775

gagctcgtgc tgacccagac tccatcctcc gtggaggtag ctgtggggagg cgcagtcacc 60

atcaagtgcc aggccagtca tatcattact aactacttag cctggtatca gcagagacca 120

gggcagcctc ccaagctcct gatctacgat gcatcgaagc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaaac tatctttattttagtagtgg tgattggaat 300

gttttcggcg gagggaccga ggtggtggtc aaa 333

<210> 776

<400> 776

000

<210> 777

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 777

gagctcgtga tgacccagac tccatcctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtcc gagcattagt acttacttgt cctggtatca gcagaaacca 120

gggcagcctc ccaagcgcct gatcaacagg gcatccactc tggcatctgg ggtcccaccg 180

cggttcaaag gcagtggagc tgggacacag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ttgtcaaaac aattaccata gtggtagtag taatggtggt 300

ggtgttgctt tcggcggagg gaccgaggtg gaaatcaaa 339

<210> 778

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 778

gagctcgtgc tgacccagac tccagcctcc gtgtctgcgg ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtca gagtattggt agtggtaatt tagcctggta tcagcagaaa 120

ccagggcagc ctcccaagct cctgatctat ctggcatcca ctctggcatc tggggtccca 180

ccgcggttca aaggcagtgg atctgggaca gagttcactc tcaccatcag cgacctggag 240

tgtgacgatg ctgccactta ctactgtcaa tatacttatt atggtactac ttatgataat 300

gctttcggcg gagggaccga gctggaaatc aaa 333

<210> 779

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 779

gagctcgatc tgacccagac tccatcccca gtgtctgcag ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtca gattgttgct aacggccgct tagcctggta tcagcagaaa 120

ccagggcagc ctcccaagct cctgatctat gctacatcca ctctggcatc tggggtccca 180

tcgcggttca agggcagtgg atctgggaca cagttcactc tcaccatcaa cggtgtgcag 240

tgtgacgatg ctgccactta ctactgtcaa ggcgcttata gtagtgggga tgttcggact 300

ttcggcggag ggaccgaggt ggtggtcaaa 330

<210> 780

<211> 324

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 780

gagctcgtgc tgacccagac accatcctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtga ggacattgat aggtatttag cctggtatca acagaaacca 120

gggcagcgtc ccaagctcct gatcgtcgat gcatccactc tgccatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatggtg ccacttacta ctgtcaaagc tatgataata gtgataataa tggtttcggc 300

ggagggaccg aggtggtggt caaa 324

<210> 781

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 781

gagctcgatc tgacccagac tccatcctcc gtggaggtag ctgtgggagg cgcagtcacc 60

atcaagtgcc aggccagtca tatcattact aactacttag cctggtatca gcagagacca 120

gggcagcctc ccaagctcct gatctacgat gcatcgaagc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaaac tatctttattttagtagtgg tgattggaat 300

gttttcggcg gagggaccga ggtggtggtc aaa 333

<210> 782

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 782

gagctcgatc tgacccagac tccagcctcc gtgtctgcag ctgtgggagg cacagtcacc 60

atcaattgcc aggccagtga gagcattggc agtgcattag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccgctc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag tacactctca ccatcagcga cttggagtgt 240

gccgatgctg ccacttatta ctgtcaaagt tattatggaa gtggtacgac tgctttagat 300

actttcggcg gagggaccga ggtggaaatc aaa 333

<210> 783

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 783

gagctcgatc tgacccagac tccaggctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccggtca gagcatttac aactacttat cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccactc tggaatctgg ggtcccaccg 180

cggttcagcg gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttactc ctgtcaaaac aattatggta ttggtagtaa ttatggtcct 300

ggtttcggcg gagggaccga ggtggaaatc aaa 333

<210> 784

<211> 327

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 784

gagctcgatc tgacccagac tccagcctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtct gaacattaat agttggttgg cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctcttat acatccagtc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag tacactctca ccatcaacga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaacc acatattttg gtactaatgg tggtggtttc 300

ggcggaggga ccgaggtgga aatcaaa 327

<210> 785

<211> 321

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 785

gagctcgtga tgacccagac accatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

aacaagtgcc aggccagtga ggacatttat agcaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctatggt gcaaccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ttgtcaggcc gaaagtaatg atgtttgggc tttcggcgga 300

gggaccgagg tggtggtcaa a 321

<210> 786

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 786

gagctcgatc tgacccagac accagcctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtga ggatatttat agtaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctacaag gcatccactc tggcatctgg ggtcccaccg 180

cggttcaaag gcagtggatc tgggacagaa tacactctca ccatcagcgg tgtgcagtgt 240

gacgatgctg ccacttacgc ctgtcagact acttattgga ctactactga tgataatcct 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 787

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 787

gagctcgatc tgacccagac tccatcatcc tcgtctgcag ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtca gagtgtttat aataagaact acttatcctg gtttcagcag 120

aaaccagggc agcctcccaa gctcctgatc tattatgctt ccactctggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acagagttca ctctcaccat cagcgatgtg 240

gtgtgtgacg atgctgccac ttactactgt gcagcttata aaggtgttag tgatgatggt 300

atttctttcg gcggagggac cgaggtggaa atcaaa 336

<210> 788

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 788

gagctcgata tgacccagac tccatcctcc gtgtctgcag ctgtgggggg cacagtcacc 60

atcaagtgcc aggccagtca gagcattagt agttactttat cctggtatca gcagaaacca 120

gggcagcctc ccaagcgcct gatctacaag gcatccactc tgccatctgg ggtcccaccg 180

cggtttaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaaac aattatcata gtggtagtag taatggtggt 300

ggttttgctt tcggcggagg gacccaggtg gaaatcaaa 339

<210> 789

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 789

gagctcgatc tgacccagac tccagcctcc gtggaggcag ctgtgagagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattagt tactacttag cctggtatca gcagaaacca 120

gggcagcctc ccaaggtcct gatctacaag gcatccactc tggcatctgg ggtcccaccg 180

cggttcaaag gcagtggatt tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ctgtcaaagc acttatggta gggataataa tgatcttttt 300

ttcgctttcg gcggagggac cgaggtggaa atcaaa 336

<210> 790

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 790

gagctcgatc tgacccagac tccagcctcc gtgtctgcag ctgtggggagg cacggtcacc 60

atcaagtgcc aggccagtca gagtattagt agtagctact tagcctggta tcagcagaaa 120

ccagggcagc ctcccaagct cctgatctat tctgcgtcca gtacggcatc tggggtccca 180

tcgcggttca aaggcagtgg atctgggaca cagttcactc tcaccatcag cgacctggag 240

tgtgccgatg ctgccactta ctactgtcaa agcacttata ttagtagtag taagtatggt 300

gctgttttcg gcggagggac cgagctggaa atcaaa 336

<210> 791

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 791

gagctcgtga tgacccagac tgcatcgccc gtgtctgcag ctgtggggagg cacagtcacc 60

atcagttgcc agtccagtca gagtgtttat agtaacaact ggttatcctg gtatcagcag 120

aaaccagggc agcctcccaa acgcctgatc tacaaggcat ccactctgga aactggggtc 180

ccatcgcggt tcaaaggcag tggatctggg aaacagttca ctctcaccat cagcgacctg 240

gagtgtgacg atgctgccac ttattactgt gcaggcgggt atagtggtga tctttatgct 300

ttcggcggag ggaccgaggt ggtggtcaaa 330

<210> 792

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 792

gagctcgata tgacccagac tccatctccc gtgtctgcag ctgtggggagg ctcagtcacc 60

atcagttgcc aggccagtca gactatttat aataacaaaa atttggcctg gtatcagcag 120

aaaccagggc aacctcccaa gctcctgatc taccaggcat ccaaactggc atctggggtc 180

tcatcgcggt tcagtggcag tggatctggg acacagttca ctctcaccat cagcggcgtg 240

cagtgtgacg atgctgccac ttactactgt caaggcgaat ttagttgtag tagtggtgat 300

tgtactactt tcggcggagg gaccgaggtg gtggtcaaa 339

<210> 793

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 793

gagctcgata tgacccagac tccagcctcc gtgtctgaac ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtga gaacatttat agctacttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacacag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ttgtcaatat agtaatttta gggtgaatga tcctagtgtt 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 794

<211> 351

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 794

gagctcgatc tgacccagac tccagcctcc gtgtctgcag ctgtgggagg cacagtcacc 60

atcagttgcc agtccagtca gagcgttcat catagtcaga ccgttcataa taatcaatgg 120

ttagcctggt atcagcagaa accagggcag cctcccaagc tcctgatcta tgatgcatcc 180

aaactggcat ctggggtccc atcgcggttc acaggtagtg gatctgggac acagttctct 240

ctcaccatca gtgcagtgca gtgtgacgat gctgccactt actactgtca aggcggttat 300

agttatggtg atgtgtatgg tttcggcgga gggaccgagc tggaaatcaa g 351

<210> 795

<211> 342

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 795

gagctcgtgc tgacccagac tccatcttcc acgtctgcgg ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtca aagtgttgat aacaacaaac aattatcctg gtatcagcag 120

aaaccagggc agcctcccaa gcaactgatc tactctgcat ccaaactggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acacagttca ctctcaccat cagcgacctg 240

gagtgtgacg atgctgccac ttaactactgt gcaggctatt attatagtgg tagtgccact 300

gatgcgtggg ctttcggcgg agcgaccgag gtggaaatca ac 342

<210> 796

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 796

gagctcgtga tgacccagac tccatcctcc gtgtctgcag ctgtgggaga cacactcacc 60

atcaattgcc aggccagtga gaccattagt aatagattag cctggtatca acagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccactc tggaatctgg ggtcccatcg 180

cggttcagag gcagtggatc tgggacacag ttcactctca ccataagtga cctggagtgt 240

gccgatgctg ccacttatta ttgtcaaagt attcgtagta gtagtggtgt tgtgcatcca 300

aatactttcg gcggagggac cgaggtggaa atcaaa 336

<210> 797

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 797

gagctcgatc tgacccagac tccatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaccatttat accaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaacctcct gatctatgct gcatccactc tggcatctgg ggtctcatcg 180

cggttcaaag gcagtggatc cgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagc tattatggta gtagtactac tggtaatggt 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 798

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 798

gagctcgtgc tgacccagac accatcttcc aagtctgtcg ctgtgggaga cacagtcacc 60

atcaattgcc aggccagtga taatgtttat agtaataact acacatcctg gtttcagcag 120

aaaccagggc agcctcccaa acaactgctc tattatgcgg cctatcgggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acagagttca ctctctccat cagcgatgtg 240

gtgtgtgacg atgctgccac ttactattgt tcaggccata aagattatag tgatgatggt 300

agtactttcg gcggagggac cgaggtggaa atcaaa 336

<210> 799

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 799

gagctcgtgc tgacccagac accatcttcc aagtctgtcg ctgtgggaga cacagtcacc 60

atcaattgcc aggccagtga taatgtttat agtaataact acacatcctg gtttcagcag 120

aaaccagggc agcctcccaa acaactgctc tattatgcgg cctatcgggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acagagttca ctctctccat cagcgatgtg 240

gtgtgtgacg atgctgccac ttactattgt tcaggccata aagattatag tgatgatggt 300

agtactttcg gcggagggac cgaggtggaa atcaaa 336

<210> 800

<211> 324

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 800

gagctcgtga tgacccagac accagcctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtga ggatattagt agtaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatcagtggt gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagac ttcactctca ccatgagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaggc gcttattatg gtagtagtta tggtttcggg 300

ggagggaccg aggtggtggt caaa 324

<210> 801

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 801

gagctcgtgc tgacccagac accatccccc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaattgcc aggccagtca gagcattagc aatgaattat cctggtatca acagaaacca 120

gggcagcctc ccaagctcct gatctatctg gcatccactc tggattctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacccag ttcactctca ccatcagcga cctggagtgt 240

gccgacgctg ccacttacta ctgtcaaagt cattattatg gtggtagtag tgattatgga 300

tgggctttcg gcggagggac cgaggtggtg gtcaaa 336

<210> 802

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 802

gagctcgata tgacccagac tccatcttcc acgtctgcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca aagtgtttac aataacaacc aattatcctg gtttcagcag 120

aaaccagggc agcctcccaa acgcctgatc tatggtgcat ccactctgga atctggggtc 180

ccatcgcggt tcagcggcag tggatctggg acacagttca ctctcaccat tagtgacctg 240

gagtgtgacg atgctgccac ttactactgt caaggcgctg ttagtagtga ttactatcct 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 803

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 803

gagctcgata tgacccagac accagcctcc gtgtctgaac ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagtattggt agctatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct ggccttttat gcttccactc tgaagtctgg ggtcccaccg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ctgtcaaagt aatcgtctta gtagtagtga cgttaatgct 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 804

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 804

gagctcgtgc tgacccagac tgcatccccc gtgtctggag ctgtggggacacagtcacc 60

atcaagtgcc aggccagtca gaacatttac agcaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctattct gcatccaaac tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag tacactctca ccatcagcgg cgtgcagtgt 240

gaagatgctg ccacttacta ctgtcaaagc tattattata ctgctagtgc tgatactact 300

ttcggcggag ggaccgaggt ggaaatcaaa 330

<210> 805

<211> 324

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 805

gagctcgtgc tgacccagac tccatcctcc gtggaggcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattggt agctacttag cctggtatca gcagaaacca 120

gggcagcctc ccaagctcct gatctacaag gcatccactc tgtcatctgg ggtctcatca 180

cggtacaaag gcagtggatc tgggacagag ttcactctca ccatcagcga cctggagtgt 240

gacgatgctg ccacttacta ctgtcaatat actagttata gtagtggtgg ggctttcggc 300

ggagggaccg aggtggtggt caaa 324

<210> 806

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 806

gagctcgata tgacccagac tccatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gaccatttat accaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaacctcct gatctatgct gcatccactc tggcatctgg ggtctcatcg 180

cggttcaaag gcagtggatc cgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagc tattatggta gtagtactac tggtaatggt 300

ttcggcggag ggaccgaggt ggaaatcaac 330

<210> 807

<211> 339

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 807

gagctcgtga tgacccagac tccagcctct gtgtctgaac ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattagt agttactttat cctggtatca gcagaaacca 120

gggcagcctc ccaagcgcct gatctacaag gcttccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacagag ttcactctca ccatcagcgg cgtgcagtgt 240

gccgatgctg ccacttacta ctgtcaaaac aattatcata gtggtagtag taatggtggt 300

ggttttgctttcggcggagg gaccgaggtg gaaatcaaa 339

<210> 808

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 808

gagctcgtgc tgacccagac tccatcttcc aagtctgtcg ctgtgggaga cacagtcacc 60

atcaattgcc aggccagtga gagtgtttat ggtaacaacc gttgctcctg gtatcagcag 120

aaaccagggc agcctcccaa gctcctgatc taccaggctt ccactctggc ctctggggtc 180

ccatcgcggt tcagcggcag tggatctggg acacagttca ctctcaccat cagcgatgtg 240

gtgtgtgacg atgctgccac ttactactgt gcaggacata aaggaactac taatgatggg 300

aatgatttcg gcggagggac cgaggtggaa atcaaa 336

<210> 809

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 809

gagctcgata tgacccagac tccagcctcc gtgtctgcag ctgtggggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattacc aatgcattag cctggtatca acagaaacca 120

gggcagcctc ccaagctcct gatctacagg gcatccactc tggcatctgg ggtctcatcg 180

cggttcaaag gcagcggatc tgggacagag ttcactctca ccatcagtga ccttgagtgt 240

gccgatgctg ccacttacta ttgtcaatgt agttattatg gtagtactta ttttgggagt 300

cctttcggcg gagggaccga ggtggaaatc aaa 333

<210> 810

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 810

gagctcgtgc tgacccagac tccatcctcc gtgtctgaac ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattagt agtagctact tagcctggta tcagcagaaa 120

ccagggcagc ctcccaagtt cctgatctat tctgcatcca ctctggcatc tggggtccca 180

tcgcggttca aaggcagtgg atctgggaca gagttcactc tcaccatcag cgacctggag 240

tgtgccgatg ctgccactta ctactgtcaa agcacttata ttagtagtag taattatggt 300

gctgctttcg gcggagggac cgaggtggaa atcaaa 336

<210> 811

<211> 327

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 811

gagctcgatc tgacccagac tccatcctcc gtggaggcag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattggt agtaatttag cctggtatca gcagaaacca 120

gggcagcctc ccaaggtcct gatctacaag gcatccactc tggcatctgg ggtcccatcg 180

cggttcaaag gcagtggatc tgggacacag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttatta ctgtcaaaac aataattatt ggagtaatgg taaccatttc 300

ggcggaggga ccgaggtggt ggtcaaa 327

<210> 812

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 812

gagctcgtgc tgacccagac tccatcttcc aagtctgtcg ctgtgggaga cacagtcacc 60

atcaattgcc aggccagtga gaatgtttat agtaataact acacatcctg gtttcagcag 120

aaaccagggc agcctcccaa acaactgctc tattatgcgg cctatcgggc atctggggtc 180

ccatcgcggt tcaaaggcag tggatctggg acagagttca ctctctccat cagcgatgtg 240

gtgtgtgacg atgctgccac ttactattgt tcaggccata aagattatag tgatgatggt 300

agtactttcg gcggagggac cgaggtggtg gtcaaa 336

<210> 813

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 813

gagctcgatc tgacccagac tgcatccccc gtgtctggag ctgtgggagg cacagtcacc 60

atcaagtgcc aggccagtca gagcattgct agcgacttag cctggtatca gcagaaacca 120

gggcagcctc ccaacctcct gatctatgct gcatccactc tggcatctgg ggtctcatcg 180

cggttcaaag gcagtggatc cgggacagag ttcactctca ccatcagcga cctggagtgt 240

gccgatgctg ccacttacta ctgtcaaagc tattatggta gtagtactac tggtaatggt 300

ttcggcggag ggaccgaggt ggtggtcaaa 330

<210> 814

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 814

Glu Leu Asp Met Thr Gln Thr Pro Ala Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Asn Ile Tyr Ser Tyr

20 25 30

Leu Val Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Ser Lys Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Asn Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Thr Asn Tyr Phe Ser Ser Thr

85 90 95

Ser His Phe Gly Val Phe Thr Phe Gly Gly Gly Thr Glu Leu Glu Ile

100 105 110

Lys

<210> 815

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 815

Glu Leu Val Leu Thr Gln Thr Pro Ser Pro Val Ser Ala Val Val Gly

1 5 10 15

Gly Ser Val Thr Ile Asn Cys Gln Ser Ser Gln Ser Leu Tyr Asn Ala

20 25 30

Asn Asp Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Gln

35 40 45

Leu Ile Tyr Trp Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Ser Ile Ser Asp Val

65 70 75 80

Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Leu Gly Glu Phe Ser Cys

85 90 95

Ser Ser Phe Asp Cys His Val Phe Gly Gly Gly Thr Glu Val Val Val

100 105 110

Lys

<210> 816

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 816

Glu Leu Asp Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Asp Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Tyr Arg Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Ser Leu Leu Ile

35 40 45

Tyr Tyr Gly Ser Asp Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Ser Tyr Tyr Cys Gln Thr Thr Tyr Tyr Asp Asp Tyr His

85 90 95

Asn Gly Trp Ala Phe Gly Gly Gly Thr Asn Val Glu Ile Asn

100 105 110

<210> 817

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 817

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Ser Cys Gln Ala Ser Gln Ser Val Tyr Gly Asn

20 25 30

Asn Arg Leu Ala Trp Tyr His Gln Lys Pro Gly Gln Pro Pro Lys Arg

35 40 45

Leu Ile Tyr Leu Ala Ser Thr Leu Asp Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ala Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu

65 70 75 80

Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Ala Gly

85 90 95

Asn Phe Asn Ala Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 818

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 818

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Asn Ile Val Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu Ile

35 40 45

Tyr Tyr Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Ala Gly Ile Tyr Gly

85 90 95

Asn Tyr Gly His Gly Phe Gly Gly Gly Thr Glu Leu Glu Ile Lys

100 105 110

<210> 819

<211> 109

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 819

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Tyr Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly His Ser Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Val Ser Lys Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Asn Thr Val

85 90 95

Ser Phe Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105

<210> 820

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 820

Glu Leu Val Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Ser Cys Gln Ala Ser Gln Ser Val Tyr Asn Asn

20 25 30

Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg

35 40 45

Leu Ile Tyr Ser Ala Ser Thr Leu Asp Ser Gly Val Pro Ser Arg Phe

50 55 60

Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu

65 70 75 80

Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Thr Tyr

85 90 95

Asn Ile Asn Ile Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 821

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 821

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Asn Ile Tyr Asn Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Tyr Ala Ser Thr Leu Ala Ser Gly Val Pro Pro Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Ala Gly Ile Tyr Gly

85 90 95

Gly Tyr Gly His Gly Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 822

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 822

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Thr Ile Gly Ser Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu Ile

35 40 45

Tyr Glu Ala Ser Lys Leu Ala Ser Gly Val Pro Ser Trp Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Asn Tyr Tyr Arg Ala Gly

85 90 95

Gly Asn Tyr Gly Gly Ala Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 823

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 823

Glu Leu Asp Leu Thr Gln Thr Pro Phe Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Glu Thr Ile Ser Asn Arg

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Ile Arg Ser Ser Ser Gly

85 90 95

Ile Val His Pro Asn Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 824

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 824

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Ser Ser Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Thr Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Tyr Ile Ser Ala

85 90 95

Thr Val Asp Asn Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 825

<211> 109

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 825

Glu Leu Asp Leu Thr Gln Thr Pro Thr Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Asp Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Asn Tyr Tyr Gly Ser Gln

85 90 95

Gly Cys Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105

<210> 826

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 826

Glu Leu Asp Met Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Val Lys Cys Gln Val Ser Gln Ser Ile Gly Asn Ala

20 25 30

Ile Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Tyr Tyr Tyr Ser Asn Thr

85 90 95

Asn Ser Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 827

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 827

Glu Leu Asp Met Thr Gln Thr Ala Ser Pro Val Ser Gly Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Asn Ile Tyr Asn Asn

20 25 30

Ile Gly Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Gly Pro Ser Tyr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Arg Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Asp Asp Trp Met Ser Ile

85 90 95

Ser Pro Asp Ile Val Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 828

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 828

Glu Leu Val Met Thr Gln Thr Pro Ser Ser Ser Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Arg

20 25 30

Phe Ala Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu Ile

35 40 45

Tyr Glu Ala Ser Lys Leu Pro Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Ile Tyr Tyr Cys Gln Cys Thr Tyr Tyr Glu Ser Ser

85 90 95

Ser Gly Gly Gly Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 829

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 829

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Val Glu Val Ala Val Gly

1 5 10 15

Gly Ala Val Thr Ile Lys Cys Gln Ala Ser His Ile Ile Thr Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Lys Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Tyr Leu Tyr Phe Ser Ser

85 90 95

Gly Asp Trp Asn Val Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 830

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 830

Glu Leu Val Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Pro Ser Ile Ser Thr Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg Leu Ile

35 40 45

Asn Arg Ala Ser Thr Leu Ala Ser Gly Val Pro Pro Arg Phe Lys Gly

50 55 60

Ser Gly Ala Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Tyr His Ser Gly Ser

85 90 95

Ser Asn Gly Gly Gly Val Ala Phe Gly Gly Gly Thr Glu Val Glu Ile

100 105 110

Lys

<210> 831

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 831

Glu Leu Val Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser Ile Gly Ser Gly

20 25 30

Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

35 40 45

Ile Tyr Leu Ala Ser Thr Leu Ala Ser Gly Val Pro Pro Arg Phe Lys

50 55 60

Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu

65 70 75 80

Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Tyr Thr Tyr Tyr Gly Thr

85 90 95

Thr Tyr Asp Asn Ala Phe Gly Gly Gly Thr Glu Leu Glu Ile Lys

100 105 110

<210> 832

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 832

Glu Leu Asp Leu Thr Gln Thr Pro Ser Pro Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ile Val Ala Asn Gly

20 25 30

Arg Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

35 40 45

Ile Tyr Ala Thr Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys

50 55 60

Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Asn Gly Val Gln

65 70 75 80

Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gly Ala Tyr Ser Ser Gly

85 90 95

Asp Val Arg Thr Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 833

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 833

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Glu Asp Ile Asp Arg Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu Ile

35 40 45

Val Asp Ala Ser Thr Leu Pro Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Gly Ala Thr Tyr Tyr Cys Gln Ser Tyr Asp Asn Ser Asp Asn

85 90 95

Asn Gly Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 834

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 834

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Val Glu Val Ala Val Gly

1 5 10 15

Gly Ala Val Thr Ile Lys Cys Gln Ala Ser His Ile Ile Thr Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Lys Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Tyr Leu Tyr Phe Ser Ser

85 90 95

Gly Asp Trp Asn Val Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 835

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 835

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Glu Ser Ile Gly Ser Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Ala Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Ser Gly Thr

85 90 95

Thr Ala Leu Asp Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 836

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 836

Glu Leu Asp Leu Thr Gln Thr Pro Gly Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Gly Gln Ser Ile Tyr Asn Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Thr Leu Glu Ser Gly Val Pro Pro Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Ser Cys Gln Asn Asn Tyr Gly Ile Gly Ser

85 90 95

Asn Tyr Gly Pro Gly Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 837

<211> 109

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 837

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Leu Asn Ile Asn Ser Trp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Ser Tyr Thr Ser Ser Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Asn Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Thr Thr Tyr Tyr Phe Gly Thr Asn

85 90 95

Gly Gly Gly Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105

<210> 838

<211> 107

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 838

Glu Leu Val Met Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Asn Lys Cys Gln Ala Ser Glu Asp Ile Tyr Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Thr Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ala Glu Ser Asn Asp Val Trp

85 90 95

Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 839

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 839

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Glu Asp Ile Tyr Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Pro Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Gly Val Gln Cys

65 70 75 80

Asp Asp Ala Ala Thr Tyr Ala Cys Gln Thr Thr Tyr Trp Thr Thr Thr

85 90 95

Asp Asp Asn Pro Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 840

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 840

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Ser Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser Val Tyr Asn Lys

20 25 30

Asn Tyr Leu Ser Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu

35 40 45

Leu Ile Tyr Tyr Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Val

65 70 75 80

Val Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Ala Tyr Lys Gly Val

85 90 95

Ser Asp Asp Gly Ile Ser Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 841

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 841

Glu Leu Asp Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Ser Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Pro Ser Gly Val Pro Pro Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Tyr His Ser Gly Ser

85 90 95

Ser Asn Gly Gly Gly Phe Ala Phe Gly Gly Gly Thr Gln Val Glu Ile

100 105 110

Lys

<210> 842

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 842

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Glu Ala Ala Val Arg

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Tyr Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Val Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Pro Arg Phe Lys Gly

50 55 60

Ser Gly Phe Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Thr Tyr Gly Arg Asp Asn

85 90 95

Asn Asp Leu Phe Phe Ala Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 843

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 843

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Ser Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu

35 40 45

Ile Tyr Ser Ala Ser Ser Thr Ala Ser Gly Val Pro Ser Arg Phe Lys

50 55 60

Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu

65 70 75 80

Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Thr Tyr Ile Ser Ser

85 90 95

Ser Lys Tyr Gly Ala Val Phe Gly Gly Gly Thr Glu Leu Glu Ile Lys

100 105 110

<210> 844

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 844

Glu Leu Val Met Thr Gln Thr Ala Ser Pro Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Ser Cys Gln Ser Ser Gln Ser Val Tyr Ser Asn

20 25 30

Asn Trp Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg

35 40 45

Leu Ile Tyr Lys Ala Ser Thr Leu Glu Thr Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Lys Gln Phe Thr Leu Thr Ile Ser Asp Leu

65 70 75 80

Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Gly Gly Tyr Ser Gly

85 90 95

Asp Leu Tyr Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 845

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 845

Glu Leu Asp Met Thr Gln Thr Pro Ser Pro Val Ser Ala Ala Val Gly

1 5 10 15

Gly Ser Val Thr Ile Ser Cys Gln Ala Ser Gln Thr Ile Tyr Asn Asn

20 25 30

Lys Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu

35 40 45

Leu Ile Tyr Gln Ala Ser Lys Leu Ala Ser Gly Val Ser Ser Arg Phe

50 55 60

Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Gly Val

65 70 75 80

Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gly Glu Phe Ser Cys

85 90 95

Ser Ser Gly Asp Cys Thr Thr Phe Gly Gly Gly Thr Glu Val Val Val

100 105 110

Lys

<210> 846

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 846

Glu Leu Asp Met Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Glu Asn Ile Tyr Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Tyr Ser Asn Phe Arg Val Asn

85 90 95

Asp Pro Ser Val Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 847

<211> 117

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 847

Glu Leu Asp Leu Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Ser Cys Gln Ser Ser Gln Ser Val His His Ser

20 25 30

Gln Thr Val His Asn Asn Gln Trp Leu Ala Trp Tyr Gln Gln Lys Pro

35 40 45

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Lys Leu Ala Ser

50 55 60

Gly Val Pro Ser Arg Phe Thr Gly Ser Gly Ser Gly Thr Gln Phe Ser

65 70 75 80

Leu Thr Ile Ser Ala Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys

85 90 95

Gln Gly Gly Tyr Ser Tyr Gly Asp Val Tyr Gly Phe Gly Gly Gly Thr

100 105 110

Glu Leu Glu Ile Lys

115

<210> 848

<211> 114

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 848

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Thr Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser Val Asp Asn Asn

20 25 30

Lys Gln Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Gln

35 40 45

Leu Ile Tyr Ser Ala Ser Lys Leu Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu

65 70 75 80

Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Gly Tyr Tyr Tyr Ser

85 90 95

Gly Ser Ala Thr Asp Ala Trp Ala Phe Gly Gly Ala Thr Glu Val Glu

100 105 110

Ile Asn

<210> 849

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 849

Glu Leu Val Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly

1 5 10 15

Asp Thr Leu Thr Ile Asn Cys Gln Ala Ser Glu Thr Ile Ser Asn Arg

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Arg Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Ile Arg Ser Ser Ser Gly

85 90 95

Val Val His Pro Asn Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 850

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 850

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Thr Ile Tyr Thr Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Ser Ser Thr

85 90 95

Thr Gly Asn Gly Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 851

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 851

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Lys Ser Val Ala Val Gly

1 5 10 15

Asp Thr Val Thr Ile Asn Cys Gln Ala Ser Asp Asn Val Tyr Ser Asn

20 25 30

Asn Tyr Thr Ser Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro Lys Gln

35 40 45

Leu Leu Tyr Tyr Ala Ala Tyr Arg Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Ser Ile Ser Asp Val

65 70 75 80

Val Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ser Gly His Lys Asp Tyr

85 90 95

Ser Asp Asp Gly Ser Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 852

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 852

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Lys Ser Val Ala Val Gly

1 5 10 15

Asp Thr Val Thr Ile Asn Cys Gln Ala Ser Asp Asn Val Tyr Ser Asn

20 25 30

Asn Tyr Thr Ser Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro Lys Gln

35 40 45

Leu Leu Tyr Tyr Ala Ala Tyr Arg Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Ser Ile Ser Asp Val

65 70 75 80

Val Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ser Gly His Lys Asp Tyr

85 90 95

Ser Asp Asp Gly Ser Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 853

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 853

Glu Leu Val Met Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Glu Asp Ile Ser Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Ser Gly Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Met Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gly Ala Tyr Tyr Gly Ser Ser

85 90 95

Tyr Gly Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 854

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 854

Glu Leu Val Leu Thr Gln Thr Pro Ser Pro Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser Ile Ser Asn Glu

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Leu Ala Ser Thr Leu Asp Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser His Tyr Tyr Gly Gly Ser

85 90 95

Ser Asp Tyr Gly Trp Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 855

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 855

Glu Leu Asp Met Thr Gln Thr Pro Ser Ser Thr Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Val Tyr Asn Asn

20 25 30

Asn Gln Leu Ser Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg

35 40 45

Leu Ile Tyr Gly Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe

50 55 60

Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu

65 70 75 80

Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gly Ala Val Ser Ser

85 90 95

Asp Tyr Tyr Pro Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 856

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 856

Glu Leu Asp Met Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ala

35 40 45

Phe Tyr Ala Ser Thr Leu Lys Ser Gly Val Pro Pro Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Asn Arg Leu Ser Ser Ser

85 90 95

Asp Val Asn Ala Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 857

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 857

Glu Leu Val Leu Thr Gln Thr Ala Ser Pro Val Ser Gly Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Asn Ile Tyr Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Ala Ser Lys Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Gly Val Gln Cys

65 70 75 80

Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Tyr Thr Ala Ser

85 90 95

Ala Asp Thr Thr Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 858

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 858

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ser Ser Gly Val Ser Ser Arg Tyr Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Tyr Thr Ser Tyr Ser Ser Gly

85 90 95

Gly Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 859

<211> 113

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 859

Glu Leu Val Met Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Ser Tyr

20 25 30

Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Arg Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Gly Val Gln Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Tyr His Ser Gly Ser

85 90 95

Ser Asn Gly Gly Gly Phe Ala Phe Gly Gly Gly Thr Glu Val Glu Ile

100 105 110

Lys

<210> 860

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 860

Glu Leu Asp Met Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Thr Ile Tyr Thr Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Ser Ser Thr

85 90 95

Thr Gly Asn Gly Phe Gly Gly Gly Thr Glu Val Glu Ile Asn

100 105 110

<210> 861

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 861

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Lys Ser Val Ala Val Gly

1 5 10 15

Asp Thr Val Thr Ile Asn Cys Gln Ala Ser Glu Ser Val Tyr Gly Asn

20 25 30

Asn Arg Cys Ser Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu

35 40 45

Leu Ile Tyr Gln Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Val

65 70 75 80

Val Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ala Gly His Lys Gly Thr

85 90 95

Thr Asn Asp Gly Asn Asp Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 862

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 862

Glu Leu Asp Met Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Thr Asn Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys Ser Tyr Tyr Gly Ser Thr

85 90 95

Tyr Phe Gly Ser Pro Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 863

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 863

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Val Ser Glu Pro Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ser Ser Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Phe Leu

35 40 45

Ile Tyr Ser Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys

50 55 60

Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu

65 70 75 80

Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Thr Tyr Ile Ser Ser

85 90 95

Ser Asn Tyr Gly Ala Ala Phe Gly Gly Gly Thr Glu Val Glu Ile Lys

100 105 110

<210> 864

<211> 109

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 864

Glu Leu Asp Leu Thr Gln Thr Pro Ser Ser Val Glu Ala Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Gly Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Val Leu Ile

35 40 45

Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Asn Asn Asn Tyr Trp Ser Asn

85 90 95

Gly Asn His Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105

<210> 865

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 865

Glu Leu Val Leu Thr Gln Thr Pro Ser Ser Lys Ser Val Ala Val Gly

1 5 10 15

Asp Thr Val Thr Ile Asn Cys Gln Ala Ser Glu Asn Val Tyr Ser Asn

20 25 30

Asn Tyr Thr Ser Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro Lys Gln

35 40 45

Leu Leu Tyr Tyr Ala Ala Tyr Arg Ala Ser Gly Val Pro Ser Arg Phe

50 55 60

Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Ser Ile Ser Asp Val

65 70 75 80

Val Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Ser Gly His Lys Asp Tyr

85 90 95

Ser Asp Asp Gly Ser Thr Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 866

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 866

Glu Leu Asp Leu Thr Gln Thr Ala Ser Pro Val Ser Gly Ala Val Gly

1 5 10 15

Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Ala Ser Asp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe Lys Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys

65 70 75 80

Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Ser Ser Thr

85 90 95

Thr Gly Asn Gly Phe Gly Gly Gly Thr Glu Val Val Val Lys

100 105 110

<210> 867

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic antibody sequences

<400> 867

Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Thr Ile Tyr Thr Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Ser Tyr Tyr Gly Ser Ser Thr

85 90 95

Thr Gly Asn Gly Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105 110

<210> 868

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 868

His Ile Ile Thr Asn Tyr

1 5

<210> 869

<211> 3

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 869

Asp Ala Ser

1

<210> 870

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 870

Gln Asn Tyr Leu Tyr Phe Ser Ser Gly Asp Trp Asn Val

1 5 10

<210> 871

<211> 384

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 871

gaagtgcagc tggtggagag cggcggcggt ctggtacaac cgggcggcag cctgagactg 60

agctgcgccg ctagcggctt cagcttcagc agcagctact gcatgtgctg ggtgagacaa 120

gcccccggca agggcctgga gtgggtgagc tgcatctaca ccgacagcag cggcgccacc 180

tactacgcta gctgggccaa gggcagattc accatcagca gacacaacag caagaacacc 240

ctgtacctgc agatgaacag cctgagagcc gaggacaccg ccgtgtacta ctgcgctaga 300

ggctgggact acgaggaccc cggctacacc gacaccacct acttcagcct gtggggcaga 360

ggcaccctgg tgaccgtgag cagc 384

<210> 872

<211> 384

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 872

gaagtgcagc tggtggagag cggcggcggt ctggtacaac cgggcggcag cctgagactg 60

agctgcgccg ctagcggctt cagcttcagc agcagctact gcatgtgctg ggtgagacaa 120

gcccccggca agggcctgga gctggtgagc tgcatctaca ccgacagcag cggcgccacc 180

tactacgcta gctgggccaa gggcagattc accatcagca gacacaacag caagaacacc 240

ctgtacctgc agatgaacag cctgagagcc gaggacaccg ccgtgtacta ctgcgctaga 300

ggctgggact acgaggaccc cggctacacc gacaccacct acttcagcct gtggggcaga 360

ggcaccctgg tgaccgtgag cagc 384

<210> 873

<211> 384

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 873

gaagtgcagc tggtggagag cggcggcggt ctggtacaac cgggcggcag cctgagactg 60

agctgcgccg ctagcggctt cagcttcagc agcagctaca gcatgagctg ggtgagacaa 120

gcccccggca agggcctgga gtgggtgagc agcatctaca ccgacagcag cggcgccacc 180

tactacgcta gctgggccaa gggcagattc accatcagca gacacaacag caagaacacc 240

ctgtacctgc agatgaacag cctgagagcc gaggacaccg ccgtgtacta ctgcgctaga 300

ggctgggact acgaggaccc cggctacacc gacaccacct acttcagcct gtggggcaga 360

ggcaccctgg tgaccgtgag cagc 384

<210> 874

<211> 128

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 874

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Tyr Ser Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

35 40 45

Val Ser Ser Ile Tyr Thr Asp Ser Ser Gly Ala Thr Tyr Tyr Ala Ser

50 55 60

Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg His Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Gly Trp Asp Tyr Glu Asp Pro Gly Tyr Thr Asp Thr

100 105 110

Thr Tyr Phe Ser Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 875

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic Antibodies

<400> 875

gacattcagc tgacacagag ccctagcttc ctgagcgcta gcgtgggcga cagagtgacc 60

atcacctgcc aagcctctca gaccatctac accaacctgg cctggtatca gcagaagccc 120

ggcaaagccc ccaagctgct gatatacgcc gctagcaccc tggcgagcgg cgtgcctagc 180

agattcagcg gcagcggcag cggcaccgag ttcaccctga ccatcagcag cctgcagccc 240

gaggacttcg ccacctacta ctgtcagagc tactacggca gcagcaccac cggcaacggc 300

ttcggcggcg gcaccaaggt ggagatcaag 330

Claims (72)

1. An isolated monoclonal antibody or antigen-binding fragment thereof, comprising: a heavy chain (HC) variable region (VH) and a light chain (LC) variable region (VL), wherein the VH and the VL comprise the clone-paired CDR sequences shown in Tables 1 and 3; and variants thereof, wherein one or more of the HC-CDR and/or LC-CDR has one, two or three amino acid substitutions, additions, deletions or a combination thereof. 2. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the isolated monoclonal antibody is a murine antibody, a rodent antibody, a rabbit antibody, a chimeric antibody, a humanized antibody or a human antibody. 3. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the antigen-binding fragment is a recombinant ScFv (single-chain fragment variable) antibody, a Fab fragment, a F(ab')2 fragment or a Fv fragment. 4. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the isolated monoclonal antibody is a human antibody. 5. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the VH chain and the VL chain have an amino acid sequence that is at least 90% or 95% identical to the sequence of the clone pair of Table 6 and Table 8, respectively. 6. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 5, wherein the VH chain and the VL chain have amino acid sequences identical to the sequences of the clone pairs of Tables 6 and 8, respectively. 7. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the VH chain and the VL chain are encoded by nucleic acid sequences that are at least 80% or 90% identical to the sequences of the clone pairs of Tables 5 and 7, respectively. 8. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 7, wherein the VH chain and the VL chain are encoded by nucleic acid sequences identical to the sequences of the clone pairs of Tables 5 and 7, respectively. 9. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the isolated monoclonal antibody is a humanized antibody. 10. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 9, wherein the humanized antibody has a VH chain and a VL chain, and the VH chain and the VL chain have an amino acid sequence that is at least 90% or 95% identical to the sequence of the clone pairing of Hu-176 VH-1 and Hu-176-K as shown in Tables 6 and 8, respectively. 11. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 10, wherein the VH chain and the VL chain have amino acid sequences identical to the sequences of the clone pairs of Hu-176 VH-1 and Hu-176-K as shown in Tables 6 and 8, respectively. 12. The isolated monoclonal antibody or antigen-binding fragment thereof of claim 9, wherein the humanized antibody has a VH chain and a VL chain having an amino acid sequence that is at least 90% or 95% identical to the sequences of the clone pairings of Hu-176 VH-1 (W48L) and Hu-176-K as shown in Tables 6 and 8, respectively. 13. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 10, wherein the VH chain and the VL chain have an amino acid sequence identical to the sequence of the clone pairing of Hu-176 VH-1 (W48L) and Hu-176-K as shown in Tables 6 and 8, respectively. 14. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 13, comprising an IgG Fc region comprising an amino acid modification in one or more of amino acid positions 234, 235, 297 and 329. 15. The isolated monoclonal antibody or antigen-binding fragment thereof of claim 14, wherein the IgG Fc region comprises an amino acid substitution N to A at amino acid position 297. 16. The isolated monoclonal antibody or antigen-binding fragment thereof of claim 14, wherein the IgG Fc region comprises an amino acid substitution at amino acid position 234 of L to A, an amino acid substitution at amino acid position 235 of L to A, and an amino acid substitution at amino acid position 329 of P to G. 17. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, wherein the antibody is a chimeric antibody. 18. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, which induces activation of LILRB1. 19. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, which inhibits activation of LILRB1. 20. An isolated monoclonal antibody or antigen-binding fragment thereof that competes for binding to the same epitope as the isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 19. 21. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to an epitope on LILRB1 recognized by the antibody of any one of claims 1 to 20. 22. An isolated monoclonal antibody or antigen-binding fragment thereof, wherein when bound to LILRB1, the monoclonal antibody binds to residues Y76 and R84 of LILRB1. 23. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, wherein the antibody or fragment thereof is conjugated or fused to an imaging agent or a cytotoxic agent. 24. The isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, wherein the antibody or fragment thereof is labeled. 25. The isolated monoclonal antibody or antigen-binding fragment thereof according to claim 24, wherein the label is a fluorescent label, an enzymatic label or a radioactive label. 26. A pharmaceutical composition comprising the isolated monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 25 and a pharmaceutically acceptable carrier. 27. An isolated nucleic acid encoding the isolated monoclonal antibody of any one of claims 1 to 22. 28. A vector comprising the isolated nucleic acid according to claim 27. 29. A host cell comprising the vector according to claim 28. 30. The host cell of claim 29, wherein the host cell is a mammalian cell. 31. The host cell of claim 29, wherein the host cell is a CHO cell. 32. A hybridoma or engineered cell encoding and/or producing the isolated monoclonal antibody according to any one of claims 1 to 22. 33. A method of producing an antibody, the method comprising culturing the host cell according to claim 29 under conditions suitable for expression of the antibody and recovering the antibody. 34. A chimeric antigen receptor (CAR) protein comprising an antigen binding fragment according to any one of claims 1 to 22. 35. An isolated nucleic acid encoding the CAR protein according to claim 34. 36. A vector comprising the isolated nucleic acid according to claim 35. 37. An engineered cell comprising the isolated nucleic acid of claim 35. 38. The engineered cell of claim 37, wherein the cell is a T cell, a NK cell, or a macrophage. 39. A method of treating cancer in a subject or ameliorating the effects of cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 or the engineered cell according to claim 37 or 38. 40. The method of claim 39, wherein the method reduces or eradicates tumor burden in the subject. 41. The method of claim 39, wherein the method reduces the number of tumor cells. 42. The method of claim 39, wherein the method reduces tumor size. 43. The method of claim 39, wherein the method reduces or prevents tumor metastasis. 44. The method of claim 39, wherein the method eradicates a tumor in the subject. 45. The method of claim 39, wherein the subject's NK cells have been identified as expressing LILRB1. 46. The method of claim 45, wherein the subject's NK cells have been identified as expressing increased levels of LILRB1 relative to a reference level. 47. The method of claim 39, wherein the cancer is a solid cancer. 48. The method of claim 47, wherein the solid cancer is selected from the group consisting of adrenal cancer, bile duct cancer, bone cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, colorectal cancer, esophageal cancer, eye cancer, gastric cancer, glioblastoma, head and neck cancer, kidney cancer, liver cancer, lung cancer, mesothelioma, melanoma, Merkel cell carcinoma, nasopharyngeal carcinoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pineal tumor, prostate cancer, renal cell carcinoma, retinoblastoma, sarcoma, skin cancer, testicular cancer, thymic cancer, thyroid cancer, uterine cancer, and vaginal cancer. 49. The method of claim 39, wherein monocytes, macrophages, dendritic cells, neutrophils and other myeloid cells, myeloid-derived suppressor cells and tumor-associated macrophages are targeted. 50. The method of claim 39, wherein the cancer is a hematological malignancy. 51. The method of claim 50, wherein the hematologic malignancy is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), B cell leukemia, chronic lymphocytic leukemia (CLL), blastic plasmacytoid dendritic cell neoplasm (BPDCN), chronic myelomonocytic leukemia (CMML), chronic myeloid leukemia (CML), pre-B acute lymphocytic leukemia (pre-B ALL), diffuse large B-cell lymphoma (DLBCL), extranodal NK/T-cell lymphoma, hairy cell leukemia, heavy chain disease, HHV8-related primary effusion lymphoma, plasmablastic lymphoma, primary CNS lymphoma, primary mediastinal large B-cell lymphoma, T-cell/histiocyte-rich B-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma (MM), myelodysplastic syndrome (MDS), myeloproliferative neoplasms, and polycythemia vera. 52. The method of claim 51, wherein the subject's myeloma cells have been identified as not expressing LILRB1. 53. The method of claim 39, wherein the antibody or antigen-binding fragment thereof is administered intravenously, intraarterially, intratumorally, or subcutaneously. 54. The method of claim 39, further comprising administering to the subject one or more drugs selected from the group consisting of: topoisomerase inhibitors, anthracycline topoisomerase inhibitors, anthracyclines, daunorubicin, nucleoside metabolism inhibitors, cytarabine, hypomethylating agents, low-dose cytarabine (LDAC), a combination of daunorubicin and cytarabine, daunorubicin and cytarabine liposomes for injection, Azacytidine, Decitabine, all-trans retinoic acid (ATRA), arsenic, arsenic trioxide, histamine dihydrochloride, Interleukin-2, Aldesleukin, Gemtuzumab, FLT-3 inhibitors, midostaurin, Clofarabine, farnesyl transferase inhibitors, decitabine, IDH1 inhibitors, ivosidenib, IDH2 inhibitors, etanercept, Smoothened (SMO) inhibitors, gradizib, arginase inhibitors, IDO inhibitors, icadolstat, BCL-2 inhibitors, venetoclax, Platinum complex derivatives, oxaliplatin, kinase inhibitors, tyrosine kinase inhibitors, PI3 kinase inhibitors, BTK inhibitors, ibrutinib, Acalabrutinib, Zambutinib, PD-1 antibody, PD-L1 antibody, CTLA-4 antibody, LAG3 antibody, ICOS antibody, TIGIT antibody, TIM3 antibody, CD40 antibody, 4-1BB antibody, CD47 antibody, SIRP1α antibody or fusion protein, CD70 antibody and CLL1 antibody, CD123 antibody, antagonist of E-selectin, antibody binding to tumor antigen, antibody binding to T cell surface marker, antibody binding to myeloid cell or NK cell surface marker, alkylating agent, nitrosourea agent, antimetabolite, antitumor antibiotic, alkaloid derived from plant, hormone therapy drug, hormone antagonist, aromatase inhibitor and P-glycoprotein inhibitor. 55. The method of any one of claims 39 to 54, wherein the isolated monoclonal antibody or antigen-binding fragment thereof further comprises an anti-tumor drug attached thereto. 56. The method of claim 55, wherein the anti-tumor drug is linked to the antibody via a photolabile linker. 57. The method of claim 55, wherein the anti-tumor drug is linked to the antibody via an enzymatically cleavable linker. 58. The method of claim 55, wherein the anti-tumor drug is a toxin, a radioisotope, a cytokine, or an enzyme. 59. A method for detecting cancer cells or cancer stem cells in a sample or a subject, the method comprising: (a) contacting a subject or a sample from the subject with the antibody or antigen-binding fragment thereof according to any one of claims 1 to 25; and (b) detecting binding of the antibody to cancer cells or cancer stem cells in the subject or sample. 60. The method of claim 59, wherein the sample is a body fluid or a biopsy. 61. The method of claim 59, wherein the sample is blood, bone marrow, sputum, tears, saliva, mucus, serum, urine, or feces. 62. The method of claim 59, wherein detecting comprises immunohistochemistry, flow cytometry, immunoassay (including ELISA, RIA, etc.), or Western blot. 63. The method of claim 59, further comprising: performing steps (a) and (b) a second time; and determining a change in the detected level compared to the first time. 64. The method of claim 59, wherein the isolated monoclonal antibody or antigen-binding fragment thereof further comprises a label. 65. The method of claim 64, wherein the label is a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemiluminescent molecule or a dye. 66. The method of any one of claims 39 to 65, wherein the isolated monoclonal antibody or antigen-binding fragment thereof is conjugated to a liposome or a nanoparticle. 67. A method of treating an autoimmune disease in a subject or ameliorating the effects of an autoimmune disease in a subject, the method comprising administering to the subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 or the engineered cell according to claim 37 or 38. 68. The method of claim 67, wherein monocytes, macrophages, dendritic cells, neutrophils and/or other myeloid cells are targeted. 69. The method of claim 67, wherein the antibody or antigen-binding fragment thereof is administered intravenously, intraarterially, intratumorally, or subcutaneously. 70. The method of claim 67, further comprising administering to the subject one or more drugs selected from the group consisting of steroids or NSAIDs. 71. The method of claim 67, wherein the autoimmune disease is Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy, ankylosing spondylitis, psoriatic arthritis, enteropathic arthritis, reactive arthritis, undifferentiated spondyloarthropathy, juvenile spondyloarthropathy, Behcet's disease, enthesitis, ulcerative colitis, Crohn's disease, irritable bowel syndrome, inflammatory bowel disease, fibromyalgia, chronic fatigue syndrome, painful conditions associated with systemic inflammatory diseases, systemic lupus erythematosus, Sjögren's syndrome, rheumatoid arthritis, juvenile rheumatoid arthritis, juvenile-onset diabetes ( also known as type I diabetes), Wegener's granulomatosis, polymyositis, dermatomyositis, inclusion body myositis, multiple endocrine failure, Schmidt's syndrome, autoimmune uveitis, Addison's disease, Grave's disease, Hashimoto's thyroiditis, autoimmune thyroid disease, pernicious anemia, gastric atrophy, chronic hepatitis, lupus hepatitis, atherosclerosis, multiple sclerosis, amyotrophic lateral sclerosis, hypoparathyroidism, Dressler's syndrome, myasthenia gravis, Eaton-Lambert syndrome, autoimmune thrombocytopenia, idiopathic thrombocytopenic purpura, hemolytic anemia, pemphigus vulgaris, Herpes, dermatitis herpetiformis, alopecia, scleroderma, progressive systemic sclerosis, CREST syndrome (calcification, Raynaud's phenomenon, esophageal dysmotility, sclerodactyly, and telangiectasia), adult-onset diabetes mellitus (also called type II diabetes), mixed connective tissue disease, polyarteritis nodosa, systemic necrotizing vasculitis, glomerulonephritis, atopic dermatitis, atopic rhinitis, Goodpasture's syndrome, Chagas' disease, sarcoidosis, rheumatic fever, asthma, antiphospholipid syndrome, erythema multiforme, Cushing's syndrome, autoimmune chronic active hepatitis, allergic diseases, allergic encephalomyelitis, transfusion reaction leprosy, malaria, leishmaniasis, trypanosomiasis, Takayasu's arteritis, polymyalgia rheumatica, temporal arteritis, schistosomiasis, giant cell arteritis, eczema, lymphomatoid granulomatosis, Kawasaki disease, endophthalmitis, psoriasis, erythroblastosis fetalis, eosinophilic fasciitis, Schulman's syndrome, Felty's syndrome, Fuchs' cyclitis, IgA nephropathy, Henlein-Schuh purpura, graft-versus-host disease, transplant rejection, tularemia, periodic fever syndromes, septic arthritis, familial Mediterranean fever, TNF receptor-associated periodic syndrome (TRAPS), Mueller-Weiss syndrome, or hyper-IgD syndrome. 72. A method for increasing the immune function of NK cells of a subject, the method comprising administering to the subject an antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 or an engineered cell according to claim 37 or 38.