CN116987666A - Preparation of therapeutic NK cells targeting STING pathway - Google Patents

Preparation of therapeutic NK cells targeting STING pathway Download PDF

Info

Publication number
CN116987666A
CN116987666A CN202311114635.XA CN202311114635A CN116987666A CN 116987666 A CN116987666 A CN 116987666A CN 202311114635 A CN202311114635 A CN 202311114635A CN 116987666 A CN116987666 A CN 116987666A
Authority
CN
China
Prior art keywords
cells
sting
cell
sting pathway
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311114635.XA
Other languages
Chinese (zh)
Inventor
邓刘福
路璐
杨超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202311114635.XA priority Critical patent/CN116987666A/en
Publication of CN116987666A publication Critical patent/CN116987666A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/01—Modulators of cAMP or cGMP, e.g. non-hydrolysable analogs, phosphodiesterase inhibitors, cholera toxin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2315—Interleukin-15 (IL-15)

Abstract

The invention relates to a preparation method for enhancing therapeutic NK cell function and application thereof in treating cancers. Specifically, the invention provides a method for preparing therapeutic NK cells by taking a cGAS-STING pathway protein or gene as a target, and activating the cGAS-STING pathway enables the NK cells to have stronger IFN-gamma secretion capacity and stronger anti-tumor effect.

Description

Preparation of therapeutic NK cells targeting STING pathway
Technical Field
The invention relates to the field of biology, in particular to application of STING protein or gene as a target in preparation of therapeutic NK cells.
Background
NK cell therapy is becoming a new direction for tumor immunotherapy. With further exploration of the molecular characteristics and functions of NK cells, development of targeted immunotherapy based on NK cells will become a new breakthrough in tumor immunotherapy. The NK cell therapy has the advantages of capability of directly killing tumors, small toxic and side effects and wide sources, and is convenient for preparing a large amount of spot-type NK. However, how to increase infiltration of NK cells, promote activation of NK cells, increase persistence of NK cells in vivo, and enhance targeting of tumor cells is a clinical challenge. NK cells can be activated by several different modes, including participation of stimulatory receptors, in combination with IL-12, IL-15 And IL-18 cytokines, and stimulate RNA induction (Nat Rev Clin Oncol 18,85-100,2021;J Exp Med 209,2351-2365,2012). Interestingly, memory-like NK cells were defined as a subset (Immunity 43,634-645,2015;Trends Immunol 37,877-888.2016;Nat Rev Immunol 16,112-123,2016) corresponding to T and B cells of adaptive immune memory. NK cells with memory-like phenotype exhibit the characteristic of high expression of the transcription factor TCF-1 (Nat Immunol 21,274-286,2020;Cell Rep 20,613-626,2017. Stimulation of immature NK cells with cytokine cocktails containing IL-12, IL-18 and IL-15 can induce their differentiation into memory-like NK cells, which in Chimeric Antigen Receptor (CAR) -NK therapy has also been shown to enhance the anti-tumor response of CAR-NK cells (Sci Transl Med 8,357ra123,2016;Blood 136,2308-2318,2020.) in humans, NK cells are divided into two major subgroups: CD56 dim CD16 + Cytotoxic NK cells and CD56 hi CD16 - NK cells secreted by cytokines. Pre-activation of CD56 in PBMCs with IL-15 hi NK cells can enhance their anti-tumor response (J Clin Invest 127,4042-4058,2017). Thus, understanding the molecular mechanisms that maintain a sustained NK cell response would provide a powerful basis for designing NK cell-based cancer immunotherapy.
The cGAS-STING (Cyclic GMP-AMP synthase-stimulator of interferon genes) pathway is an important bridge for DNA damage and immune system response, and its associated regulatory network in tumor immunity is a hotspot and difficulty of current research, and is expected to become a new generation of immunotherapeutic targets. The action mechanism is as follows: cytoplasmic free dsDNA was recognized by cGAS findings, producing a second messenger cGAMP, which in turn activates STING adaptor proteins, inducing the production of type I interferon by recruiting TBK1 to activate IRF3 to form a protein complex. At present, the research of the cGAS-STING pathway is mainly focused on tumor cells and antigen presenting cells, and the cGAS-STING agonist is found to be important in the processes of anti-tumor immunity, cell aging, inflammatory diseases, virus infection and the like, and simultaneously, the STING agonist can regulate the 'dryness' of T cells so as to promote more durable anti-tumor effect. However, it is not known which effect is exerted in NK cells, and whether a better antitumor effect can be obtained by a combination of STING agonist and NK cell therapy is not known.
Disclosure of Invention
The invention overcomes the defects of the prior art and provides a preparation method for enhancing the function of therapeutic NK cells, maintaining the differentiation state and improving the lasting killing activity of the NK cells.
In one aspect, the invention provides a composition comprising a STING pathway agonist and a cytokine,
in one or more embodiments, the STING pathway agonist is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein, or a coding sequence thereof.
In one or more embodiments, the STING pathway agonist is a protein of the STING pathway, or a variant thereof, or a coding sequence thereof; preferably, the protein of the STING pathway is selected from STING, cGAS, or variants thereof.
In one or more embodiments, the agonist is a cyclic dinucleotide compound.
In one or more embodiments, the agonist is cGAMP, c-di-AMP, or c-di-GMP.
In one or more embodiments, the cytokine is IL-15.
In one or more embodiments, the concentration of IL-15 is 1-50ng/mL, preferably 5-20ng/mL.
In one or more embodiments, the concentration of cGAMP is in the range of 0.2 to 5 μm, preferably 1 to 2 μm.
The invention also provides a kit comprising a STING pathway agonist and a cytokine.
In one or more embodiments, the STING pathway agonist is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein, or a coding sequence thereof.
In one or more embodiments, the protein is a protein of the STING pathway or variant thereof, preferably including STING, cGAS, or variants thereof.
In one or more embodiments, the amino acid sequence of STING protein is as set forth in SEQ ID No. 1, and variants thereof have any one or more mutations selected from the group consisting of: H72N, F153V, V147L, N S, V155M, G158A, G166E, C206Y, G207E, R281Q, R281W, R284G, R S.
In one or more embodiments, the amino acid sequence of STING protein is as set forth in SEQ ID No. 2, and variants thereof have any one or more mutations selected from the group consisting of: N153S, V M.
In one or more embodiments, the agonist is a cyclic dinucleotide compound.
In one or more embodiments, the agonist is cGAMP, c-di-AMP, or c-di-GMP.
In one or more embodiments, the cytokine is IL-15.
In one or more embodiments, the kit further comprises a medium suitable for culturing NK cells. The NK cells are selected from NK cells or NK92 cell lines derived from mammalian peripheral blood, primary hematopoietic stem or progenitor cells or Induced Pluripotent Stem Cells (iPSCs). Preferably, the medium comprises RPMI 1640 complete medium.
The invention also provides application of STING pathway agonist and cytokine in preparation of NK cell-containing reagent.
In one or more embodiments, the STING pathway agonist is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein, or a coding sequence thereof.
In one or more embodiments, the protein is a protein of the STING pathway or variant thereof, preferably including STING, cGAS, or variants thereof.
In one or more embodiments, the agonist is a cyclic dinucleotide compound.
In one or more embodiments, the agonist is cGAMP, c-di-AMP, or c-di-GMP.
In one or more embodiments, the cytokine is IL-15.
In one or more embodiments, the NK cells are derived from mammalian peripheral blood, primary hematopoietic stem or progenitor cells, or induced pluripotent stem cells (ipscs).
In one or more embodiments, the NK cells are used in immune cell therapy; preferably, the NK cells are used to treat cancers, including but not limited to primary or metastatic cancers; further preferably, the cancer comprises colon cancer, liver cancer, small cell lung cancer, non-small cell lung cancer, melanoma, pancreatic cancer, skin cancer, uterine cancer, ovarian cancer, gastric cancer, kaposi's sarcoma, and squamous cell carcinoma,
In one or more embodiments, the NK cell is immature TCF-1 + CD56 + NK cells.
In one or more embodiments, TCF-1 in the NK cells + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine.
The invention also provides a non-therapeutic method of preparing NK cells comprising: optionally (1) incubating NK cells with IL-15 (5 ng/mL) for 16-24 hours, preferably 16 hours
(2) NK cells are incubated with STING pathway agonists and cytokines for 24 hours to 20 days, preferably 5-10 days,
in one or more embodiments, the NK cell produced is TCF-1 + CD56 + NK cells.
In one or more embodiments, TCF-1 in the resulting NK cells is prepared + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine.
In one or more embodiments, the NK cells of step (1) are selected from mammalian peripheral blood, primary hematopoietic stem or progenitor cells, or Induced Pluripotent Stem Cell (iPSC) derived NK cells or NK92 cell lines.
In one or more embodiments, the NK cells of step (1) are genetically engineered NK cells.
In one or more embodiments, the NK cells of step (1) are therapeutic NK cells, such as CAR-NK cells.
In one or more embodiments, the NK cells of step (1) are derived from EasySep TM Human NK Cell IsolationKit was obtained by sorting from peripheral blood PBMC.
In one or more embodiments, the NK cell density of step (1) is from 0.5 to 4X 10 5 /100μL。
The invention also provides a pharmaceutical composition comprising a pharmaceutically acceptable adjuvant, and a composition as described in any of the embodiments herein, optionally further comprising NK cells,
preferably, the NK cells are selected from NK cells or NK92 cell lines derived from mammalian peripheral blood, primary hematopoietic stem or progenitor cells, or induced pluripotent stem cells (ipscs).
The invention also provides a pharmaceutical composition comprising pharmaceutically acceptable excipients, and NK cells prepared by the method described in any of the embodiments herein,
in one or more embodiments, TCF-1 in the NK cells + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine.
Drawings
Fig. 1: deletion of STING in NK cells resulted in a significant decrease in the anti-tumor metastatic capacity of mice.
Fig. 2: deletion of STING in NK cells resulted in a decrease in the antitumor capacity of mice.
A is construction of B16-F10/MC 38-beta 2m -/- Cell line, normal tumor cell B16-F10/MC38-Ctrl upregulated MHC-I (H2 kb) expression upon IFN-gamma stimulation; in the absence of beta 2m, there is no obvious change in MHC-I expression after IFN-gamma stimulation
B is in STING f/f Ncr1 iCre STING f/f Subcutaneous inoculation of 5 x 10 in mice, respectively 5 B16F 10-. Beta.2m -/- Cells, a subcutaneous tumor model is constructed, tumor growth is monitored, and NK cell specific knockout STING is found to remarkably promote the growth of the subcutaneous tumor.
C is at STING f/f Ncr1 iCre STING f/f Subcutaneous inoculation of 5 x 10 in mice, respectively 5 Individual MC 38-. Beta.2m -/- Cell, build subcutaneous tumor model, monitor tumor growth, find NK cell specific knockoutSTING can significantly promote subcutaneous tumor growth.
Fig. 3: the absence of cGAS from tumor cells results in increased tumor growth.
A is the construction of tumor metastasis models with B16F10-cGAS KO and B16F10-STING KO cell lines, and it was found that the loss of cGAS resulted in a decrease in survival rate of mice, while the loss of tumor cells STING did not.
B is the construction of tumor metastasis models with MC38-cGAS KO and MC38-STING KO cell lines, and it was found that loss of cGAS resulted in decreased survival of mice, while loss of tumor cells STING did not.
Fig. 4: flow assays demonstrated that NK cells can directly uptake cGAMP and activate.
A is in vitro sorting NK cells, in the presence of IL-15 (5 ng/ml), using different concentrations of biotin-cGAMP treatment, flow analysis technique to detect biotin levels. It was found that as the cGAMP concentration increased, the amount of biotin expressed increased accordingly. Indicating that NK cells can directly ingest cGAMP in the culture solution.
B is in vitro sorting WT and STING -/- NK cells were treated with various concentrations of cGAMP in the presence of IL-15 (5 ng/ml) and assayed for NK cell activation by flow-through analysis of CD69 levels after 24 h. cGAMP promotes NK cell activation and relies on STING.
Fig. 5: cGAMP stimulation can directly activate the murine and humanized NK cell STING pathway.
A is the use of flow sorting of mouse spleen NK cells, the diagram is the sorting strategy and sorting efficiency.
B is IL-15 (5 ng/ml) +cGAMP (5. Mu.M) after NK cells were sorted, and qPCR was performed 10 hours later to detect the gene expression level of ISGs downstream of STING. cGAMP can significantly increase Ifnb1, cxcl10, irf7 and Isg15 expression levels, activating STING pathway.
C is treatment of cancer patients PBMC with cGAMP (5. Mu.M) in RPMI1640 Quan Pei solution, 4h post-flow detection of p-STING levels. cGAMP can significantly increase STING phosphorylation levels, activating STING pathways.
D is to treat NK-92MI cell line with cGAMP (5. Mu.M) in NK-92MI special RPMI1640 whole culture solution, and to detect STING pathway protein expression after 4 h. cGAMP can significantly increase STING and TBK1 phosphorylation levels, activating STING pathways.
Fig. 6: healthy volunteers differ from cancer patients in NK cell TCF-1 expression.
Fig. 7: different levels of STING and TCF-1 expression in human NK cells at different developmental stages.
A is the flow detection of NK cell subset CD56 in PBMC of healthy volunteers hi CD16 - (CD56 hi ) And CD56 dim CD16 + (CD56 dim ) STING and TCF-1 expression levels. STING and TCF-1 in immature NK cell CD56 hi The expression is higher in the subgroup.
B is CD56 of NK cell subset in PBMC of cancer patient in flow detection mode hi CD16 - (CD56 hi ) And CD56 dim CD16 + (CD56 dim ) STING and TCF-1 expression levels. STING and TCF-1 in immature NK cell CD56 hi The expression is higher in the subgroup.
Fig. 8: IL-15+cgamp-induced CD56 + TCF-1 + NK cells are amplified, enhancing NK cell function.
A is an experimental flow diagram. 1) Using EasySep TM Human NK Cell Isolation Kit NK cells were sorted from peripheral blood PBMC of healthy human; 2) Spreading on 96-well round bottom plate, 0.5-1×105/100 μL, and treating with hIL-15 (5 ng/mL) for 16h; 3) Half-volume exchange, one group continued to be cultivated with hIL-15 (5 ng/mL) and the other group with hIL-15 (5 ng/mL) and cGAMP (1. Mu.M) for 7 days; 4) After 7 days, NK cells were counted for each group, K562 as a Target cell stimulated NK cells at an effective Target ratio (Effector: target=1:5), while protein transport inhibitor (Protein transportor inhibitor) was added, and after 6 hours, flow staining was performed to evaluate differentiation and function.
B is a flow analysis showing that after IL15+cGAMP treatment, TCF-1 + CD56 + NK cell ratio. Wherein, TCF-1 after IL15+cGAMP treatment + CD56 + NK cell ratio was 21.9% -41.5%, 5.2% -20.8% higher compared to control without IL15+cGAMP treatment.
C is a flow analysis showing that IL15+ cGAMP post-treatment TCF-1 + CD56 + NK cells have elevated IFN-gamma expression and enhanced function.
D is a flow analysis showing that IL15+cGAMP treated TCF-1 + CD56 + NK cell CD107a expression is increased and function is enhanced.
Detailed Description
It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute a preferred technical solution.
It is not known which role the natural immune recognition pathway plays in NK cells, nor is it known whether better anti-tumor effects can be achieved by STING agonists in combination with NK cell therapy. The inventors found that tumor growth would be significantly faster with conditional knockout of STING gene in mouse NK cells. The invention reveals for the first time that the STING gene in NK cells has direct regulation and control effect. Therefore, the invention relates to the preparation and amplification of NK cells by taking STING genes as targets, and the enhancement of the anti-tumor function of the NK cells.
The present invention provides a method for enhancing therapeutic NK cell function and maintaining its differentiated state and improving its long-lasting killing activity. Specifically, the invention provides an application of a reagent for activating the activation of the channel protein or the gene expression in preparing therapeutic NK cells by taking the channel protein or the gene of the cGAS-STING as a target point, and the activation of the channel protein or the gene expression ensures that the NK cells have stronger IFN-gamma secretion capacity and stronger anti-tumor effect.
Herein, an NK cell may be any NK cell or NK92 cell line from an animal, especially a mammal. Examples of NK cells include human CD3 - CD56 + Cells comprising CD56 bright CD16 - Immature NK cells or CD56 dim CD16 + Mature NK cells, and the like. In some embodiments, the NK cells are mammalian peripheral blood, primary hematopoietic stem/progenitor cell-derived cells or Induced Pluripotent Stem Cell (iPSC) derived NK cells or NK92 cell lines. NK cells also include genetically engineered NK cells, such as therapeutic CAR-NK cells.
NK cells of the present invention can be obtained using techniques well known in the art. NK cells can be isolated from the peripheryBlood, lymph node, thymus, bone marrow, tumor, hydrothorax, ascites or umbilical cord blood collected mononuclear cells, more preferably peripheral blood mononuclear cells. For example, mononuclear cells containing NK cells can be recovered from peripheral blood by density centrifugation. The peripheral blood may be derived from healthy human sources such as the patient himself, the blood donor, the non-blood donor, and the like. In an exemplary embodiment, the NK cells are derived from EasySep TM Human NK Cell Isolation Kit is obtained by sorting from peripheral blood PBMC.
NK cells in the present application also include NK cells derived from primary hematopoietic stem cells or progenitor cells or pluripotent stem cells. The pluripotent stem cells are preferably of mammalian origin, more preferably of human origin. The induction of NK cells by pluripotent Stem cells can be carried out using technical methods well known in the art (e.g. Cell Stem cell.23 (2): 181-192, 2018).
Herein, STING gene is also called MITA, MPYS, ERIS and TMEM173, which are interferon gene stimulatory proteins, four transmembrane proteins, mainly distributed in immune-related tissue cells, and highly expressed in thymus, spleen and peripheral blood cells. The STING proteins or STING genes related to the present application include STING proteins or STING genes from dairy animals, such as human and murine STING proteins or STING genes. Human STING codes 379 amino acids, murine STING codes 378 amino acids, and although the similarity of the two is as high as 80%, the currently developed drug dmxaa only binds murine STING and cannot activate human STING. The sequence of the humanized STING protein is shown as SEQ ID NO. 1, and the sequence of the murine STING protein is shown as SEQ ID NO. 3.
The present application relates to a composition for stimulating activation of STING pathway for enhancing NK cell function, the composition comprising STING pathway agonist and cytokine.
STING pathway agonists may be small molecule compounds, which within the ordinary knowledge of those skilled in the art may be cyclic dinucleotide compounds, such as cGAMP, c-di-AMP, c-di-GMP. Unless otherwise indicated, cGAMP refers to 2',5' -3',5' -cGAMP Cyclic [ G (2 ', 5') pA (3 ', 5') p ]]CAS number 1441190-66-4, molecular formula C 20 H 22 N 10 O 13 P 2 2Na, molecular weight 718.38, purity not less than 95% LC/MS.
The STING pathway agonist may also be a protein of the STING pathway or a coding sequence thereof, proteins of the STING pathway known in the art to have agonistic function to the pathway, including but not limited to STING and/or cGAS or variants thereof. The sequence of the humanized STING protein is shown as SEQ ID NO. 1, and the sequence of the murine STING protein is shown as SEQ ID NO. 3. The sequence of the human cGAS protein is shown as SEQ ID NO. 2, and the sequence of the murine cGAS protein is shown as SEQ ID NO. 4.
The STING proteins and cGAS proteins of the present invention also include wild-type based variants, which may be variants with enhanced activity or which may be constitutively active without induction (e.g., cGAMP). For example, many human STING variants are found in SAVI patients (H72N, F153V, V147L, N154S, V155M, G158A, G166E, C206Y, G207E, R281Q/W and R284G/S). These pathogenic variants constitutively activate type I interferon response in the absence of cGAMP (Jeremia et al, 2014; liu et al, 2014; dobbs et al, 2015; mukai et al, 2016) and are encompassed by the present invention. Also included herein are variants of murine STING proteins (e.g., N153S and V154M, corresponding to human N154S and V155M, respectively) (Warner et al, 2017; motwani et al, 2019).
The STING pathway agonist may also have an inhibitor of a protein that inhibits the function of STING pathway, such as a nucleic acid molecule such as siRNA used in RNA interference technology, or a gene editing vector that inhibits the expression or activity of the corresponding protein, preferably a CRISPR-CAS9 gene editing vector or a TALEN gene editing vector.
In the compositions described herein, the cytokine is preferably IL-15. Of course, other cytokines may be used in the present invention as long as they can be used in combination with STING pathway agonists to stimulate STING pathways.
In one or more embodiments, the composition that stimulates activation of the STING pathway comprises cGAMP and IL-15 at a concentration of 0.2-5 μm, e.g., 0.2 μm, 0.4 μm, 0.6 μm, 0.8 μm, 1 μm, 1.2 μm, 1.4 μm, 1.6 μm, 1.8 μm, 2.0 μm, 2.5 μm, 3.0 μm, 3.5 μm, 4.0 μm, 4.5 μm, or 5.0 μm, or a range between any two of the foregoing values, and IL-15 at a concentration of 1-50ng/mL, e.g., 1ng/mL, 2ng/mL, 3ng/mL, 4ng/mL, 5ng/mL, 6ng/mL, 7ng/mL, 8ng/mL, 9ng/mL, 10ng/mL, 15ng/mL, 20ng/mL, 25ng/mL, 30ng/mL, 35ng/mL, 40ng/mL, or a range between any two of the foregoing values, 50 ng/mL. Preferably, the concentration of cGAMP is 5ng/mL and the concentration of cGAMP is 1. Mu.M.
The above-described compositions, or components thereof, may be provided in the form of a kit, e.g., comprising a STING pathway agonist and a cytokine as described herein. In addition, the kit further comprises a culture medium suitable for culturing NK cells, so that the kit is used for culturing and preparing NK cells. Preferably, the medium comprises RPMI 1640 complete medium.
In some embodiments, the present application provides a method of preparing NK cells comprising the steps of: therapeutic NK cells are prepared using STING proteins or genes as targets, agents that activate activation of the pathway proteins or gene expression. Specifically, the method for preparing NK cells comprises: NK cells are incubated with STING pathway agonists and cytokines described herein, or with the compositions described herein, for 24 hours to 20 days (preferably 5-10 days) to obtain NK cells with enhanced function, maintained differentiation status, and enhanced durable killing activity. TCF-1 in NK cells prepared by the method + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine. Optionally, the method may further comprise a pre-culture step of NK cells, comprising incubating NK cells with IL-15 (5 ng/mL) for 16-24 hours (preferably 16 hours), before the above step. In each of the above incubation steps, the density of NK cells is not limited, and in an exemplary embodiment, the density of NK cells in the preculture step is 0.5 to 4X 10 5 100. Mu.L, preferably 1X 10 5 /100μL。
The application provides an induction method of NK cells with high expression of CD56 and enhanced IFN-gamma production capacity, which can promote immature TCF-1 by utilizing IL-15 and a cyclic dinucleotide STING agonist + CD56 + NK cell expansion, enhancement of NK cell secretion IFN-gamma abilityPromoting more durable anti-tumor effect. TCF-1 in the NK cells obtained + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine.
The present application also provides a method for maintaining memory-like NK cells comprising the steps of: NK cells are incubated with STING pathway agonists and cytokines described herein, or with the compositions described herein, for 24 hours to 20 days (preferably 5-10 days).
The application also provides a method for improving TCF-1 in NK cells + CD56 + A method of NK cell proportion comprising incubating NK cells for 24 hours to 20 days (preferably 5-10 days) with a STING pathway agonist and a cytokine as described herein, or a composition as described herein. TCF-1 in the NK cells obtained + CD56 + The proportion of NK cells is increased by at least 5%, e.g. at least 10%, 15%, 20% compared to a control not treated with STING pathway agonist and cytokine.
NK cells prepared by the method of the present invention can be directly used for the treatment of diseases, particularly cancer. Cancers that can be treated with NK cells are routine in the art, including but not limited to primary or metastatic cancers. In one or more embodiments, the cancer includes colon cancer, liver cancer, small cell lung cancer, non-small cell lung cancer, melanoma, pancreatic cancer, skin cancer, uterine cancer, ovarian cancer, gastric cancer, kaposi's sarcoma, and squamous cell carcinoma. Generally, NK cells can be genetically engineered to allow a nucleic acid molecule of interest (e.g., for expression of a protein such as a CAR) to enter (e.g., by transfection) the NK cells before, during, or after the culturing methods of the present invention are performed. Thus, the NK cells may be NK cells for immune cell therapy. NK cells prepared by the methods of the present invention may also be used for non-therapeutic purposes such as research, pharmaceutical production, quality control, etc.
The invention also provides a pharmaceutical composition comprising a composition as described herein, i.e., the pharmaceutical composition comprises a STING pathway agonist and a cytokine, which pharmaceutical composition may further comprise NK cells not treated by the culture methods described herein. In addition, the present invention also provides a pharmaceutical composition comprising NK cells prepared by the methods described herein. In addition to these active ingredients, the pharmaceutical compositions also contain pharmaceutically acceptable excipients. The term "pharmaceutically acceptable excipients" refers to carriers and/or excipients that are pharmacologically and/or physiologically compatible with the subject and active ingredient, as is well known in the art (see, e.g., remington's Pharmaceutical sciences. Mediated by Gennaro AR,19th ed.Pennsylvania:Mack Publishing Company,1995). Pharmaceutically acceptable excipients include, but are not limited to, diluents, carriers, solubilizers, emulsifiers, preservatives and/or adjuvants. The adjuvant is preferably non-toxic to the recipient at the dosage and concentration employed. Such excipients include, but are not limited to: saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or permeation of the composition. These substances are known from the prior art. The optimal pharmaceutical composition can be determined depending on the intended route of administration, the mode of delivery and the dosage required.
Pharmaceutical compositions for in vivo administration are generally provided in the form of sterile formulations. Sterilization is achieved by filtration through sterile filtration membranes. In the case of lyophilization of a composition, this method may be used to sterilize the composition either before or after lyophilization and reconstitution. The pharmaceutical compositions of the present invention may be selected for parenteral delivery. Compositions for parenteral administration may be stored in lyophilized form or in solution. For example, by using physiological saline or an aqueous solution containing glucose and other auxiliary agents by conventional methods. Parenteral compositions are typically placed in a container having a sterile access port, such as an intravenous solution tape or vial having a stopper pierceable by a hypodermic injection needle. Alternatively, the composition may be selected for inhalation or delivery through the digestive tract (such as orally). The preparation of such pharmaceutically acceptable compositions is within the skill of the art. Other pharmaceutical compositions will be apparent to those skilled in the art. Techniques for formulating a variety of other sustained or controlled delivery means, such as liposome carriers, bioerodible particles or porous beads, and depot injections, are also known to those skilled in the art.
Once formulated, the pharmaceutical compositions are stored in sterile vials as solutions, suspensions, gels, emulsions, solids, crystals, or as dehydrated or lyophilized powders. The formulation may be stored in a ready-to-use form or reconstituted (e.g., lyophilized) prior to administration.
The invention also provides a method of treating a patient (particularly an NK cell-associated disease including but not limited to infectious disease, metabolic disease and/or cancer) by administering NK cells prepared according to any of the embodiments of the invention or a pharmaceutical composition thereof. The terms "patient," "subject," "individual," "subject" are used interchangeably herein to include any organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. "treating" refers to a subject employing a treatment regimen described herein to achieve at least one positive therapeutic effect (e.g., reduced number of cancer cells, reduced tumor volume, reduced rate of infiltration of cancer cells into peripheral organs, or reduced rate of tumor metastasis or tumor growth). The treatment regimen effective to treat a patient can vary depending on a variety of factors, such as the disease state, age, weight, and ability of the patient to elicit an anti-cancer response in the subject by therapy.
The therapeutically effective amount of the pharmaceutical composition comprising NK cells of the invention to be employed will depend on, for example, the extent of treatment and the goal. Those skilled in the art will appreciate that the appropriate dosage level for treatment will vary depending in part on the molecule delivered, the indication, the route of administration, and the size (body weight, body surface or organ size) and/or condition (age and general health) of the patient. In certain embodiments, the clinician may titrate the dose and alter the route of administration to obtain the optimal therapeutic effect. Such as from about 10 micrograms per kilogram of body weight to about 50 milligrams per kilogram of body weight per day.
The frequency of administration will depend on the pharmacokinetic parameters of the NK cells in the formulation used. The clinician typically administers the composition until a dose is reached that achieves the desired effect. The composition may thus be administered as a single dose, or over time as two or more doses (which may or may not contain the same amount of the desired molecule), or as a continuous infusion through an implanted device or catheter.
The route of administration of the pharmaceutical composition is according to known methods, for example, by oral, intravenous, intraperitoneal, intracerebral (intraparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial, portal or intralesional route injection; either by a sustained release system or by an implanted device.
The invention will be illustrated by way of specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the invention. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.
Examples
Example 1: effect of endogenous STING pathway on the anti-tumor effect of NK cells
The experimental method comprises the following steps:
1. STING flox/flox Mice were hybridized with Ncr1-iCre, and the-STING condition specific for NK cells was propagated to knock out STING f/f Ncr1 iCre And (3) establishing a tumor lung metastasis model in a mouse.
2. Lung transfer model: tumor cells were digested with 0.25% pancreatin, washed 3 times with PBS, counted 1X 10 6 density/mL resuspended in PBS; will be 2X 10 5 200. Mu.L tumor cells were injected 3X 10 by tail vein 5 Tumor cell lines (mouse melanoma cell line B16F 10) to 6-8w mice, 5-6 mice per group; mice were sacrificed 11-14 days after inoculation, lung tissue was perfused and dissected with PBS, tumor foci were counted under an dissecting microscope or tumor microenvironment analysis was performed to evaluate the anti-tumor metastasis ability of knockout mice specific for NK cell-STING conditions.
3. Transient constructs of beta 2m knockout B16F10/MC38 tumor cell lines:
NK cell surface inhibitory receptors mainly recognize MHC-class I molecules, mediate inhibitory signals, thereby inhibiting the killing activity of NK cells and achieving autoimmune tolerance. NK cell activation is induced by down-regulating tumor cell surface MHC-I class moleculesRapid killing effect. We constructed knockout mouse melanoma cell line B16F 10-. Beta.2m -/- And the mouse colorectal cancer cell line MC 38-beta 2m -/- Cell lines, which are rendered MHC-I-deficient, are thus insensitive to T cells and sensitive to NK cells. For β2m knockdown, we transfected tumor cells directly with the lenti-CISPR-v2 vector plasmid, transiently expressing the CRISPR-Cas9 system: transfection was performed using Lipofectamine3000 (Invitrogen) and Opti-MEM (Gibco) according to the instructions; the gRNA sequence of β2m is shown in Table 1; after 48h cells were incubated with puromycin 4d, B16F10 with 2. Mu.g/mL and MC38 with 3. Mu.g/mL; flow cytometry analysis confirmed the knockout of β2m, and screened tumor cells were incubated with 20ng/mL IFN- γ (PeproTech) for 48h, with upregulation of MHC-i expression upon stimulation by IFN- γ; flow staining was performed with anti-MHC class I (H-2 Kb clone AF 6-88.5) and tumor cells negative for H-2Kb expression were sorted.
In STING f/f Ncr1 iCre STING (STING) f/f Establishment of B16F 10-. Beta.2m in mice -/- MC 38-beta 2m -/- Cell line subcutaneous tumor model, tumor growth curve was monitored.
4. Subcutaneous tumor model: tumor cells were digested with 0.25% pancreatin, washed 3 times with PBS, counted 5X 10 6 density/mL resuspended in PBS; 1% sodium pentobarbital is used for intraperitoneal injection of 100-150 mu L of anesthetized mice; after the mice were anesthetized, the right-side back hair was shaved with a shaver; subcutaneous inoculation 0.5X10 6 100. Mu.L tumor cells on the back of mice; tumor volumes were then measured every 3 days or twice weekly, or used to analyze tumor immune microenvironments.
5. Construction of cGAS/STING knockout B16F10 and MC38 cell lines using CRISPR-CAS9 technology:
(1) gRNA design: the Design of the gRNA sequence can be cited in the relevant reference or mousgeckov2_library, and also the CRISPR Design at the wire mesh station can be used: http:// crispr. The cGAS-gRNA and STING-gRNA sequences used herein are shown in Table 1.
(2) Constructing a recombinant plasmid:
1) gRNA duplex synthesis
The reaction system is as follows:
the power supply is turned off for natural cooling at 95 ℃ for 5min (PCR instrument); 1:200, and is ready for use.
2) Plasmid enzyme digestion
The reaction system is as follows:
and (3) enzyme cutting is carried out at 55 ℃ for 2 hours, so that full enzyme cutting is ensured.
3) Glue recovery
a) 0.8% agarose gel electrophoresis, facilitating band separation (voltage 100V;20-30 min); recovering the large fragment of about 11 kb; the small fragment was about 1.9kb and discarded; the recovery is carried out according to the following steps:
b) Cutting off the fragments to be recovered, sucking the electrophoresis liquid on the surface layer by using absorbent paper, putting the electrophoresis liquid into an EP tube, and weighing;
c) Adding 3 times of QG buffer (100 mg gel-100 mu L), placing into a water bath kettle at 50 ℃ for incubation for 10min, taking out an EP tube every 2-3min, reversing or vibrating up and down, and promoting the dissolution of the gel;
d) After the glue is completely dissolved, adding 1-time volume of isopropanol, and blowing and mixing uniformly;
e) Placing the QIAquick binding column in a 2mL collecting tube, adding the sample into the binding column, and rapidly centrifuging for 1min until all the liquid passes through a filter membrane;
f) Discarding the filtrate in the collecting pipe, putting the binding column in the collecting pipe again, adding 500 mu LQG buffer, and rapidly centrifuging for 1min until all the liquid passes through the filter membrane;
g) Discarding the filtrate in the collecting pipe, putting the binding column in the collecting pipe again, adding 750 mu LPE buffer, and rapidly centrifuging for 1min until all the liquid passes through the filter membrane;
h) Discarding filtrate in the collecting pipe, putting the binding column in the collecting pipe again, and centrifuging at high speed for 1min to remove residual liquid;
i) Placing the centrifuge tube in a new 1.5mL EP tube, adding 30 μl of EB buffer, standing at room temperature for 1min, and rapidly centrifuging for 1min;
g) Concentration was measured using nanodrop.
4) Connection
The reaction system is as follows:
samples without added gRNA were used as negative controls at 16℃for 120min (PCR).
5) Transformation
a) Thawing competent cells in ice for 10 min;
b) Adding 10 μl of the ligation product into 100 μl of competent cells, flicking, mixing, and standing in ice for 30min;
c) Heat shock at 42 ℃ for 90s, rapidly transferring to ice for 2-3min, and the process can not shake the EP tube;
d) Mu.l of preheated antibiotic-free LB was added to each EP tube and the bacteria were resuscitated by shaking at 37℃for 220rpm/60 min;
e) Centrifuging at 2000rpm for 3min, removing supernatant, collecting 100 μl of bacteria liquid coated plate, absorbing liquid, and inverting at 37deg.C for 12-16 hr;
f) Selecting monoclonal, shaking, extracting plasmid and sequencing.
6) Plasmid amplification
a) Adding 30 μl of small shaking bacterial liquid into 30mL LBA culture medium, shaking at 37deg.C for 12-16 hr; centrifuging at 4000g for 10min at room temperature, and collecting thalli;
b) Discarding the culture Solution, adding 2.5mL Solution I/RNaseA mixed Solution into the sediment, and completely suspending the cells by vortex oscillation;
c) 2.5mL Solution II was added and gently mixed upside down 7-10 times. If necessary, the lysate may be left to stand at room temperature for 5 minutes. Severe mixing of the lysate is avoided, which would otherwise break the chromosomal DNA and reduce the purity of the resulting plasmid. Prolonged standing time may lead to fragmentation of plasmid DNA. (after using Solution II, the bottle cap is tightly covered and stored)
d) 1.25mL of pre-chilled Buffer N3 on ice was added and the tube was gently mixed upside down until a white, flocculent precipitate formed (the solution had to be thoroughly mixed). If the mixture is still very viscous and takes the shape of brown balls, the mixture is uniformly mixed until the solution is completely neutralized, the complete neutralization of the solution is critical to obtain high yield), and 4000g of the mixture is centrifuged for 5min;
e) Preparing a filter needle cylinder, pulling out a piston in the needle cylinder, vertically placing the needle cylinder on a proper test tube rack, placing a new 15mL tube at the outlet of the lower end of the injector, and enabling the opening of the needle cylinder to be upward;
f) Immediately pouring the supernatant of the centrifuged lysate into the barrel of the filter, carefully and gently inserting the syringe plunger into the barrel, slowly pushing the plunger to flow the lysate into the centrifuge tube;
g) Adding ETR Solution (blue) of 0.1 times volume into the filtered lysate, mixing for 7-10 times upside down, and standing in ice bath for 10-20min. Note that: after addition of the ETR solution, the lysate may appear cloudy, but will gradually become clear after the ice bath.
h) The lysate is subjected to water bath at 42 ℃ for 5min, turbidity of the lysate again occurs, at the moment, 4000g of the lysate is centrifuged for 5min at 25 ℃, and an ETR solution forms a blue layer at the bottom of a test tube;
i) The supernatant was transferred to another new 15mL or 50mL tube, 1/2 times the volume of absolute ethanol was added, the tube was gently inverted 5-6 times, and left at room temperature for 2min.
g) Handle HiBind TM The DNA Midi binding column is sleeved into a 15mL collecting tube, and 3.5mL of the mixed solution obtained in the previous step is transferred to HiBind TM DNA Midi binding column, centrifuging 4000g at room temperature for 3-5min, discarding filtrate;
k) Repeating the step g) until all the mixed solution obtained in the step i) is combined into a medium-amount combination column;
l) handle HiBind TM The DNA Midi binding column is sleeved into the same collecting tube, and 3mL Buffer HB is added into HiBind TM DNA Midi binding column, at room temperatureCentrifuging at 4000g for 3-5min, and discarding the filtrate.
m) handle HiBind TM The DNA Midi binding column was placed in the same collection tube, 3.5. 3.5mL DNA Wash Buffer (diluted with absolute ethanol) was added, centrifuged at 4000g for 3-5min at room temperature and the filtrate was discarded. Note that: the concentrated DNA Wash Buffer must be diluted with ethanol as indicated by the label prior to use. If the DNA WashBuffer is placed in a refrigerator before use, it is taken out and left at room temperature.
n) repeating step m);
o) handle HiBind TM Putting the DNA Midi binding column into the same collecting tube, and centrifuging at room temperature for 10-15min by 4000g to dry the binding column matrix;
p) handle HiBind TM The DNA Midi binding column was nested in a clean 15mL centrifuge tube, and 0.5-1mL Endo-Free Elution Buffer (or Buffer TE) preheated at 70℃was added to the binding column matrix (the amount added depends on the desired final product concentration) and allowed to stand at room temperature for 2 minutes. Centrifuge 4000g for 5min to elute DNA.
Experimental results:
in STING f/f Ncr1 iCre Ncr1 iCre The lung metastasis model of B16F10 melanoma was constructed in mice, respectively, and we found that NK cell specific knockout of STING significantly increased tumor metastasis (FIG. 1).
Simultaneous use of B16F10/MC 38-. Beta.2m -/- Cell lines build a subcutaneous tumor model. First build beta 2m -/- Cell lines, normal tumor cells up-regulate MHC-I (H2 kb) expression under IFN-gamma stimulation; in contrast, there was no significant change in MHC-I expression following IFN-gamma stimulation following beta 2m depletion (FIG. 2, A). Tumor cells were not sensitive to T cells but to NK cells due to lack of MHC-I expression, and NK cell specific knockout of STING was found to significantly promote tumor growth using this model (fig. 2, b and C).
Meanwhile, tumor metastasis models were constructed with B16F10-cGAS KO and MC38-cGAS KO cell lines, respectively, and it was found that loss of both cell lines cGAS resulted in decreased survival of mice, while loss of tumor cells STING did not (FIGS. 3, A and B). Thus cGAS in tumor cells is critical for the activation of STING in the body, and tumor cells produce cGAMP which is transmitted to NK cell activation STING pathways in the body.
Example 2: stimulation of NK cells with cGAMP can result in enhanced NK cell activation
The experimental method comprises the following steps:
1. sorting of NK cells:
(1) Mice were sacrificed by cervical dislocation and immersed in alcohol for 5min. Taking spleen with the surgical instrument sterilized by high pressure;
(2) The spleen was flat-ground with a 1mL syringe, filtered through a 70 μm filter, the filter was rinsed with a stock solution containing 2% FBS, the cells were resuspended in 50mL centrifuge tubes, 2000rpm, and centrifuged for 5min;
(3) After centrifugation, the spleens were lysed with 1×red blood cell lysate, 1 spleen was lysed with 2mL, 3 min, 20mL PBS was added for suspension, centrifugation was performed at 2000rpm for 5min;
(4) Spleen lymphocytes were resuspended with 10mL of 2% FBS whole culture, and if there were a small number of tissue pieces in the suspension, the suspension was again passed through a 70 μm filter and counted;
(5) Sorting NK CELLs by using a STEM CELL negative sorting agent box, recycling the NK CELLs into a 15mL centrifuge tube after the last sorting, and counting; centrifugation at 2000rpm for 5min, RPMI 1640 and Quan Pei suspension (IL-15, 20 ng/mL);
(6) Different cytokine plates were added as required and incubated at 37 ℃.
2. To investigate the uptake of extracellular cGAMP by NK cells: after sorting NK cells, different concentrations of Fluorescein-cGAMP (BIOLOG, cat#C178) (0, 5, 10. Mu.M) were added to the medium, and after 24h, fluorescein fluorescence intensity was measured to demonstrate that NK cells could directly ingest cGAMP.
3. To examine the effect of cGAMP on NK cell activation: in vitro sorting mouse WT NK cells and STING KO NK cells, adding different concentrations of cGAMP into culture solution, detecting CD69 after 24 hr + NK cell ratio.
4. To detect activation of NK cell STING pathway by cGAMP: the activation of STING pathway was verified using flow-sorting of mouse NK cells, and qPCR for detection of IFN- β, CXCL10, irf7 and ISG15 mRNA levels 10h after cGAMP treatment of NK cells, with qPCR primer sequences as shown in table 1.
5. To detect cGAMP versus human sourceActivation of NK cell STING pathway: we collected peripheral blood from cancer patients, extracted PBMC by Ficoll-Paque treatment, and analyzed NK cells (CD 3 - CD56 + ) STING activation level. Simultaneously using NK-92MI cell line, p-STING, p-TBK1 levels were detected using flow cytometry western blot after 6h of treatment of NK cells with cGAMP to verify the activation of STING pathway.
6. Flow cytometry analysis:
(1) Lung single cell suspension obtained: the pulmonary tumor microenvironment was analyzed 11-14 days after tail vein tumor inoculation:
a) Killing the mice, perfusing with PBS and dissecting lung tissue, and cutting;
b) Digesting with 0.4mg/mL collagenase VIII and 0.1mg/mL DNase I at 37 ℃ for 45 minutes, shaking and mixing uniformly every 15 minutes;
c) Digestion was stopped on ice and the single cell suspension was isolated by grinding and filtration through a 70 μm cell strain screen (note: the grinding is not needed, and the tissues such as fat and the like are easy to be taken into the cell suspension);
d) The single cell suspension can be used for detecting various indexes and analyzing functions of tumor microenvironment NK cells.
The subcutaneous tumor single cell suspension was obtained and the flow staining analysis procedure was the same as in experimental method 5 of example 1.
Experimental results:
the flow assay technique examined the levels of biotin and found that as the concentration of cGAMP increased, the amount of biotin expressed increased accordingly, indicating that NK cells did take cGAMP in the culture broth (fig. 4, a).
In vitro NK cell survival requires the presence of the cytokine IL-15, cGAMP promotes NK cell activation in the presence of 5ng/ml IL-15 (CD 69 + ) (FIG. 4, B).
Type I interferon production can be induced by recruiting TBK1 to activate IRF3 to form a protein complex following STING activation, and thus to further explore whether STING's regulation of NK cells is dependent on type I interferon. WT NK cell efficiency using in vitro flow sorting is shown in fig. 5, a; we found that cGAMP treated for 10h, cGAMP caused significant increases in NK cell IFN-. Beta.and ISGs mRNA levels (FIG. 5, B). At the same time, we found that direct treatment of peripheral blood PBMCs from cancer patients with cGAMP resulted in elevated STING phosphorylation levels in human NK cells (fig. 5, c), treatment of NK-92MI cell lines with STING agonists, and significant increases in p-STING and p-TBK1 levels (fig. 5, d), indicating activation of STING pathways.
Example 3: endogenous STING activation promotes TCF-1 + CD56 + NK cell subsets expand and enhance NK cell function.
The experimental method comprises the following steps:
1. previous studies have shown that TCF-1 is associated with memory-like status of human NK cells. Collecting peripheral blood of healthy volunteers and cancer patients, and firstly detecting the expression level of TCF-1 by using a flow cytometry;
2. to further investigate whether STING is associated with TCF-1 + CD56 + In connection with NK cell maintenance, we collected peripheral blood from healthy volunteers and cancer patients, extracted PBMC by Ficoll-Paque treatment, and analyzed human NK cells by flow staining (CD 3) - CD56 + ) Different subpopulations of (CD 56) dim And CD56 hi NK cells) STING and TCF-1 expression levels;
3. next, we examined the direct regulation of cGAMP on human NK cells, sorting human NK cells in peripheral blood PBMC, dividing them into IL-15 (control group) treatment group and IL-15+cgamp treatment group according to the conditions of memory-like NK induction in literature, treating for 16h respectively, culturing for 7 days under IL-15 treatment after changing the liquid, co-culturing for 6h with K562 as secondary stimulation, and examining NK cell IFN- γ secretion ability and killing ability.
4. Human TCF-1 + CD56 + NK cell induction experiment:
(1) Using EasySep TM Human NK Cell Isolation Kit NK cells were sorted from peripheral blood PBMC of healthy human;
(2) Spreading on 96-well round bottom plate, 0.5-4×10 5 100 μl, RPMI 1640 Quan Pei suspension; hIL-15 (5 ng/mL) treatment for 16h,5% CO 2 ，37℃；
(3) Half-volume medium exchange, one group continued to be cultivated with hIL-15 (5 ng/mL), the other group was cultivated with hIL-15 (5 ng/mL) and cGAMP (1. Mu.M) for 7 days, 5% CO 2 ，37℃；
(4) After 7 days, NK cells were counted for each group, K562 as a Target cell stimulated NK cells at an effective Target ratio (Effector: target=1:5), while Protein transportor inhibitor was added, and after 6 hours, flow staining was performed to evaluate differentiation and function.
5. Statistical analysis:
experimental results statistical analysis was performed using Prism software (GraphPad Prism 8.0 software). Data are expressed as mean ± SEM, data are in accordance with normal distribution, parametric test is used, statistical of differences between two groups is performed using Student's t tests (unpaired or paired, two-tailed), differences between groups are performed using One-way ANOVA, parametric post test is performed using Turkey test. The significance differences correspond to the following: * P <0.05; * P <0.01; * P <0.001; ns is no statistical difference.
Experimental results:
we found that TCF-1 in a peripheral blood sample of a cancer patient compared to healthy volunteers + CD56 +
NK cells decreased in proportion (fig. 6); to further determine the expression levels of TCF-1 and STING at different maturation stages in human NK cells, we examined CD56 in healthy volunteers and cancer patients dim And CD56 hi Expression of both TCF-1 and STING in NK cells. We found immature CD56 hi NK cells showed higher expression levels of TCF-1 and STING in the human environment (FIG. 7, A and B). These evidence indicate that STING signals are associated with TCF-1 in humans + CD56 + NK cell expansion is involved.
We found that low doses of cGAMP treatment (1 uM cGAMP+5ng/ml IL-15 treatment for 7 days) contributed to TCF-1 + CD56 + NK cell formation of (c). As shown in FIG. 8, B, TCF-1 after IL15+cGAMP treatment + CD56 + NK cell ratio was 21.9% -41.5%, 5.2% -20.8% higher compared to control without IL15+cGAMP treatment. And IL-15+cGAMP treated NK cells secreted IFN-. Gamma.and CD107a with enhanced function (FIG. 8, C and D). Indicating that activation of STING pathway in peripheral blood NK cells will directly affect their differentiation into prolonged NK cells in tumor microenvironmentSurvival time and strategy for effector function.
TABLE 1 nucleotide sequences used in the present invention
SgRNA sequences (construction of gene knockout cell lines):
SEQ ID NO:5:Murineβ2m F:GAGTCGTCAGCATGGCTCGCT
SEQ ID NO:6:Murineβ2m R:GACGTAGCAGTTCAGTATGTT
SEQ ID NO:7:Murine cGAS F:CACCGATATTCTTGTAGCTCAATCC
SEQ ID NO:8:Murine cGAS R:AAACGGATTGAGCTACAAGAATATC
SEQ ID NO:9:Murine STING F:CACCGTTGAAAAACCTCTGCTGTC
SEQ ID NO:10:Murine STING R:AAACGACAGCAGAGGTTTTTCAAC
qPCR primer sequence:
SEQ ID NO:11:Ifnb1 F:TGAACTCCACCAGCAGACA
SEQ ID NO:12:Ifnb1 R:ACCACCATCCAGGCGTAG
SEQ ID NO:13:Irf7 F:AATTCCTACCTGTTACCA
SEQ ID NO:14:Irf71R:ATGCTACTACTCTGTGAT
SEQ ID NO:15:Cxcl10F:CGATGACGGGCCAGTGAGAATG
SEQ ID NO:16:Cxcl10R:TCAACACGTGGGCAGGATAGGCT
SEQ ID NO:17:Isg15F:GGTGTCCGTGACTAACTCCAT
SEQ ID NO:18:Isg15R:TGGAAAGGGTAAGACCGTCCT
SEQ ID NO:19:Actb F:TTGCACATGCCGGAGCCGTT
SEQ ID NO:20:Actb R:CACACCCGCCACCAGTTCGC
the reagents used in the present invention are shown in tables 2-7 below:
TABLE 2
/>
TABLE 3 Table 3
TABLE 4 Table 4
TABLE 5
/>
TABLE 6
TABLE 7
/>

Claims (10)

1. A composition comprising a STING pathway agonist and a cytokine,
preferably, the STING pathway agonist is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein or a coding sequence thereof,
A STING pathway agonist is a protein of the STING pathway or a variant thereof, or a coding sequence thereof,
preferably, the protein of the STING pathway is selected from STING, cGAS, or variants thereof.
2. The composition of claim 1, wherein the agonist is a cyclic dinucleotide compound,
preferably, the agonist is cGAMP, c-di-AMP or c-di-GMP.
3. The composition of claim 1, wherein the cytokine is IL-15.
4. The composition of claim 1, wherein the composition comprises,
IL-15 concentration of 1-50ng/mL, preferably 5ng/mL, and/or
The concentration of cGAMP is 0.2-5. Mu.M, preferably 1. Mu.M.
5. A kit comprising a STING pathway agonist and a cytokine,
preferably, the method comprises the steps of,
STING pathway agonists are selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein or a coding sequence thereof,
the protein is a protein of the STING pathway or a variant thereof; preferably, the protein of the STING pathway comprises STING, cGAS, or variants thereof,
the agonist is a cyclic dinucleotide compound; preferably, the agonist is cGAMP, c-di-AMP or c-di-GMP,
the cytokine is IL-15 and the cytokine is expressed in a human,
the kit further comprises a medium suitable for culturing NK cells; preferably, the medium comprises RPMI 1640 complete medium.
The use of sting pathway agonists and cytokines in the preparation of NK cell-containing agents,
preferably, the method comprises the steps of,
STING pathway agonists are selected from the group consisting of: a small molecule compound, a nucleic acid molecule, a protein or a coding sequence thereof,
the protein is a protein of the STING pathway or a variant thereof, preferably the protein of the STING pathway comprises STING, cGAS, or a variant thereof.
The agonist is a cyclic dinucleotide compound,
the agonist is cGAMP, c-di-AMP or c-di-GMP,
the cytokine is IL-15.
7. The use according to claim 6, wherein said NK cells are derived from mammalian peripheral blood, primary hematopoietic stem or progenitor cells, or Induced Pluripotent Stem Cells (iPSCs),
preferably, the NK cells are used in immune cell therapy; more preferably, the NK cells are used to treat cancers, including but not limited to primary or metastatic cancers; further preferably, the cancer comprises colon cancer, liver cancer, small cell lung cancer, non-small cell lung cancer, melanoma, pancreatic cancer, skin cancer, uterine cancer, ovarian cancer, gastric cancer, kaposi's sarcoma, and squamous cell carcinoma,
preferably, the NK cell is TCF-1 + CD56 + The cell population of the NK cells,
preferably, TCF-1 in said NK cells + CD56 + The proportion of NK cells was at least 5% higher than the control without STING pathway agonist and cytokine treatment.
8. A method of making NK cells comprising:
optionally (1) incubating NK cells with IL-15 (5 ng/mL) for 16-24 hours, preferably 16 hours;
(2) NK cells are incubated with STING pathway agonists and cytokines for 24 hours to 20 days, preferably 5-10 days,
preferably, the NK cell obtained is TCF-1 + CD56 + The cell population of the NK cells,
preferably, TCF-1 in the NK cells prepared + CD56 + The proportion of NK cells was at least 5% higher than the control without STING pathway agonist and cytokine treatment.
9. The method of claim 8, wherein the NK cells of step (1) are selected from mammalian peripheral blood, primary hematopoietic stem or progenitor cells, or Induced Pluripotent Stem Cell (iPSC) derived NK cells or NK92 cell lines;
preferably, the NK cells of step (1) are derived from EasySep TM Human NK CellIsolation Kit is obtained by sorting from peripheral blood PBMC,
more preferably, the NK cell density of step (1) is 0.5-4X 10 5 /100μL。
10. A pharmaceutical composition comprising a pharmaceutically acceptable adjuvant and an NK cell prepared by the composition of any one of claims 1-4 and/or the method of claim 8.
CN202311114635.XA 2023-08-30 2023-08-30 Preparation of therapeutic NK cells targeting STING pathway Pending CN116987666A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311114635.XA CN116987666A (en) 2023-08-30 2023-08-30 Preparation of therapeutic NK cells targeting STING pathway

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311114635.XA CN116987666A (en) 2023-08-30 2023-08-30 Preparation of therapeutic NK cells targeting STING pathway

Publications (1)

Publication Number Publication Date
CN116987666A true CN116987666A (en) 2023-11-03

Family

ID=88528447

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311114635.XA Pending CN116987666A (en) 2023-08-30 2023-08-30 Preparation of therapeutic NK cells targeting STING pathway

Country Status (1)

Country Link
CN (1) CN116987666A (en)

Similar Documents

Publication Publication Date Title
JP2020518256A (en) Compositions and methods for gene editing in T cells using CRISPR/CPF1
CN110603048A (en) Cytokine combinations
KR19990063818A (en) Dendritic cell stimulating factor
CN105008521A (en) Methods modulating immunoregulatory effect of stem cells
JP2021536435A (en) Therapeutic agents containing nucleic acids and CAR-modified immune cells and their use
EP3964531A1 (en) Protein molecule and use thereof
CN105296431A (en) Tumor binding specific gamma delta TCR gene modified alpha beta T cell and cancer suppression application thereof
EP3299023A1 (en) Low-oxygen-treated mesenchymal stem cell and use thereof
JPH06504785A (en) Treatment of neoplastic diseases with interleukin-10
CN109021114B (en) Bispecific chimeric antigen receptor combining two single-chain antibodies and expression vector
TW202128739A (en) Fusion protein containing human interleukin 10 and fc fragment and medical use thereof
EP3940063A2 (en) Method for the expansion and differentiation of t lymphocytes and nk cells in adoptive transfer therapies
US9410143B1 (en) Biological molecules produced by electromagnetically stimulating living mammalian cells
CN110016465A (en) A kind of immunocyte drug comprising B cell and the double identity T cells of tumour
Sun et al. Recombinant human prolactin improves antitumor effects of murine natural killer cells in vitro and in vivo
KR101636139B1 (en) Mesenchymal stem cells overexpressing sRAGE and cell therapeutic agent for preventing or treating immune disease
JP2017520582A (en) Mesenchymal stromal cells for the treatment of rheumatoid arthritis
CN108395480A (en) Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER2-NKT cells and its preparation method and application
JPH08509859A (en) Expansion of stem cells in long-term bone marrow cultures by neutralization of TGF-β
CN116987666A (en) Preparation of therapeutic NK cells targeting STING pathway
CN109439627A (en) A kind of polarization and the method and composition for expanding CD4+T cell and the application in the tumour for curing expression specificity antigen
CN111499766B (en) Immune effector cell aiming at chronic lymphocytic leukemia, preparation method and application thereof
CN104524560A (en) Dendritic cell tumor vaccine and preparation method and application thereof
CN101380465A (en) Construction method of Beta-alexin-2-tumor vaccine and uses thereof
JPH08510131A (en) Use of modified TALL-104 cells to treat cancer and viral diseases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination