CN116970578A - Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application - Google Patents

Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application Download PDF

Info

Publication number
CN116970578A
CN116970578A CN202210432812.8A CN202210432812A CN116970578A CN 116970578 A CN116970578 A CN 116970578A CN 202210432812 A CN202210432812 A CN 202210432812A CN 116970578 A CN116970578 A CN 116970578A
Authority
CN
China
Prior art keywords
nodule
protein
soybean
gmcyp35
gmcyp37
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210432812.8A
Other languages
Chinese (zh)
Inventor
肖爱芳
余海翔
朱辉
曹扬荣
吴佳姗
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202210432812.8A priority Critical patent/CN116970578A/en
Publication of CN116970578A publication Critical patent/CN116970578A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a method for regulating and controlling root nodule development and/or regulating and controlling nitrogen fixation efficiency of root nodules and application thereof. Experiments prove that the soybean GmCYP35 protein and/or the soybean GmCYP37 protein can regulate and control plant nodule development and/or nodule nitrogen fixation efficiency, and specifically comprises the steps of reducing the nodule nitrogen fixation efficiency, inhibiting nodule development and promoting nodule aging. Therefore, the soybean GmCYP35 gene or the soybean GmCYP37 gene is proved to be a negative regulating factor for regulating the growth of the root nodule and regulating the nitrogen fixation efficiency of the root nodule, so that the gene can be knocked out or the expression of the gene can be interfered by means of gene editing, the senescence of the root nodule and the plant can be delayed, the nitrogen fixation capacity of the plant can be improved, and the soybean GmCYP35 gene has a certain application prospect in the research of nitrogen fixation mechanism of leguminous crops and agricultural production.

Description

Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to a method for regulating and controlling root nodule development and/or regulating and controlling nitrogen fixation efficiency of root nodules and application thereof.
Background
The symbiotic nitrogen fixation system formed by leguminous plants and rhizobium is an efficient and environment-friendly nitrogen fixation mode, is an effective way for reducing the dosage of chemical nitrogen fertilizer, and plays an important role in natural nitrogen circulation and sustainable development of human agriculture ecology. The soybean is an important grain and oil crop, and is a main source of high-quality protein of human beings and feed protein of animal husbandry, and most of high protein rich in the soybean is derived from nitrogen fixed by a symbiotic nitrogen fixation system. Various environmental factors such as drought, high and low temperature, salt stress and the like in the soybean planting process lead root nodules to be aged in advance, so that the nitrogen fixation capacity is obviously reduced, and finally the quality and the yield of soybeans are influenced. Therefore, the method properly delays root nodule aging, improves the nitrogen fixation efficiency of the soybean root nodule, and is a powerful way for reducing nitrogen fertilizer application and increasing soybean yield.
Symbiotic nitrogen fixation of legumes is a highly controlled process, and both biological and abiotic factors can lead to nodule senescence, such as drought and high nitrate levels, which in turn affect nodule nitrogen fixation efficiency. During plant senescence, an important process of cell death is typically exerted with the up-regulation of some cysteine protease encoding gene (Van De Velde, W., guerra, J.C., de Keyser, A., de Rycke, R., rombuots, S., maunory, N., mergaert, P., kondorosi, E., holsters, M., and Goormachtig, S. (2006) & gt, acting in unguidum systems A molecular view on nodule senescence in Medicago vector plant physiology 141, 711-720) and [ Kunert, K.J., van Wyk, S.G., curlis, C.A., vorster, B.J., and Foyer, C.H. (2015), potential use ofphytocystatins in crop improvement, with aparticular focus on unguidus. ofexperimental botany 66,3559, 3566) and the like in the cell death processes of the organism. There is no report on controlling plant nodule senescence by GmCYP35 or GmCYP 37.
Disclosure of Invention
In order to solve the problems, the invention provides a method for regulating and controlling the root nodule development and/or regulating and controlling the nitrogen fixation efficiency of the root nodule and application thereof. The soybean GmCYP35 protein and/or the soybean GmCYP37 protein can regulate plant nodule development and/or nodule nitrogen fixation efficiency, and specifically comprises the steps of reducing the nodule nitrogen fixation efficiency, inhibiting nodule development and promoting nodule aging.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an application of soybean GmCYP35 protein and/or soybean GmCYP37 protein in regulating and controlling root nodule development and/or reducing root nodule nitrogen fixation efficiency, wherein the regulating and controlling root nodule development comprises the following steps: inhibit nodule development and/or promote nodule senescence;
the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2.
Preferably, the reduction of the root nodule nitrogen fixation efficiency comprises a reduction of the activity of a nitrogen fixation enzyme and/or a reduction of the expression of a leghemoglobin gene.
The invention also provides an application of the biological material related to the GmCYP35 protein and/or the soybean GmCYP37 protein in regulating and controlling the root nodule development and/or reducing the nitrogen fixation efficiency of the root nodule, wherein the regulating and controlling the root nodule development comprises the following steps: inhibit nodule development and/or promote nodule senescence; the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2;
the biological material comprises any one of the following:
1) A nucleic acid molecule encoding a GmCYP35 protein or a soybean GmCYP37 protein;
2) Recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules of 1).
Preferably, the CDS sequence of the encoding GmCYP35 protein is shown in SEQ ID NO. 3; the CDS sequence of the encoding GmCYP37 protein is shown in SEQ ID NO. 4.
Preferably, the reduction of the root nodule nitrogen fixation efficiency comprises a reduction of the activity of a nitrogen fixation enzyme and/or a reduction of the expression of a leghemoglobin gene.
The invention also provides application of the soybean GmCYP35 protein or the soybean GmCYP37 protein or the biological material in cultivating transgenic plants, wherein the characteristics of the transgenic plants comprise improvement of nitrogen fixation efficiency and/or delay of root nodule aging.
The invention also provides application of the soybean GmCYP35 protein or the soybean GmCYP37 protein or the biological material in cultivating transgenic plants, wherein the characteristics of the transgenic plants comprise reduced nitrogen fixation efficiency and/or accelerated root nodule senescence.
Preferably, the plant comprises a leguminous plant.
Preferably, the leguminous plant comprises one or more of soybean, alfalfa and centella asiatica.
The beneficial effects are that:
the invention provides an application of soybean GmCYP35 protein and/or soybean GmCYP37 protein in regulating and controlling root nodule development and/or reducing root nodule nitrogen fixation efficiency, wherein the regulating and controlling root nodule development comprises the following steps: inhibit nodule development and/or promote nodule senescence; the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2. According to the invention, through the over-expression of the encoding gene of the soybean GmCYP35 protein or the over-expression of the encoding gene of the soybean GmCYP37 protein in the soybean nodule, the condition that the soybean GmCYP35 protein and/or the soybean GmCYP37 protein can regulate and control the plant nodule development and/or the nodule nitrogen fixation efficiency is determined, and the method specifically comprises the steps of reducing the nodule nitrogen fixation efficiency, inhibiting the nodule development and promoting the nodule aging. Therefore, the soybean GmCYP35 gene or the soybean GmCYP37 gene is proved to be a negative regulating factor for regulating the growth of the root nodule and regulating the nitrogen fixation efficiency of the root nodule, so that the gene can be knocked out or the expression of the gene can be interfered by means of gene editing, the senescence of the root nodule and the plant can be delayed, the nitrogen fixation capacity of the plant can be improved, and the soybean GmCYP35 gene has a certain application prospect in the research of nitrogen fixation mechanism of leguminous crops and agricultural production.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a sequence alignment of the GmCYP35 and GmCYP37 proteins;
FIG. 2 is a graph of growth conditions of GmCYP35 overexpressing plants;
FIG. 3 is a graph of growth conditions of GmCYP37 overexpressing plants;
FIG. 4 is a sectional view of root nodules of GmCYP35 overexpressing plants;
FIG. 5 is a sectional view of root nodules of GmCYP37 overexpressing plants;
FIG. 6 is a root nodule chart of a GmCYP35 overexpressing plant;
FIG. 7 is a root nodule chart of a GmCYP37 overexpressing plant;
FIG. 8 is a graph showing the expression of gene in GmCYP35 by fluorescent quantitative PCR; wherein A is the expression level of GmCYP35, B is the expression level of LbA, and C is the expression level of LbC 1;
FIG. 9 is a graph showing the expression of gene in GmCYP37 by fluorescent quantitative PCR; wherein D is the expression level of GmCYP37, E is the expression level of LbA, and F is the expression level of LbC 1;
wherein, control is transferred into an empty carrier plant, and CYP35-OE and CYP37-OE are over-expression plants.
Detailed Description
The invention provides an application of soybean GmCYP35 protein and/or soybean GmCYP37 protein in regulating and controlling root nodule development and/or reducing root nodule nitrogen fixation efficiency, wherein the regulating and controlling root nodule development comprises the following steps: inhibit nodule development and/or promote nodule senescence;
the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO.1, and specifically comprises the following steps:
MVAKNQFYQISLALLFCSGFLAFQVTCRTLQDASMYERHEEWMGRYAKVYKDPQERERRFKIFKENVNYIEAFNNAANKPYTLGINQFADLTNEEFIAPRNRFKGHMCSSITRTTTFKYENVTAIPSTVDWRQKGAVTPIKDQGQCGCCWAFSAVAATEGIHALSAGKLISLSEQEVVDCDTKGEDQGCAGGFMDGAFKFIIQNHGLNNEPNYPYKAVDGKCNAKAAANHVATITGYEDVPVNNEKALQKAVANQPVSVAIDASGSDFQFYQSGVFTGSCGTELDHGVTAVGYGVSADGTEYWLVKNSWGTEWGEEGYIRMQRGVKAEEGLCGIAMMASYPTA；
the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO.2, and specifically comprises the following steps:
MFAKNQFYQISLALLFCSGFLTFQVTCRTLQDASMYERHEEWMGRYAKVYKDPQERERRFKIFKENVNYIEAFNNAANKPYTLGINQFADLTNEEFIAPRNRFKGHMCSSITRTTTFKYENVTAIPSTVDWRQKGAVTPIKDQGQCGCCWAFSAVAATEGIHALSAGKLISLSEQEVVDCDTKGEDQGCAGGFMDGAFKFIIQNHGLNNEPNYPYKAVDGKCNAKAAANHVATITGYEDVPVNNEKALQKAVANQPVSVAIDASGSDFQFYQSGVFTGSCGTELDHGVTAVGYGVSADGTEYWLVKNSWGTEWGEEGYIRMQRGVKAEEGLCGIAMMASYPTA。
in the present invention, the GmCYP35 and GmCYP37 are homologous proteins.
In the present invention, the reduction of the nitrogen fixation efficiency of the root nodule preferably comprises reduction of the activity of the azotase and/or reduction of the expression of the leghemoglobin gene; the leghemoglobin gene preferably includes LbA gene and/or LbC1 gene.
The invention also provides an application of the biological material related to the GmCYP35 protein and/or the soybean GmCYP37 protein in regulating and controlling the root nodule development and/or reducing the nitrogen fixation efficiency of the root nodule, wherein the regulating and controlling the root nodule development comprises the following steps: inhibit nodule development and/or promote nodule senescence; the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2;
the biological material comprises any one of the following:
1) A nucleic acid molecule encoding a GmCYP35 protein or a soybean GmCYP37 protein;
2) Recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules of 1).
In the present invention, the reduction of the nitrogen fixation efficiency of the nodule preferably comprises a reduction of the activity of the nitrogen fixation enzyme and/or a reduction of the expression of the leghemoglobin gene.
In the invention, the CDS sequence encoding the GmCYP35 protein is preferably shown in SEQ ID NO.3, and specifically comprises the following steps:
atggttgccaaaaatcaattctatcaaatttcattggcattgcttttctgttcgggattcttggcttttcaagtcacatgtcgcactcttcaagatgcatccatgtatgagaggcacgaagaatggatgggtcgttatgccaaagtgtataaggaccctcaggaaagggaaaggcgtttcaagatatttaaggaaaatgtgaattacatcgaagccttcaacaatgctgccaacaaaccttacacgctaggcatcaatcaatttgcagacctcaccaatgaggagttcattgcaccaagaaatagattcaaggggcacatgtgttcctcaatcacaagaacaaccacttttaagtatgaaaatgtgactgcaataccatccacagtggattggaggcagaagggtgcagtgacacccatcaaggaccaaggccaatgtggatgttgttgggctttttctgcagttgcagcaactgaaggaattcatgcactgagtgctggaaaattgatatctttgtcagaacaagaagtcgttgattgtgacacaaagggtgaggaccaaggttgtgcaggtggttttatggatggtgctttcaaattcatcatccaaaaccatggactcaacaatgaacccaattacccctataaggctgttgatggaaaatgcaatgctaaggctgcagctaaccacgttgctactattactggctatgaagatgttcctgttaacaatgagaaggcactgcaaaaagctgtggcgaatcaaccagtttctgtagccattgatgccagtggctctgactttcaattttaccagagcggtgtgttcactggttcgtgtggaacagagttagatcacggtgtcactgccgtgggatacggtgttagcgctgatggaactgagtattggttggttaagaactcctggggaaccgagtggggcgaagaaggatacattagaatgcagaggggtgtaaaagctgaggaaggactctgtggcatagctatgatggcatcttaccctactgcataa；
the CDS sequence for encoding the GmCYP37 protein is preferably shown in SEQ ID NO.4, and specifically comprises the following steps:
atgtttgccaaaaatcaattctatcaaatttcattggcattgcttttctgttcgggattcttgacttttcaagtcacatgtcgcactcttcaagatgcatccatgtatgagaggcacgaagaatggatgggtcgttatgccaaagtgtataaggaccctcaggaaagggaaaggcgtttcaagatatttaaggaaaatgtgaattacatcgaagccttcaacaatgctgccaacaaaccttacacgctaggcatcaatcaatttgcagacctcaccaatgaggagttcattgcaccaagaaatagattcaaggggcacatgtgttcctcaatcacaagaacaaccacttttaagtatgaaaatgtgactgcaataccatccacagtggattggaggcagaagggtgcagtgacacccatcaaggaccaaggccaatgtggatgttgttgggctttttctgcagttgcagcaactgaaggaattcatgcactgagtgctggaaaattgatatctttgtcggaacaagaagttgttgattgtgacacaaagggtgaggaccaaggttgtgcaggtggttttatggatggtgctttcaaattcatcatccaaaaccatggactcaacaatgaacccaattacccctataaggctgttgatggaaaatgcaatgctaaggctgcagctaaccacgttgctactattactggctatgaagatgttcctgttaacaatgagaaggcactgcaaaaagctgtggcgaatcaacctgtttctgtagccattgatgccagtggctctgactttcaattttaccagagcggtgtgttcactggttcgtgtggaacagagttagatcacggtgtcactgccgtgggatacggtgttagcgctgatggaactgagtattggttggttaagaactcctggggaaccgagtggggcgaagaaggatacattagaatgcagaggggtgtaaaagctgaggaaggactctgtggcatagctatgatggcatcttaccctactgcataa。
in the present invention, the base vector of the recombinant vector preferably comprises a pLb2-GFP-C'3xFLAG vector; the pLb-GFP-C' 3xFLAG vector is preferably modified according to pUB-GFP C-3xFLAG in the literature [ Yu, H., et al, suppression ofinnate immunity mediated by the CDPK-Rboh complex is required for rhizobial colonization in Medicago truncating agents, new Phytol,2018.220 (2): p.425-434 ]. The nucleic acid molecule is preferably located between the XbaI and StuI cleavage sites of the pLb2-GFP-C'3xFLAG vector.
In the present invention, the recombinant microorganism preferably includes Agrobacterium rhizogenes K599 containing the above-mentioned nucleic acid molecule.
In the present invention, the plant cells of the transgenic plant cell line preferably comprise leguminous plant cells; the leguminous plant preferably comprises one or more of soybean, alfalfa and centella asiatica.
The invention also provides application of the soybean GmCYP35 protein or the soybean GmCYP37 protein or the biological material in cultivating transgenic plants, wherein the characteristics of the transgenic plants comprise improvement of nitrogen fixation efficiency and/or delay of root nodule aging. In the present invention, the use preferably comprises knocking out the gene or interfering with the expression of the gene by means of gene editing. The invention proves that the soybean GmCYP35 gene or the soybean GmCYP37 gene is a negative regulating factor for regulating the growth of the root nodule and the nitrogen fixation efficiency of the root nodule, so that the gene can be knocked out or the expression of the gene can be interfered by a means of gene editing, thereby delaying the senescence of the root nodule and improving the nitrogen fixation capacity of plants.
The invention also provides application of the soybean GmCYP35 protein or the soybean GmCYP37 protein or the biological material in cultivating transgenic plants, wherein the characteristics of the transgenic plants comprise reduced nitrogen fixation efficiency and/or accelerated root nodule senescence.
In the present invention, the plant preferably includes a leguminous plant; the leguminous plant preferably comprises one or more of soybean, alfalfa and centella asiatica.
For further explanation of the present invention, a method and application of controlling nodule development and/or controlling nodule nitrogen fixation efficiency provided by the present invention will be described in detail with reference to the examples, which should not be construed as limiting the scope of the invention.
Example 1
Protein alignment of GmCYP35 (glyma.06g 278000) and GmCYP37 (glyma.06g 279100): the protein sequences of GmCYP35 (Glyma.06G 278000) and GmCYP37 (Glyma.06G 279100) were obtained in the soybean database Phytozome (https:// Phytozome. Jgi. Dov/pz/portal. Html # | Infoalias=org_Gmax) and aligned on-line with Clustal Omega (https:// www.ebi.ac.uk/Tools/msa/clustalo /). The aligned sequences were colored online with ESPrip 3.0 (https:// ESPript. Ibcp. Fr/ESPript/cgi-bin/ESPript. Cgi), the results are shown in FIG. 1; it can be seen that GmCYP35 and GmCYP37 are homologous proteins.
Example 2
Effect of GmCYP35 overexpression on plants.
1. Vector construction
The primer is designed according to the GmCYP35 full-length genome DNA (Glyma.06G278000), soybean root nodule genome is used as a template, and the primers GmCYP35-F and GmCYP35-R are used for carrying out first-round PCR amplification to obtain the CYP35 fragment. And then using the CYP35 fragment as a template, and performing second round amplification by using the primers GmCYP35-XbaI (Gibson) -F and GmCYP35-StuI (Gibson) -R to obtain the GmCYP35 fragment (the nucleotide sequence is shown as SEQ ID NO. 21: atggttgccaaaaatcaattctatcaaatttcattggcattgcttttctgttcgggattcttggcttttcaagtcacatgtcgcactcttcaagatgcatccatgtatgagaggcacgaagaatggatgggtcgttatgccaaagtgtataaggaccctcaggaaagggaaaggcgtttcaagatatttaaggaaaatgtgaattacatcgaagccttcaacaatgctgccaacaaaccttacacgctaggcatcaatcaatttgcagacctcaccaatgaggagttcattgcaccaagaaatagattcaaggggcacatgtgttcctcaatcacaagaacaaccacttttaagtatgaaaatgtgactgcaataccatccacagtggattggaggcagaagggtgcagtgacacccatcaaggaccaaggccaatgtggtaagtgcctgataatttgtttcacaaatcaaattaaattgaattgttatctaataacttttaattttaccttgtattgtaggatgttgttgggctttttctgcagttgcagcaactgaaggaattcatgcactgagtgctggaaaattgatatctttgtcagaacaagaagtcgttgattgtgacacaaagggtgaggaccaaggttgtgcaggtggttttatggatggtgctttcaaattcatcatccaaaaccatggactcaacaatgaacccaattacccctataaggctgttgatggaaaatgcaatgctaaggctgcagctaaccacgttgctactattactggctatgaagatgttcctgttaacaatgagaaggcactgcaaaaagctgtggcgaatcaaccagtttctgtagccattgatgccagtggctctgactttcaattttaccagagcggtgtgttcactggttcgtgtggaacagagttagatcacggtgtcactgccgtgggatacggtgttagcgctgatggaactgagtattggttggttaagaactcctggggaaccgagtggggcgaagaaggatacattagaatgcagaggggtgtaaaagctgaggaaggactctgtggcatagctatgatggcatcttaccctactgcataa).
The nucleotide sequence of the primer is as follows:
GmCYP35-F (forward primer): agcatgtgcaactctcaatcac, SEQ ID NO.5;
GmCYP35-R (reverse primer): aatctgttcaaattggtgatgcgt, SEQ ID NO.6;
GmCYP35-XbaI (Gibson) -F (forward primer): tgatgtgattacagtctagaatggttgccaaaaatcaattc, SEQ ID NO.7;
GmCYP35-StuI (Gibson) -R (reverse primer): ggatccactagtaggtgcagtagggtaagatgccatc, SEQ ID NO.8;
the first and second round PCR amplification systems were both (20. Mu.L): 2X Phanta Max Buffer mu L, dNTP (10 mM each dNTP concentration) 0.5. Mu.L, forward primer (10. Mu.M) 0.5. Mu.L, reverse primer (10. Mu.M) 0.5. Mu.L, phanta Max Super-Fidelity DNAPolymerase (Vazyme) 0.5. Mu.L, template DNA 1. Mu.L and ddH 2 O 7μL；
The first round and the second round of PCR amplification procedures were: pre-denaturation at 95℃for 2min; denaturation at 95℃for 5s, annealing at 57℃for 30s, extension at 72℃for 50s,35 cycles; reacting for 3min at 72 ℃; and 5s at 18 ℃.
After obtaining GmCYP35 fragment, carrying out double enzyme digestion on a pLb2-GFP-C'3xFLAG vector by using XbaI (Thermo, FD 0684) and StuI (Thermo, ER 0421), and connecting with GmCYP35 through a Ginson reaction to obtain a recombinant vector;
the enzyme digestion system is 50 mu L: vector 2. Mu.g, xbaI 1.5. Mu. L, stu I1.5. Mu.L, 10 Xbuffer 5. Mu.L and the balance ddH 2 O；
The Ginson reaction kit was purchased from Hohout Biotechnology (Shanghai) Inc. (Yeasen) under the accession number 10911ES20;
the Ginson reaction system was 5. Mu.L: 2X HieffEnzyme Premix 2.5 μl, gene fragment 100ng, vector 300ng and the rest ddH 2 O；
The Gibbing reaction conditions were: the reaction was carried out at 50℃for 20min.
The vector pLb-GFP-C' 3xFLAG was derived from the vector pUB-GFP C-3xFLAG in the literature [ Yu, H., et al, suppression ofinnate immunity mediated by the CDPK-Rboh complex is required for rhizobial colonization in Medicago truncatula nodules.New Phytol,2018.220 (2): p.425-434 ], comprising: pUB-GFP C-3xFLAG is digested by using restriction enzymes PstI and XbaI (Thermo, FD 0684), and the original Ubiqitin promoter is replaced by a alfalfa leghemoglobin promoter (shown as SEQ ID NO. 20: attgaatccacgcgaatctctcacgagaggaatataacatgtattgagtcactaacttgtattccaccaaagaaaatatctattgacttataagaaaattattgtgtgaaaattataatatatggaaaatataggtgtaacaactccccctttcttaaaaataattgtcgtcaaattttacgataaatatatggaaaattacaatatttcttgaaatggttcttcttcaagtgtaatatttatatatattatttatggtgaaatatcatagttcaaagctatgaatgttggactttattattttttttaagaagctaaaatgaattatataccacacaattggccctcctagtacaaggtgtacttaggaggaaacatcaagagaaacagaaacagtagtgtcagtggcctatatcaaggatggtaaatggactaagttaccagccatgataattgaagagaagagaaacaagtttcaccttcaaccacctaaaggttactgacttgatctcgtccaccacttgtgtaataggactttccatagaattaaagattctgttgtttctttctttccataatttccacgttgttgcaaactagataacttgtaatatcgactgcttcgtttttgtaacaccaccaatatgactaaattgaataaaatgatctaacacattagcgggcatgaccgcagatacacctacccaccgatatatatagttccaaacagagccaaataaattacaatgtaaaaataagtgggaagatgattccacctcgccacatcctcctatacaaactcttcatcatacaaacctagaaaatcaaatttcattggaaaaatctcataaaaaatgataaaatattgtcattttataacataaaagactaaatcgttacaaaaaaaagataaaggacgaaaatgttacctaaaattaagttaagggactaattatgtaattttgccaaattttaaagttactatcttcgagctcccctctattgtagccgaaaaagggtattattttatttaattgtaatttatttgcttaagtttttgaaaagttttttgtctcttaataactacaatggtcacctccacaagccattatattctttaaaaatagaattacaataaaataatacacctctttgcacctcaaactttctatataaacaaaggatgcatgtaactttattgcattcaaaatacaaataataaaacaaaaacaagaaaagagagaaattgatgtgattacag), so that an overexpression vector pLb-GFP-C' 3xFLAG is finally obtained; the cleavage system was 50. Mu.L: carrier 2Mu.g, xbaI 1.5 mu L, stu I1.5 mu.L, 10 Xbuffer 5 mu.L and the balance ddH 2 O。
After obtaining a recombinant vector, the recombinant vector was introduced into agrobacterium rhizogenes (a. Rhizogenes) K599 (NCPPB No. 2659) to obtain agrobacterium rhizogenes K599 containing GmCYP 35.
2. Conversion of soybean roots
FM (Fahraeus medium) liquid medium formulation is: 0.5mM (final concentration) MgSO 4 ·H 2 O, 0.7mM (final concentration) KH 2 PO 4 0.8mM (final concentration) Na 2 HPO 4 ·2H 2 O, 50. Mu.M (final concentration) Fe-EDTA (with FeSO) 4 Formulated with disk EDTA), 0.1 μg MnSO 4 、0.1μg CuSO 4 、0.1μg ZnSO 4 、0.1μg H 3 BO 3 、0.1μg Na 2 MoO 4 Adding ddH 2 Adjusting the pH to 6.5 by adjusting the concentration of O to 1L, sterilizing, and preserving at normal temperature for 6 months; FM medium formulations reference (Toth, K., J.Batek, and G.Stacey, generation ofSoybean (Glycine max) Transient Transgenic roots.Curr Protoc Plant Biol,2016.1 (1): p.1-13.) mother liquor may be prepared and diluted for use, and 1% (w/v) agar added to the solid medium.
The formula of the HM liquid culture medium is as follows: 0.125g Na 2 HPO 4 、0.25g Na 2 SO 4 、0.32g NH 4 Cl、0.18g MgSO 4 ·7H 2 O, 0.25g yeast powder, 1g D-arabinose, 1g sodium gluconate, 0.004g FeCl 3 、0.001g CaCl 2 1.30g HEPES, and 1.10g MES, plus ddH 2 O is regulated to 1L, and NaOH is used for regulating the PH to 6.6;
HM solid medium: 1.5% (w/v) agar was added on the basis of the aforementioned HM liquid medium.
The formula of the LB culture medium is as follows: 10g peptone, 5g yeast powder, 10g NaCl, add ddH 2 O was adjusted to 1L, pH was adjusted to 7.2 with NaOH, and 1.5% (w/v) agar was added to the solid medium.
1) Plant material: sterilizing soybean seeds with chlorine overnight, washing with sterile water for 6 times, soaking the seeds in sterile water for 3h to allow the seeds to swell, rolling the soybean seeds with sterilized filter paper, placing the soybean seeds in a sterilized plastic beaker, adding 1/2 volume of FM liquid culture medium into the plastic beaker, and finally sealing the beaker with a plastic film. After 2d of dark culture at 26 ℃, the culture is continued for 2d at 26 ℃ in an illumination incubator (16 h illumination and 8h darkness).
2) Strains: the soybean agrobacterium rhizogenes K599 containing GmCYP35 is activated on a plate containing plasmid resistance (Kanamycin, 50 mug/mL), and after activation, single colony is picked up and cultured in LB liquid medium at 28-30 ℃ in an oscillating way for 24h. Absorbing 200 mu L of bacterial liquid, coating the bacterial liquid on an LB solid flat plate, and culturing the solid flat plate in an incubator at the temperature of 28-30 ℃ to form a bacterial film of soybean agrobacterium rhizogenes K599 containing GmCYP 35;
meanwhile, the control vector pLb2-GFP-C '3xFLAG was cultured as described above to obtain a bacterial membrane containing the control vector pLb2-GFP-C'3 xFLAG.
3) Infection and cultivation: scraping a bacterial film of the soybean agrobacterium rhizogenes K599 containing the control vector pLb2-GFP-C '3xFLAG and GmCYP35, chamfering the white-green interval of the hypocotyl of the soybean seedling obtained in the step 1) to cut off the hypocotyl, dipping the soybean from which the hypocotyl is cut into the bacterial film of the soybean agrobacterium rhizogenes K599 containing the control vector pLb-GFP-C' 3xFLAG and GmCYP35, and culturing on FM solid culture mediums respectively; the co-culture steps are as follows: the seedlings are firstly cultivated in the dark for 2 days in a 26 ℃ incubator, the agrobacterium on the seedlings is washed clean by sterile water, then the seedlings are placed on a new FM solid culture medium, and the cultivation is continued for about 6 days in a 26 ℃ illumination incubator (16 h illumination, 8h darkness).
4) Rooting: soybean seedlings were taken out and placed in rooting boxes with FM liquid medium added, and cultured in an illumination incubator (16 h illumination, 8h darkness) at 26 ℃ for 8 days.
5) Positive transgenic root identification: positive seedlings were selected under a stereoscopic fluorescent microscope by GFP screening markers and non-positive roots were removed.
6) Rhizobium inoculation: rhizobia (bradyrhizobium japonicum) USDA110 was activated on HM (HEPES-MES) solid plates and then was picked up in HM broth and shake-cultured at 28 ℃ for 3 days. Centrifuging at 7000r/min for 5min, collecting thallus, re-suspending thallus with FM medium, and adjusting concentration to OD 600 ≈0.02，Inoculating to soybean seedling root to obtain hairy root transformed plant. After 4 weeks, the phenotype was observed and the results are shown in figure 2: compared with a Control (Control), the GmCYP35 overexpressed plant turns yellow, the root nodule turns white or green, and the plant appears to be presenility, which indicates that the GmCYP35 overexpressed plant promotes root nodule and plant senescence.
Example 3
Effect of GmCYP37 overexpression on plants.
1. The vector construction procedure was similar to example 2, except that:
the primer is designed according to GmCYP37 genome DNA (Glyma.06G279100), soybean root nodule genome is used as a template, and the primer GmCYP37-F and GmCYP37-R are used for carrying out first PCR amplification to obtain the CYP37 fragment. And then using the CYP37 fragment as a template, and performing second round amplification by using primers GmCYP37-XbaI (Gibson) -F and GmCYP37-StuI (Gibson) -R to obtain the GmCYP37 fragment (the nucleotide sequence is shown as SEQ ID NO. 22: atgtttgccaaaaatcaattctatcaaatttcattggcattgcttttctgttcgggattcttgacttttcaagtcacatgtcgcactcttcaagatgcatccatgtatgagaggcacgaagaatggatgggtcgttatgccaaagtgtataaggaccctcaggaaagggaaaggcgtttcaagatatttaaggaaaatgtgaattacatcgaagccttcaacaatgctgccaacaaaccttacacgctaggcatcaatcaatttgcagacctcaccaatgaggagttcattgcaccaagaaatagattcaaggggcacatgtgttcctcaatcacaagaacaaccacttttaagtatgaaaatgtgactgcaataccatccacagtggattggaggcagaagggtgcagtgacacccatcaaggaccaaggccaatgtggtaagtgcctgataatttgtttcacaaatcaaattaaattgaattgttatctaataacttttaattttaccttgtattgtaggatgttgttgggctttttctgcagttgcagcaactgaaggaattcatgcactgagtgctggaaaattgatatctttgtcggaacaagaagttgttgattgtgacacaaagggtgaggaccaaggttgtgcaggtggttttatggatggtgctttcaaattcatcatccaaaaccatggactcaacaatgaacccaattacccctataaggctgttgatggaaaatgcaatgctaaggctgcagctaaccacgttgctactattactggctatgaagatgttcctgttaacaatgagaaggcactgcaaaaagctgtggcgaatcaacctgtttctgtagccattgatgccagtggctctgactttcaattttaccagagcggtgtgttcactggttcgtgtggaacagagttagatcacggtgtcactgccgtgggatacggtgttagcgctgatggaactgagtattggttggttaagaactcctggggaaccgagtggggcgaagaaggatacattagaatgcagaggggtgtaaaagctgaggaaggactctgtggcatagctatgatggcatcttaccctactgcataa).
The nucleotide sequence of the primer is as follows:
GmCYP37-F (forward primer): tcacacatttcactaaccagcc, SEQ ID NO.9;
GmCYP37-R (reverse primer): aatcgtataagcgtgagtgaga, SEQ ID NO.10;
GmCYP37-XbaI (Gibson) -F (forward primer): tgatgtgattacagtctagaatgtttgccaaaaatcaattc, SEQ ID NO.11;
GmCYP37-StuI (Gibson) -R (reverse primer): ggatccactagtaggtgcagtagggtaagatgccatc, SEQ ID NO.8;
after obtaining a recombinant vector, the recombinant vector was introduced into agrobacterium rhizogenes (a. Rhizogenes) K599 (NCPPB No. 2659) to obtain agrobacterium rhizogenes K599 containing GmCYP 37.
2. The soybean hairy root transformation was similar to example 2, except that the soybean agrobacterium rhizogenes K599 containing GmCYP35 was replaced with the soybean agrobacterium rhizogenes K599 containing GmCYP37 obtained in this example.
4 weeks after obtaining the hairy root transformed plants, the phenotype was observed, and the results are shown in fig. 3: compared with a Control (Control), the GmCYP37 overexpressed plant turns yellow, the root nodule turns white or green, and the plant appears to be presenility, which indicates that the GmCYP37 overexpresses to promote root nodule and plant senescence.
Example 4
Effect of GmCYP35 overexpression on root nodule development
After the soybean hairy root transformed seedlings of example 2 were inoculated with rhizobium USDA for 1104 weeks, the subsurface portions were fixed with FAA fixing solution (Servicebio, G1103-500 mL), paraffin-embedded, sectioned, stained with toluidine blue, and observed with a stereomicroscope, and the results are shown in FIG. 4: the overexpression of GmCYP35 promotes the cracking of symbionts, so that root nodules are aged in advance.
Example 5
Effect of GmCYP37 overexpression on root nodule development
After the soybean hairy root transformed seedlings of example 3 were inoculated with rhizobium USDA for 1104 weeks, the subsurface portions were fixed with FAA fixing solution (Servicebio, G1103-500 mL), paraffin-embedded, sectioned, stained with toluidine blue, and observed with a stereomicroscope, and the results are shown in FIG. 5: the overexpression of GmCYP37 promotes the cracking of symbionts, so that root nodules are aged in advance.
Example 6
Influence of GmCYP35 overexpression on the Nitrogen fixation enzyme Activity
1. Determination of Soybean root nodule Nitrogen-fixing enzyme Activity
After the rhizoctonia solani USDA1104 weeks inoculated with the hairy root transformed plants obtained in example 2, the underground portion of soybean was put into a 40mL glass bottle, 3mL of air was first drawn out of the glass bottle by a syringe, and then 2mL of acetylene gas was injected into the glass bottle by the syringe. The glass bottle was placed in a plastic box containing water, reacted at 28℃for 2 hours, and then taken out, and detected by a gas chromatograph.
2. Ethylene standard curve production
A glass bottle was filled with a volume of ethylene standard gas using a microsyringe, 3 replicates were set for each concentration, and the ethylene peak was detected using a gas chromatograph. The standard curve of ethylene volume versus ethylene peak area is plotted on an excel table.
3. Calculation of the activity of the Nitrogen fixing enzyme
The activity of the root nodule nitrogen fixation enzyme is Acetylene reduction activity (actylene ReductionActivity, ARA), and can be expressed as the mole number of the root nodule per unit weight for reducing Acetylene in unit time, and the calculation formula is as follows: acetylene reduction activity = moles of ethylene per fresh nodule weight x reaction time (unit of enzyme activity: μmol/g.h).
According to the relation between the mole number of the gas and the volume, temperature and pressure, the mole number can be obtained by the volume of ethylene:
C 2 H 4 (μmol)＝C 2 H 4 volume (. Mu.L). Times.1/22.4X1273/(273+t ℃ C.) times.P/760, where: t DEG C: reaction temperature (temperature of celsius, 28), P: the air pressure, typically 760 mmHg, 22.4: the volume of 1mol of gas in the standard state is 22.4 liters; 273: absolute temperature.
Fresh weight of each plant nodule was weighed separately. The results are shown in FIG. 6 and Table 1.
TABLE 1 determination of the Nitrogen fixation enzyme Activity of control plants and GmCYP35 overexpressing plants
As can be seen from table 1, compared with the control, the activity of GmCYP35 overexpressing the nitrogen fixation enzyme was reduced, demonstrating that GmCYP35 overexpression promotes root nodule senescence.
Example 7
Effect of GmCYP37 overexpression on the activity of the azotase the experimental procedure was similar to example 6, except that the hairy root transformed plant obtained in example 2 was replaced with the hairy root transformed plant obtained in example 3.
Fresh weight of each plant nodule was weighed separately. The results are shown in FIG. 7 and Table 2.
TABLE 2 determination of the Nitrogen fixation enzyme Activity of control plants and GmCYP37 overexpressing plants
As can be seen from table 2, compared with the control, gmCYP37 overexpressing nitrogenase activity was reduced, demonstrating that GmCYP37 overexpression promotes root nodule senescence.
Example 8
Fluorescent quantitative PCR (polymerase chain reaction) detection of gene expression level in GmCYP35 over-expression root nodule
After soybean hairy root transformed seedlings in example 2 were inoculated with rhizobium USDA for 1104 weeks, rhizomes of control plants and GmCYP35 overexpressing plants were harvested, RNA of the rhizomes was extracted, and expression levels of GmCYP35 and leghemoglobin genes (LbA and LbC 1) were detected by fluorescent quantitative PCR, respectively.
The RNA extraction method comprises the following steps: total RNA from soybean nodules was extracted using RNA extraction kit (Aidlab, RN 3302). Specific methods refer to the kit operating manual. After RNA elution, the concentration and purity of RNA was checked using NanoDrop 2000 (Thermo) and the samples were stored at-70 ℃.
The reverse transcription method comprises the following steps: reverse transcription was performed using a reverse transcription kit (ABcloanl, RK 20403) to obtain a cDNA template. Specific methods refer to the kit operating manual.
The fluorescent quantitative PCR primer is (the final F of the primer is a forward primer, and R is a reverse primer):
ACT11-qRT-F：atcttgactgagcgtggttattcc，SEQ ID NO.12；
ACT11-qRT-R：gctggtcctggctgtctcc，SEQ ID NO.13；
GmCYP35-qRT-F：aaggctgcagctaaccacg，SEQ ID NO.14；
GmCYP35-qRT-R：tgaacacaccgctctggta，SEQ ID NO.15；
GmLbA-qRT-F：gaaggcataattagtatctattg，SEQ ID NO.16；
GmLbA-qRT-R：tatcaggaacttgtctaatag，SEQ ID NO.17；
GmLbC1-qRT-F：acaataaaggaagctgttggcgg，SEQ ID NO.18；
GmLbC1-qRT-R：ttacactttacggcaatgcag，SEQ ID NO.19。
the fluorescent quantitative PCR system was (10. Mu.L): SYBR Select master mix (ABI, 2×) 5. Mu.L, forward primer (10. Mu.M) 0.4. Mu.L, reverse primer (10. Mu.M) 0.4. Mu. L, cDNA template 0.4. Mu.L and ddH 2 O 3.8μL；
The fluorescent quantitative PCR procedure was: 50 ℃ for 2min;95 ℃ for 10min; 15s at 95℃and 1min at 60℃for 40 cycles.
The soybean housekeeping gene ACT11 is taken as an internal reference gene to standardize the gene expression level, and the quantitative method adopts relative quantification △△Ct The relative expression level was the ratio of the expression level of the target gene to the expression level of the reference gene, and the results are shown in FIG. 8 and Table 3.
TABLE 3 expression levels of different genes in different plants
Plants and methods of making the same GmCYP35 gene LbA gene LbC1 gene
Control 1.23 0.99 1.00
GmCYP35-OE 19.37 0.05 0.09
As can be seen from table 3 and fig. 8, in the GmCYP35 overexpressing nodule, the expression level of GmCYP35 was higher than that of the control nodule, and the expression levels of leghemoglobin genes LbA, lbC1 were lower than that of the control nodule, indicating that the nitrogen fixation level of the GmCYP35 overexpressing nodule was lower than that of the control nodule.
Example 9
Fluorescent quantitative PCR (polymerase chain reaction) detection of gene expression level in GmCYP37 over-expression root nodule
After soybean hairy root transformed seedlings in example 3 were inoculated with rhizobium USDA for 1104 weeks, rhizomes of control plants and GmCYP37 overexpressing plants were harvested, RNA of the rhizomes was extracted, and expression levels of GmCYP37 and leghemoglobin genes (LbA and LbC 1) were detected by fluorescent quantitative PCR, respectively.
The RNA extraction method was the same as in example 8.
The reverse transcription method was the same as in example 8.
The fluorescent quantitative PCR primer was the same as in example 8.
The fluorescent quantitative PCR system was (10. Mu.L): SYBR Select master mix (ABI, 2×) 5. Mu.L, forward primer (10. Mu.M) 0.4. Mu.L, reverse primer (10. Mu.M) 0.4. Mu. L, cDNA template 0.4. Mu.L and ddH 2 O 3.8μL；
The fluorescent quantitative PCR procedure was: 50 ℃ for 2min;95 ℃ for 10min; 15s at 95℃and 1min at 60℃for 40 cycles.
The soybean housekeeping gene ACT11 is taken as an internal reference gene to standardize the gene expression level, and the quantitative method adopts relative quantification △△Ct The relative expression level was the ratio of the expression level of the target gene to the expression level of the reference gene, and the results are shown in FIG. 9 and Table 4.
TABLE 3 expression levels of different genes in different plants
Plants and methods of making the same GmCYP37 gene LbA gene LbC1 gene
Control 1.08 1.77 1.61
GmCYP37-OE 243.75 0.32 0.38
As can be seen from table 4 and fig. 9, in the GmCYP37 overexpressing nodules, the expression level of GmCYP37 was higher than that of the control nodules, and the expression levels of leghemoglobin genes LbA, lbC1 were lower than that of the control nodules, indicating that the nitrogen fixation level of the GmCYP37 overexpressing nodules was lower than that of the control nodules.
In conclusion, the invention determines that the soybean GmCYP35 protein and/or the soybean GmCYP37 protein can regulate and control plant nodule development and/or nodule nitrogen fixation efficiency by overexpressing the encoding gene of the soybean GmCYP35 protein or the encoding gene of the soybean GmCYP37 protein in the soybean nodule, and specifically comprises the steps of reducing the nodule nitrogen fixation efficiency, inhibiting the nodule development and promoting the nodule aging. Therefore, the soybean GmCYP35 gene or the soybean GmCYP37 gene is proved to be a negative regulating factor for regulating the growth of the root nodule and regulating the nitrogen fixation efficiency of the root nodule, so that the gene can be knocked out or the expression of the gene can be interfered by means of gene editing, the senescence of the root nodule and the plant can be delayed, the nitrogen fixation capacity of the plant can be improved, and the soybean GmCYP35 gene has a certain application prospect in the research of nitrogen fixation mechanism of leguminous crops and agricultural production.
While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.
Sequence listing
<110> university of agriculture in China
<120> a method for controlling root nodule development and/or controlling root nodule nitrogen fixation efficiency and application thereof
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 343
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Met Val Ala Lys Asn Gln Phe Tyr Gln Ile Ser Leu Ala Leu Leu Phe
1 5 10 15
Cys Ser Gly Phe Leu Ala Phe Gln Val Thr Cys Arg Thr Leu Gln Asp
20 25 30
Ala Ser Met Tyr Glu Arg His Glu Glu Trp Met Gly Arg Tyr Ala Lys
35 40 45
Val Tyr Lys Asp Pro Gln Glu Arg Glu Arg Arg Phe Lys Ile Phe Lys
50 55 60
Glu Asn Val Asn Tyr Ile Glu Ala Phe Asn Asn Ala Ala Asn Lys Pro
65 70 75 80
Tyr Thr Leu Gly Ile Asn Gln Phe Ala Asp Leu Thr Asn Glu Glu Phe
85 90 95
Ile Ala Pro Arg Asn Arg Phe Lys Gly His Met Cys Ser Ser Ile Thr
100 105 110
Arg Thr Thr Thr Phe Lys Tyr Glu Asn Val Thr Ala Ile Pro Ser Thr
115 120 125
Val Asp Trp Arg Gln Lys Gly Ala Val Thr Pro Ile Lys Asp Gln Gly
130 135 140
Gln Cys Gly Cys Cys Trp Ala Phe Ser Ala Val Ala Ala Thr Glu Gly
145 150 155 160
Ile His Ala Leu Ser Ala Gly Lys Leu Ile Ser Leu Ser Glu Gln Glu
165 170 175
Val Val Asp Cys Asp Thr Lys Gly Glu Asp Gln Gly Cys Ala Gly Gly
180 185 190
Phe Met Asp Gly Ala Phe Lys Phe Ile Ile Gln Asn His Gly Leu Asn
195 200 205
Asn Glu Pro Asn Tyr Pro Tyr Lys Ala Val Asp Gly Lys Cys Asn Ala
210 215 220
Lys Ala Ala Ala Asn His Val Ala Thr Ile Thr Gly Tyr Glu Asp Val
225 230 235 240
Pro Val Asn Asn Glu Lys Ala Leu Gln Lys Ala Val Ala Asn Gln Pro
245 250 255
Val Ser Val Ala Ile Asp Ala Ser Gly Ser Asp Phe Gln Phe Tyr Gln
260 265 270
Ser Gly Val Phe Thr Gly Ser Cys Gly Thr Glu Leu Asp His Gly Val
275 280 285
Thr Ala Val Gly Tyr Gly Val Ser Ala Asp Gly Thr Glu Tyr Trp Leu
290 295 300
Val Lys Asn Ser Trp Gly Thr Glu Trp Gly Glu Glu Gly Tyr Ile Arg
305 310 315 320
Met Gln Arg Gly Val Lys Ala Glu Glu Gly Leu Cys Gly Ile Ala Met
325 330 335
Met Ala Ser Tyr Pro Thr Ala
340
<210> 2
<211> 343
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Phe Ala Lys Asn Gln Phe Tyr Gln Ile Ser Leu Ala Leu Leu Phe
1 5 10 15
Cys Ser Gly Phe Leu Thr Phe Gln Val Thr Cys Arg Thr Leu Gln Asp
20 25 30
Ala Ser Met Tyr Glu Arg His Glu Glu Trp Met Gly Arg Tyr Ala Lys
35 40 45
Val Tyr Lys Asp Pro Gln Glu Arg Glu Arg Arg Phe Lys Ile Phe Lys
50 55 60
Glu Asn Val Asn Tyr Ile Glu Ala Phe Asn Asn Ala Ala Asn Lys Pro
65 70 75 80
Tyr Thr Leu Gly Ile Asn Gln Phe Ala Asp Leu Thr Asn Glu Glu Phe
85 90 95
Ile Ala Pro Arg Asn Arg Phe Lys Gly His Met Cys Ser Ser Ile Thr
100 105 110
Arg Thr Thr Thr Phe Lys Tyr Glu Asn Val Thr Ala Ile Pro Ser Thr
115 120 125
Val Asp Trp Arg Gln Lys Gly Ala Val Thr Pro Ile Lys Asp Gln Gly
130 135 140
Gln Cys Gly Cys Cys Trp Ala Phe Ser Ala Val Ala Ala Thr Glu Gly
145 150 155 160
Ile His Ala Leu Ser Ala Gly Lys Leu Ile Ser Leu Ser Glu Gln Glu
165 170 175
Val Val Asp Cys Asp Thr Lys Gly Glu Asp Gln Gly Cys Ala Gly Gly
180 185 190
Phe Met Asp Gly Ala Phe Lys Phe Ile Ile Gln Asn His Gly Leu Asn
195 200 205
Asn Glu Pro Asn Tyr Pro Tyr Lys Ala Val Asp Gly Lys Cys Asn Ala
210 215 220
Lys Ala Ala Ala Asn His Val Ala Thr Ile Thr Gly Tyr Glu Asp Val
225 230 235 240
Pro Val Asn Asn Glu Lys Ala Leu Gln Lys Ala Val Ala Asn Gln Pro
245 250 255
Val Ser Val Ala Ile Asp Ala Ser Gly Ser Asp Phe Gln Phe Tyr Gln
260 265 270
Ser Gly Val Phe Thr Gly Ser Cys Gly Thr Glu Leu Asp His Gly Val
275 280 285
Thr Ala Val Gly Tyr Gly Val Ser Ala Asp Gly Thr Glu Tyr Trp Leu
290 295 300
Val Lys Asn Ser Trp Gly Thr Glu Trp Gly Glu Glu Gly Tyr Ile Arg
305 310 315 320
Met Gln Arg Gly Val Lys Ala Glu Glu Gly Leu Cys Gly Ile Ala Met
325 330 335
Met Ala Ser Tyr Pro Thr Ala
340
<210> 3
<211> 1032
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggttgcca aaaatcaatt ctatcaaatt tcattggcat tgcttttctg ttcgggattc 60
ttggcttttc aagtcacatg tcgcactctt caagatgcat ccatgtatga gaggcacgaa 120
gaatggatgg gtcgttatgc caaagtgtat aaggaccctc aggaaaggga aaggcgtttc 180
aagatattta aggaaaatgt gaattacatc gaagccttca acaatgctgc caacaaacct 240
tacacgctag gcatcaatca atttgcagac ctcaccaatg aggagttcat tgcaccaaga 300
aatagattca aggggcacat gtgttcctca atcacaagaa caaccacttt taagtatgaa 360
aatgtgactg caataccatc cacagtggat tggaggcaga agggtgcagt gacacccatc 420
aaggaccaag gccaatgtgg atgttgttgg gctttttctg cagttgcagc aactgaagga 480
attcatgcac tgagtgctgg aaaattgata tctttgtcag aacaagaagt cgttgattgt 540
gacacaaagg gtgaggacca aggttgtgca ggtggtttta tggatggtgc tttcaaattc 600
atcatccaaa accatggact caacaatgaa cccaattacc cctataaggc tgttgatgga 660
aaatgcaatg ctaaggctgc agctaaccac gttgctacta ttactggcta tgaagatgtt 720
cctgttaaca atgagaaggc actgcaaaaa gctgtggcga atcaaccagt ttctgtagcc 780
attgatgcca gtggctctga ctttcaattt taccagagcg gtgtgttcac tggttcgtgt 840
ggaacagagt tagatcacgg tgtcactgcc gtgggatacg gtgttagcgc tgatggaact 900
gagtattggt tggttaagaa ctcctgggga accgagtggg gcgaagaagg atacattaga 960
atgcagaggg gtgtaaaagc tgaggaagga ctctgtggca tagctatgat ggcatcttac 1020
cctactgcat aa 1032
<210> 4
<211> 1032
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
atgtttgcca aaaatcaatt ctatcaaatt tcattggcat tgcttttctg ttcgggattc 60
ttgacttttc aagtcacatg tcgcactctt caagatgcat ccatgtatga gaggcacgaa 120
gaatggatgg gtcgttatgc caaagtgtat aaggaccctc aggaaaggga aaggcgtttc 180
aagatattta aggaaaatgt gaattacatc gaagccttca acaatgctgc caacaaacct 240
tacacgctag gcatcaatca atttgcagac ctcaccaatg aggagttcat tgcaccaaga 300
aatagattca aggggcacat gtgttcctca atcacaagaa caaccacttt taagtatgaa 360
aatgtgactg caataccatc cacagtggat tggaggcaga agggtgcagt gacacccatc 420
aaggaccaag gccaatgtgg atgttgttgg gctttttctg cagttgcagc aactgaagga 480
attcatgcac tgagtgctgg aaaattgata tctttgtcgg aacaagaagt tgttgattgt 540
gacacaaagg gtgaggacca aggttgtgca ggtggtttta tggatggtgc tttcaaattc 600
atcatccaaa accatggact caacaatgaa cccaattacc cctataaggc tgttgatgga 660
aaatgcaatg ctaaggctgc agctaaccac gttgctacta ttactggcta tgaagatgtt 720
cctgttaaca atgagaaggc actgcaaaaa gctgtggcga atcaacctgt ttctgtagcc 780
attgatgcca gtggctctga ctttcaattt taccagagcg gtgtgttcac tggttcgtgt 840
ggaacagagt tagatcacgg tgtcactgcc gtgggatacg gtgttagcgc tgatggaact 900
gagtattggt tggttaagaa ctcctgggga accgagtggg gcgaagaagg atacattaga 960
atgcagaggg gtgtaaaagc tgaggaagga ctctgtggca tagctatgat ggcatcttac 1020
cctactgcat aa 1032
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
agcatgtgca actctcaatc ac 22
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aatctgttca aattggtgat gcgt 24
<210> 7
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
tgatgtgatt acagtctaga atggttgcca aaaatcaatt c 41
<210> 8
<211> 37
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
ggatccacta gtaggtgcag tagggtaaga tgccatc 37
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
tcacacattt cactaaccag cc 22
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
aatcgtataa gcgtgagtga ga 22
<210> 11
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tgatgtgatt acagtctaga atgtttgcca aaaatcaatt c 41
<210> 12
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
atcttgactg agcgtggtta ttcc 24
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
gctggtcctg gctgtctcc 19
<210> 14
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
aaggctgcag ctaaccacg 19
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
tgaacacacc gctctggta 19
<210> 16
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
gaaggcataa ttagtatcta ttg 23
<210> 17
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
tatcaggaac ttgtctaata g 21
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
acaataaagg aagctgttgg cgg 23
<210> 19
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
ttacacttta cggcaatgca g 21
<210> 20
<211> 1261
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
attgaatcca cgcgaatctc tcacgagagg aatataacat gtattgagtc actaacttgt 60
attccaccaa agaaaatatc tattgactta taagaaaatt attgtgtgaa aattataata 120
tatggaaaat ataggtgtaa caactccccc tttcttaaaa ataattgtcg tcaaatttta 180
cgataaatat atggaaaatt acaatatttc ttgaaatggt tcttcttcaa gtgtaatatt 240
tatatatatt atttatggtg aaatatcata gttcaaagct atgaatgttg gactttatta 300
ttttttttaa gaagctaaaa tgaattatat accacacaat tggccctcct agtacaaggt 360
gtacttagga ggaaacatca agagaaacag aaacagtagt gtcagtggcc tatatcaagg 420
atggtaaatg gactaagtta ccagccatga taattgaaga gaagagaaac aagtttcacc 480
ttcaaccacc taaaggttac tgacttgatc tcgtccacca cttgtgtaat aggactttcc 540
atagaattaa agattctgtt gtttctttct ttccataatt tccacgttgt tgcaaactag 600
ataacttgta atatcgactg cttcgttttt gtaacaccac caatatgact aaattgaata 660
aaatgatcta acacattagc gggcatgacc gcagatacac ctacccaccg atatatatag 720
ttccaaacag agccaaataa attacaatgt aaaaataagt gggaagatga ttccacctcg 780
ccacatcctc ctatacaaac tcttcatcat acaaacctag aaaatcaaat ttcattggaa 840
aaatctcata aaaaatgata aaatattgtc attttataac ataaaagact aaatcgttac 900
aaaaaaaaga taaaggacga aaatgttacc taaaattaag ttaagggact aattatgtaa 960
ttttgccaaa ttttaaagtt actatcttcg agctcccctc tattgtagcc gaaaaagggt 1020
attattttat ttaattgtaa tttatttgct taagtttttg aaaagttttt tgtctcttaa 1080
taactacaat ggtcacctcc acaagccatt atattcttta aaaatagaat tacaataaaa 1140
taatacacct ctttgcacct caaactttct atataaacaa aggatgcatg taactttatt 1200
gcattcaaaa tacaaataat aaaacaaaaa caagaaaaga gagaaattga tgtgattaca 1260
g 1261
<210> 21
<211> 1114
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
atggttgcca aaaatcaatt ctatcaaatt tcattggcat tgcttttctg ttcgggattc 60
ttggcttttc aagtcacatg tcgcactctt caagatgcat ccatgtatga gaggcacgaa 120
gaatggatgg gtcgttatgc caaagtgtat aaggaccctc aggaaaggga aaggcgtttc 180
aagatattta aggaaaatgt gaattacatc gaagccttca acaatgctgc caacaaacct 240
tacacgctag gcatcaatca atttgcagac ctcaccaatg aggagttcat tgcaccaaga 300
aatagattca aggggcacat gtgttcctca atcacaagaa caaccacttt taagtatgaa 360
aatgtgactg caataccatc cacagtggat tggaggcaga agggtgcagt gacacccatc 420
aaggaccaag gccaatgtgg taagtgcctg ataatttgtt tcacaaatca aattaaattg 480
aattgttatc taataacttt taattttacc ttgtattgta ggatgttgtt gggctttttc 540
tgcagttgca gcaactgaag gaattcatgc actgagtgct ggaaaattga tatctttgtc 600
agaacaagaa gtcgttgatt gtgacacaaa gggtgaggac caaggttgtg caggtggttt 660
tatggatggt gctttcaaat tcatcatcca aaaccatgga ctcaacaatg aacccaatta 720
cccctataag gctgttgatg gaaaatgcaa tgctaaggct gcagctaacc acgttgctac 780
tattactggc tatgaagatg ttcctgttaa caatgagaag gcactgcaaa aagctgtggc 840
gaatcaacca gtttctgtag ccattgatgc cagtggctct gactttcaat tttaccagag 900
cggtgtgttc actggttcgt gtggaacaga gttagatcac ggtgtcactg ccgtgggata 960
cggtgttagc gctgatggaa ctgagtattg gttggttaag aactcctggg gaaccgagtg 1020
gggcgaagaa ggatacatta gaatgcagag gggtgtaaaa gctgaggaag gactctgtgg 1080
catagctatg atggcatctt accctactgc ataa 1114
<210> 22
<211> 1114
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
atgtttgcca aaaatcaatt ctatcaaatt tcattggcat tgcttttctg ttcgggattc 60
ttgacttttc aagtcacatg tcgcactctt caagatgcat ccatgtatga gaggcacgaa 120
gaatggatgg gtcgttatgc caaagtgtat aaggaccctc aggaaaggga aaggcgtttc 180
aagatattta aggaaaatgt gaattacatc gaagccttca acaatgctgc caacaaacct 240
tacacgctag gcatcaatca atttgcagac ctcaccaatg aggagttcat tgcaccaaga 300
aatagattca aggggcacat gtgttcctca atcacaagaa caaccacttt taagtatgaa 360
aatgtgactg caataccatc cacagtggat tggaggcaga agggtgcagt gacacccatc 420
aaggaccaag gccaatgtgg taagtgcctg ataatttgtt tcacaaatca aattaaattg 480
aattgttatc taataacttt taattttacc ttgtattgta ggatgttgtt gggctttttc 540
tgcagttgca gcaactgaag gaattcatgc actgagtgct ggaaaattga tatctttgtc 600
ggaacaagaa gttgttgatt gtgacacaaa gggtgaggac caaggttgtg caggtggttt 660
tatggatggt gctttcaaat tcatcatcca aaaccatgga ctcaacaatg aacccaatta 720
cccctataag gctgttgatg gaaaatgcaa tgctaaggct gcagctaacc acgttgctac 780
tattactggc tatgaagatg ttcctgttaa caatgagaag gcactgcaaa aagctgtggc 840
gaatcaacct gtttctgtag ccattgatgc cagtggctct gactttcaat tttaccagag 900
cggtgtgttc actggttcgt gtggaacaga gttagatcac ggtgtcactg ccgtgggata 960
cggtgttagc gctgatggaa ctgagtattg gttggttaag aactcctggg gaaccgagtg 1020
gggcgaagaa ggatacatta gaatgcagag gggtgtaaaa gctgaggaag gactctgtgg 1080
catagctatg atggcatctt accctactgc ataa 1114

Claims (9)

1. Use of soybean GmCYP35 protein and/or soybean GmCYP37 protein for regulating nodule development and/or reducing nodule nitrogen fixation efficiency, characterized in that the regulating of nodule development comprises: inhibit nodule development and/or promote nodule senescence;
the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2.
2. The use according to claim 1, wherein said reducing the nitrogen fixation efficiency of the nodule comprises reducing the activity of a azotase and/or reducing the expression of a leghemoglobin gene.
3. Use of a biological material related to GmCYP35 protein and/or soybean GmCYP37 protein for modulating nodule development and/or reducing nodule nitrogen fixation efficiency, wherein modulating nodule development comprises: inhibit nodule development and/or promote nodule senescence; the amino acid sequence of the GmCYP35 protein is shown in SEQ ID NO. 1; the amino acid sequence of the GmCYP37 protein is shown in SEQ ID NO. 2;
the biological material comprises any one of the following:
1) A nucleic acid molecule encoding a GmCYP35 protein or a soybean GmCYP37 protein;
2) Recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules of 1).
4. The use according to claim 3, wherein the CDS sequence encoding GmCYP35 protein is shown in SEQ ID No. 3; the CDS sequence of the encoding GmCYP37 protein is shown in SEQ ID NO. 4.
5. The use according to claim 3 or 4, wherein said reducing the nitrogen fixation efficiency of the nodule comprises reducing the activity of a azotase and/or reducing the expression of a leghemoglobin gene.
6. Use of the soybean GmCYP35 protein or soybean GmCYP37 protein as claimed in claim 1 or 2 or the biological material as claimed in any one of claims 3 to 5 for the cultivation of transgenic plants, characterized in that the traits of said transgenic plants comprise increased nitrogen fixation efficiency and/or delayed root nodule senescence.
7. Use of the soybean GmCYP35 protein or soybean GmCYP37 protein as claimed in claim 1 or 2 or the biological material as claimed in any one of claims 3 to 5 for the cultivation of transgenic plants, characterized in that the traits of said transgenic plants comprise reduced nitrogen fixation efficiency and/or accelerated root nodule senescence.
8. The use according to claim 6 or 7, wherein the plants comprise leguminous plants.
9. The use according to claim 8, wherein the leguminous plants comprise one or more of soybean, alfalfa and centella asiatica.
CN202210432812.8A 2022-04-24 2022-04-24 Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application Pending CN116970578A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210432812.8A CN116970578A (en) 2022-04-24 2022-04-24 Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210432812.8A CN116970578A (en) 2022-04-24 2022-04-24 Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application

Publications (1)

Publication Number Publication Date
CN116970578A true CN116970578A (en) 2023-10-31

Family

ID=88478376

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210432812.8A Pending CN116970578A (en) 2022-04-24 2022-04-24 Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application

Country Status (1)

Country Link
CN (1) CN116970578A (en)

Similar Documents

Publication Publication Date Title
CN107435047B (en) Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof
CN114717215B (en) Application of soybean GmLecRLK1 gene in regulation and control of nitrogen fixation efficiency and/or yield of plant root nodule
CN113604490B (en) Kiwi fruit canker susceptibility gene AcBXL1 and application thereof
CN112626080B (en) R gene for controlling soybean-rhizobium matching property, protein and application thereof
CN115043917A (en) Application of soybean GmNAC039 or GmNAC018 in regulation and control of nitrogen fixation and/or yield of plant nodules
CN110283829B (en) Intermediate complex subunit OsMEDdicator 16 gene for regulating rice blast resistance
CN113788886B (en) Application of cucumber photosynthetic system II oxygen evolution enhancement protein CsPSII-OEEP in resistance to melon epidemic diseases
CN113621625B (en) Application of sesame SiERF103 gene in enhancing plant resistance
CN100540665C (en) Regulate the gene of plant branching, contain the carrier of this gene,, and utilize this microorganism to regulate the method for plant branching by this carrier microorganism transformed
CN108517324A (en) One NtIPMD gene for influencing tobacco axillary bud differentiation
CN117430678A (en) Immune induced resistance protein from wheat stripe rust and related biological material and application thereof
CN108220304B (en) Application of wheat stripe rust PSTG _06371 gene in stripe rust prevention and control and stripe rust resistant wheat cultivation method
CN114149998B (en) Wheat TaPT1 gene and application thereof
CN116970578A (en) Method for regulating and controlling root nodule development and/or regulating and controlling root nodule nitrogen fixation efficiency and application
CN114525298B (en) Application of soybean protein GmFVE in regulation and control of salt tolerance of plants
CN113969270A (en) Application of plant infection-related protein TaCIPK14 in regulation and control of stripe rust resistance of plants
CN112898395A (en) Aluminum-resistant related gene GmNAC069, and coding protein and application thereof
CN106282200B (en) Application of the sea island cotton GbNAC1 in resisting verticillium
CN113788885B (en) Application of cucumber photosynthetic system I reaction center N subunit protein CsPSI-N in resistance to melon epidemic diseases
CN113788887B (en) Cucumber photosynthetic system II reaction center protein CsPSII-CP47 and application thereof in resisting melon epidemic disease
KR101677483B1 (en) Antibiotic marker-free transgenic rice with over-expressed of OsNAS3 gene from Oryza sativa enhancing content of seed inorganic compounds
CN113789315B (en) Application of cucumber lipophosphophosphatase CsLPP epsilon 2 in resisting melon epidemic disease
CN114106120B (en) Heavy metal transport protein PhHMA5II-1 and related products and application thereof
KR101602883B1 (en) Antibiotic marker-free transgenic rice with over-expressed high affinity phosphate transporter OsPT7 gene from Oryza sativa
CN116497054B (en) Application of GmSGT1 gene in controlling soybean nodulation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination