CN116970048A - Rice fertility gene OsRIP1 and application thereof - Google Patents

Abstract

The invention discloses a rice dominant genic male sterile protein OsRIP1, the amino acid sequence of which is shown as SEQ ID NO.1, the nucleotide sequence of the encoding gene of which is shown as SEQ ID NO.2, and the rice dominant genic male sterile protein OsRIP1 or the encoding gene thereof or rice dominant genic male sterile materialDms1The application in rice breeding. The invention opens the door for the utilization of plant heterosis, has important production application value, can more effectively and simply carry out recurrent selection and population improvement, and can also be used for polymerizing a plurality of key high-quality genes. The genes of the present invention can be utilized in the future,the dominant genic male sterile material can greatly improve the rice breeding efficiency, is favorable for creating excellent and heterologous sources and improving the hybridization efficiency, and can cultivate high-quality rice varieties with high yield, strong stress resistance and wide adaptability, thereby having important utilization value in plant breeding.

Description

Rice fertility gene OsRIP1 and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a rice fertility gene OsRIP1 and application thereof.

Background

Rice fertility is a key factor affecting rice yield, and in flowering plants, male gamete reproductive development is an important biological process, and is also a growth process commonly experienced by higher plants. Plant male sterility refers to the genetic phenomenon that stamens cannot produce male gametophytes with normal functions (such as no pollen in anthers, pollen abortion, no anther cracking and the like) due to physiological or genetic reasons in sexual reproduction, but pistils develop normally, and can accept external mature pollen to fertilize and set normally.

Male sterility is a phenomenon commonly existing in flowering plants, opens the door for utilizing plant heterosis, and has important production and application values. The most successful applications of self-pollinated plant heterosis are the discovery of sterile lines of rice and the large-area application of hybrid rice. Male sterility of plants refers to the failure of anthers, pollen or male gametophytes due to dysplasia, which is mainly manifested by the lack of normal anthers, pollen or male gametes, but normal pistil development, which can accept exogenous pollen for fertilization and fructification. Plant male sterility provides important materials for researching pollen development, cytoplasmic inheritance and nuclear-cytoplasmic interaction, and also becomes an important tool for developing crop heterosis, recurrent selection and population improvement.

At present, the cloned nuclear sterility related genes in plants are basically recessive, and the cloning of dominant nuclear sterility genes is rarely reported, and the reason is probably that natural mutation is mostly recessive mutation and dominant mutation is very few. To date, 24 dominant genic male sterile materials have been found only on over 10 crops, and therefore are a very rare and valuable breeding and research material. The dominant genic male sterile wheat of the Taigu is valuable wheat genetic resource in China, and has important application in the aspects of wheat breeding, germplasm innovation and the like. Liu in order of China et al establish and utilize dwarf-male-sterile wheat to develop the wheat high-efficient breeding system "mainly select round and multiple ways are used comprehensively" on the basis of the sterility of Taigu. The breeding system comprises the processes of basic population construction, parent selection and control, excellent gene introduction, elimination of bad plants, population improvement, excellent variety breeding and the like.

OsRIP1 encodes a Ribosome-inactivating protein (RIP). RIP is widely distributed in monocots and can bind to mammalian ribosomes, destroying the S/RLoop of rRNA by depurination, rendering the ribosome useless for translation. The biochemical functions of RIP have been widely reported, but the physiological functions of RIP in plants remain unclear, and no report has been made so far on the influence of RIP on plant fertility. Can create dominant genic male sterile rice when the OsRIP1 is specifically expressed in rice anther.

Disclosure of Invention

The invention provides a dominant genic male sterile related gene OsRIP1, the discovery and application of the dominant genic male sterile gene of rice opens the door for the utilization of plant heterosis, has important production and application values, can more effectively and simply carry out recurrent selection and population improvement, and can also be used for polymerizing a plurality of key high-quality genes. The gene of the invention can be utilized in the future, the rice breeding efficiency can be greatly improved by creating dominant genic male sterile materials, the invention is favorable for creating excellent heterologous sources and improving the hybridization efficiency, and the invention can cultivate high-quality rice varieties with high yield, strong stress resistance and wide adaptability, thereby having important utilization value in plant breeding.

The invention aims at providing a ribosome inactivating protein OsRIP1.

The second purpose of the invention is to provide a dominant genic male sterile gene OsRIP1.

The invention further aims at providing an application of the key gene OsRIP1 for creating dominant genic male sterile materials.

Wherein the relevant biological material can be a nucleic acid molecule capable of expressing the OsRIP1 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

The expression cassette refers to DNA capable of expressing OsRIP1 in a host cell, and the DNA can comprise a promoter for starting the transcription of the OsRIP1 gene and a terminator for stopping the transcription of the OsRIP1 gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: ubiquitin gene Ubiqutin promoter (pUbi); a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin and soybean beta-glycin (Beachy et al (1985) EMBO J.4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Constructing a recombinant expression vector containing the OsRIP1 gene expression cassette. The plant expression vector used may be a binary Agrobacterium vector or a Gateway system vector, etc., such as pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pGWB411, pGWB412, pGWB405, pCAMBIA1391-Xa or pCAMBIA1391-Xb. When OsRIP1 is used to construct recombinant expression vectors, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like can be added before transcription initiation nucleotide thereof, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria may be derived from Escherichia, erwinia, agrobacterium (Agrobacterium) such as Agrobacterium tumefaciens EHA105, flavobacterium (Flavobacterium), alcaligenes, pseudomonas, bacillus, etc.

The ribosome inactivating protein OsRIP1 can be any one of the following:

(A1) A protein with an amino acid sequence of SEQ ID No. 1;

(A2) The amino acid sequence shown in SEQ ID No.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and is derived from rice protein with the same function;

(A3) A protein which has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and is derived from rice and has the same function;

(A4) A fusion protein obtained by ligating the N-terminal and/or C-terminal of the protein defined in any one of (A1) to (A3) with a protein tag.

Among the above proteins, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the homology of 95% or more may be at least 96%, 97% or 98% identical. The 90% or more homology may be at least 91%, 92%, 93%, 94% identical. The 85% or more homology may be at least 86%, 87%, 88%, 89% identical. The 80% or more homology may be at least 81%, 82%, 83%, 84% identical.

In the plant, the expression amount and/or activity of the OsRIP1 protein is increased, and the plant is changed from normal selfing fertility to dominant genic sterility.

The aim of the invention is achieved by the following technical scheme:

the invention provides a rice dominant genic male sterile protein OsRIP1, which is a ribosome inactivating protein. In the rice dominant genic male sterile material Dms1, osRIP1 is highly expressed in the period of rice pollen mother cells, so that the translation function of ribosomes is directly inhibited, and anthers cannot synthesize proteins, so that the anthers die. The OsRIP1 has a protein size of 32.5kD and contains a conserved ribosome inactivating protein domain, and the amino acid sequence of the OsRIP1 is shown as SEQ ID NO. 1.

The invention also provides a rice male meiosis cytoplasmic separation key gene OsRIP1, the DNA sequence of which is shown as SEQ ID NO. 2. The CDS of OsRIP1 has a total length of 855bp and contains 3 exons and 2 introns. Dms1 it is the promoter of the OsRIP1 gene that has been inserted with a 1978bp DNA fragment that results in dominant nuclear sterility.

The invention also provides the exploration of the mechanism of regulating dominant genic male sterile phenotype of OsRIP1 gene and the coded protein thereof, especially the mechanism of inhibiting translation of ribosome-inactivating protein.

The invention also provides application of the protein OsRIP1 or gene OsRIP1 or rice dominant genic male sterile material Dms1 in rice breeding work.

The invention also provides application of the protein OsRIP1 or gene OsRIP1 or rice dominant genic male sterile material Dms1 in rice breeding research. Specifically, expression of OsRIP1 in anther from normal wild rice can result in dominant genic male sterile rice.

The invention also provides application of the gene OsRIP1 or the protein OsRIP1 in improving male sterile rice, and the application is specifically that the gene OsRIP1 is knocked out in dominant genic sterile rice, so that fertility can be recovered. Male sterile rice is typically sterile due to expression of the gene OsRIP1 in anthers.

The invention also provides application of the protein OsRIP1 or gene OsRIP1 in rice breeding. In some embodiments, normal wild-type rice is expressed as ospp 1 in anthers; in other embodiments, knockout of gene OsRIP1 in dominant genic male sterile rice can restore fertility.

The invention also provides the value of the protein OsRIP1 or gene OsRIP1 in the pharmaceutical and chemical industries.

Through research on the dominant genic male sterile material Dms1, the invention obtains the dominant genic male sterile related gene OsRIP1. The discovery and application of the dominant genic male sterile gene of the rice deepens the cognition of fertility of fine rice, male sterility is a phenomenon commonly existing in flowering plants, opens the door for utilizing plant heterosis, and has important production and application values. The dominant genic male sterile material can be used for more effectively, simply and conveniently carrying out recurrent selection and population improvement, and can also be used for polymerizing a plurality of key high-quality genes. The gene of the invention can be utilized in the future, the rice breeding efficiency can be greatly improved by creating dominant genic male sterile materials, the invention is favorable for creating excellent heterologous sources and improving the hybridization efficiency, and the invention can cultivate high-quality rice varieties with high yield, strong stress resistance and wide adaptability, thereby having important utilization value in plant breeding.

The mutation of the OsRIP1 gene found by the invention can lead to dominant male nuclear sterility, and the male gamete of abortion can lead to the rice not to be fertilized normally and matured, thus seriously affecting the plant yield, thus researching the molecular mechanism of the gene leading to the rice sterility, and providing a beneficial help for future genetic modification and breeding application.

Drawings

FIG. 1 is a phenotype of wild rice NJ4 and dominant genic male sterile Dms ear and anther, where a is the phenotype of NJ4 and Dms ear and anther and b is a semi-thin slice of NJ4 and Dms1 anther;

FIG. 2 is a scanning electron microscope observation of anthers of wild rice NJ4 and dominant genic male sterile material Dms1, wherein a and e are transmission electron microscope images of the pollen mother cell stage of NJ4 and Dms respectively, b and f are partial magnification of the a and e images respectively, c and g are transmission electron microscope images of microspores of NJ4 and Dms respectively, and d and h are partial magnification of the c and g images respectively;

FIG. 3 is a genetic analysis of Dms1, wherein a is the phenotype of the hybrid spike using Dms1 as the female parent and NIP as the male parent, and b is the statistics of the seed setting rate of the hybrid spike;

FIG. 4 shows map-based cloning and quantitative analysis of candidate gene expression, wherein a is map-based gram Long Guocheng of Dms1 gene, and b is qPCR result of candidate gene LOC_Os08g03820 in the interval;

FIG. 5 is a graph showing candidate gene verification using CRISPR knockout;

FIG. 6 shows the results of the enzyme activity assay of OsRIP1 and qPCR of the depurination efficiency of OsRIP1.

Detailed Description

The present invention will be further illustrated by the following examples, which are to be understood as illustrative only and not limiting of the invention, and simple modifications of the process of preparation of the invention are within the scope of the invention without departing from the spirit of the invention. The following examples do not address the specific conditions of the experimental procedure, and are generally in accordance with means well known in the art. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

Example 1: phenotype observation of Dms1 mutant and map cloning of OsRIP1 gene

(1) Phenotypic identification of Dms1 material

Dms 1F hybridized from SE21S/Basimati370 ₂ The plants were found to have no significant difference between vegetative and wild type, but appeared to be weak in the late reproductive growth. First, we carefully observe Dms1 throughout the flowering phase, and found that the anthers of the mutants were shorter than the wild type and that the mutants were lean and whitish, and I was performed on the mature pollen of the mutants and wild type ₂ KI staining observations, found that there was no pollen that could be stained, by giving Dms a wild type pollen, found that the setting rate was normal and the progeny segregation ratio was 1:1, thus Dms1 was a typical dominant genic sterile mutant (fig. 1, 2, 3).

Up to this point Dms was shown to be a dominant genic male sterile mutant. To further clarify the cause of male sterility, we observed the development of anthers and pollen, respectively, using semi-thin sections and electron microscopy, and semi-thin section results showed that the pollen mother cells of the mutants stopped developing before meiosis, were unable to enter meiosis, and did not have any pollen grains by the maturation period. Transmission electron microscopy showed that the pollen mother cells of the Dms mutant gradually apoptosis during development and the cell membrane ruptured (fig. 1 b, fig. 2).

(2) Map cloning of OsRIP1 Gene

In order to construct a locating population, dms1 is taken as a female parent, pollen of japonica rice Ning japonica No.4 is granted for hybridization. Through multiple generations of backcrossing, a near isogenic line with Ningjing No.4 as a background is constructed. The whole genome primer priming locks the localization interval to the short arm head of chromosome 8, an interval of 2.34Mb between primers xhy39 and xhy 9. Then, a primer pair interval is designed for fine positioning (primer design website: http:// ricevarmap. Ncpgr. Cn/v1 /), finally, the interval is positioned in a 5.4kb interval of markers xhy and xhy129, and the gene information in the interval published by the center of national rice data (https:// www.ricedata.cn /) is utilized to carry out screening and sequencing on the gene in the interval, so that a 1978bp insertion exists 98bp upstream of the initiation codon ATG of the gene LOC_Os08g03820, and the nucleotide sequence is shown as SEQ ID No.4 and is defined as a candidate gene. The total length of CDS of the gene LOC_Os08g03820 is 855bp, the nucleotide sequence is shown as SEQ ID No.2, the genome comprises 3 exons and 2 introns, the genome encodes a ribosome inactivating protein, the amino acid sequence is shown as SEQ ID No.1, the protein size is 32.4kD, and the genome contains a ribosome inactivating protein motif.

Example 2: transgenic complementation and CRISPR/Cas9 technology and transgenic plant phenotype identification

To determine that LOC_Os08g03820 is the target gene causing the Dms1 mutant phenotype, we designed a specific 20bp target site for this gene through the website, sequence AAGCTACAAGAAGCTCATGG (http:// cbi.hzau.edu.cn/cgi-bin/CRISPR), recombined it into vector CRISPR/Cas9, transferred the vector into Dms1 mutant (callus from Dms1 and wild type hybrid) using Agrobacterium-mediated method, sequenced the obtained transgenic plants to identify the editing type, and found that the transgenic plants with the insert edited restored fertility (FIG. 5). We therefore determined that the Dms mutant phenotype was due to the presence of a 1978bp insert 98bp upstream of the start codon ATG of the LOC-Os 08g03820 gene (FIG. 4), we named the gene OsRIP1 with the nucleotide sequence shown in SEQ ID No. 3.

Example 3: apurinic Activity assay of OsRIP1

Structural predictions show that OsRIP1 has a conserved ribosome inactivating protein domain, and the ribosome inactivating protein can be combined on animal ribosomes, so that the conserved A base of rRNA S/RLoop is cut, the activity of GTPase is destroyed, and the ribosomes cannot translate the protein. From the predictions we constructed mutant forms with loss of active site of enzyme activity, osRIP1 was typical ribosome inactivating proteins by depurination of rabbit reticulin lysates followed by urea-polyacrylamide gel electrophoresis and qRT-PCR, showing depurination activity of OsRIP1 without mutant proteins (FIG. 6).

Claims (7)

1. A rice dominant genic male sterile protein OsRIP1 is a ribosome inactivating protein, and the amino acid sequence of the protein is shown as SEQ ID NO. 1.

2. The coding gene of the rice dominant genic male sterile protein OsRIP1 as set forth in claim 1 has the nucleotide sequence shown in SEQ ID NO. 2.

3. A recombinant expression vector comprising the coding gene according to claim 2.

4. A recombinant host cell comprising the coding gene of claim 2 or the recombinant expression vector of claim 3.

5. The rice dominant genic male sterile protein OsRIP1 as claimed in claim 1 or its coding gene or rice dominant genic male sterile materialDms1The application in rice breeding.

6. The use according to claim 5, wherein said coding gene is expressed in normal wild-type rice anthers to yield dominant genic sterile rice.

7. The use according to claim 5, wherein the use is in improving male sterile rice, in particular knocking out the coding gene in dominant genic sterile rice to restore fertility.