CN116964222A - Improved assay - Google Patents

Abstract

The present disclosure provides improved detection (e.g., diagnostic) assays that utilize Cas protein-attached cleavage activity.

Description

Improved assay

Cross Reference to Related Applications

The present application claims priority from each of U.S. provisional patent application No. 62/966,527, U.S. provisional patent application No. 62/967,536, U.S. provisional patent application No. 62/970,159, U.S. provisional patent application No. 63/038,710, U.S. provisional patent application No. 63/139,267, U.S. provisional patent application No. 19, 2021, each of which is incorporated herein by reference in its entirety.

Background

A variety of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated ("Cas") proteins have been found to have collateral cleavage activity (collateral cleavage activity) that can be used in detection (e.g., diagnostic) systems to detect specific related nucleic acids. See, e.g., sashital Genome Med 2018:10,32.

Disclosure of Invention

The present disclosure provides improved detection (e.g., diagnostic) techniques that exploit Cas protein incidental activity.

The present disclosure identifies, among other things, the source of the problem of using certain Cas enzymes in certain incidental activity assays. For example, the present disclosure recites that certain such assays include steps involving incubation at elevated temperatures for a period of time, and that various Cas enzymes may not be sufficiently stable under such conditions to maintain adequate levels of activity (e.g., incidental activity). In many embodiments, such a step may be or comprise a nucleic acid extension and/or amplification step.

Alternatively or additionally, the present disclosure provides the following insight: particularly desirable embodiments of the various incidental activity assays are those that can be performed in a single reaction vessel (i.e., so-called "one-pot") assay. The present disclosure understands that Cas enzymes whose activity (e.g., accessory cleavage activity) is not sufficiently stable in any and all elevated temperature steps (which may be or include, for example, one or more nucleic acid extension and/or amplification steps) to maintain sufficient activity may not be useful in such one-pot assays. The present disclosure further states that certain Cas proteins (e.g., cas13 and Cas 12) are not sufficiently stable at the relevant temperatures, e.g., at temperatures (e.g., above about 60-65 ℃) at which nucleic acid extension and/or amplification reactions are typically performed.

The present disclosure encompasses the following recognition: thermostable variants of various Cas proteins (e.g., cas 9) have been described and/or otherwise publicly available (see, e.g., mougiakos et al, nat commun.8:1647,2017). Those skilled in the art are able to compare such thermostable variants to related non-thermostable homologs (e.g., orthologs) to assess sequence changes and/or elements that may be necessary and/or sufficient to achieve thermostability, and furthermore may identify such sequence changes and/or elements in other homologs (e.g., orthologs) and/or may introduce such sequence changes and/or elements therein. Still further, those skilled in the art are familiar with potential sources of naturally occurring thermostable Cas proteins (e.g., in microorganisms that survive or are otherwise thermophilic under elevated temperature conditions (e.g., in marine spouts). Thus, one of ordinary skill in the art, upon reading this disclosure, can readily identify and/or develop appropriate thermostable Cas proteins for use as described herein.

In some embodiments, useful thermostable Cas proteins are Cas12 or Cas13 homologs (e.g., orthologs). In some embodiments, useful thermostable Cas proteins are Cas enzymes comprising an amino acid sequence having 80%, 85%, 90%, 99% or 100% sequence identity to any one of SEQ ID nos. 1-283.

Alternatively or additionally, in some embodiments, useful thermostable Cas proteins perform functions (e.g., their attendant cleavage activity is fully functional) at temperatures above about 50 ℃, in some embodiments above a temperature selected from the group consisting of: about 55 ℃, about 56 ℃, about 57 ℃, about 58 ℃, about 59 ℃, about 60 ℃, about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, about 65 ℃, about 66 ℃, about 67 ℃, about 68 ℃, about 69 ℃, about 70 ℃, about 71 ℃, about 72 ℃, about 73 ℃, about 74 ℃, about 75 ℃, about 76 ℃, about 77 ℃, about 78 ℃, about 79 ℃, about 80 ℃, about 81 ℃, about 82 ℃, about 83 ℃, about 84 ℃, about 85 ℃, about 86 ℃, about 87 ℃, about 88 ℃, about 89 ℃, about 90 ℃, about 91 ℃, about 92 ℃, about 93 ℃, about 94 ℃, about 95 ℃, about 96 ℃, about 97 ℃, about 98 ℃, about 99 ℃, about 100 ℃, or a combination thereof. In many embodiments, useful thermostable Cas proteins perform functions (e.g., their attendant cleavage activity is fully functional) at temperatures above about 60 ℃.

In some embodiments, useful thermostable Cas proteins perform functions (e.g., their attendant cleavage activity is fully functional) over a range of temperatures at which nucleic acid extension and/or amplification reactions are performed; those skilled in the art are well aware of various such reactions and temperature ranges in which they are carried out. In some embodiments, such a temperature range may be a temperature above a temperature selected from the group consisting of: about 60 ℃, about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, 65 ℃, about 66 ℃, about 67 ℃, about 68 ℃, about 69 ℃, about 70 ℃, about 71 ℃, about 72 ℃, about 73 ℃, about 74 ℃, about 75 ℃, about 76 ℃, about 77 ℃, about 78 ℃, about 79 ℃, about 80 ℃, about 81 ℃, about 82 ℃, about 83 ℃, about 84 ℃, about 85 ℃, about 86 ℃, about 87 ℃, about 88 ℃, about 89 ℃, about 90 ℃, about 91 ℃, about 92 ℃, about 93 ℃, about 94 ℃, about 95 ℃, about 96 ℃, about 97 ℃, about 98 ℃, about 99 ℃, about 100 ℃, or a combination thereof. In some embodiments, the temperature may range from about 60 ℃ to about 90 ℃. In some embodiments, the temperature may range from about 60 ℃ to about 80 ℃. In some embodiments, the temperature may range from about 60 ℃ to about 75 ℃. In some embodiments, the temperature may range from about 65 ℃ to about 90 ℃. In some embodiments, the temperature may range from about 60 ℃ to about 80 ℃. In some embodiments, the temperature may range from about 60 ℃ to about 75 ℃.

Thus, as set forth herein, in some embodiments, a useful thermostable Cas protein is a Cas12 or Cas13 homolog (e.g., ortholog), such as a Cas enzyme comprising an amino acid sequence having 80%, 85%, 90%, 99% or 100% sequence identity to any of SEQ id nos. 1-283, which is thermostable at a temperature above about 50 ℃ and in some embodiments above about 60 ℃, such as within about 60-65 ℃ and/or above about 60-65 ℃. Those of skill in the art will particularly appreciate upon reading the present disclosure that in some embodiments, a useful thermostable Cas protein is Cas12 (e.g., SEQ ID NOs 3-21, 33-47, 51-56, 68-178 and 274-283 or variants thereof having, for example, at least 90%, 95%, 99% or greater amino acid sequence identity thereto) or Cas13 (e.g., SEQ ID NOs 1-2, 22-32, 48-50, 57-67, 179-273 or variants thereof having, for example, at least 90%, 95%, 99% or greater amino acid sequence identity thereto), whose activity (e.g., target binding and accessory cleavage activity thereof) is sufficiently thermostable, e.g., at a temperature in the range of 60-65 ℃ to perform a function in an assay as described herein (e.g., in some embodiments, a one-pot assay). For example, in some embodiments, sufficient thermostable activity is an activity reasonably comparable (e.g., within about 25%) to a suitable reference thermostable Cas protein (e.g., SEQ ID NO 15) as described herein.

In some embodiments, the present disclosure describes a detection method comprising the steps of: contacting a CRISPR-Cas complex with a sample of nucleic acid potentially comprising a target sequence, the CRISPR-Cas complex comprising: cas proteins with cleavage-attached activity that are thermostable at temperatures above at least 60-65 ℃; and a guide RNA selected or engineered to be complementary to the target sequence.

In some embodiments, the contacting step comprises contacting the crjsrp-Cas complex and the sample with a reporter that is susceptible to cleavage by Cas protein incidental activity. In some embodiments, the contacting step comprises incubating above the temperature for a period of time. In some embodiments, the detection method further comprises the step of amplifying the nucleic acid present in the sample. In some embodiments, the amplification step utilizes a thermostable nucleic acid polymerase. In some embodiments, the amplifying and contacting steps are performed in a single vessel.

In some embodiments, the Cas protein is a Cas12 protein. In some embodiments, the Cas protein has an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID No. 15. In some embodiments, the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ id nos. 3-21, 33-47, 51-56, 68-178 and 274-283. In some embodiments, the Cas protein has an amino acid sequence with 80% sequence identity to any one of SEQ ID nos. 1-283.

In some embodiments, in methods of performing detection assays with Cas proteins having a cleavage-by-tag activity, the improvement comprises utilizing Cas proteins having a thermostable cleavage-by-tag activity. In some embodiments, the Cas protein is a Cas12 protein. In some embodiments, the Cas protein has an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID No. 15. In some embodiments, the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ ID nos. 3-21, 33-47, 51-56, 68-178 and 274-283. In some embodiments, the method of performing the detection assay is performed in a single reaction vessel. In some embodiments, the thermally stable side cleavage activity is thermally stable at a temperature greater than about 60 ℃. In some embodiments, the thermally stable side cleavage activity is thermally stable at a temperature greater than about 65 ℃. In some embodiments, the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ ID nos. 1-283.

Drawings

Fig. 1A and 1B document the following insights provided by the present disclosure: some Cas13 proteins are not sufficiently stable at the temperatures involved, for example, at temperatures at which nucleic acid extension and/or amplification reactions are typically performed (e.g., above about 60-65 ℃).

Fig. 2 depicts the following insights provided by the present disclosure: some Cas12 proteins are not sufficiently stable at the temperatures involved, for example, at temperatures at which nucleic acid extension and/or amplification reactions are typically performed (e.g., above about 60-65 ℃).

Figures 3A-3C demonstrate and further demonstrate the thermal stability of tccas 13 incidental activity.

Fig. 4 shows an exemplary method for discovering and screening for thermostable Cas enzyme candidates (e.g., cas12 and Cas13 enzymes).

Fig. 5 shows an exemplary evaluation of Cas12a candidate enzymes by endpoint assay.

Fig. 6 shows an exemplary evaluation of Cas12a candidate enzymes by kinetic assay.

FIG. 7 shows an exemplary evaluation of candidate enzymes by endpoint and kinetic assays at 58 ℃.

FIG. 8 shows an exemplary evaluation of candidate enzymes by endpoint and kinetic assays at 60 ℃.

FIG. 9 shows an exemplary evaluation of candidate enzymes by endpoint and kinetic assays at 62 ℃.

Fig. 10 shows an exemplary evaluation of four candidate enzymes purified and activity measured at varying temperatures (e.g., about 35 ℃ to about 65 ℃).

Fig. 11 shows an exemplary characterization of a subset of enzyme candidates using three different guide and target sets compared to no template controls at both 58 ℃ and 70 ℃.

Fig. 12 shows an exemplary characterization of Cas12 candidate enzymes utilizing multiple guide/target pairs at both 52 ℃ and 58 ℃.

Figure 13 demonstrates a kinetic assay of Cas12a candidate enzyme RS62, which Cas12a candidate enzyme shows activity at 52 ℃.

Figure 14 shows characterization of Cas13 candidate enzyme by endpoint assay at both 37 ℃ and 52 ℃.

Fig. 15 shows that an exemplary thermostable Cas12a enzyme RS9 requires thermostable inorganic pyrophosphatase (TIPP) for amplification. Real-time detection of ORF1ab amplification was accomplished in a range of ORF1ab starting concentrations (4.5 copies/microliter to 4,500 copies/microliter) with or without TIPP.

Fig. 16 demonstrates that an exemplary thermostable Cas12a enzyme RS9 is specific for its target and requires TIPP to be amplified. Amplification was performed with an initial concentration of 4,500 copies/microliter of the ORF1ab template and primers and guide or non-targeting primers specific for ORF1ab and ORF1ab guide. Each reaction condition is also performed in the presence or absence of TIPP.

Fig. 17 shows that exemplary thermostable Cas12a enzyme RS9 shows additive cleavage activity.

Fig. 18 demonstrates the collateral cleavage activity of RS9 compared to known Cas12a, lbcas 12 a.

Fig. 19 demonstrates characterization of an exemplary thermostable Cas13a enzyme tccas 13a. The optimal temperature for tccas 13a activity is determined over a range of temperatures using a Cas reaction. The temperature profile indicates that tccas 13a shows the highest activity at about 62 ℃.

Fig. 20 shows that tccas 13a can be activated by RNA but cannot be activated by ssDNA even at the highest concentration of ssDNA.

Fig. 21 shows that tccas 13a activation requires higher ssDNA concentrations than RNA, similar to that observed for LwaCas13ssDNA activation. Tccas 13a was not activated by ssDNA at any concentration (10 nM, 100nM or 1,000 nM) compared to the control.

Fig. 22 shows tccas 13a shows increased incidental activity at the "NN" site compared to the "UU" site, whereas LwaCas13a does not show a preference for incidental activity at the "NN" site compared to the "UU" site.

Fig. 23 demonstrates exemplary characterization of candidate thermostable Cas enzymes Pal1, low molecular weight Pal2, high molecular weight Pal2, and Pal 3.

FIG. 24 shows exemplary Pal1 and Pal2 activities at 56 ℃.

FIG. 25 shows exemplary activities of Pal1 with different exemplary guides at 37 ℃, 56 ℃ and 70 ℃.

Fig. 26 shows exemplary activities of Pal1 at 56 ℃ and 70 ℃ compared to a control. These data indicate that Pal1 activity is specific for target DNA.

Fig. 27 shows an exemplary temperature profile for Pal 1.

FIG. 28 shows exemplary activities of high molecular weight Pal2 at 37 ℃, 56 ℃ and 70 ℃ with different exemplary guides.

Fig. 29 shows exemplary activity of high molecular weight Pal2 at 56 ℃ compared to control. These data indicate that the activity of high molecular weight Pal2 is specific for the target DNA.

Fig. 30 shows an exemplary temperature profile for high molecular weight Pal 2.

Detailed Description

Additional Activity assay

Useful detection (e.g., diagnostic) assays that have been developed and are under development that use rapid increases in the incidental activity of Cas proteins are well known to those of skill in the art. See, e.g., sashital Genome Med 2018:10,32. Furthermore, it is well known to those skilled in the art that a detailed classification of "CRISPR/Cas biosensing systems based on Cas protein incidental activity has been recently disclosed. See Li et al, trends Biotechnol.37:730,2019, 7.

Particularly relevant formats include Cas 13-based (e.g., cas13 a-based or Cas13 b-based) systems, including those known as "sholock" and/or "HUDSON" systems (see, e.g., gootenberg et al, science 356:438,2017; gootenberg et al, science360:339,2018; myhrvold et al, science 360:444,2018; see also US 10266887), and Cas 12-based (e.g., cas12 a-based or Cas12 b-based) systems, including those known as "holms" or "DETECTR" systems (see, e.g., cheng et al, CN patent application CN107488710a; PCT/CN18/82769 and US 16/631,157; li et al, cell c.4:20,2018; chen et al, science 360:436,2018; li, l et al, cell bioxiv, 2018, 26 days per day, http/d.35/3589/3684). Both Cas13a and Cas13b enzymes have been used in the sholock and/or HUDSON systems; similarly, cas12a and Cas12b are both.

As known in the art, and as described in the references cited herein, a typical detection assay utilizing Cas protein accessory cleavage activity involves contacting an appropriate CRISPR-Cas complex comprising a Cas protein with accessory activity and a guide RNA complementary to the relevant target sequence with a sample that may contain the target sequence. Upon recognition of the target sequence, the incidental activity of the Cas protein is activated such that it cleaves unrelated nucleic acids (DNA or RNA or both, depending on the enzyme). A reporter is provided for cleavable nucleic acids that is suitably configured (e.g., labeled) such that cleavage thereof is detectable due to the incidental activity of activation (e.g., separation of a fluorophore from a quencher such that fluorescence becomes detectable, etc.).

In many assays, the target sequence is generated and/or amplified (e.g., from RNA copy to DNA and/or amplified, e.g., by primer extension, DNA replication (e.g., by polymerase chain reaction), and/or transcription). See, for example, FIGS. 3 and 4 of the above-mentioned review of Li (Li et al, trends Biotechnol.37:730,2019, 7).

Thus, in many embodiments, the additional activity assay comprises the steps of: (1) target copy and/or amplification; (2) target binding; and (3) signal release and/or detection.

Typically, the additional activity assay as described herein is an in vitro assay. In some embodiments, it may be a cell-free assay (e.g., may be substantially free of intact cells, or in some embodiments, substantially free of cell fragments).

In some embodiments, the additional activity assay as described herein is performed on a sample that is or is prepared from a biological original sample (e.g., blood, saliva, tears, urine, etc.) or an environmental original sample (e.g., soil, water, etc.).

Thermostable Cas enzymes

As described herein, the problem with the present disclosure of identifying certain assays (e.g., diagnostic assays) that utilize Cas protein incidental activity as described above is that certain Cas proteins with incidental activity are not sufficiently stable at the relevant temperatures (e.g., at the temperatures at which nucleic acid extension and/or amplification is performed). In addition, the present disclosure further surprisingly shows that for some proteins, the loss of activity at elevated temperatures can be irreversible. This reality increases the importance of the insight provided by the present disclosure that Cas proteins with thermostable incidental activity are particularly desirable for use in the assays described herein. These findings are described in fig. 1 and 2.

Thus, the present disclosure provides improved detection (e.g., diagnostic) assays that utilize Cas protein incidental activity that utilize thermostable Cas proteins (e.g., whose incidental activity is thermostable) as described herein.

In some embodiments, the steps of nucleic acid detection and target binding are performed in a single container; in some embodiments, the steps of target binding and signal release are performed in a single container; in some embodiments, the steps of (1) target copying and/or amplification, (2) target binding, and (3) signal release and/or detection are performed in a single container; in some embodiments, all steps are performed in a single vessel-i.e., the improved assay provided is a one-pot assay.

In some embodiments, the modified additional activity assay as described herein is an in vitro assay. In some embodiments, it may be a cell-free assay (e.g., may be substantially free of intact cells, or in some embodiments, substantially free of cell fragments).

In some embodiments, the modified additional activity assay as described herein is performed on a sample that is a biological original sample (e.g., blood, saliva, tears, urine, etc.) or an environmental original sample (e.g., soil, water, etc.) or prepared therefrom.

In some embodiments, a Cas enzyme with thermostable cleavage-by activity is a homolog (e.g., ortholog) of a Cas enzyme that does not have a displayable cleavage-by activity, or has a displayable cleavage-by activity but loses such activity at a temperature above the relevant temperature as described herein.

In some embodiments, the Cas enzyme with thermostable cleavage-attached activity as described herein is a Cas12 (e.g., cas12a or Cas12 b) enzyme. In some embodiments, the Cas enzyme with thermostable cleavage-attached activity as described herein is a Cas13 (e.g., cas13a or Cas13 b) enzyme.

In some embodiments, a Cas enzyme with thermostable cleavage-attached activity as described herein is a Cas enzyme comprising an amino acid sequence with 80%, 85%, 90%, 99% or 100% sequence identity to any one of SEQ ID nos. 1-283. In some embodiments, the improved incidentally-activity assay as described herein is performed using a Cas enzyme comprising an amino acid sequence that has 80%, 85%, 90%, 99% or 100% sequence identity to any one of SEQ ID nos. 1-283.

Target nucleic acid

Those skilled in the art will immediately appreciate that the techniques provided herein are broadly applicable to effecting detection of a variety of nucleic acids, including, for example, nucleic acids from infectious agents (e.g., viruses, microorganisms, parasites, etc.), nucleic acids indicative of a particular physiological state or condition (e.g., the presence or status of a disease, disorder, or condition, such as cancer or inflammatory or metabolic disease, disorder, or condition, etc.), prenatal nucleic acids, and the like.

In some embodiments, the target nucleic acid is detected by an assay comprising a Cas enzyme and a cRNA as described herein. In some embodiments, the structure of the cRNA can affect the activity of the Cas/cRNA complex. In some embodiments, the structure of the Cas/cRNA complex contributes to the thermal stability of Cas-attached activity.

Typically, the provided techniques are applied to one or more samples to assess the presence and/or level of one or more target nucleic acids in the sample. In some embodiments, the sample is a biological sample; in some embodiments, the sample is an environmental sample. In some embodiments, the sample is a crude sample (e.g., a raw sample or a sample that has undergone minimal processing).

In some embodiments, the sample will be treated (e.g., the nucleic acid will be partially or substantially isolated or purified from the original sample); in some embodiments, only minimal processing will be performed (i.e., the sample will be a crude sample).

Example

Example 1: temperature profile of lwaca 13a

The thermal stability of lwaca 13a was tested. Briefly, the labeled RNA targets were incubated with rnase inhibitor, T7RNA polymerase, lwaCas13a, mgCl2, and cRNA. Individual samples were incubated at various temperatures to determine incidental activity.

Fig. 1A presents a temperature profile for lwaca 13a incidental activity. It can be seen that low activity was observed above 45 ℃; the activity completely disappeared at about 55 ℃.

In addition, fig. 1B presents the results of testing the loss reversibility of lwaca 13a at higher temperatures. Lkas 13a was incubated at 65 ℃ for 5 minutes ("heat pulse"), while the control group ("no heat pulse") was incubated at room temperature. The activity of both enzymes was then tested at 37 ℃. The heat pulse group showed no activity. This reality increases the importance of the insight provided by the present disclosure that Cas proteins with thermostable incidental activity are particularly desirable for use in the assays described herein.

Example 2: temperature profiles of AsCas12a and Lbacas12a

Heat stability of AsCas12a and Lbacas12a were tested. Briefly, the labeled RNA target is incubated with an rnase inhibitor, T7RNA polymerase, asCas12a or Lbacas12a, mgCl2, and cRNA. Individual samples were incubated at various temperatures to determine incidental activity.

Fig. 2 presents temperature profiles for AsCas12a and lbascas 12 a. It can be seen that low AsCas12a activity is observed at temperatures above 55 ℃. AsCas12a remained active at 60 ℃ for about 5 minutes. AsCas12a has an activity of <10% within a few minutes at 65 ℃. Furthermore, lbcas 12a activity was significantly reduced at temperatures above 55 ℃.

Example 3: exemplary thermostable Cas candidates

This example describes certain thermostable Cas13 candidates for use in the improved accessory activity assay as described herein.

In this example, it was determined that Cas13 with incidental activity that is thermally stable over a temperature range of about 62 ℃ to about 68 ℃ is particularly desirable, especially in one pot assays with LAMP pre-amplification.

We performed a computational search for potential thermostable Cas candidates and identified:

■ 2 Cas13a candidates:

tccas 13a (high temperature resistant clostridium mud (Thermoclostridium caenicola))

Exemplary sequences for use with tccas 13a include, but are not limited to:

agtgtctttgcaggaaagaacacagatcttgagggtcacaactcccatgtaggcggagactgcaacccctatagtgagtcgtattaatt tc (SEQ ID NO.: 284) (forward DR crRNA); and

agtgtctttgcaggaaagaacacagatcttgagggttgcagtctccgcctacatgggagttgtgacccctatagtgagtcgtattaat ttc (SEQ ID NO: 285) (reverse complement DR crRNA); thpCas13a (deep sea helicobacter (Thalassospira profundimaris))

Exemplary sequences for use with ThpCas13a include, but are not limited to:

tctttgcaggaaagaacacagatcttgaggggtgtagttcccctcaatttggggatgaacgtcgacccctatagtgagtcgtattaat ttc (SEQ ID NO: 286) (Forward DR crRNA); and

tctttgcaggaaagaacacagatcttgagggtcgacgttcatccccaaattgaggggaactacaccccctatagtgagtcgtattaa tttc (SEQ ID NO: 287) (reverse complement DR crRNA);

■ 4 Cas12b candidates:

■ AacCas12b (Alicyclobacillus acidophilus)

■ AkCas12b (Bacillus calmette-guerin)

■ BhCAs12b (Bacillus exovillage (Bacillus hisashii))

■ LsCas12b (Lawsonia of deposit (Laceyella sediminis))

Exemplary sequences for use with aacas 12b include, but are not limited to:

ttgtgagcggataaacacaggtgccacttctcagatttgagaagctcaacgggctttgccacctggaaagtggccattggcacaccc gttgaaaaattctgtcctctagacccctatagtgagtcgtattaatttc(SEQ ID NO.:288)(crRNA)

exemplary sequences for use with AkCas12b include, but are not limited to:

ttccggctcgtatgttgtgtggaattgtgagcggagtgccacttctcagaccgctcgccctatagtgagtcgtattaatttc (SEQ ID NO.: 289) (crRNA); and

cgagcggtcatcttgaagccaacggggtgtttgctcttggaaagagcacattggcacttcccgttgtcctcgccgtcctatagacgac ccctatagtgagtcgtattaatttc(SEQ ID NO.:290)(tracrRNA)

exemplary sequences for use with BhCas12b include, but are not limited to:

aattgtgagcggataaacacaggtgctaatgcctcccctatagtgagtcgtattaatttc (SEQ ID NO.: 291) (crRNA); and

gagacatcgtccagcaataggagtttctcacaccctgcagcacttatagctagacggttgtcctgaccaaaagacagaacccctata gtgagtcgtattaatttc(SEQ ID NO.:292)(tracrRNA)

exemplary sequences for use with LsCas12b include, but are not limited to:

atggtcatagctgtttcctgtgtttatccgctcagtgctaatcacatttaattcatctaccctatagtgagtcgtattaatttc (SEQ ID NO: 293) (crRNA); and

Gataaataatgtaatcctgtggttgaatggattttttccatccttagcacacgcacagtattctttgccctttaggcaaaccctatagtg agtcgtattaatttc(SEQ ID NO.:294)(tracrRNA)。

exemplary sequences for Cas proteins with thermostable incidental activity include those described in table 1:

table 1: exemplary sequences of Cas proteins with thermostable incidental activity

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

Those skilled in the art will appreciate that, given that their amino acid sequences are known, these enzymes can be readily produced (e.g., via culture of the source organism and/or by recombinant expression/purification, as may be obtained, for example, from any of a variety of commercial sources). Additional evidence of direct and/or collateral cleavage of the produced enzyme at different temperatures and/or stability and/or functionality at the relevant temperature can then be assessed.

Example 4: thermal stability of Cas13

This example demonstrates and further demonstrates the thermostability of Cas13 enzymes. This example provides certain thermostable Cas13 candidates for use in the improved accessory activity assays as described herein. Tccas 13a and ThpCas13a were tested for thermal stability. Briefly, different ranges of labeled RNA targets were incubated with tccas 13a or ThpCas13a, rnase inhibitors, T7RNA polymerase, mgCl2, and cRNA (forward or reverse complement orientation). Figure 3A shows significant activity of tccas 13A at 65 ℃. The data of FIG. 3A also indicate that the structure of cRNA can affect the activity of thermostable enzymes. Furthermore, fig. 3B shows that tccas 13a is active over a broad temperature range including the range 40 ℃ to 65 ℃.

Additional assays were performed with tccas 13a with or without some components to identify parameters that contributed to the background within the assay. Figure 3C shows that the presence of a complex of Cas enzyme and cRNA contributes to the background in the assay.

Example 5: exemplary discovery and screening of thermostable Cas enzymes

This example demonstrates an exemplary method of discovering and screening for thermostable Cas enzyme candidates (e.g., cas12 and Cas13 enzymes) (fig. 4). Novel Cas12 and Cas13 enzymes were discovered using custom computer pipelines. Briefly, publicly available microbial genomes and metagenome databases are first filtered based on environmental metadata (e.g., sample collection temperature and sequencing read quality). CRISPR repeats were then identified in the filtered genomic dataset using the disclosed repeat annotation method. Next, all coding sequences were annotated in the genome with CRISPR repeats using the Open Reading Frame (ORF) discovery method disclosed, and these ORFs were then classified using hidden markov models (Hidden Markov Model, HMM) pre-trained on known Cas12 and Cas13 enzymes. An enzyme is annotated as a putative candidate if and only if the direct repeat sequence of the enzyme is conserved (> 95%) and the predicted enzyme has a domain topology consistent with previously discovered enzymes.

The candidate enzyme was expressed by in vitro protein synthesis (e.g., PURExpress in vitro protein synthesis kit of New England BioLabs) according to the manufacturer's instructions. The initial pool of Cas12a candidate enzymes was assessed by endpoint (fig. 5) and kinetic analysis (fig. 6) using no template as a negative control for activity at 52 ℃. Each candidate was tested with three different guide/target pairs at 52 ℃ (figure 5).

A subset of the 44 initial candidates that exhibited the highest activity (e.g., 12 candidates) at 52 ℃ was selected to be combined with its most effective guide and target for further evaluation at higher temperatures (e.g., 58 ℃, 60 ℃, 62 ℃).

Both endpoint analysis and kinetic analysis indicated a subset of candidate enzymes (e.g., 9 of 12 candidate enzymes) that showed some activity at 58 ℃. Of the 9 with some activity, five were classified as high activity (RS 9, RS12, RS38, RS54 and RS 56), and the remaining four were classified as lower activity (RS 31, RS39, RS47 and RS 50) (fig. 7).

Both endpoint analysis and kinetic analysis indicated a subset (e.g., 5 of 12 candidate enzymes) that showed some activity at 60 ℃. Of the five with some activity, three were classified as high activity (RS 50, RS56 and RS 9), and the remaining two were classified as lower activity (RS 28 and RS 29) (fig. 8).

Both endpoint analysis and kinetic analysis indicated a subset (e.g., 2 of the 12 candidate enzymes) (RS 9 and RS 54) that showed some activity at 62 ℃ (fig. 9).

Although a refined list of 12 candidate enzymes was evaluated at different temperatures, four preferential candidate enzymes (RS 10, RS28, RS38, and RS 54) were purified and evaluated for activity at different temperatures (e.g., about 35 ℃ to about 65 ℃). RS54 showed activity at LAMP temperature (e.g., 61 ℃) (fig. 10).

A subset of Cas12a candidates was further examined using three different guide and target groups at both 58 ℃ and 70 ℃ compared to no template control (fig. 11). Cas12bcdf was also evaluated with all guide/target pairs at both 52 ℃ and 58 ℃ (fig. 12). Kinetic analysis was also performed on Cas12a candidate RS62, which Cas12a candidate RS62 showed activity at 52 ℃ (fig. 13).

By endpoint analysis (fig. 14), the initial pool of Cas13 candidate enzymes was assessed using no template as a negative control for activity at both 37 ℃ and 52 ℃. A single Cas13 candidate enzyme exhibiting thermostability was identified (RS 73).

Example 6: exemplary characterization of thermostable Cas12a enzymes

This example demonstrates characterization of an exemplary thermostable Cas12a enzyme RS 9. To determine whether RS9 requires the use of thermostable inorganic pyrophosphatase (TIPP) to amplify target nucleic acid, real-time detection of ORF1ab amplification was accomplished in a range of ORF1ab starting concentrations (4.5 copies/microliter to 4,500 copies/microliter) with or without TIPP. Exemplary reactions include 30ng/ul RS9, 112.5XL-213 (ORF 1ab guide), 1 XHKBB (ORF 1 ab) primer set, 1 XwsLAMP mix, 125nM DNase Alert, with or without 1U thermostable inorganic pyrophosphatase (TIPP), presence indicating viral RNA template concentration. Exemplary reactions were incubated at 58℃for 120 min on QS5 and tested in the VIC channel. The TIPP-free real-time response did not result in statistically significant amplification of ORF1ab compared to the no-template control, independent of the starting concentration of template. In addition to the initial concentration of 4.5 copies/μl of template, the real-time reaction with TIPP showed significant amplification of ORF1ab compared to the no template control, indicating that RS9 requires amplification using TIPP (fig. 15).

The specificity of RS9 was also assessed using real-time analysis. Amplification was performed with an initial concentration of 4,500 copies/microliter of the ORF1ab template and primers and guide or non-targeting primers specific for ORF1ab and ORF1ab guide. Each reaction condition is also performed in the presence or absence of TIPP. Exemplary reactions include 30ng/ul RS9, 112.5XL-213 (ORF 1ab guide), 1 XHKBB (ORF 1 ab) or CFB (N) primer sets, 1 XwsLAMP mixtures, 125nM DNase Alert, with or without 1U thermostable inorganic pyrophosphatase (TIPP) in the presence of 4,500 copies/microliter of viral RNA. Exemplary reactions were incubated at 58℃for 120 min on QS5 and tested in the VIC channel. No amplification was detected for reactions containing non-targeting primers and/or no TIPP. Robust amplification was detected in reactions containing the ORF1ab primer, ORF1ab guide and TIPP, indicating that RS9 was specific for its target and that TIPP was required for amplification (fig. 16).

The collateral cleavage activity of RS9 was assessed using 100nM single stranded DNA target and dnase alert or rnase alert as reporter. No target condition was used as negative control. RS9 failed to cleave dnaseaert, resulting in intensity measurements significantly higher than the no-target control condition. RS9 was able to cleave RNaseAlert, resulting in a measured intensity similar to that of the no target control condition, indicating that RS9 has RNA-specific collateral cleavage activity (fig. 17).

The additive cleavage activity of RS9 was further evaluated using ORF LAMP products as targets and RNaseAlert, polyrA, polyrC or PolyrU reporter, along with known Cas12a, lbacas12 a. No target condition was used as negative control. Both RS9 and lbcas 12a were able to cleave RNaseAlert more efficiently than PolyrA, polyrC or PolyrU (fig. 18).

Example 7: exemplary characterization of thermostable Cas13a

This example demonstrates characterization of an exemplary thermostable Cas13a enzyme tccas 13a. To determine the optimal temperature for tccas 13a activity, cas reactions were performed over a range of temperatures using 10nM target and RNaseAlert as reporter. No target condition was used as negative control. The temperature profile indicates that tccas 13a shows the highest activity at about 62 ℃ (fig. 19).

To determine if tccas 13a can also be activated by ssDNA in addition to RNA, cas reactions were completed using RNaseAlert as a reporter at 62 ℃. Different targets (e.g., 10nM, 100nM or 1,000nM ssDNA or 10nM RNA) are used at different concentrations. No target condition was used as negative control. The results indicate that tccas 13a is able to be activated by RNA but not by ssDNA even at the highest concentration of ssDNA template at 62 ℃ (fig. 20).

Tccas 13a activation by ssDNA was also assessed at 58 ℃. Tccas 13a is activated at 58 ℃ in the presence of 1nM, 10nM and 100nM RNA targets compared to no target control, whereas tccas 13a is activated by ssDNA at 58 ℃ only when 100nM or 1,000nM ssDNA targets are utilized. There was no difference in ssDNA targets of 10nM at 58 ℃ compared to no target control, indicating that tccas 13a activation requires higher ssDNA concentrations than RNA, similar to that observed for LwaCas13ssDNA activation. Interestingly, tccas 13a was not activated by ssDNA at any concentration (10 nM, 100nM, or 1,000 nM) compared to the control (no target) (fig. 21).

To determine whether tccas 13a shows a different specific incidental activity than LwaCas13, cas reactions were performed with two different reporters, namely RNaseAlert containing multiple different bases ("NN") and a "UU" specific reporter having only two "UU" bases and a DNA backbone. The reaction was carried out at 60 ℃. LwaCas13a did not show a preference for any reporter over the other, whereas tccas 13a showed increased incidental activity at the "NN" site compared to the "UU" site (fig. 22).

Example 8: exemplary characterization of additional candidate thermostable Cas enzymes

This example shows characterization of exemplary thermostable Cas enzymes Pal1 (SEQ ID No. 274), low molecular weight Pal2, high molecular weight Pal2 (SEQ ID No. 275) and Pal3 (SEQ ID No. 276). In a Cas-only reaction using DnaseAlert as a reporter, each enzyme was tested using four guides (designated 342-353) at both 37 ℃ and 56 ℃. The fluorescence signal of each reaction was plotted against time (fig. 23). Pal1 shows low activity for both guides at 56 ℃. For low molecular weight Pal2 or Pal3 no activity was observed, whereas for high molecular weight Pal2 activity was observed for both guides at 56 ℃. The Pal1 and Pal2 activities at 56 ℃ are shown in figure 24. Additional results of the study using these enzymes are shown in FIGS. 25-30. It can be seen that Pal1 shows activity for 2 guides at 56 ℃ and 70 ℃; pal1 showed maximum activity at 57 ℃ and significant activity up to at least 67 ℃. High molecular weight Pal2 shows activity for 2 guides at 56 ℃; the high molecular weight Pal2 also shows maximum activity at 47-52 ℃ and significant activity up to at least 57 ℃. No significant activity was observed for either of low molecular weight Pal2 or Pal3-6 at 37 ℃, 56 ℃ or 70 ℃. Thus, those skilled in the art will appreciate that these enzymes are thermostable at least at about 56 ℃ and/or in the range of 56 ℃ and 70 ℃. These particular example enzymes may also be described as thermally active because their associated activities are significantly reduced and/or undetected at lower temperatures (e.g., 37 ℃). Without wishing to be bound by any particular theory, it is noted that enzymes of thermophilic organisms may generally exhibit reduced (or undetectable) activity at such temperatures.

Equivalent forms

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. The scope of the application is not intended to be limited to the above description but rather is set forth in the following claims.

Claims (18)

1. A method of detection, the method comprising the steps of:

allowing a CRISPR-Cas complex comprising:

cas proteins with cleavage-attached activity that are thermostable at temperatures above at least 60-65 ℃; and

a guide RNA selected or engineered to be complementary to a target sequence;

and (3) with

Sample contact of nucleic acids potentially comprising the target sequence.

2. The method of claim 1, wherein the contacting step comprises contacting the crjsrp-Cas complex and sample with a reporter susceptible to cleavage by the Cas protein.

3. The method of claim 1 or claim 2, wherein the contacting step comprises incubating above the temperature for a period of time.

4. The method of any one of the preceding claims, further comprising the step of amplifying nucleic acids present in the sample.

5. The method of claim 4, wherein the amplifying step utilizes a thermostable nucleic acid polymerase.

6. The method of claim 4 or claim 5, wherein the amplifying and contacting steps are performed in a single vessel.

7. The method of claim 1, wherein the Cas protein is a Cas12 protein.

8. The method of claim 7, wherein the Cas protein has an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ id No. 15.

9. The method of claim 7, wherein the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ id nos. 3-21, 33-47, 51-56, 68-178 and 274-283.

10. The method of claim 1, wherein the Cas protein has an amino acid sequence with 80% sequence identity to any one of SEQ id nos. 1-283.

11. In a method of performing a detection assay with a Cas protein having a cleavage-by-tag activity, the improvement comprising utilizing a Cas protein having a thermostable cleavage-by-tag activity.

12. The improvement of claim 11, wherein the Cas protein is a Cas12 protein.

13. The improvement of claim 12, wherein the Cas protein has an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID No. 15.

14. The improvement of claim 12, wherein the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ ID nos. 3-21, 33-47, 51-56, 68-178 and 274-283.

15. The improvement of claim 11, wherein the method of performing the detection assay is performed in a single reaction vessel.

16. The improvement of claim 11, wherein the thermally stable side cleavage activity is thermally stable at temperatures above about 60 ℃.

17. The improvement of claim 11, wherein the thermally stable side cleavage activity is thermally stable at a temperature greater than about 65 ℃.

18. The improvement of claim 11, wherein the Cas protein has an amino acid sequence with at least 80% sequence identity to any one of SEQ ID nos. 1-283.