CN116949107A - Lysine production method, ABC transport protein mutant, recombinant microorganism and application - Google Patents

Lysine production method, ABC transport protein mutant, recombinant microorganism and application Download PDF

Info

Publication number
CN116949107A
CN116949107A CN202210404992.9A CN202210404992A CN116949107A CN 116949107 A CN116949107 A CN 116949107A CN 202210404992 A CN202210404992 A CN 202210404992A CN 116949107 A CN116949107 A CN 116949107A
Authority
CN
China
Prior art keywords
leu
ala
abc transporter
thr
cgl0666
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210404992.9A
Other languages
Chinese (zh)
Inventor
王亚迪
胡丹
冯帆
赵津津
李岩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Langfang Meihua Bio Technology Development Co Ltd
Original Assignee
Langfang Meihua Bio Technology Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Langfang Meihua Bio Technology Development Co Ltd filed Critical Langfang Meihua Bio Technology Development Co Ltd
Priority to CN202210404992.9A priority Critical patent/CN116949107A/en
Publication of CN116949107A publication Critical patent/CN116949107A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of microbial engineering, and particularly discloses a lysine production method, an ABC transport protein mutant, recombinant microorganisms and application. The lysine production method comprises the step of fermenting and culturing recombinant microorganisms, wherein the recombinant microorganisms have enhanced ABC transporter activity compared with a starting strain, and the amino acid sequence of the wild ABC transporter is shown as SEQ ID NO. 1. Preferably, the enhancement of the ABC transporter activity is achieved by mutating valine at position 199 of the amino acid sequence of the wild type ABC transporter. The method has high lysine production efficiency and is suitable for popularization and utilization.

Description

Lysine production method, ABC transport protein mutant, recombinant microorganism and application
Technical Field
The invention relates to the technical field of microbial engineering, in particular to a lysine production method, ABC transport protein mutant, recombinant microorganism and application.
Background
L-lysine is basicAmino acids of formula C 6 H 14 N 2 O 2 The appearance is white or nearly white crystalline powder. Darkening at 210 ℃, decomposing at 224.5 ℃, being readily soluble in water, slightly soluble in alcohol, insoluble in ether. Is widely used in animal feed, medicine and food industry, wherein about 90% of L-lysine is used in feed industry and 10% is used in food and medicine industry. The L-lysine can help the organism absorb other amino acids when being used as an animal feed additive, thereby improving the quality of the feed. Therefore, lysine production has wide prospects.
At present, the most commonly used production method of L-lysine is a microbial fermentation method. Corynebacterium glutamicum (Corynebacterium glutamicum) is a gram-positive microorganism with the characteristics of fast growth rate, non-pathogenic, and weak ability to degrade self-metabolites. As a conventional industrial microorganism, corynebacterium glutamicum is widely used for the production of various amino acids, nucleotides and other organic acids.
The cell membrane acts as a cytoprotective barrier separating the cytoplasm from the external environment, its stability under pressure and the interaction of membrane lipids with membrane proteins greatly affect the performance of industrial strains. Because of the complexity of metabolism of industrial strains, changing the membrane function to increase its substrate tolerance does not necessarily lead to an increase in the yield of the target product, but there is also a good coupling relationship between some metabolites and the membrane function, and increasing the robustness of industrial strains will increase the yield of the target product. ABC transport protein is a membrane channel protein which utilizes energy generated by ATP hydrolysis in cytoplasm to regulate substances to exit/enter a membrane, and can influence both functions of the membrane protein and an energy system in a cell membrane. At present, whether ABC transport proteins have influence on accumulation of amino acids of aspartic acid family such as L-lysine or not is not reported.
Disclosure of Invention
The invention aims to provide a method for improving lysine yield, ABC transporter mutant, recombinant microorganism and application.
The technical scheme of the invention is as follows:
a method for producing lysine comprising the step of fermentation culturing a recombinant microorganism having enhanced ABC transporter activity as compared to a starting strain, the amino acid sequence of a wild-type ABC transporter being shown in SEQ ID No. 1.
The research of the invention finds that the expression of specific ABC transport proteins is enhanced, which is beneficial to the production of lysine by zymophyte. The ABC transporter is an ATPase component and participates in inorganic ion transport and metabolism, coenzyme transport and metabolism.
ABC transporter expression/activity is enhanced by means well known in the art, such as by altering the regulatory regions, or by increasing the copy number of the polynucleotide encoding the protein, or by amino acid sequence mutation, etc.
Preferably, the enhancement of the ABC transporter activity is achieved by mutating valine at amino acid position 199 of the wild-type ABC transporter; more preferably, the recombinant microorganism expresses a mutated ABC transporter having an amino acid sequence as set forth in any one of SEQ ID NO. 2-6.
According to the invention, the amino acid at a specific position of the ABC transport protein is replaced, so that the expression of the ABC transport protein can be enhanced, and the effect of improving the yield of recombinant microorganism lysine can be further achieved (similar effects can be achieved by strengthening in other modes). Specifically, lysine production is improved when the 199 th position of the wild-type ABC transporter is mutated from valine to another amino acid, preferably methionine, isoleucine, glutamic acid, tryptophan or lysine.
The gene encoding the ABC transporter was designated Cgl0666.
Further preferably, the recombinant microorganism expresses a mutated ABC transporter, the amino acid sequence of which is shown in SEQ ID NO. 4.
In the lysine production method of the present invention, the starting strain is Corynebacterium glutamicum.
The invention also provides an ABC transporter mutant, which takes the amino acid sequence of a wild ABC transporter as a reference sequence, wherein the ABC transporter mutant contains mutation of substituting valine at 199 th position; the amino acid sequence of the wild ABC transporter is shown as SEQ ID NO. 1.
Preferably, the amino acid sequence of the ABC transporter mutant is shown in any one of SEQ ID NO. 2-6.
The invention further provides a recombinant microorganism which expresses the ABC transporter mutant.
Preferably, the starting strain of the recombinant microorganism is Corynebacterium glutamicum.
The invention further provides an application of any one of the recombinant microorganisms as follows:
(1) The application in producing lysine by fermentation;
(2) Use in genetic breeding of microorganisms for producing lysine;
(3) The application of the method in improving the yield of lysine produced by fermentation.
The invention has the advantages that:
the invention uses recombinant microorganism with enhanced ABC transporter activity to produce lysine, provides a novel biological fermentation method for increasing the yield of lysine, and can obviously improve the conversion rate of lysine.
Detailed Description
Preferred embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention may be made by those skilled in the art without departing from the spirit and scope of this invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. The following examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the product specifications. The reagents or equipment used were conventional products available for purchase through regular channels, with no manufacturer noted.
The names and sequences of the primers involved in the examples of the present invention are shown in Table 1.
TABLE 1 primer sequences (SEQ ID No. 7-29)
Name of the name Sequence 5 '. Fwdarw.3'
P-1f atggatccatcgtccccggcaaaat
P-1r catgacgatggtggtgcc
P-Cgl0666 V199M --2f ggcaccaccatcgtcatgatgctccacgaattgggact
P-Cgl0666 V199I --2f ggcaccaccatcgtcatgatcctccacgaattgggact
P-Cgl0666 V199E --2f ggcaccaccatcgtcatggaactccacgaattgggact
P-Cgl0666 V199W --2f ggcaccaccatcgtcatgtggctccacgaattgggact
P-Cgl0666 V199K --2f ggcaccaccatcgtcatgaaactccacgaattgggact
P-2r acgtcgacgtggaggacgaaatcgacg
Cgl0666 V199M -F1 atgctccacgaattgggact
Cgl0666 V199I -F1 atcctccacgaattgggact
Cgl0666 V199E -F1 gaactccacgaattgggact
Cgl0666 V199W -F1 tggctccacgaattgggact
Cgl0666 V199K -F1 aaactccacgaattgggact
Cgl0666 V199 -F cgggagtaaccctgtgac
Cgl0666 V199 -R ggagcgaattcaatgccac
Cgl0666-tuf-1f atggatcccgtattcgctgtccaaggc
Cgl0666-tuf-1r agggttactcccgcgcggttg
Cgl0666-tuf-2f gtgaccaccaaccatcaactat
Cgl0666-tuf-2r atgctagccatcaagaagcaggatgtc
Cgl0666-tuf-f cgcgggagtaaccctagtaggcgcgtagggta
Cgl0666-tuf-r gttgatggttggtggtcactgtatgtcctcctggactt
Cgl0666-tuf-F ggtggcgtatcgcggtg
Cgl0666-tuf-R ccggcgttcatggcgatgag
Example 1 introduction of the mutant Gene Cgl0666 into CGMCC No.13407 V199M
Performing PCR amplification by using a Corynebacterium glutamicum ATCC 13032 genome as a template and a P-1f/P-1r primer pair to obtain an upstream homologous arm fragment P-up; the Corynebacterium glutamicum ATCC 13032 genome was used as a template, and P-Cgl0666 was used as a template V199M The PCR amplification is carried out on the primer pair of the-2 f/P-2r to obtain the downstream homologous arm fragment P-dn. PCR amplification was performed using a mixture of two fragments of P-up and P-dn as a template and a P-1f/P-2r primer pair to obtain a fragment up-dn, which was digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1, available from public sources) was digested with the same enzymes. The two enzyme digestion products are connected by T4 DNA Ligase, and Trans1T1 competent cells are transformed to obtain recombinant plasmid pK18mobsacB-Cgl0666 V199M 。
The amino acid sequence of the wild Cgl0666 is shown as SEQ ID No.1, and the mutant Cgl0666 V199M The amino acid sequence is shown as SEQ ID No. 2.
Competent cells of CGMCC No.13407 were prepared according to Corynebacterium glutamicum Handbook (C.glutamicum Handbook, charpter 23). Recombinant plasmid pK18mobsacB-Cgl0666 V199M By electric punctureThe well method transformed the competent cells, and transformants were selected on BHI selection medium containing 15mg/L kanamycin. The obtained transformant was cultured overnight in a common BHI liquid medium at a temperature of 33℃and shaking-cultured at 220rpm with a shaking table. During this culture, a second recombination of the transformant takes place and the vector sequence is removed from the genome by gene exchange. The cultures were serially diluted in gradient (10 -2 Serial dilution to 10 -4 ) The diluted solution was spread on a normal BHI solid medium containing 10% sucrose, and was subjected to stationary culture at 33℃for 48 hours. The grown strain does not carry the inserted vector sequence in its genome. Primer Cgl0666 was used V199M -F1 and P-2r identification of mutated recombinants by PCR amplification of the sequence of interest, using primer Cgl0666 V199 -F and Cgl0666 V199 R amplification target sequence is subjected to nucleotide sequencing analysis, and the mutant gene Cgl0666 is obtained through PCR amplification target sequence and nucleotide sequencing analysis V199M Is named 13407-Cgl0666 V199M 。
CGMCC No.13407 is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at the date of 11 and 30 of 2016, and has the address of China academy of sciences of China, including national institute of microbiology, no.3, national institute of sciences, no.1, beijing, chaoyang, and its classification designation: corynebacterium glutamicum, corynebacterium glutamicum, which strain has been disclosed in the Chinese patent application CN 106635944A.
Example 2 introduction of the mutant Gene Cgl0666 into CGMCC No.13407 V199I
Reference was made to the procedure of example 1 (primer P-Cgl 0666) V199M -2f substitution to P-Cgl0666 V199I - -2f, primer Cgl0666 V199M -F1 substitution to Cgl0666 V199I F1) to obtain a recombinant strain obtained by mutating amino acid 199 of ABC transporter gene into isoleucine, and the strain is named 13407-Cgl0666 V199I 。
Mutant Cgl0666 V199I The amino acid sequence is shown as SEQ ID No. 3.
Example 3 introduction of the mutant Gene Cgl0666 into CGMCC No.13407 V199E
Reference was made to the procedure of example 1 (primer P-Cgl 0666) V199M -2f substitution to P-Cgl0666 V199E - -2f, primer Cgl0666 V199M -F1 substitution to Cgl0666 V199E F1) to obtain recombinant strain of ABC transporter gene 199 amino acid mutated to glutamic acid, the strain is named 13407-Cgl0666 V199E 。
Mutant Cgl0666 V199E The amino acid sequence is shown as SEQ ID No. 4.
Example 4 introduction of the mutant Gene Cgl0666 into CGMCC No.13407 V199W
Reference was made to the procedure of example 1 (primer P-Cgl 0666) V199M -2f substitution to P-Cgl0666 V199W - -2f, primer Cgl0666 V199M -F1 substitution to Cgl0666 V199W F1) to obtain recombinant strain of ABC transporter gene 199 amino acid mutated into tryptophan, the strain is named 13407-Cgl0666 V199W 。
Mutant Cgl0666 V199W The amino acid sequence is shown as SEQ ID No. 5.
Example 5 introduction of the mutant Gene Cgl0666 into CGMCC No.13407 V199K
Reference was made to the procedure of example 1 (primer P-Cgl 0666) V199M -2f substitution to P-Cgl0666 V199K - -2f, primer Cgl0666 V199M -F1 substitution to Cgl0666 V199K F1) to obtain recombinant strain with ABC transporter gene 199 amino acid mutated to lysine, the strain is named 13407-Cgl0666 V199K 。
Mutant Cgl0666 V199K The amino acid sequence is shown as SEQ ID No. 6.
EXAMPLE 6 lysine fermentation experiment
The culture medium used for lysine fermentation experiments was as follows:
seed activation medium: BHI 37g/L,18g/L agar powder.
Seed culture medium: 20g/L of sucrose, 5g/L of yeast powder, 10g/L of peptone, 5g/L of urea and 0.4g/L of magnesium sulfate heptahydrate, and adjusting the pH value to 7.0.
Fermentation medium: 60g/L of glucose, 25g/L of ammonium sulfate, 2.0g/L of monopotassium phosphate, 1.0g/L of magnesium sulfate heptahydrate, 10g/L of soybean meal hydrolysate and 30g/L of calcium carbonate, and adjusting the pH value to 7.0.
The lysine fermentation method comprises the following steps:
1. seed activation: taking the strain to be verified from the freezing tube, streaking and activating on a seed activation culture medium, and culturing at 33 ℃ for 24 hours;
2. seed culture: the plate activated seeds 1 are picked and looped into a 500mL triangular flask filled with 30mL seed culture medium, and shake culture is carried out for 6h at 33 ℃ and 220 r/min;
3. fermentation culture: 2mL of the seed solution is inoculated into a 500mL triangular flask filled with 20mL of fermentation medium, and the culture is carried out for 14-15h at 33 ℃ under 220r/min in a shaking way, and three strains are arranged in parallel.
4、OD 562 And (3) measuring: diluting 100 μl of fermentation broth by a proper multiple, detecting OD at wavelength 562 with spectrophotometer, performing three parallels for each strain, calculating average value, and detecting OD 562 As shown in table 2.
5. Lysine concentration measurement: 2mL of the fermentation broth was centrifuged (12000 rpm,2 min), the supernatant was collected, the L-lysine content in the fermentation broth of the recombinant bacteria and the control bacteria was measured by HPLC, three bacteria were used in parallel, and the average value was calculated, and the measured lysine concentration was shown in Table 2.
TABLE 2 lysine production and growth assays for recombinant strains
Strain L-lysine (g/L) Sugar acid conversion% OD 562
CGMCC No.13407 15.2 25.3％ 47.5
13407-Cgl0666 V199M 17.2 28.7％ 46.3
13407-Cgl0666 V199I 16.9 28.2％ 46.7
13407-Cgl0666 V199E 18.6 31.0％ 46.1
13407-Cgl0666 V199W 18.1 30.2％ 46.8
13407-Cgl0666 V199K 18.4 30.7％ 46.2
Fermentation results show that after the 199 th amino acid Cgl0666 is mutated from valine (V) into methionine (M), isoleucine (I), glutamic acid (E), tryptophan (W) and lysine (K), the final OD value is equivalent to that of the original strain, but the lysine yield is improved, and the effect is better after the mutation into glutamic acid (E), 13407-Cgl0666 V199E The recombinant strain L-lysine yield is improved by 3.4g/L compared with the original strain, and the conversion rate is higherThe starting strain is improved by 5.7 percent.
Based on the results of the above mutant detection, it is presumed that other enhancement modes of Cgl0666 may have the effect of improving lysine yield and conversion rate, and thus other enhancement modes of Cgl0666 are further performed.
Example 7 introduction of a promoter-enhanced Cgl0666 Gene in CGMCC No.13407
Performing PCR amplification by using a Corynebacterium glutamicum ATCC 13032 genome as a template and Cgl0666-tuf-1f/Cgl0666-tuf-1r primer pairs to obtain an upstream homologous arm fragment P-up; performing PCR amplification by using a Corynebacterium glutamicum ATCC 13032 genome as a template and Cgl0666-tuf-2f/Cgl0666-tuf-2r primer pairs to obtain a downstream homologous arm fragment P-dn; PCR amplification was performed with the Cgl0666-tuf-f/Cgl0666-tuf-r primer set to give Ptuf. The three fragment mixtures of P-up, P-dn and Ptuf are used as templates, cgl0666-tuf-1f/Cgl0666-tuf-2r primer pairs are used for PCR amplification to obtain fragment up-Ptuf-dn, up-Ptuf-dn is subjected to double digestion by BamHI and NheI, and vector pK18mobsacB (GenBank: FJ437239.1, which is available from public sources) is subjected to double digestion by the same enzyme. The two cleavage products are connected by T4 DNALigase, and Trans1T1 competent cells are transformed to obtain recombinant plasmid pK18mobsacB-Ptuf-Cg10666.
Referring to the method of example 1, competent cells of CGMCC No.13407 were transformed with the above recombinant plasmid by electroporation, transformants were selected and cultured, and nucleotide sequencing analysis was performed using Cgl0666-tuf-F/Cgl0666-tuf-R amplified target sequence to obtain a recombinant strain in which the promoter of ABC transporter gene Cgl0666 was replaced with strong promoter Ptuf, and the strain was named 13407-Ptuf-Cgl0666.
Example 8 Performance test of promoter-enhanced Cgl0666 recombinant Strain
The recombinant strain constructed in example 7 was tested for its performance by referring to the method of example 6, and the lysine production and growth were measured as shown in Table 3.
TABLE 3 lysine production and growth assays for recombinant strains
Strain L-lysine (g/L) Sugar acid conversion% OD 562
CGMCC No.13407 15.2 25.3％ 47.5
13407-Ptuf-Cgl0666 18.5 30.8％ 46.2
The fermentation result shows that after the Cgl0666 promoter is replaced by the strong promoter Ptuf, the lysine yield is improved, the recombinant strain L-lysine yield is 3.3g/L higher than that of the original strain, and the conversion rate is improved by 5.5%. This example further demonstrates that lysine production by Corynebacterium glutamicum can be facilitated by enhancing the expression of ABC transporter proteins.
In order to further verify the effect of ABC transporter expression enhancement on lysine yield improvement, the inventor further introduces the means into another strain of lysine producing strain CGMCC No.11942 to examine the influence on lysine synthesis by corynebacterium glutamicum.
Example 9 introduction of the mutant Gene Cgl0666 into CGMCC No.11942 V199M
The recombinant strain obtained by mutating 199 th amino acid of ABC transport protein gene into methionine is obtained by using CGMCC No.11942 as an original strain and adopting the method and the primer of the example 1, and the strain is named as 11942-Cgl0666 V199M 。
CGMCC No.11942 is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) for 12 months and 25 days in 2015, and has the address of China academy of sciences of China, national academy of sciences of China, no.3, north Chen West Lu No.1, chao, beijing, and the classification designation: corynebacterium glutamicum, corynebacterium glutamicum, which strain has been disclosed in Chinese patent CN 105734004B.
Example 10 introduction of the mutant Gene Cgl0666 into CGMCC No.11942 V199I
Using CGMCC No.11942 as original strain, adopting the method and primer of example 1 to obtain recombinant strain with amino acid mutation of 199 th site of ABC transport protein gene into isoleucine, the strain is named 11942-Cgl0666 V199I 。
Example 11 introduction of the mutant Gene Cgl0666 into CGMCC No.11942 V199E
Using CGMCC No.11942 as original strain, adopting the method and primer of example 1 to obtain recombinant strain of ABC transporter gene 199 amino acid mutation into glutamic acid, the strain is named 11942-Cgl0666 V199E 。
Example 12 introduction of the mutant Gene Cgl0666 into CGMCC No.11942 V199W
Using CGMCC No.11942 as original strain, adopting the method and primer of example 1 to obtain recombinant strain whose amino acid at 199 th position of ABC transporter gene is mutated into tryptophan, the strain is named 11942-Cgl0666 V199W 。
Example 13 introduction of the mutant Gene Cgl0666 into CGMCC No.11942 V199K
Using CGMCC No.11942 as original strain, adopting the method and primer of example 1 to obtain recombinant strain with amino acid mutation of 199 th site of ABC transport protein gene into lysine, the strain is named 11942-Cgl0666 V199K 。
Example 14 introduction of a promoter-enhanced Cgl0666 Gene in CGMCC No.11942
The CGMCC No.11942 is taken as an original strain, the method and the primer of the embodiment 7 are adopted to obtain a recombinant strain in which the promoter of the ABC transporter gene Cgl0666 is replaced by a strong promoter Ptuf, and the strain is named 11942-Ptuf-Cgl0666.
EXAMPLE 15 shaking flask test of lysine fermentation Capacity of engineering bacteria
CGMCC No.11942 and recombinant bacteria 11942-Cgl0666 modified by the method of the example 6 V199M 、11942-Cgl0666 V199I 、11942-Cgl0666 V199E 、11942-Cgl0666 V199W 、11942-Cgl0666 V199K Fermentation verification was performed on 11942-Ptuf-Cgl0666. The lysine fermentation test results are shown in Table 4.
TABLE 4 lysine production and growth assays for recombinant strains
Strain L-lysine (g/L) Sugar acid conversion% OD 562
CGMCC No.11942 18.3 30.5％ 38.2
11942-Cgl0666 V199M 19.3 32.2％ 37.4
11942-Cgl0666 V199I 20.1 33.5％ 37.6
11942-Cgl0666 V199E 21.6 36.0％ 37.1
11942-Cgl0666 V199W 21.2 35.3％ 37.2
11942-Cgl0666 V199K 21.3 35.5％ 37.6
11942-Ptuf-Cgl0666 21.5 35.8％ 37.2
Fermentation results show that the final OD value of the recombinant strain is equivalent to that of the original strain, but the lysine yield is improved, and the effect is better after mutation into glutamic acid (E) is introduced, wherein the 199 th valine (V) of Cgl0666 gene is respectively introduced into CGMCC No.11942 into methionine (M), isoleucine (I), glutamic acid (E), tryptophan (W), lysine (K) and Cgl0666 gene enhanced by introducing a promoter V199E The recombinant strain L-lysine yield is improved by 3.3g/L compared with the original strain, and the conversion rate is improved by 5.5% compared with the original strain. It was shown that the enhanced expression of ABC transporter in Corynebacterium glutamicum contributes to an increase in L-lysine production.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> gallery plum blossom biotechnology development Co., ltd
<120> lysine production method, ABC transporter mutant, recombinant microorganism and application
<130> KHP221113213.6
<160> 29
<170> SIPOSequenceListing 1.0
<210> 1
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Val Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 2
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Met Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 3
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Ile Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 4
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Glu Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 5
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 5
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Trp Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 6
<211> 269
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
Met Thr Thr Asn His Gln Leu Ser Ala Glu Glu Ile Ser Leu Ala Tyr
1 5 10 15
Gly Glu Arg Thr Ile Ile Asp Ser Leu Ser Val Asp Ile Val Pro Gly
20 25 30
Lys Ile Thr Ser Ile Val Gly Pro Asn Gly Cys Gly Lys Ser Thr Leu
35 40 45
Leu Arg Ala Phe Ala Arg Leu Leu Lys Pro Ser Ala Gly Gln Ala Leu
50 55 60
Ile Asp Ala His Pro Leu Pro Ser Leu Pro Gly Lys Glu Leu Ala Arg
65 70 75 80
Met Leu Gly Leu Leu Pro Gln Ser Pro Thr Ala Pro Glu Gly Ile Val
85 90 95
Val Ala Asp Leu Val Gly Arg Gly Arg His Pro His Gln Gly Leu Met
100 105 110
Gly Arg Trp Ser Thr Arg Asp Tyr Glu Val Val Ala Gln Ala Leu Glu
115 120 125
Met Thr Asn Thr Thr Glu Leu Ala Glu Arg Pro Ile Asp Glu Leu Ser
130 135 140
Gly Gly Gln Arg Gln Arg Val Trp Ile Ala Met Ala Leu Ala Gln Glu
145 150 155 160
Thr Asp Ile Leu Leu Leu Asp Glu Pro Thr Thr Tyr Leu Asp Ile Ala
165 170 175
Asn Gln Leu Glu Val Leu Asp Leu Leu Thr Asp Leu Asn His Asn His
180 185 190
Gly Thr Thr Ile Val Met Lys Leu His Glu Leu Gly Leu Ala Ala Arg
195 200 205
Tyr Ser Asp His Leu Ile Ala Met Asn Ala Gly Lys Ile Tyr Ala Gln
210 215 220
Gly Thr Pro Thr Asn Val Ile Thr Glu Thr Met Met Ser Glu Val Phe
225 230 235 240
His Thr Asp Ala Arg Ile Ile Ala Asp Pro Val Ser Gly Ala Pro Leu
245 250 255
Val Met Pro Met Gly Arg His His Ile Thr Ala Leu His
260 265
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atggatccat cgtccccggc aaaat 25
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
catgacgatg gtggtgcc 18
<210> 9
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ggcaccacca tcgtcatgat gctccacgaa ttgggact 38
<210> 10
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
ggcaccacca tcgtcatgat cctccacgaa ttgggact 38
<210> 11
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ggcaccacca tcgtcatgga actccacgaa ttgggact 38
<210> 12
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
ggcaccacca tcgtcatgtg gctccacgaa ttgggact 38
<210> 13
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
ggcaccacca tcgtcatgaa actccacgaa ttgggact 38
<210> 14
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
acgtcgacgt ggaggacgaa atcgacg 27
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
atgctccacg aattgggact 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
atcctccacg aattgggact 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gaactccacg aattgggact 20
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
tggctccacg aattgggact 20
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
aaactccacg aattgggact 20
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
cgggagtaac cctgtgac 18
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
ggagcgaatt caatgccac 19
<210> 22
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
atggatcccg tattcgctgt ccaaggc 27
<210> 23
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
agggttactc ccgcgcggtt g 21
<210> 24
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
gtgaccacca accatcaact at 22
<210> 25
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
atgctagcca tcaagaagca ggatgtc 27
<210> 26
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
cgcgggagta accctagtag gcgcgtaggg ta 32
<210> 27
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
gttgatggtt ggtggtcact gtatgtcctc ctggactt 38
<210> 28
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
ggtggcgtat cgcggtg 17
<210> 29
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
ccggcgttca tggcgatgag 20

Claims (10)

1. A lysine production method is characterized by comprising the step of fermenting and culturing recombinant microorganisms, wherein the recombinant microorganisms have enhanced ABC transporter activity compared with a starting strain, and the amino acid sequence of wild type ABC transporter is shown as SEQ ID NO. 1.
2. The method of lysine production according to claim 1, wherein the enhancement of ABC transporter activity is achieved by an alteration of the regulatory region of the promoter, an increase in the copy number of the polynucleotide encoding the protein or an alteration of the amino acid sequence.
3. The method of producing lysine according to claim 2, wherein the enhancement of the activity of the ABC transporter is achieved by mutating valine at amino acid position 199 of the wild-type ABC transporter.
4. A method of lysine production according to claim 3, wherein the recombinant microorganism expresses a mutated ABC transporter having the amino acid sequence set forth in any one of SEQ ID nos. 2 to 6.
5. The method for producing lysine according to any of claims 1 to 4, wherein the starting strain is corynebacterium glutamicum.
6. An ABC transporter mutant, wherein the ABC transporter mutant comprises a mutation in which valine at position 199 is substituted, using the amino acid sequence of a wild-type ABC transporter as a reference sequence; the amino acid sequence of the wild ABC transporter is shown as SEQ ID NO. 1.
7. The ABC transporter mutant according to claim 6, wherein the amino acid sequence of the ABC transporter mutant is as set forth in any one of SEQ ID nos. 2 to 6.
8. A recombinant microorganism expressing the ABC transporter mutant of claim 6 or 7.
9. The recombinant microorganism according to claim 8, wherein the starting strain of the recombinant microorganism is corynebacterium glutamicum.
10. Use of a recombinant microorganism according to claim 8 or 9 for any of the following:
(1) The application in producing lysine by fermentation;
(2) Use in genetic breeding of microorganisms for producing lysine;
(3) The application of the method in improving the yield of lysine produced by fermentation.
CN202210404992.9A 2022-04-18 2022-04-18 Lysine production method, ABC transport protein mutant, recombinant microorganism and application Pending CN116949107A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210404992.9A CN116949107A (en) 2022-04-18 2022-04-18 Lysine production method, ABC transport protein mutant, recombinant microorganism and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210404992.9A CN116949107A (en) 2022-04-18 2022-04-18 Lysine production method, ABC transport protein mutant, recombinant microorganism and application

Publications (1)

Publication Number Publication Date
CN116949107A true CN116949107A (en) 2023-10-27

Family

ID=88444834

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210404992.9A Pending CN116949107A (en) 2022-04-18 2022-04-18 Lysine production method, ABC transport protein mutant, recombinant microorganism and application

Country Status (1)

Country Link
CN (1) CN116949107A (en)

Similar Documents

Publication Publication Date Title
US11512333B2 (en) Method for producing tetrahydropyrimidine by fermenting recombinant Corynebacterium glutamicum
CN110106206B (en) Corynebacterium glutamicum construction method for improving yield and stability of L-lysine
CN110551670B (en) Genetically engineered bacterium for producing L-leucine and application thereof
KR20220139351A (en) Modified Microorganisms and Methods for Improved Production of Ectoins
CN111349640B (en) Trans-4-hydroxy-L-proline production strain and construction method and application thereof
CN113430181A (en) Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof
CN110592084B (en) Recombinant strain transformed by rhtA gene promoter, construction method and application thereof
CN114729385A (en) Mutant filamentous fungus and method for producing protein using same
CN111718882A (en) Method for promoting corynebacterium glutamicum to synthesize amino acid by using ion transport protein
CN108588108B (en) Preparation method and application of bacillus for efficiently metabolizing glycerol
CN110862952B (en) 5-aminolevulinic acid production strain and construction method and application thereof
CN114426983B (en) Method for producing 5-aminolevulinic acid by knocking out transcription regulatory factor Ncgl0580 in corynebacterium glutamicum
CN116949107A (en) Lysine production method, ABC transport protein mutant, recombinant microorganism and application
CN111172090B (en) Method for promoting corynebacterium crenatum to synthesize L-arginine by using ion transport protein
CN110872595B (en) Acid-resistant expression cassette and application thereof in fermentation production of organic acid
CN118222603A (en) Engineering bacterium for high-yield L-lysine and construction method and application thereof
CN116949006A (en) Gamma subunit mutant of DNA polymerase III, recombinant microorganism, construction method and application thereof
KR20200009926A (en) A screening system for formate dehydrogenase with increased carbon dioxide reducing activity and uses thereof
CN116240192A (en) Histidine kinase mutant, recombinant microorganism containing histidine kinase mutant and application of histidine kinase mutant
CN115927267B (en) Bile acid complex enzyme preparation and application thereof
CN114634883B (en) Recombinant engineering bacterium for producing 2&#39; -fucosyllactose and construction method and application thereof
CN117720629A (en) Mutant of transcription termination protein and application thereof
CN116640752A (en) Aconitate hydratase mutant and application thereof
CN116262780A (en) Threonine efflux protein mutant and application thereof
CN116640791A (en) Construction method and application of recombinant microorganism

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination