CN116949047A - Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus - Google Patents

Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus Download PDF

Info

Publication number
CN116949047A
CN116949047A CN202310953177.2A CN202310953177A CN116949047A CN 116949047 A CN116949047 A CN 116949047A CN 202310953177 A CN202310953177 A CN 202310953177A CN 116949047 A CN116949047 A CN 116949047A
Authority
CN
China
Prior art keywords
nucleic acid
acid aptamer
virus
channel
influenza
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310953177.2A
Other languages
Chinese (zh)
Inventor
张志凌
王萌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan University WHU
Original Assignee
Wuhan University WHU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan University WHU filed Critical Wuhan University WHU
Priority to CN202310953177.2A priority Critical patent/CN116949047A/en
Publication of CN116949047A publication Critical patent/CN116949047A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/502761—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip specially adapted for handling suspended solids or molecules independently from the bulk fluid flow, e.g. for trapping or sorting beads, for physically stretching molecules
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00—Moving or stopping fluids
    • B01L2400/04—Moving fluids with specific forces or mechanical means
    • B01L2400/0403—Moving fluids with specific forces or mechanical means specific forces
    • B01L2400/043—Moving fluids with specific forces or mechanical means specific forces magnetic forces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Abstract

The application provides a nucleic acid aptamer for identifying hemagglutinin protein from influenza A virus, which is shown in a nucleotide sequence SEQ ID NO. 1. The aptamer can enable a single DNA molecule to bind to multiple subtype HA proteins (hemagglutinin proteins) and widely inhibit H5N1, H7N9, H9N2 and H1N1 virus infection. The application not only develops a novel broad-spectrum aptamer which has wide inhibition effect on various viruses, but also opens up an effective strategy for developing general virus inhibitors, and is expected to be applied in the field of virus treatment.

Description

Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus
Technical Field
The application relates to the technical field of biomedicine, in particular to a nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus and a screening method thereof.
Background
Viral infectious diseases are severely threatening the life health and social development of humans. The development of broad-spectrum antiviral inhibitors is urgent in order to cope with antigenic variation of viruses and the unpredictable emergence of new strains. Over the last decade, studies of broad spectrum inhibitors have been developed, including broad spectrum neutralizing antibodies, multivalent vaccines, polypeptide complexes, and the like. The inhibitor needs to be obtained from the body, has long period, difficult operation, high cost, large molecular size and complex structure, and influences the development of the inhibitor to a certain extent. To overcome these limitations, aptamer blocking has become a novel viral inhibition strategy. The aptamer is a single-stranded oligonucleotide DNA or RNA fragment, has high affinity and strict recognition capability on a corresponding target through a specific three-dimensional structure and intermolecular force, and can be obtained from a random oligonucleotide library through in vitro exponential enrichment ligand systematic evolution (Systematic Evolution of Ligands by Exponential Enrichment, SELEX) technology. At present, the aptamer has the advantages of small volume, low cost, easy acquisition, stable property and the like, and has been widely applied to the field of virus inhibition. Specific aptamers are the most common method of inhibiting infection by a single subtype of virus. To further achieve broad inhibition, a broad recognition and inhibition of multiple subtype viruses can be successfully provided by coupling multiple nucleic acid aptamers to nanocarriers or by hybridization to form new DNA complexes to construct multivalent nucleic acid aptamers. However, the broad spectrum of such inhibitors is limited by the type and number of loading aptamers.
Therefore, there is a need to develop a broad-spectrum aptamer inhibitor capable of widely aiming at influenza a virus, which provides a high-efficiency method for developing broad-spectrum inhibitors of other viruses, and is expected to be applied in the field of virus treatment.
Disclosure of Invention
The application aims to provide a nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus, which can enable a single DNA molecule to bind to multiple subtype HA proteins (hemagglutinin proteins) and widely inhibit H5N1, H7N9, H9N2 and H1N1 virus infection.
In order to solve the technical problems of the application, the application adopts the following technical scheme:
in a first aspect of the present application, there is provided a nucleic acid aptamer for use in identifying an influenza a virus-derived hemagglutinin protein, the nucleotide sequence of the nucleic acid aptamer for use in identifying an influenza a virus-derived hemagglutinin protein being shown in SEQ ID No. 1.
Further, the influenza a virus includes at least one of H5N1, H7N9, H9N2, and H1N 1.
Further, the nucleic acid aptamer for recognizing hemagglutinin protein derived from influenza a virus further comprises: one of fluorescent substances, nano luminescent materials, biotin, digoxin and enzyme labels is combined on the nucleotide sequence of the nucleic acid aptamer; the fluorescent substance is FAM fluorescent group or Cy5 fluorescent group; the nano luminescent material is quantum dots or up-conversion nano particles; the enzyme label is horseradish peroxidase or sucrase.
Further, the nucleic acid aptamer for recognizing hemagglutinin protein derived from influenza a virus further comprises: a nucleic acid aptamer that is phosphorylated, methylated, aminated, sulfhydrylated or isotopically substituted at a position on the nucleotide sequence of the nucleic acid aptamer.
In a second aspect of the application, there is provided the use of said aptamer in the preparation of an influenza a virus inhibitor.
In a third aspect of the application there is provided an inhibitor for use in the detection of influenza a virus comprising said nucleic acid aptamer.
In a fourth aspect of the present application, there is provided a method for screening for the nucleic acid aptamer, the method comprising:
step S1, obtaining an initial random DNA library simultaneously containing the following molecules:
A. molecules of H5N1-HA specific sequences, molecules of H7N9-HA specific sequences, molecules of H9N2-HA specific sequences: a molecule that specifically binds to the sequence of one hemagglutinin protein (HA) of three viruses H5N1, H7N9, H9N 2;
B. molecules of the HA general sequence: a sequence (HA general sequence) of hemagglutinin protein binding to three viruses H5N1, H7N9, H9N 2;
C. molecules of HA non-specific sequences: a sequence that does not bind to any hemagglutinin protein of three viruses H5N1, H7N9, H9N2 (HA non-specific sequence);
s2, dissolving the random DNA library in a binding buffer solution, heating at 95 ℃, cooling on ice for 10min, standing at room temperature to form a specific space structure, incubating with magnetic-sphere-coupled bovine serum albumin, and removing nonspecific binding through magnetic separation to obtain magnetic-sphere-coupled H5N1, H7N9 and H9N2 proteins;
step S3, preparing a chip containing 3 microfluidic channels, and respectively pumping H5N1, H7N9 and H9N2 proteins coupled by magnetic spheres into the 3 microfluidic channels to form target protein arrays;
and S4, pumping the random DNA library into a chip channel, combining and enriching HA proteins in the corresponding channel, collecting a mixture in a collecting area, and carrying out sequencing analysis on the collected DNA products through multiple rounds of screening to obtain the nucleic acid aptamer.
In a fifth aspect of the present application, there is provided a magnetic control micro-fluidic chip for screening the nucleic acid aptamer, the magnetic control micro-fluidic chip comprising:
a first screening zone comprising a first inlet, a first channel, and a first outlet; the first channel is internally provided with H5N1 proteins coupled with magnetic balls;
a second screening zone comprising a second inlet, a second channel, and a second outlet; the H7N9 protein coupled with the magnetic ball is distributed in the second channel;
a third screening zone comprising a third inlet, a second channel, and a third outlet; the H9N2 protein coupled with the magnetic ball is distributed in the third channel;
and the first outlet of the first channel, the second outlet of the second channel and the third outlet of the third channel are converged to form the collecting area.
One or more technical solutions in the embodiments of the present application at least have the following technical effects or advantages:
the application provides a nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus and application thereof, and the nucleic acid aptamer screened by the application realizes the combination of single DNA molecules on multiple subtype hemagglutinin proteins and can widely inhibit the infection of the influenza A virus. The application not only develops a novel broad-spectrum aptamer which has wide inhibition effect on various viruses, but also opens up an effective strategy for developing general virus inhibitors, and is hopeful to be applied to the field of virus treatment.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present application, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1, (a) schematic structural diagram of a multichannel enrichment magnetic control micro-fluidic chip; (b) a multi-channel enrichment magnetic control micro-fluidic chip structure diagram; (c-f) a schematic of a multichannel enrichment process; the reference numerals in the drawings are: 1-a first inlet; 2-a second inlet; 3-a third inlet; 4-a first channel; 5-a second channel; 6-a third channel; 7-collection zone.
FIG. 2, (a-c) determination of UHA-2 aptamer affinity; (d) secondary structure of UHA-2 aptamer;
FIG. 3, (a-d) extensive neutralization assay of influenza A virus by UHA-2 aptamer; (e) Fluorescent field patterns of UHA-2 aptamer inhibiting influenza A virus infection of MDCK cells.
Detailed Description
The advantages and various effects of the present application will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the application, not to limit the application.
Throughout the specification, unless specifically indicated otherwise, the terms used herein should be understood as meaning as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification will control.
Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, etc., used in the present application are commercially available or may be obtained by existing methods.
A nucleic acid aptamer for recognizing a hemagglutinin protein derived from influenza A virus and a screening method thereof according to the present application will be described in detail with reference to examples and experimental data.
Example 1 screening for broad-spectrum aptamers using a multichannel enrichment strategy
(1) As shown in fig. one (c-f), 200pmol of random DNA library was dissolved in 200 μl of binding buffer, heated with PCR instrument at 95 ℃ for 10min, cooled on ice for 10min, then left at room temperature for 5min to form a specific spatial structure, then incubated with magnetic-sphere-coupled bovine serum albumin, and nonspecific binding was removed by magnetic separation;
(2) Respectively pumping H5N1, H7N9 and H9N2 proteins coupled by magnetic balls into microfluidic channels of a chip containing 3 microfluidic channels to form a target protein array, so as to obtain a multichannel enrichment magnetic control microfluidic chip;
the multichannel enrichment magnetic control micro-fluidic chip comprises:
a first screening zone comprising a first inlet 1, a first channel 4 and a first outlet; the first channel is internally provided with H5N1 proteins coupled with magnetic balls;
a second screening zone comprising a second inlet 2, a second channel 5 and a second outlet; the H7N9 protein coupled with the magnetic ball is distributed in the second channel;
a third screening zone comprising a third inlet 3, a second channel 6 and a third outlet; the H9N2 protein coupled with the magnetic ball is distributed in the third channel;
the first outlet of the first channel, the second outlet of the second channel and the third outlet of the third channel are converged to form a collecting area 7.
(3) Pumping the obtained random DNA library into channels of the multichannel enrichment magnetic control micro-fluidic chip, combining and enriching HA proteins in the respective channels, and finally collecting a mixture in a collecting area, and carrying out sequencing analysis on the collected DNA products through multiple rounds of screening. From the nucleotide sequence of the obtained UHA-2 nucleic acid aptamer:
5’-AGCATTCGCCCGCCTATCCACATCCTGACGCCCTTAGGGGCCGGAGCGCATTGG AACACA-3’(SEQ ID NO.1)。
example 2 affinity assay of UHA-2 aptamer for multiple subtype hemagglutinin proteins
The binding capacity of the aptamer was determined by fluorescence intensity measurement. Different concentrations (0, 10, 20, 50,100, 150, 200 nM) of FAM fluorescent-labeled UHA-2 aptamer were incubated with magnetic-sphere-coupled H5N1, H7N9 and H9N2 hemagglutinin proteins, respectively, for 1H at room temperature, after magnetic sorting, the supernatant was discarded, and the mixture of magnetic-sphere-coupled H5N1, H7N9 and H9N2 hemagglutinin proteins and different concentrations of aptamer was collected for resuspension, the binding affinity of UHA-2 aptamer was determined by 520nM fluorescent signal intensity, and the equation Y=B was used max X/(K d +X) to draw a curve and calculate K by Sigmaplot 14 software d Values. Y is the target binding fluorescence intensity, B max For saturated fluorescence intensity, the X value is the concentration of FAM fluorescence-labeled UHA-2 aptamer.
The results are shown in FIG. 2 (a-c), where the UHA-2 aptamer is K against different proteins d The values were 1.6.+ -. 0.7nM (H5N 1-HA), 3.9.+ -. 0.6nM (H7N 9-HA) and 10.1.+ -. 1.1nM (H9N 2-HA), respectively. The secondary structure of the UHA-2 aptamer is shown in FIG. 2 (d).
Example 3 broad inhibition of multiple influenza A viruses by UHA-2 aptamer
UHA-2 aptamer at various concentrations (0, 25,50,100,200,400,800,160 nM) was added to MDCK cells along with various influenza A viruses, and their inhibitory concentration (EC 50 )。
As shown in FIGS. 3 (a-d), the EC of UHA-2 aptamer against H5N1, H7N9, H9N2 and H1N1 viruses 50 Values 234.4nM, 292.9nM, 132.0nM and 378.7nM, respectively, demonstrate extensive neutralization of influenza A virus by the aptamer.
As shown in the immunofluorescent staining of FIG. 3 (e), the UHA-2 aptamer can remarkably reduce the number of virus infected cells and has good effect on widely inhibiting the infection of influenza A virus.
Finally, it is also noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
While preferred embodiments of the present application have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the application.
It will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Claims (8)

1. A nucleic acid aptamer for recognizing a hemagglutinin protein derived from influenza a virus, characterized in that the nucleotide sequence of the nucleic acid aptamer for recognizing a hemagglutinin protein derived from influenza a virus is shown in SEQ ID No. 1.
2. The nucleic acid aptamer of claim 1, wherein the influenza a virus comprises at least one of H5N1, H7N9, H9N2, and H1N 1.
3. The nucleic acid aptamer of claim 1, further comprising: one of fluorescent substances, nano luminescent materials, biotin, digoxin and enzyme labels is combined on the nucleotide sequence of the nucleic acid aptamer; the fluorescent substance is FAM fluorescent group or Cy5 fluorescent group; the nano luminescent material is quantum dots or up-conversion nano particles; the enzyme label is horseradish peroxidase or sucrase.
4. The nucleic acid aptamer of claim 1, wherein the nucleic acid aptamer for recognizing hemagglutinin protein of influenza a virus origin further comprises: a nucleic acid aptamer that is phosphorylated, methylated, aminated, sulfhydrylated or isotopically substituted at a position on the nucleotide sequence of the nucleic acid aptamer.
5. Use of a nucleic acid aptamer according to any one of claims 1 to 4 for the preparation of an influenza a virus inhibitor.
6. An inhibitor of influenza a virus comprising the nucleic acid aptamer of any one of claims 1-4.
7. A method of screening for a nucleic acid aptamer according to any one of claims 1 to 4, comprising:
step S1, obtaining an initial random DNA library simultaneously containing the following molecules:
A. molecules of H5N1-HA specific sequences, molecules of H7N9-HA specific sequences, molecules of H9N2-HA specific sequences: a molecule that specifically binds to the sequence of one of the Haemagglutinin proteins (HA) in three viruses H5N1, H7N9, H9N 2;
B. molecules of the HA general sequence: a sequence (HA universal sequence) molecule that binds to hemagglutinin proteins of three viruses H5N1, H7N9, H9N 2;
C. molecules of HA non-specific sequences: a sequence molecule which does not bind to any hemagglutinin protein of three viruses H5N1, H7N9 and H9N 2;
s2, dissolving the random DNA library in a binding buffer solution, heating, cooling on ice, standing at room temperature, incubating with magnetic-sphere-coupled bovine serum albumin, and removing nonspecific binding through magnetic separation to obtain magnetic-sphere-coupled H5N1, H7N9 and H9N2 proteins;
step S3, preparing a chip containing 3 micro-fluidic channels, and respectively pumping the H5N1, H7N9 and H9N2 proteins coupled by the magnetic balls into the 3 micro-fluidic channels to form a multi-channel enrichment magnetic control micro-fluidic chip;
and S4, pumping the random DNA library into the multichannel enrichment magnetic control micro-fluidic chip, collecting the mixture in a collecting area, and carrying out sequencing analysis on the collected DNA products through multiple rounds of screening to obtain the nucleic acid aptamer.
8. A multichannel enrichment magnetic control microfluidic chip for screening of the nucleic acid aptamer of any of claims 1-4, characterized in that the multichannel enrichment magnetic control microfluidic chip comprises:
a first screening zone comprising a first inlet, a first channel, and a first outlet; the first channel is internally provided with H5N1 proteins coupled with magnetic balls;
a second screening zone comprising a second inlet, a second channel, and a second outlet; the H7N9 protein coupled with the magnetic ball is distributed in the second channel;
a third screening zone comprising a third inlet, a second channel, and a third outlet; the H9N2 protein coupled with the magnetic ball is distributed in the third channel;
and the first outlet of the first channel, the second outlet of the second channel and the third outlet of the third channel are converged to form the collecting area.
CN202310953177.2A 2023-07-28 2023-07-28 Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus Pending CN116949047A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310953177.2A CN116949047A (en) 2023-07-28 2023-07-28 Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310953177.2A CN116949047A (en) 2023-07-28 2023-07-28 Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus

Publications (1)

Publication Number Publication Date
CN116949047A true CN116949047A (en) 2023-10-27

Family

ID=88444405

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310953177.2A Pending CN116949047A (en) 2023-07-28 2023-07-28 Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus

Country Status (1)

Country Link
CN (1) CN116949047A (en)

Similar Documents

Publication Publication Date Title
Komarova et al. Inside the black box: what makes SELEX better?
US9404919B2 (en) Multiplexed analyses of test samples
US7855054B2 (en) Multiplexed analyses of test samples
CA2693453C (en) Multiplexed analyses of test samples
Yüce et al. Trends in aptamer selection methods and applications
CN101374965B (en) Multiplexed analyses of test samples
Ozer et al. New technologies provide quantum changes in the scale, speed, and success of SELEX methods and aptamer characterization
Qian et al. Generation of highly specific aptamers via micromagnetic selection
AU2013271401B2 (en) Aptamer-based multiplexed assays
JP6404714B2 (en) Multivariate diagnostic assay and method for using the same
CN104131105A (en) Method for screening aptamer specifically bound with alpha-fetoprotein
US20130116129A1 (en) Method for detecting target molecules
Kedzierski et al. Synthetic antibodies: the emerging field of aptamers
CN104818278A (en) Aptamer capable of being in specific binding to TS/MDEP protein in gastric cancer cells
Zeng et al. Target‐triggered formation of artificial enzymes on filamentous phage for ultrasensitive direct detection of circulating miRNA biomarkers in clinical samples
Wen et al. A microfluidic dual-aptamer sandwich assay for rapid and cost-effective detection of recombinant proteins
Jin et al. Web hybrid chain reaction enhanced fluorescent magnetic bead array for digital nucleic acid detection
CN116949047A (en) Nucleic acid aptamer for identifying hemagglutinin protein derived from influenza A virus
US10883145B2 (en) Compositions and methods for metagenome biomarker detection
Banu et al. Prospects for the application of aptamer based assay platforms in pathogen detection
AU2017202493B2 (en) Multiplexed analyses of test samples
Sorensen Individualized miRNA assay panels using optically encoded beads
CN102373212A (en) Chymotrypsin nucleic acid aptamers, preparation method and application thereof
Kakoti Aptamer: An Emerging Biorecognition System
KR20220164163A (en) Preparation of aptamer pool using magnetic collection for proteomic profile or protein quantification and automated equipment thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination