CN116948000A - Recombinant uromodulin fragment product and application thereof in inhibiting complement activation - Google Patents

Abstract

The application discloses a recombinant uromodulin fragment product and application thereof in inhibiting complement activation. Aiming at the problem that the direct extraction of natural uromodulin monomer is difficult in the prior art, the application designs and prepares a recombinant uromodulin fragment UMOD-FLR1 in vitro. Experiments prove that: the recombinant uromodulin fragment has the functions of regulating complement activity and inhibiting complement activation, and the recombinant uromodulin fragment does not aggregate to form a polymer because of containing an external hydrophobic group and exists as a monomer. In addition, a large amount of recombinant uromodulin fragments can be obtained in vitro stably by the preparation method of the application, and mass production can be carried out, thereby effectively avoiding the difficulty of directly extracting natural uromodulin monomers. The composition can be used as peptide drugs for treating and preventing rare diseases or acute kidney injury, and can also be used for modifying medical membrane materials to increase biocompatibility.

Description

Recombinant uromodulin fragment product and application thereof in inhibiting complement activation

Technical Field

The application belongs to the technical field of biology, and particularly relates to a recombinant uromodulin fragment product and application thereof in inhibiting complement activation.

Background

Uromodulin (UMOD; also known as Tamm-Horsfall protein, THP), specifically expressed in the tubular epithelial cells of the ascending branch of the tubular loop and proximal end of the distal tubular, is secreted into urine and is detectable in blood. Uromodulin gene mutation can cause autosomal dominant inherited chronic tubular interstitial disease, and renal pathology manifests as extensive tubular atrophy and tubular fibrosis, ultimately leading to end-stage renal disease. Results from genetic and massive population studies have shown that uromodulin is a protective factor for kidney injury, and is associated with the occurrence and progression of acute and chronic kidney disease. After ischemia reperfusion injury, the animal model of the uromodulin gene knockout mice has more serious kidney injury than the control group, and the uromodulin is suggested to play a role in protection by regulating natural immunity. Micanovic R et al found that uromodulin exists mainly in a monomer form in human serum, and extracted from human urine and injected intraperitoneally into mice, reduced the exacerbation of acute kidney injury in ischemia reperfusion injury mice (uromodulin gene knockout), showing for the first time the possibility of uromodulin treatment or prevention of acute kidney injury. Other studies have further demonstrated that the modulation of natural immunity by uromodulin is multi-directional. Uromodulin may bind to a variety of immunomodulatory molecules; synthesis of cytokines such as IL-8, IL-1. Beta., IL-6 and TNF-. Alpha.can be induced by activation of monocytes, neutrophils and myeloid dendritic cells.

Although Micanovic R and the like extract uromodulin monomers from urine, and exogenously administer such uromodulin monomers reduces the deterioration of acute kidney injury, uromodulin in urine is mainly multimeric, purification of the monomers is very complicated and uncertain, and at the same time, since the content of the monomers in blood is low, direct extraction from blood is difficult, limiting possible future applicability.

Disclosure of Invention

It is an object of the present application to provide a recombinant uromodulin fragment having a complement activation inhibiting function.

The name of the recombinant uromodulin fragment provided by the application is UMOD-FLR1, and the recombinant uromodulin fragment is protein shown as the following R1) -R5):

r1) the amino acid sequence is a protein shown as SEQ ID No. 2;

r2) fusion proteins with the same functions obtained by fusing tag proteins at the carboxyl terminal and/or amino terminal of the protein shown in R1);

r3) fusion proteins with the same functions obtained by fusing signal peptides at the carboxyl end and/or the amino end of the protein shown in R1) or R2);

r4) protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in R1), R2) or R3);

a protein having 90% or more identity or function with the amino acid sequence represented by R5) and R1) or R2) or R3) or R4).

In R2), the tag refers to a polypeptide or protein which is fused and expressed together with the target protein by using a DNA in vitro recombination technology so as to facilitate the expression, detection, tracing and/or purification of the target protein. The tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above R3), the recombinant uromodulin fragment is composed of a signal peptide, a tag protein and a protein shown in SEQ ID No.2 in this order from the amino terminus to the carboxy terminus. Further, the signal peptide is a signal peptide SP. The tag protein is a 6xHis tag protein.

In the above R4), the substitution and/or deletion and/or addition of one or several amino acid residues is substitution and/or deletion and/or addition of not more than 10 amino acid residues, or substitution and/or deletion and/or addition of not more than 9 amino acid residues, or substitution and/or deletion and/or addition of not more than 8 amino acid residues, or substitution and/or deletion and/or addition of not more than 7 amino acid residues, or substitution and/or deletion and/or addition of not more than 6 amino acid residues, or substitution and/or deletion and/or addition of not more than 5 amino acid residues, or substitution and/or deletion and/or addition of not more than 4 amino acid residues, or substitution and/or deletion and/or addition of not more than 3 amino acid residues, or substitution and/or deletion and/or addition of not more than 2 amino acid residues, or substitution and/or deletion and/or addition of not more than 1 amino acid residue.

In R5) above, the identity includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity with the amino acid sequence shown in SEQ ID No.2 of the present application.

The protein described in the above R1) -R5) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

It is another object of the present application to provide a method for preparing the recombinant uromodulin fragment UMOD-FLR1 as described above.

The method for preparing the recombinant uromodulin fragment UMOD-FLR1 provided by the application comprises the following steps: and (3) expressing the coding gene of the recombinant uromodulin fragment UMOD-FLR1 in organisms or biological cells to obtain the recombinant uromodulin fragment UMOD-FLR1.

Further, the method for expressing the coding gene of the recombinant uromodulin fragment UMOD-FLR1 in the organism or the organism cell is to introduce the coding gene of the recombinant uromodulin fragment UMOD-FLR1 into the organism or the organism cell.

Furthermore, the coding gene of the recombinant uromodulin fragment UMOD-FLR1 is a DNA molecule shown as SEQ ID No.1 or SEQ ID No. 3.

In a specific embodiment of the application, the gene encoding the recombinant uromodulin fragment UMOD-FLR1 is introduced into the organism or the organism cell by means of a pCAG-SP-6XHis-UMOD expression vector. The pCAG-SP-6xHis-UMOD expression vector is obtained by replacing a DNA fragment between restriction enzyme sites EcoRI and NotI in the pCAG-GFP plasmid with a DNA molecule shown in SEQ ID No.3 and keeping other sequences of the pCAG-GFP plasmid unchanged.

Since the EHP and GPI domains of natural uromodulin are cleaved during secretion, polymerization is easy to occur under the action of the remaining IHP domains to form a polymer, while the recombinant uromodulin fragment UMOD-FLR1 prepared by the method of the application is a recombinant protein containing the EHP domains, does not converge to form a polymer, and exists as a monomer.

It is a further object of the present application to provide a nucleic acid molecule encoding the recombinant uromodulin fragment UMOD-FLR1 as described above.

The nucleic acid molecule for encoding the recombinant uromodulin fragment UMOD-FLR1 provided by the application is a gene shown in the following 1) or 2):

1) The coding sequence is a DNA molecule shown as SEQ ID No.1 or SEQ ID No. 3;

2) A DNA molecule which has more than 75% identity with the DNA molecule defined in 1) and which encodes the recombinant uromodulin fragment UMOD-FLR1 described above.

Wherein the nucleic acid molecule may be DNA, such as recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA.

The nucleotide sequence encoding the recombinant uromodulin fragment UMOD-FLR1 of the present application can be easily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence encoding the recombinant uromodulin fragment UMOD-FLR1 fragment are all derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application, as long as they encode the recombinant uromodulin fragment UMOD-FLR1 and have the same function.

In the above 2), the identity refers to sequence similarity with a natural nucleic acid sequence. "identity" includes nucleotide sequences having 75% or more, 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence of the present application which encodes the amino acid sequence shown in SEQ ID No. 2. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

Any of the following biological materials S1) to S3) also falls within the scope of the present application:

s1) an expression cassette comprising the above nucleic acid molecule;

s2) a recombinant vector containing the above nucleic acid molecule;

s3) transgenic cell lines containing the above-described nucleic acid molecules.

In the above S1), the expression cassette means a DNA capable of expressing the recombinant uromodulin fragment UMOD-FLR1 in a host cell, and the DNA may include not only a promoter for initiating transcription of the gene sequence encoding the recombinant uromodulin fragment UMOD-FLR1 but also a terminator for terminating transcription of the gene sequence encoding the recombinant uromodulin fragment UMOD-FLR1. Further, the expression cassette may also include an enhancer sequence.

In the above S2), the vector may be a plasmid, cosmid, phage or viral vector. The plasmid may specifically be the pCAG-GFP plasmid.

In the above S3), the cell may be a prokaryotic cell or a eukaryotic cell. The eukaryotic cell may specifically be a HEK293 cell.

It is also an object of the present application to provide a novel use of the recombinant uromodulin fragment UMOD-FLR1 as described above or the nucleic acid molecule as described above or the biological material as described above.

The present application provides the use of the recombinant uromodulin fragment UMOD-FLR1 as described above or the nucleic acid molecule as described above or the biological material as described above in any one of the following T1) -T16):

t1) preparing a product which modulates complement activity;

t2) preparing a complement-cleaving product;

t3) preparing a product that promotes or accelerates the degradation of complement fragment 3 b;

t4) preparing a product that enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

t5) preparing a product for the treatment or prevention of autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

t6) preparing a product for inhibiting erythrocyte hemolysis;

t7) preparing a product that enhances the ability of complement factor H to inhibit hemolysis of erythrocytes;

t8) preparing a product for improving the biocompatibility of the membrane material;

t9) modulates complement activity;

t10) cleavage of complement;

t11) promotes or accelerates the degradation of complement fragment 3 b;

t12) enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

t13) treatment or prevention of autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

t14) inhibits erythrocyte hemolysis;

t15) enhances the ability of complement factor H to inhibit erythrocyte hemolysis;

t16) improves the membrane material biocompatibility.

It is a final object of the present application to provide a product having any of the following functions X1) to X8):

x1) modulates complement activity;

x2) cleavage of complement;

x3) promotes or accelerates the degradation of complement fragment 3 b;

x4) enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

x5) treating or preventing autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

x6) inhibiting erythrocyte hemolysis;

x7) enhances the ability of complement factor H to inhibit erythrocyte hemolysis;

x8) improves the biocompatibility of the biofilm material.

The active ingredient of the product is the recombinant uromodulin fragment UMOD-FLR1 or the nucleic acid molecule or the biological material.

In any of the above products or applications, the complement may specifically be complement fragment 3b.

In any of the above products or applications, the improvement in biocompatibility of the biofilm material is manifested in: the recombinant uromodulin fragment UMOD-FLR1 prepared by the application can be combined with the surface of a biological film material by a method commonly used in the field of materials, and after the surface of the biological film material combined with the fragment contacts with blood, the fragment has the function of inhibiting complement activation, so that the complement activation in the blood can be inhibited, and the biocompatibility of the biological film material is improved.

In any one of the above products or applications, the amino acid sequence of complement factor H is AAI42700.1 in GenBank number in NCBI, the amino acid sequence of complement factor I is shown as SEQ ID No.4, and the amino acid sequence of complement fragment 3b is shown as SEQ ID No. 5.

Aiming at the problem that the direct extraction of natural uromodulin monomer is difficult in the prior art, the application designs and prepares a recombinant uromodulin fragment UMOD-FLR1 in vitro. Micro thermophoresis (MST) experiments prove that the recombinant uromodulin fragment UMOD-FLR1 can be combined with complement factor H. C3b cleavage experiments prove that the recombinant uromodulin fragment UMOD-FLR1 can enhance the ability of complement factor H as a cofactor of complement factor I to cleave complement fragment C3b, promote or accelerate the degradation of complement fragment C3b, cleave complement and inhibit the overactivation of complement system. Cell function experiments prove that the recombinant uromodulin fragment UMOD-FLR1 can enhance the capacity of complement factor H for inhibiting sheep erythrocyte hemolysis and inhibit erythrocyte lysis. The experiment shows that the recombinant uromodulin fragment UMOD-FLR1 prepared in vitro still has the functions of regulating complement activity and inhibiting complement activation, and the recombinant uromodulin fragment UMOD-FLR1 does not aggregate to form a polymer because of containing an external hydrophobic group and exists as a monomer. In addition, a large amount of recombinant uromodulin fragments UMOD-FLR1 can be obtained in vitro stably by the preparation method of the application, and mass production can be carried out, thus effectively avoiding the difficulty of directly extracting natural uromodulin monomers. The composition can be used as peptide drugs for treating and preventing rare diseases (ADTKD) or acute kidney injury, and can also be used for modifying medical membrane materials to increase biocompatibility.

Drawings

FIG. 1 is a schematic diagram of the structure of pCAG-GFP plasmid.

FIG. 2 is a schematic structural diagram of UMOD-pCMV-AC-GPF plasmid.

FIG. 3 is a schematic representation of the structure of pCAG-SP-6XHis-UMOD-FLR1 expression vector. The red box indicates restriction enzyme sites, light blue indicates CAG promoter, grey indicates 5 'and 3' ends, dark blue indicates signal peptide, yellow indicates 6XHis tag, green indicates GFP on original plasmid, and the lower Fang Lan indicates subclone replaces GFP inserted UMOD-FLR1 fragment.

FIG. 4 shows the detection results of Western blot and silver staining of the purified recombinant uromodulin fragment UMOD-FLR1.

FIG. 5 shows the results of Microphoresis (MST) of recombinant uromodulin fragment UMOD-FLR1 and complement factor H. The abscissa indicates ligand concentration and the ordinate indicates normalized fluorescence intensity.

FIG. 6 is a graph of C3b cleavage experiments and gray scale ratio statistics. A is a Western blot detection result of a C3b cleavage product of the recombinant uromodulin fragment UMOD-FLR1. B is a statistical plot of the relative gray scale ratio of 43kDa to 108kDa for the recombinant uromodulin fragment UMOD-FLR1 (gray scale values were obtained based on at least three replicates). Ordinate: 43kDa and 108kDa relative gray scale ratio, abscissa: different reaction times. Experiments were repeated at least 3 times.

FIG. 7 shows the hemolysis rate of sheep erythrocytes after addition of different amounts of complement factor H antibody and exogenous complement factor H to normal human serum. Abscissa: the amount of complement factor H antibody added; ordinate: hemolysis ratio (%) of sheep red blood cells. Experiments were repeated at least three times.

FIG. 8 is a graph showing the function of recombinant uromodulin fragment UMOD-FLR1 in inhibiting hemolysis of sheep erythrocytes by complement factor H. Abscissa: the amounts of exogenous complement factor H and uromodulin added in different groups; ordinate: sheep erythrocyte hemolysis rate (%). Experiments were repeated at least three times.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The data statistics method in the following examples is as follows: numerical variables are expressed as mean ± standard deviation, and classification variables are expressed as numerical values and percentages. And comparing continuous variables by adopting independent sample t test, and analyzing classified variables by chi-square test and Fisher accurate test. Post-hoc multiplex assays were used for inter-group variance analysis. Wherein P < 0.05 indicates a statistically significant difference. The data were analyzed using statistical software SPSS 22.0.

Example 1 preparation and identification of recombinant uromodulin fragment UMOD-FLR1

1. Structural design of recombinant uromodulin fragment UMOD-FLR1 and construction and identification of expression vector thereof

1. Structural design of recombinant uromodulin fragment UMOD-FLR1

The recombinant uromodulin fragment UMOD-FLR1 designed by the application comprises all domains and hydrophobic groups of the uromodulin.

2. Construction and identification of recombinant uromodulin fragment UMOD-FLR1 expression vector

The construction method of the recombinant uromodulin fragment UMOD-FLR1 expression vector is as follows:

1) Construction of pCAG-SP-6XHis-GFP expression vector

a. Using plasmid containing signal peptide SP as template, using primer corresponding to signal peptide SP in table 1 to make PCR amplification so as to obtain PCR product, its sequence is as follows: GAATTC (EcoRI) gccactig (SP start codon) gggcagccatctctgacttggatgctgatggtggtggtggcctcttggttcatcacaactgcagccactgacacc (SP) CATCATCACCATCACCAC (6 XHis) TGCGATCGC (AsiSI) CCCGGG (SmaI) ATCCACCGGTCGCCACCATGGTG.

TABLE 1 primers and PCR conditions for PCR amplification of target fragment

b. And (3) respectively carrying out double digestion (digestion at 37 ℃ C. For 2 hours) on the pCAG-GFP Plasmid (Addgene, product number is Plasmid #11150, addgene website: https:// www.addgene.org/11150/, structure diagram is shown in figure 1) and the PCR product purified in the step a, separating by agarose gel electrophoresis, cutting agarose containing the target DNA fragment, recovering DNA in the agarose fragment by using a kit, connecting the digested DNA fragment with a skeleton vector by using T4 ligase (16 ℃) and finally sequencing the connected product, wherein the vector with correct sequencing is pCAG-SP-6xHis-GFP.

2) Amplification of recombinant uromodulin fragment UMOD-FLR1 coding gene

The plasmid UMOD-pCMV-AC-GPF (origin, CAT#: RG223787, origin website: https:// www.origene.com/category/cdna-cones/expression-plasmas/RG 223787/uronuco ID-UMOD-nm_003361-human-tagged-orf-clone, structure schematic diagram is shown in FIG. 2) is used as a template, and PCR amplification is performed by using the primer corresponding to UMOD-FLR1 in Table 1 to obtain a PCR product (the sequence of the PCR product is shown in SEQ ID No. 1).

3) Construction of pCAG-SP-6XHis-UMOD expression vector

The GFP sequence between the AsiSI and NotI cleavage sites in the pCAG-SP-6xHis-GFP expression vector obtained in the step 1) is replaced by a recombinant uromodulin fragment UMOD-FLR1 coding gene shown in SEQ ID No.1, and other sequences of the pCAG-SP-6xHis-GFP expression vector are kept unchanged, so that the pCAG-SP-6xHis-UMOD-FLR1 expression vector (the structure schematic diagram of the pCAG-SP-6xHis-UMOD-FLR1 expression vector is shown in FIG. 3) is obtained. The pCAG-SP-6xHis-UMOD-FLR1 expression vector can be expressed to obtain a recombinant uromodulin fragment UMOD-FLR1, and the amino acid sequence of the recombinant uromodulin fragment UMOD-FLR1 is shown as SEQ ID No. 2.

4) Sequencing identification of pCAG-SP-6xHis-UMOD expression vector

N-terminal sequencing pCAG-F sequencing primers were used, with the sequence: CGGCTCTAGAGCCTCTGCTAAC; c-terminal sequencing pCAG-R sequencing primers were used, with the sequence: CAGTGGTATTTGTGAGCCAG. The UMOD gene sequence is longer, so that two sequencing primers, UMOD-F1 and UMOD-F2, are added before and after the D8C sequence: TACTGGCGCAGCACCGAGTA and TACGTCTACAACCTGACAGC. And adopting a bidirectional sequencing mode, and considering the sequences consistent with the bidirectional sequencing as correct sequences.

Sequencing results showed that: the pCAG-SP-6xHis-UMOD expression vector is obtained by replacing the DNA fragment between the restriction enzyme sites EcoRI and NotI in the pCAG-GFP plasmid with the DNA molecule shown in SEQ ID No.3, and keeping the other sequences of the pCAG-GFP plasmid unchanged.

Plasmids with correct sequencing were selected for the following cell culture experiments.

2. Expression, purification and identification of recombinant uromodulin fragment UMOD-FLR1

The specific steps of expression, purification and identification of the recombinant uromodulin fragment UMOD-FLR1 are as follows:

1. cell resuscitation

(1) Preparing a culture medium: DMEM high sugar medium (Corning, 10-013-CVR) 500 ml+fetal bovine serum (Gibco, 10099141) 50 ml+diabody (Lanbolode, 03-031-1B) 5ml.

(2) The medium was preheated at 37 ℃.

(3) HEK293 cells (Invitrogen, CBP 60438) were removed from the liquid nitrogen tank and gently shaken in a 37 ℃ water bath to allow rapid thawing.

(4) The cell solution was added to a 15ml centrifuge tube containing 10ml of medium and centrifuged at 800-1000rpm for 5min.

(5) The supernatant was discarded, the pellet was collected, 10ml of medium was added to the pellet, and after mixing by blowing, the suspension was transferred to 100mm ² In sterile culture flask, 37℃and 5% CO ₂ Cell incubator overnight.

(6) The next day the cell growth was observed, if the cell attachment was good, the old medium was discarded, 10ml of fresh medium was added for further culture, and the medium was changed every other day.

2. Cell passage

(1) The cells were passaged until the flask area was 80% -90%.

(2) Old media was discarded and sterile PBS gently rinsed 2 times.

(3) Digesting the cells, adding 0.5-1ml of 0.25% EDTA pancreatin, standing in a incubator at 37 ℃ for 30sec-1min, observing the cell rounding, floating, adding 5ml of culture medium to stop digestion, transferring the mixed solution into a 50ml centrifuge tube, and centrifuging at 800-1000rpm for 5min.

(4) The supernatant was discarded, the pellet was collected, and 6ml of fresh medium was added to the pellet, stirred well, passaged at 1:3 ratio to 100mm containing 8ml of fresh medium ² In a flask.

3. Cell transfection

1) Cell count and plating:

(1) cells were digested into single cell suspensions 24-36h prior to transfection (see step cell passaging).

(2) Coverslips were placed on 2 chambers of a cytometer.

(3) Mu.l of single cell suspension was pipetted at 45℃rapidly into the junction of the coverslip and the counting plate.

(4) Observed under a microscope and counted. The total number of four large cells of the cell counting plate was recorded, only whole cells were counted, and the line pressing cells were counted only to the left and above. Then the method comprises the following steps of: cell number of cell suspension/ml = total number of 4 large lattice cells/4 x10 ⁴ 。

(5) At 10cm ² Inoculating 1×10 in culture dish ⁶ Individual cells. Before transfection, the serum-containing medium was changed to serum-free medium.

2) Transfection:

(1) when the cells grow to 60% -70% of the area of the culture flask (24-36 h), transfection can be performed.

(2) Each 10cm ² Cell culture flasks were transfected with 10. Mu.g of plasmid (pCAG-SP-6 XHis-UMOD) at a 1:2 ratio of plasmid to transfection reagent.

(3) The plasmid and the transfection reagent were mixed with 500. Mu.l of serum-free medium, respectively, using the pre-shake transfection reagent X-treme GENE HP (Roche Co., ltd., 6365787001), and after shaking mixing, the two were mixed again, shaking mixing and standing for 15min.

(4) The mixture of plasmid and transfection reagent was added to the flask and gently swirled to distribute it evenly. After 48-60h, the supernatant was collected.

4. Purification of recombinant uromodulin fragment UMOD-FLR1

The recombinant uromodulin fragment UMOD-FLR1 is purified by Ni-beads, and the specific steps are as follows:

(1) The cell supernatant after transfection was collected and centrifuged at 3000rpm/min for 10min, and the supernatant was left.

(2) Sample treatment: the supernatant was filtered through a 0.2 μm filter to filter out cells and their debris. And concentrating 30ml of supernatant to 5ml by using a 30kD ultrafiltration concentration tube, and mixing with 5ml of binding buffer to prepare a crude protein sample.

(3) Pretreatment of magnetic beads: shaking and uniformly mixing the magnetic beads, sucking 5ml into a 15ml centrifuge tube, placing the centrifuge tube on a magnetic rack, and discarding the supernatant after the magnetic beads are separated from the preservation solution. 5ml of binding buffer was added, turned upside down for 1-2 minutes, then placed on a magnetic rack, and the supernatant was discarded. This step was repeated 2 times.

(4) Binding of the protein of interest to the magnetic beads: mixing the crude protein sample obtained in the step (2) with the magnetic beads treated in the step (3), and placing the mixture on a rotary mixer for rotary mixing for 1-2h at 4 ℃. Subsequently, the sample was placed on a magnetic rack, and the supernatant was left as a control.

(5) Washing magnetic beads: 10ml of washing buffer solution is taken and added into the magnetic beads, the magnetic beads are turned upside down for 1-2 minutes, the magnetic beads are fully washed, the magnetic beads are placed on a magnetic rack, and the supernatant is discarded. This step was repeated 1 time.

(6) Eluting target protein: sequentially taking 5ml of elution buffer with imidazole concentration of 100mM, 200mM and 300mM, uniformly mixing with the magnetic beads, turning over up and down for 1-2 minutes, magnetically separating, and reserving supernatant.

(7) The eluate containing the target protein was filtered through a 0.2 μm filter, then added to a 14kD dialysis bag, and then placed in a large amount of deionized water for overnight dialysis at 4 ℃.

(8) Placing the dialyzed protein sample into a 30kDa ultrafiltration concentration tube, carrying out ultrafiltration concentration at 3000rpm/min to obtain a target protein solution (the target protein is recombinant uromodulin fragment UMOD-FLR1, and the solvent is deionized water), and measuring the protein concentration in the target protein solution by using a BCA method. The results show that: the concentration of the target protein is 0.5-1mg/ml.

(9) Mixing the target protein solution obtained in the step (8) with a loading buffer solution, and carrying out silver staining and Western blot detection to detect the purity of the target protein.

5. Identification of recombinant uromodulin fragment UMOD-FLR1

The Western blot is adopted to detect the extracted recombinant uromodulin fragment UMOD-FLR1, and the specific steps are as follows:

(1) And (3) glue preparation: preparing 10% SDS-PAGE separating gel with 1.5mm, adding the separating gel to a green frame of a gel making frame, adding deionized water for flattening, pouring deionized water after gel is solidified, adding concentrated gel, immediately inserting a comb, standing at room temperature until the gel is solidified, and standing for use at 4 ℃ for a week without pulling out the comb.

(2) Loading: taking protein samples with the same quality, using a proper amount of deionized water to fix the volume, adding 5×loading buffer, carrying out metal bath at 99 ℃ for 10min, cooling, uniformly mixing and loading.

(3) Electrophoresis: constant voltage is firstly kept at 90V, and after the separation glue is reached, the voltage is regulated to 110V.

(4) After electrophoresis, the gel was removed, and the excess gel was cut and discarded.

(5) Transferring: 2 sheets of thick filter paper and 1 sheet of polyvinylidene fluoride film (PVDF film) were prepared, the film being slightly larger than the gel. The filter paper was wetted with the transfer solution and the PVDF membrane was activated with anhydrous methanol. The separation gel was immersed in a transfer buffer to wash and then placed on the membrane. And (3) respectively placing 1 piece of thick filter paper on the upper part and the lower part, extruding out the middle bubble, taking the gel side as a negative electrode, taking the PVDF film side as a positive electrode, and placing the materials at 4 ℃ or in an ice bath for film transfer, wherein the constant current is 300mA and 90min.

(6) Closing: after the completion of the transfer, the membrane was taken out, gently rinsed with TBST, and then blocked by shaking with TBST containing 5% nonfat milk powder as a blocking solution at room temperature for 1 hour (the blocking time may be prolonged appropriately).

(7) Adding an antibody: sheep anti-human uromodulin mab was diluted with blocking solution at a ratio of 1:500 overnight at 4 ℃.

(8) The PVDF membrane was washed 3 times with TBST for 10min each (the time can be prolonged appropriately).

(9) Adding a secondary antibody: the mouse anti-sheep IgG antibody was labeled with horseradish peroxidase (HRP) at a ratio of 1:1000 with blocking solution and shaken for 1h at room temperature.

(10) The PVDF membrane was washed 3 times with TBST for 10min each (the time can be prolonged appropriately).

(11) And developing by using a chemiluminescent liquid, mixing the liquid A and the liquid B in equal volumes, and dripping the mixture on the PVDF film to uniformly spread the PVDF film on the whole film.

(12) Color development: the film was placed in a GE Image Quant LAS4000 chemiluminescent imaging analyzer for light exposure and color development, and the image was observed and saved.

The Western blot detection result of the purified recombinant uromodulin fragment UMOD-FLR1 is shown in FIG. 4.

6. Purity detection of recombinant uromodulin fragment UMOD-FLR1

The purity of the extracted recombinant uromodulin fragment UMOD-FLR1 is detected by adopting a silver staining method, and the specific steps are as follows:

(1) The SDS-PAGE gel after electrophoresis was removed, and the excess was excised.

(2) The procedure was performed according to the instructions of the protein silver staining kit (Beijing cool Lei Bo technology Co., ltd.).

(3) The gel was observed and photographed.

The silver staining detection result of the purified recombinant uromodulin fragment UMOD-FLR1 is shown in FIG. 4.

EXAMPLE 2 detection of binding of recombinant uromodulin fragment UMOD-FLR1 to complement factor H by micro-thermophoresis (MST)

The application detects the binding capacity of a recombinant uromodulin fragment UMOD-FLR1 and a complement factor H by a micro thermophoresis method, and specifically comprises the following steps:

1. sample preparation

A sample of the recombinant uromodulin fragment UMOD-FLR1 (the protein solution of interest prepared in step two (8) of example 1) was diluted to 200nM. Protein samples were fluorescently labeled according to the instructions of the second generation His-tag protein labeling kit (nanomemper).

2. Dilution of ligands with a multiple ratio

10 μl of PBST, numbered 2-16, was added to each of 15 200 μl EP tubes. To another clean 200. Mu.l EP tube was added 20. Mu.l complement factor H (Merck, cat. No. 341274, genBank No. AAI42700.1 with amino acid sequence base acid sequence in NCBI) at a concentration of 5. Mu.g/. Mu.l, and this tube was numbered 1. Mu.l of complement factor H in tube 1 was aspirated into tube 2, and after mixing, 10. Mu.l of tube 2 was aspirated into tube 3, and so on, and 10. Mu.l of the last tube was aspirated and discarded, and the complement factor H was diluted in a double ratio.

3. 10 μl of the labeled protein sample in step 1 is pipetted into 1-16 tubes, mixed well and incubated at room temperature for 5 minutes.

4. And (3) respectively sucking the incubated mixed solution by using capillaries in sequence, putting the capillaries into an MST detection instrument in sequence, setting the MST power to be 100%, setting the LED excitation power to be 20%, performing quality control by using MO software, and performing analysis by using MO Affinity Analysis software.

The results are shown in FIG. 5. The result shows that the recombinant uromodulin fragment UMOD-FLR1 can be combined with complement factor H, and the Kd value is 1.7942 multiplied by 10 ^-6 M。

Example 3C 3b cleavage experiment

1. Preparation of the reaction System

CFH: complement factor H (Merck, inc., accession number 341274-M, genBank accession number AAI42700.1 for amino acid sequence in NCBI).

CFI: complement factor I (Merck company, cat. Number 341280) with the amino acid sequence shown in SEQ ID No. 4.

C3b: complement fragment 3b (Merck, inc., accession number 204860, SEQ ID No. 5).

Natural uromodulin: natural UMOD (myospouse, cat# MBS 537977).

Recombinant uromodulin fragment UMOD-FLR1: example 1.

According to the different components in the reaction system, the four groups are as follows:

first set of reaction system (20 μl): c3b (1. Mu.g/. Mu.l) 3. Mu.l, CFI (50 ng/. Mu.l) 1. Mu.l, PBS (pH 7.4) complements the system to 20. Mu.l.

Second set of reaction system (20 μl): c3b (1. Mu.g/. Mu.l) 3. Mu.l, CFH (0.5. Mu.g/. Mu.l) 1. Mu.l, CFI (50 ng/. Mu.l) 1. Mu.l, PBS (pH 7.4) make up the system to 20. Mu.l.

Third set of reaction system (20 μl): c3b (1. Mu.g/. Mu.l) 3. Mu.l, CFH (0.5. Mu.g/. Mu.l) 1. Mu.l, CFI (50 ng/. Mu.l) 1. Mu.l, native UMOD (self-concentration measurement), added volume amounts calculated according to the required mass and concentration), PBS (pH 7.4) make up the system to 20. Mu.l.

Fourth set of reaction system (20 μl): c3b (1. Mu.g/. Mu.l) 3. Mu.l, CFH (0.5. Mu.g/. Mu.l) 1. Mu.l, CFI (50 ng/. Mu.l) 1. Mu.l, recombinant uromodulin fragment UMOD-FLR1 (concentration self-test, volume addition calculated on the basis of the desired mass and concentration), PBS (pH 7.4) make up the system to 20. Mu.l.

The amount of the native UMOD and the recombinant uromodulin fragment UMOD-FLR1 having a molecular weight close thereto in the reaction system (20. Mu.l) was 8. Mu.g.

2. The components in the reaction systems are mixed evenly and then immediately put into a water bath at 37 ℃. Taking out after incubation for 40min, adding a loading buffer, boiling the sample at 100 ℃, and cooling.

3. And (2) carrying out Western blot detection on the product cooled in the step (2) according to the Western blot detection method in the embodiment (1).

4. The relative gray values of the bands were analyzed with Image J software. Since complement C3b has an alpha chain and a beta chain, wherein the alpha chain is 108kDa, it can be cleaved into 68kDa and 43kDa, the content of the 68kDa band is stable, and the 43kDa band increases with increasing cleavage of the alpha chain, so that the grey scale value of the band can be obtained using Image J software, and the grey scale ratio of 43kDa to 108kDa is used to represent the cleavage level of complement C3b, and a larger grey scale ratio represents a larger cleavage level of C3 b.

The results show that after the recombinant uromodulin fragment UMOD-FLR1 was added to the reaction system, the fragment 43kDa/108kDa gray scale ratio was significantly higher than that of the control group to which complement factor H was added alone, and that the natural uromodulin control group was also significantly higher than that of the control group to which complement factor H was added alone (FIG. 6). Specific results are as follows (results are expressed in mean±sd): a first group: 0.00912 + -0.00174; second group: 3.82710 + -0.26188; third group: 9.74100 + -0.49091; fourth group: 6.30395 + -0.68702. The recombinant uromodulin fragment UMOD-FLR1 has the functions of regulating complement activity and promoting complement cleavage.

Example 4 sheep erythrocyte hemolysis experiment

1. Establishment of sheep erythrocyte hemolysis experiment system

The addition of complement factor H antibodies to healthy human serum may partially or fully antagonize factor H originally present in the serum, resulting in hemolysis. Based on this, the experiment adds different doses of complement factor H antibody to healthy human serum and detects sheep erythrocyte hemolysis rate. The method comprises the following specific steps:

1. taking 5ml of venous whole blood of a healthy person in a non-anticoagulation blood collection tube, standing at room temperature for 30min, centrifuging at 2000rpm/min for 10min, and sub-packaging and storing at-80 ℃.

2. On the day of the experiment, 2ml of aseptic sheep red blood cells are taken and placed in a 15ml centrifuge tube, an appropriate amount of PBS buffer solution is added, the mixture is centrifuged for 3min at 2000rpm, and the centrifugation is repeated for 3 to 5 times until the supernatant is clear.

3. Taking 15 μl of sheep erythrocytes after washing, diluting to 10 with 3ml bypass buffer or EDTA buffer ⁷ About/ml.

4. 30 μl of the serum prepared in step 1 was mixed with 7 μl of complement factor H antibody (bioport, cat. No. GAU 018-03-02) in an amount of 5 μg, 6 μg, 7 μg or 8 μg in the system, and left at 4deg.C for 1H, with the complement to 100 μl with either the alternative pathway buffer or EDTA buffer.

5. 100 μl of diluted sheep erythrocytes were mixed with 100 μl of diluted serum mixture, gently shaken, and water-bath at 37deg.C for 30min.

6. Setting up a total-dissolution control: 100. Mu.l of diluted sheep red blood cells were added to 100. Mu.l of deionized water, and the sheep red blood cells were all ruptured, at which point the liquid in the EP tube was observed to be a clear pale red.

7. After the water bath was completed, the EP tube was removed, centrifuged at 5000rpm/min, and the mixture was centrifuged for 5min. The supernatant was placed in wells of an ELSIA plate and read at the wavelength of 414nm of the microplate reader and the A value was recorded.

8. The percent hemolysis was calculated according to the following formula: percent hemolysis = (alternative pathway buffer dilution system a value-EDTA buffer dilution a value)/total dissolved a value x100%.

The results are shown in FIG. 7, which shows that the addition of 7. Mu.g of complement factor H antibody induced nearly 100% hemolysis.

Complement factor H was exogenously added in step 4 in accordance with the procedure described above, with complement factor H being used in the system in an amount of 3. Mu.g, 4. Mu.g or 5. Mu.g. The results show that: the further exogenous addition of different doses (3. Mu.g, 4. Mu.g or 5. Mu.g) of complement factor H inhibited sheep erythrocyte hemolysis, wherein the further addition of 4. Mu.g of complement factor H inhibited sheep erythrocyte hemolysis to about 40% (FIG. 7).

2. Recombinant uromodulin fragment UMOD-FLR1 auxiliary complement factor H for inhibiting sheep erythrocyte hemolysis

As is clear from the first step, the addition of 7. Mu.g of the complement factor H antibody to normal human serum can induce a hemolysis rate of approximately 100%, and the addition of 4. Mu.g of complement factor H exogenously can inhibit the hemolysis rate to about 40%. According to the method in step one, 7. Mu.g of complement factor H antibody is added in step 4, and then complement factor H and/or uromodulin (uromodulin is recombinant uromodulin fragment UMOD-FLR1 or natural UMOD), natural UMOD and recombinant uromodulin fragment UMOD-FLR1 having a molecular weight close thereto are added in an amount of 15. Mu.g in the system, and complement factor H is added in an amount of 4. Mu.g in the system.

The results are shown in FIG. 8. The results show that: compared with the control group added with complement factor H only, the hemolysis rate of the experimental group added with the uromodulin (recombinant uromodulin fragment UMOD-FLR1 or natural UMOD) is obviously reduced, and the hemolysis rate is further reduced to about 30% by adding 15 mug of the uromodulin (recombinant uromodulin UMOD-FLR1 or natural UMOD). This suggests that the recombinant uromodulin fragment UMOD-FLR1 prepared by the present application has a function of assisting the complement factor H in inhibiting hemolysis.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Beijing university first Hospital

<120> a recombinant uromodulin fragment product and its use in inhibiting complement activation

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 1780

<212> DNA

<213> Artificial Sequence

<400> 1

gcgatcgctc agaagcaaga tggtgctctg aatgtcacag caatgccacc tgcacggagg 60

atgaggccgt tacgacgtgc acctgtcagg agggcttcac cggcgatggc ctgacctgcg 120

tggacctgga tgagtgcgcc attcctggag ctcacaactg ctccgccaac agcagctgcg 180

taaacacgcc aggctccttc tcctgcgtct gccccgaagg cttccgcctg tcgcccggtc 240

tcggctgcac agacgtggat gagtgcgctg agcctgggct tagccactgc cacgccctgg 300

ccacatgtgt caatgtggtg ggcagctact tgtgcgtatg ccccgcgggc taccgggggg 360

atggatggca ctgtgagtgc tccccgggct cctgcgggcc ggggttggac tgcgtgcccg 420

agggcgacgc gctcgtgtgc gcggatccgt gccaggcgca ccgcaccctg gacgagtact 480

ggcgcagcac cgagtacggg gagggctacg cctgcgacac ggacctgcgc ggctggtacc 540

gcttcgtggg ccagggcggt gcgcgcatgg ccgagacctg cgtgccagtc ctgcgctgca 600

acacggccgc ccccatgtgg ctcaatggca cgcatccgtc cagcgacgag ggcatcgtga 660

gccgcaaggc ctgcgcgcac tggagcggcc actgctgcct gtgggatgcg tccgtccagg 720

tgaaggcctg tgccggcggc tactacgtct acaacctgac agcgcccccc gagtgtcacc 780

tggcgtactg cacagacccc agctccgtgg aggggacgtg tgaggagtgc agtatagacg 840

aggactgcaa atcgaataat ggcagatggc actgccagtg caaacaggac ttcaacatca 900

ctgatatctc cctcctggag cacaggctgg aatgtggggc caatgacatg aaggtgtcgc 960

tgggcaagtg ccagctgaag agtctgggct tcgacaaggt cttcatgtac ctgagtgaca 1020

gccggtgctc gggcttcaat gacagagaca accgggactg ggtgtctgta gtgaccccag 1080

cccgggatgg cccctgtggg acagtgttga cgaggaatga aacccatgcc acttacagca 1140

acaccctcta cctggcagat gagatcatca tccgtgacct caacatcaaa atcaactttg 1200

catgctccta ccccctggac atgaaagtca gcctgaagac cgccctacag ccaatggtca 1260

gtgctctaaa catcagagtg ggcgggaccg gcatgttcac cgtgcggatg gcgctcttcc 1320

agaccccttc ctacacgcag ccctaccaag gctcctccgt gacactgtcc actgaggctt 1380

ttctctacgt gggcaccatg ttggatgggg gcgacctgtc ccgatttgca ctgctcatga 1440

ccaactgcta tgccacaccc agtagcaatg ccacggaccc cctgaagtac ttcatcatcc 1500

aggacagatg cccacacact agagactcaa ctatccaagt ggtggagaat ggggagtcct 1560

cccagggccg attttccgtc cagatgttcc ggtttgctgg aaactatgac ctagtctacc 1620

tgcactgtga agtctatctc tgtgacacca tgaatgaaaa gtgcaagcct acctgctctg 1680

ggaccagatt ccgaagtggg agtgtcatag atcaatcccg tgtcctgaac ttgggtccca 1740

tcacacggaa aggtgtccag gccacagtct gagcggccgc 1780

<210> 2

<211> 587

<212> PRT

<213> Artificial Sequence

<400> 2

Ser Glu Ala Arg Trp Cys Ser Glu Cys His Ser Asn Ala Thr Cys Thr

1 5 10 15

Glu Asp Glu Ala Val Thr Thr Cys Thr Cys Gln Glu Gly Phe Thr Gly

20 25 30

Asp Gly Leu Thr Cys Val Asp Leu Asp Glu Cys Ala Ile Pro Gly Ala

35 40 45

His Asn Cys Ser Ala Asn Ser Ser Cys Val Asn Thr Pro Gly Ser Phe

50 55 60

Ser Cys Val Cys Pro Glu Gly Phe Arg Leu Ser Pro Gly Leu Gly Cys

65 70 75 80

Thr Asp Val Asp Glu Cys Ala Glu Pro Gly Leu Ser His Cys His Ala

85 90 95

Leu Ala Thr Cys Val Asn Val Val Gly Ser Tyr Leu Cys Val Cys Pro

100 105 110

Ala Gly Tyr Arg Gly Asp Gly Trp His Cys Glu Cys Ser Pro Gly Ser

115 120 125

Cys Gly Pro Gly Leu Asp Cys Val Pro Glu Gly Asp Ala Leu Val Cys

130 135 140

Ala Asp Pro Cys Gln Ala His Arg Thr Leu Asp Glu Tyr Trp Arg Ser

145 150 155 160

Thr Glu Tyr Gly Glu Gly Tyr Ala Cys Asp Thr Asp Leu Arg Gly Trp

165 170 175

Tyr Arg Phe Val Gly Gln Gly Gly Ala Arg Met Ala Glu Thr Cys Val

180 185 190

Pro Val Leu Arg Cys Asn Thr Ala Ala Pro Met Trp Leu Asn Gly Thr

195 200 205

His Pro Ser Ser Asp Glu Gly Ile Val Ser Arg Lys Ala Cys Ala His

210 215 220

Trp Ser Gly His Cys Cys Leu Trp Asp Ala Ser Val Gln Val Lys Ala

225 230 235 240

Cys Ala Gly Gly Tyr Tyr Val Tyr Asn Leu Thr Ala Pro Pro Glu Cys

245 250 255

His Leu Ala Tyr Cys Thr Asp Pro Ser Ser Val Glu Gly Thr Cys Glu

260 265 270

Glu Cys Ser Ile Asp Glu Asp Cys Lys Ser Asn Asn Gly Arg Trp His

275 280 285

Cys Gln Cys Lys Gln Asp Phe Asn Ile Thr Asp Ile Ser Leu Leu Glu

290 295 300

His Arg Leu Glu Cys Gly Ala Asn Asp Met Lys Val Ser Leu Gly Lys

305 310 315 320

Cys Gln Leu Lys Ser Leu Gly Phe Asp Lys Val Phe Met Tyr Leu Ser

325 330 335

Asp Ser Arg Cys Ser Gly Phe Asn Asp Arg Asp Asn Arg Asp Trp Val

340 345 350

Ser Val Val Thr Pro Ala Arg Asp Gly Pro Cys Gly Thr Val Leu Thr

355 360 365

Arg Asn Glu Thr His Ala Thr Tyr Ser Asn Thr Leu Tyr Leu Ala Asp

370 375 380

Glu Ile Ile Ile Arg Asp Leu Asn Ile Lys Ile Asn Phe Ala Cys Ser

385 390 395 400

Tyr Pro Leu Asp Met Lys Val Ser Leu Lys Thr Ala Leu Gln Pro Met

405 410 415

Val Ser Ala Leu Asn Ile Arg Val Gly Gly Thr Gly Met Phe Thr Val

420 425 430

Arg Met Ala Leu Phe Gln Thr Pro Ser Tyr Thr Gln Pro Tyr Gln Gly

435 440 445

Ser Ser Val Thr Leu Ser Thr Glu Ala Phe Leu Tyr Val Gly Thr Met

450 455 460

Leu Asp Gly Gly Asp Leu Ser Arg Phe Ala Leu Leu Met Thr Asn Cys

465 470 475 480

Tyr Ala Thr Pro Ser Ser Asn Ala Thr Asp Pro Leu Lys Tyr Phe Ile

485 490 495

Ile Gln Asp Arg Cys Pro His Thr Arg Asp Ser Thr Ile Gln Val Val

500 505 510

Glu Asn Gly Glu Ser Ser Gln Gly Arg Phe Ser Val Gln Met Phe Arg

515 520 525

Phe Ala Gly Asn Tyr Asp Leu Val Tyr Leu His Cys Glu Val Tyr Leu

530 535 540

Cys Asp Thr Met Asn Glu Lys Cys Lys Pro Thr Cys Ser Gly Thr Arg

545 550 555 560

Phe Arg Ser Gly Ser Val Ile Asp Gln Ser Arg Val Leu Asn Leu Gly

565 570 575

Pro Ile Thr Arg Lys Gly Val Gln Ala Thr Val

580 585

<210> 3

<211> 1889

<212> DNA

<213> Artificial Sequence

<400> 3

gaattcgcca ccatggggca gccatctctg acttggatgc tgatggtggt ggtggcctct 60

tggttcatca caactgcagc cactgacacc catcatcacc atcaccactg cgatcgctca 120

gaagcaagat ggtgctctga atgtcacagc aatgccacct gcacggagga tgaggccgtt 180

acgacgtgca cctgtcagga gggcttcacc ggcgatggcc tgacctgcgt ggacctggat 240

gagtgcgcca ttcctggagc tcacaactgc tccgccaaca gcagctgcgt aaacacgcca 300

ggctccttct cctgcgtctg ccccgaaggc ttccgcctgt cgcccggtct cggctgcaca 360

gacgtggatg agtgcgctga gcctgggctt agccactgcc acgccctggc cacatgtgtc 420

aatgtggtgg gcagctactt gtgcgtatgc cccgcgggct accgggggga tggatggcac 480

tgtgagtgct ccccgggctc ctgcgggccg gggttggact gcgtgcccga gggcgacgcg 540

ctcgtgtgcg cggatccgtg ccaggcgcac cgcaccctgg acgagtactg gcgcagcacc 600

gagtacgggg agggctacgc ctgcgacacg gacctgcgcg gctggtaccg cttcgtgggc 660

cagggcggtg cgcgcatggc cgagacctgc gtgccagtcc tgcgctgcaa cacggccgcc 720

cccatgtggc tcaatggcac gcatccgtcc agcgacgagg gcatcgtgag ccgcaaggcc 780

tgcgcgcact ggagcggcca ctgctgcctg tgggatgcgt ccgtccaggt gaaggcctgt 840

gccggcggct actacgtcta caacctgaca gcgccccccg agtgtcacct ggcgtactgc 900

acagacccca gctccgtgga ggggacgtgt gaggagtgca gtatagacga ggactgcaaa 960

tcgaataatg gcagatggca ctgccagtgc aaacaggact tcaacatcac tgatatctcc 1020

ctcctggagc acaggctgga atgtggggcc aatgacatga aggtgtcgct gggcaagtgc 1080

cagctgaaga gtctgggctt cgacaaggtc ttcatgtacc tgagtgacag ccggtgctcg 1140

ggcttcaatg acagagacaa ccgggactgg gtgtctgtag tgaccccagc ccgggatggc 1200

ccctgtggga cagtgttgac gaggaatgaa acccatgcca cttacagcaa caccctctac 1260

ctggcagatg agatcatcat ccgtgacctc aacatcaaaa tcaactttgc atgctcctac 1320

cccctggaca tgaaagtcag cctgaagacc gccctacagc caatggtcag tgctctaaac 1380

atcagagtgg gcgggaccgg catgttcacc gtgcggatgg cgctcttcca gaccccttcc 1440

tacacgcagc cctaccaagg ctcctccgtg acactgtcca ctgaggcttt tctctacgtg 1500

ggcaccatgt tggatggggg cgacctgtcc cgatttgcac tgctcatgac caactgctat 1560

gccacaccca gtagcaatgc cacggacccc ctgaagtact tcatcatcca ggacagatgc 1620

ccacacacta gagactcaac tatccaagtg gtggagaatg gggagtcctc ccagggccga 1680

ttttccgtcc agatgttccg gtttgctgga aactatgacc tagtctacct gcactgtgaa 1740

gtctatctct gtgacaccat gaatgaaaag tgcaagccta cctgctctgg gaccagattc 1800

cgaagtggga gtgtcataga tcaatcccgt gtcctgaact tgggtcccat cacacggaaa 1860

ggtgtccagg ccacagtctg agcggccgc 1889

<210> 4

<211> 583

<212> PRT

<213> Artificial Sequence

<400> 4

Met Lys Leu Leu His Val Phe Leu Leu Phe Leu Cys Phe His Leu Arg

1 5 10 15

Phe Cys Lys Val Thr Tyr Thr Ser Gln Glu Asp Leu Val Glu Lys Lys

20 25 30

Cys Leu Ala Lys Lys Tyr Thr His Leu Ser Cys Asp Lys Val Phe Cys

35 40 45

Gln Pro Trp Gln Arg Cys Ile Glu Gly Thr Cys Val Cys Lys Leu Pro

50 55 60

Tyr Gln Cys Pro Lys Asn Gly Thr Ala Val Cys Ala Thr Asn Arg Arg

65 70 75 80

Ser Phe Pro Thr Tyr Cys Gln Gln Lys Ser Leu Glu Cys Leu His Pro

85 90 95

Gly Thr Lys Phe Leu Asn Asn Gly Thr Cys Thr Ala Glu Gly Lys Phe

100 105 110

Ser Val Ser Leu Lys His Gly Asn Thr Asp Ser Glu Gly Ile Val Glu

115 120 125

Val Lys Leu Val Asp Gln Asp Lys Thr Met Phe Ile Cys Lys Ser Ser

130 135 140

Trp Ser Met Arg Glu Ala Asn Val Ala Cys Leu Asp Leu Gly Phe Gln

145 150 155 160

Gln Gly Ala Asp Thr Gln Arg Arg Phe Lys Leu Ser Asp Leu Ser Ile

165 170 175

Asn Ser Thr Glu Cys Leu His Val His Cys Arg Gly Leu Glu Thr Ser

180 185 190

Leu Ala Glu Cys Thr Phe Thr Lys Arg Arg Thr Met Gly Tyr Gln Asp

195 200 205

Phe Ala Asp Val Val Cys Tyr Thr Gln Lys Ala Asp Ser Pro Met Asp

210 215 220

Asp Phe Phe Gln Cys Val Asn Gly Lys Tyr Ile Ser Gln Met Lys Ala

225 230 235 240

Cys Asp Gly Ile Asn Asp Cys Gly Asp Gln Ser Asp Glu Leu Cys Cys

245 250 255

Lys Ala Cys Gln Gly Lys Gly Phe His Cys Lys Ser Gly Val Cys Ile

260 265 270

Pro Ser Gln Tyr Gln Cys Asn Gly Glu Val Asp Cys Ile Thr Gly Glu

275 280 285

Asp Glu Val Gly Cys Ala Gly Phe Ala Ser Val Thr Gln Glu Glu Thr

290 295 300

Glu Ile Leu Thr Ala Asp Met Asp Ala Glu Arg Arg Arg Ile Lys Ser

305 310 315 320

Leu Leu Pro Lys Leu Ser Cys Gly Val Lys Asn Arg Met His Ile Arg

325 330 335

Arg Lys Arg Ile Val Gly Gly Lys Arg Ala Gln Leu Gly Asp Leu Pro

340 345 350

Trp Gln Val Ala Ile Lys Asp Ala Ser Gly Ile Thr Cys Gly Gly Ile

355 360 365

Tyr Ile Gly Gly Cys Trp Ile Leu Thr Ala Ala His Cys Leu Arg Ala

370 375 380

Ser Lys Thr His Arg Tyr Gln Ile Trp Thr Thr Val Val Asp Trp Ile

385 390 395 400

His Pro Asp Leu Lys Arg Ile Val Ile Glu Tyr Val Asp Arg Ile Ile

405 410 415

Phe His Glu Asn Tyr Asn Ala Gly Thr Tyr Gln Asn Asp Ile Ala Leu

420 425 430

Ile Glu Met Lys Lys Asp Gly Asn Lys Lys Asp Cys Glu Leu Pro Arg

435 440 445

Ser Ile Pro Ala Cys Val Pro Trp Ser Pro Tyr Leu Phe Gln Pro Asn

450 455 460

Asp Thr Cys Ile Val Ser Gly Trp Gly Arg Glu Lys Asp Asn Glu Arg

465 470 475 480

Val Phe Ser Leu Gln Trp Gly Glu Val Lys Leu Ile Ser Asn Cys Ser

485 490 495

Lys Phe Tyr Gly Asn Arg Phe Tyr Glu Lys Glu Met Glu Cys Ala Gly

500 505 510

Thr Tyr Asp Gly Ser Ile Asp Ala Cys Lys Gly Asp Ser Gly Gly Pro

515 520 525

Leu Val Cys Met Asp Ala Asn Asn Val Thr Tyr Val Trp Gly Val Val

530 535 540

Ser Trp Gly Glu Asn Cys Gly Lys Pro Glu Phe Pro Gly Val Tyr Thr

545 550 555 560

Lys Val Ala Asn Tyr Phe Asp Trp Ile Ser Tyr His Val Gly Arg Pro

565 570 575

Phe Ile Ser Gln Tyr Asn Val

580

<210> 5

<211> 915

<212> PRT

<213> Artificial Sequence

<400> 5

Ser Asn Leu Asp Glu Asp Ile Ile Ala Glu Glu Asn Ile Val Ser Arg

1 5 10 15

Ser Glu Phe Pro Glu Ser Trp Leu Trp Asn Val Glu Asp Leu Lys Glu

20 25 30

Pro Pro Lys Asn Gly Ile Ser Thr Lys Leu Met Asn Ile Phe Leu Lys

35 40 45

Asp Ser Ile Thr Thr Trp Glu Ile Leu Ala Val Ser Met Ser Asp Lys

50 55 60

Lys Gly Ile Cys Val Ala Asp Pro Phe Glu Val Thr Val Met Gln Asp

65 70 75 80

Phe Phe Ile Asp Leu Arg Leu Pro Tyr Ser Val Val Arg Asn Glu Gln

85 90 95

Val Glu Ile Arg Ala Val Leu Tyr Asn Tyr Arg Gln Asn Gln Glu Leu

100 105 110

Lys Val Arg Val Glu Leu Leu His Asn Pro Ala Phe Cys Ser Leu Ala

115 120 125

Thr Thr Lys Arg Arg His Gln Gln Thr Val Thr Ile Pro Pro Lys Ser

130 135 140

Ser Leu Ser Val Pro Tyr Val Ile Val Pro Leu Lys Thr Gly Leu Gln

145 150 155 160

Glu Val Glu Val Lys Ala Ala Val Tyr His His Phe Ile Ser Asp Gly

165 170 175

Val Arg Lys Ser Leu Lys Val Val Pro Glu Gly Ile Arg Met Asn Lys

180 185 190

Thr Val Ala Val Arg Thr Leu Asp Pro Glu Arg Leu Gly Arg Glu Gly

195 200 205

Val Gln Lys Glu Asp Ile Pro Pro Ala Asp Leu Ser Asp Gln Val Pro

210 215 220

Asp Thr Glu Ser Glu Thr Arg Ile Leu Leu Gln Gly Thr Pro Val Ala

225 230 235 240

Gln Met Thr Glu Asp Ala Val Asp Ala Glu Arg Leu Lys His Leu Ile

245 250 255

Val Thr Pro Ser Gly Cys Gly Glu Glu Asn Met Ile Gly Met Thr Pro

260 265 270

Thr Val Ile Ala Val His Tyr Leu Asp Glu Thr Glu Gln Trp Glu Lys

275 280 285

Phe Gly Leu Glu Lys Arg Gln Gly Ala Leu Glu Leu Ile Lys Lys Gly

290 295 300

Tyr Thr Gln Gln Leu Ala Phe Arg Gln Pro Ser Ser Ala Phe Ala Ala

305 310 315 320

Phe Val Lys Arg Ala Pro Ser Thr Trp Leu Thr Ala Tyr Val Val Lys

325 330 335

Val Phe Ser Leu Ala Val Asn Leu Ile Ala Ile Asp Ser Gln Val Leu

340 345 350

Cys Gly Ala Val Lys Trp Leu Ile Leu Glu Lys Gln Lys Pro Asp Gly

355 360 365

Val Phe Gln Glu Asp Ala Pro Val Ile His Gln Glu Met Ile Gly Gly

370 375 380

Leu Arg Asn Asn Asn Glu Lys Asp Met Ala Leu Thr Ala Phe Val Leu

385 390 395 400

Ile Ser Leu Gln Glu Ala Lys Asp Ile Cys Glu Glu Gln Val Asn Ser

405 410 415

Leu Pro Gly Ser Ile Thr Lys Ala Gly Asp Phe Leu Glu Ala Asn Tyr

420 425 430

Met Asn Leu Gln Arg Ser Tyr Thr Val Ala Ile Ala Gly Tyr Ala Leu

435 440 445

Ala Gln Met Gly Arg Leu Lys Gly Pro Leu Leu Asn Lys Phe Leu Thr

450 455 460

Thr Ala Lys Asp Lys Asn Arg Trp Glu Asp Pro Gly Lys Gln Leu Tyr

465 470 475 480

Asn Val Glu Ala Thr Ser Tyr Ala Leu Leu Ala Leu Leu Gln Leu Lys

485 490 495

Asp Phe Asp Phe Val Pro Pro Val Val Arg Trp Leu Asn Glu Gln Arg

500 505 510

Tyr Tyr Gly Gly Gly Tyr Gly Ser Thr Gln Ala Thr Phe Met Val Phe

515 520 525

Gln Ala Leu Ala Gln Tyr Gln Lys Asp Ala Pro Asp His Gln Glu Leu

530 535 540

Asn Leu Asp Val Ser Leu Gln Leu Pro Ser Arg Ser Ser Lys Ile Thr

545 550 555 560

His Arg Ile His Trp Glu Ser Ala Ser Leu Leu Arg Ser Glu Glu Thr

565 570 575

Lys Glu Asn Glu Gly Phe Thr Val Thr Ala Glu Gly Lys Gly Gln Gly

580 585 590

Thr Leu Ser Val Val Thr Met Tyr His Ala Lys Ala Lys Asp Gln Leu

595 600 605

Thr Cys Asn Lys Phe Asp Leu Lys Val Thr Ile Lys Pro Ala Pro Glu

610 615 620

Thr Glu Lys Arg Pro Gln Asp Ala Lys Asn Thr Met Ile Leu Glu Ile

625 630 635 640

Cys Thr Arg Tyr Arg Gly Asp Gln Asp Ala Thr Met Ser Ile Leu Asp

645 650 655

Ile Ser Met Met Thr Gly Phe Ala Pro Asp Thr Asp Asp Leu Lys Gln

660 665 670

Leu Ala Asn Gly Val Asp Arg Tyr Ile Ser Lys Tyr Glu Leu Asp Lys

675 680 685

Ala Phe Ser Asp Arg Asn Thr Leu Ile Ile Tyr Leu Asp Lys Val Ser

690 695 700

His Ser Glu Asp Asp Cys Leu Ala Phe Lys Val His Gln Tyr Phe Asn

705 710 715 720

Val Glu Leu Ile Gln Pro Gly Ala Val Lys Val Tyr Ala Tyr Tyr Asn

725 730 735

Leu Glu Glu Ser Cys Thr Arg Phe Tyr His Pro Glu Lys Glu Asp Gly

740 745 750

Lys Leu Asn Lys Leu Cys Arg Asp Glu Leu Cys Arg Cys Ala Glu Glu

755 760 765

Asn Cys Phe Ile Gln Lys Ser Asp Asp Lys Val Thr Leu Glu Glu Arg

770 775 780

Leu Asp Lys Ala Cys Glu Pro Gly Val Asp Tyr Val Tyr Lys Thr Arg

785 790 795 800

Leu Val Lys Val Gln Leu Ser Asn Asp Phe Asp Glu Tyr Ile Met Ala

805 810 815

Ile Glu Gln Thr Ile Lys Ser Gly Ser Asp Glu Val Gln Val Gly Gln

820 825 830

Gln Arg Thr Phe Ile Ser Pro Ile Lys Cys Arg Glu Ala Leu Lys Leu

835 840 845

Glu Glu Lys Lys His Tyr Leu Met Trp Gly Leu Ser Ser Asp Phe Trp

850 855 860

Gly Glu Lys Pro Asn Leu Ser Tyr Ile Ile Gly Lys Asp Thr Trp Val

865 870 875 880

Glu His Trp Pro Glu Glu Asp Glu Cys Gln Asp Glu Glu Asn Gln Lys

885 890 895

Gln Cys Gln Asp Leu Gly Ala Phe Thr Glu Ser Met Val Val Phe Gly

900 905 910

Cys Pro Asn

915

Claims (10)

1. Recombinant uromodulin fragments, which are proteins as indicated in the following R1) -R5):

r1) the amino acid sequence is a protein shown as SEQ ID No. 2;

r2) fusion proteins with the same functions obtained by fusing tag proteins at the carboxyl terminal and/or amino terminal of the protein shown in R1);

r3) fusion proteins with the same functions obtained by fusing signal peptides at the carboxyl end and/or the amino end of the protein shown in R1) or R2);

r4) protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in R1), R2) or R3);

a protein having 90% or more identity or function with the amino acid sequence represented by R5) and R1) or R2) or R3) or R4).

2. The recombinant uromodulin fragment of claim 1, wherein: the recombinant uromodulin fragment sequentially comprises a signal peptide, a tag protein and a protein shown in SEQ ID No.2 from the amino terminus to the carboxyl terminus.

3. A method for preparing a recombinant uromodulin fragment according to claim 1 or 2, characterized in that: the method comprises the following steps: expressing the gene encoding the recombinant uromodulin fragment of claim 1 or 2 in an organism or an organism cell, to obtain the recombinant uromodulin fragment of claim 1 or 2.

4. A method according to claim 3, characterized in that: the method for expressing the gene encoding the recombinant uromodulin fragment of claim 1 or 2 in an organism or an organism cell is to introduce the gene encoding the recombinant uromodulin fragment of claim 1 or 2 into an organism or an organism cell.

5. A method according to claim 3 or 4, characterized in that: the coding gene of the recombinant uromodulin fragment is a DNA molecule shown as SEQ ID No.1 or SEQ ID No. 3.

6. A nucleic acid molecule encoding the recombinant uromodulin fragment of claim 1 or 2.

7. The nucleic acid molecule of claim 6, wherein: the nucleic acid molecule is a gene as shown in the following 1) or 2):

1) The coding sequence is a DNA molecule shown as SEQ ID No.1 or SEQ ID No. 3;

2) A DNA molecule having more than 75% identity to the DNA molecule defined in 1) and encoding the recombinant uromodulin fragment of claim 1 or 2.

8. Any one of the following biological materials S1) to S3):

s1) an expression cassette comprising the nucleic acid molecule of claim 6 or 7;

s2) a recombinant vector comprising the nucleic acid molecule of claim 6 or 7;

s3) a transgenic cell line comprising the nucleic acid molecule according to claim 6 or 7.

9. Use of a recombinant uromodulin fragment according to claim 1 or 2 or a nucleic acid molecule according to claim 6 or 7 or a biological material according to claim 8 in any of the following T1) -T16):

t1) preparing a product which modulates complement activity;

t2) preparing a complement-cleaving product;

t3) preparing a product that promotes or accelerates the degradation of complement fragment 3 b;

t4) preparing a product that enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

t5) preparing a product for the treatment or prevention of autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

t6) preparing a product for inhibiting erythrocyte hemolysis;

t7) preparing a product that enhances the ability of complement factor H to inhibit hemolysis of erythrocytes;

t8) preparing a product for improving the biocompatibility of the membrane material;

t9) modulates complement activity;

t10) cleavage of complement;

t11) promotes or accelerates the degradation of complement fragment 3 b;

t12) enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

t13) treatment or prevention of autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

t14) inhibits erythrocyte hemolysis;

t15) enhances the ability of complement factor H to inhibit erythrocyte hemolysis;

t16) improves the membrane material biocompatibility.

10. A product having the function of any one of X1) to X8), the active ingredient of which is the recombinant uromodulin fragment of claim 1 or 2 or the nucleic acid molecule of claim 6 or 7 or the biological material of claim 8;

x1) modulates complement activity;

x2) cleavage of complement;

x3) promotes or accelerates the degradation of complement fragment 3 b;

x4) enhances the ability of complement factor H to cleave complement fragment 3b as a cofactor for complement factor I;

x5) treating or preventing autosomal dominant inherited chronic tubular interstitial disease or acute kidney injury;

x6) inhibiting erythrocyte hemolysis;

x7) enhances the ability of complement factor H to inhibit erythrocyte hemolysis;

x8) improves the biocompatibility of the biofilm material.