CN116942899A

CN116942899A - Novel medical plastic filler modified L-polylactic acid gel

Info

Publication number: CN116942899A
Application number: CN202210784080.9A
Authority: CN
Inventors: 朱源源
Original assignee: Guangdong Wanghe Biotechnology Co ltd
Current assignee: Guangdong Wanghe Biotechnology Co ltd
Priority date: 2022-07-05
Filing date: 2022-07-05
Publication date: 2023-10-27

Abstract

The application discloses a novel medical shaping filler modified L-polylactic acid gel. The gel is prepared by fully mixing a L-polylactic acid solution, a polyglutamic acid solution and a vitamin P solution, then forming a preliminary gel with acetic acid, and then obtaining a final gel through freezing treatment. The gel has excellent mechanical properties, has promotion effect on growth and metabolism of chondrocytes, and can promote collagen regeneration without immunotoxic effect. The gel provided by the application has no toxic effect on chondrocytes, has the effect of obviously promoting collagen regeneration, has no immunity and cytotoxicity, is very suitable for being used as a medical filler test, is excellent in elasticity, is applied to the fields of breast enlargement, buttocks enlargement and face filling, can increase the gloss and elasticity of breasts while enlarging the breasts, and has very good effects on repairing the problems of postpartum relaxation, breast deformation, chest shape defect, external expansion sagging, breast hypofunction and the like of female breasts.

Description

Novel medical plastic filler modified L-polylactic acid gel

Technical Field

The application relates to the technical field of L-polylactic acid, in particular to novel medical plastic filler modified L-polylactic acid gel.

Background

The polylactic acid has a plurality of isomers, including a plurality of different optically active polymers such as L-polylactic acid (PLLA), D-polylactic acid (PDLA), racemic polylactic acid (PDLLA), optically inactive polylactic acid (Meso-PLA) and the like, and the performances of the optically active polymers are different, wherein the L-polylactic acid (PLLA) is a semicrystalline polymer, the crystallinity can reach more than 40 percent, the melting point Tm is about 170-180 ℃, the mechanical strength is the maximum, the highest bending strength can reach 350Mpa, and the bending strength exceeds the bending strength of human bones. Therefore, the L-polylactic acid is widely applied to tissue engineering researches on cartilage, bone, muscle leg, skin, peripheral nerve, ligament, liver, tubular structure and the like, for example, the PLLA prepared degradable stent has good mechanical properties as proved by clinical experiments; the mesh of PLLA is filled with autologous bone marrow particles and spongy bone, which promote bone growth in dogs; chondrocytes were implanted in mice within the PLLA matrix and grown into cartilage tissue.

However, the single levorotatory polymer has higher crystallinity, and polylactic acid material is hydrophobic, and the acidic degradation product of the polylactic acid material is easy to generate aseptic inflammatory reaction, and can also generate adverse effect on cells, thus limiting the wide use of polylactic acid in clinical research.

Disclosure of Invention

In view of the above, the present application aims to modify existing l-polylactic acid to achieve a certain improvement in at least one of inflammatory reaction, immune toxicity, normal growth and metabolism of cells related to the organism.

In a first aspect, the embodiment of the application discloses a preparation method of modified levorotatory polylactic acid gel, which comprises the following steps:

preparing a levorotatory polylactic acid solution, a polyglutamic acid solution and a vitamin P solution respectively;

taking a L-polylactic acid solution, a polyglutamic acid solution and a vitamin P solution, fully mixing, and adding an acetic acid solution to form primary gel;

and freezing the preliminary gel to obtain the final gel.

In the embodiment of the application, the solvent in the L-polylactic acid solution is selected from one of tetrahydrofuran, hexafluoroisopropanol and dimethyl sulfoxide, the solvent in the polyglutamic acid solution is selected from one of tetrahydrofuran, trifluoroacetic acid and dimethyl sulfoxide, and the solvent in the vitamin P solution is water.

In the embodiment of the application, the L-polylactic acid solution, the polyglutamic acid solution and the vitamin P solution are mixed according to the volume ratio of 6:4:1, and are uniformly stirred at 45 ℃ until the L-polylactic acid solution, the polyglutamic acid solution and the vitamin P solution are fully dissolved.

In the embodiment of the application, the concentration of the added acetic acid solution is 0.02M, and the added volume amount is the same as the added amount of the vitamin P solution.

In the embodiment of the application, the adding rate of the acetic acid solution is 0.2mL/min.

In the embodiment of the application, the mass concentration of the L-polylactic acid in the L-polylactic acid solution is 2.5-7wt% and the mass concentration of the polyglutamic acid in the polyglutamic acid solution is 2.0-6.0wt%.

In an embodiment of the present application, the freezing process includes:

and (3) freezing the prepared primary gel for 12 hours at the temperature of minus 20 ℃, freeze-drying, washing in distilled water to be neutral, and freeze-drying to obtain the final gel.

In a second aspect, the embodiment of the application discloses modified L-polylactic acid gel obtained by the preparation method.

In a third aspect, the embodiment of the application discloses a novel medical shaping filler modified L-polylactic acid, which comprises the modified L-polylactic acid gel.

In a fourth aspect, the embodiment of the application discloses application of the modified L-polylactic acid gel in preparing medical plastic products.

Compared with the prior art, the application has at least the following beneficial effects:

the application discloses a novel medical shaping filler modified L-polylactic acid gel. The gel is prepared by fully mixing a L-polylactic acid solution, a polyglutamic acid solution and a vitamin P solution, then forming a preliminary gel with acetic acid, and then obtaining a final gel through freezing treatment. The gel has excellent mechanical properties, has promotion effect on growth and metabolism of chondrocytes, and can promote collagen regeneration without immunotoxic effect. The gel provided by the application has no toxic effect on chondrocytes, has obvious collagen regeneration promoting effect, has no obvious immune toxicity, is very suitable for being used as a medical filler test, is excellent in elasticity, is applied to the fields of breast enlargement, buttocks enlargement and face filling, can increase the gloss and elasticity of breasts while enlarging the breasts, and has very good effects on repairing the problems of postpartum relaxation, breast deformation, chest shape defect, external expansion sagging, breast hypofunction and the like of female breasts.

Drawings

Fig. 1 is a microscopic view of the modified levorotatory polylactic acid gel provided in example 1 of the present application.

Fig. 2 is a microscopic view of the modified levorotatory polylactic acid gel provided in comparative example 1 of the present application.

Fig. 3 is a microscopic view of the modified levorotatory polylactic acid gel provided in comparative example 2 of the present application.

Fig. 4 is a microscopic view of the modified levorotatory polylactic acid gel provided in comparative example 3 of the present application.

Fig. 5 is a confocal laser microscopic image of the modified levorotatory polylactic acid gel-cell composite provided in example 1 of the present application.

Fig. 6 is a confocal laser microscopic image of the modified left-handed polylactic acid gel-cell composite provided in comparative example 1 of the present application.

Fig. 7 is a HE staining chart of a vertical section of the modified left-handed polylactic acid gel-cell complex provided in example 1 of the present application.

FIG. 8 is a HE staining chart of a longitudinal section of the modified L-polylactic acid gel-cell complex provided in comparative example 1.

Detailed Description

In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be described in further detail with reference to the following examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the application.

For the purpose of the application, the inventor provides a preparation method of modified L-polylactic acid gel, which comprises the following steps: preparing a levorotatory polylactic acid solution, a polyglutamic acid solution and a vitamin P solution respectively; taking a L-polylactic acid solution, a polyglutamic acid solution and a vitamin P solution, fully mixing, and adding an acetic acid solution to form primary gel; and freezing the preliminary gel to obtain the final gel.

The modified L-polylactic acid gel obtained by the method has excellent mechanical properties, has promotion effect on the growth and metabolism of chondrocytes through gel-chondrocyte compound experiments, has no obvious immunotoxicity effect on mice through animal experiments, and has a prospect of being widely applied to the field of medical shaping.

In the preparation process, the solvent in the L-polylactic acid solution is selected from one of tetrahydrofuran, hexafluoroisopropanol and dimethyl sulfoxide, the solvent in the polyglutamic acid solution is selected from one of tetrahydrofuran, trifluoroacetic acid and dimethyl sulfoxide, and the solvent in the vitamin P solution is water.

In the preparation process, the L-polylactic acid solution, the polyglutamic acid solution and the vitamin P solution are mixed according to the volume ratio of 6:4:1, and are uniformly stirred at 45 ℃ until the L-polylactic acid solution, the polyglutamic acid solution and the vitamin P solution are fully dissolved.

In the preparation process, the concentration of the added acetic acid solution is 0.02M, and the added volume amount is the same as the added amount of the vitamin P solution.

In the preparation process, the adding rate of the acetic acid solution is 0.2mL/min.

In the preparation process, the mass concentration of the L-polylactic acid in the L-polylactic acid solution is 2.5-7wt% and the mass concentration of the polyglutamic acid in the polyglutamic acid solution is 2.0-6.0wt%.

In an embodiment of the present application, the freezing process includes: and (3) freezing the prepared primary gel for 12 hours at the temperature of minus 20 ℃, freeze-drying, washing in distilled water to be neutral, and freeze-drying to obtain the final gel.

The details of the levorotatory polylactic acid gel will be described below with reference to more specific examples, and the reagents and equipment involved, unless otherwise specified, are known from commercial glues.

Preparation of modified L-polylactic acid gel

In an embodiment of the application, a method for blending L-polylactic acid (PLLA for short) is provided.

In one specific example 1:

preparing 5.0wt% of L-polylactic acid (PLLA) solution, wherein the solvent is Tetrahydrofuran (THF); preparing 4.3wt% polyglutamic acid (gamma PGA for short) solution and solvent THF; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water;

mixing the PLLA solution, the gamma PGA solution and the VP solution according to the volume ratio of 6:4:1, wherein the PLLA solution is 450ml, the gamma PGA solution is 360ml, the VP solution is 90ml, uniformly stirring at 45 ℃ until the PLLA solution, the gamma PGA solution and the VP solution are fully dissolved, simultaneously adding 9ml of 0.02M acetic acid solution, rapidly and uniformly mixing, stopping immediately, and standing at room temperature to form primary gel. Wherein, the acetic acid solution should be slowly added dropwise, and not excessively fast. In this example 1, the rate of addition of acetic acid solution was 0.2mL/min.

And (3) freezing the prepared primary gel at the temperature of-20 ℃ for 12 hours, and freeze-drying the material by a freeze dryer. The freeze-dried material is washed to be neutral in distilled water, and then freeze-dried again by a freeze dryer.

The preparation process of example 2 is:

preparing a PLLA solution with the concentration of 5.0wt%, wherein the solvent is Hexafluoroisopropanol (HFIP); preparing 5.0wt% gamma PGA solution with trifluoroacetic acid (TFA) as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation process of example 3 is:

preparing a PLLA solution with the concentration of 5.0 weight percent, wherein the solvent is dimethyl sulfoxide (DMSO); preparing 5.0wt% gamma PGA solution with DMSO as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation procedure of example 4 is:

preparing a PLLA solution with the concentration of 5.0 weight percent, wherein the solvent is dimethyl sulfoxide (DMSO); preparing 5.0wt% gamma PGA solution with TFA as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation process of example 5 is:

preparing a PLLA solution with the concentration of 5.0wt% and the solvent being THF; preparing 5.0wt% gamma PGA solution with TFA as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation procedure of example 6 is:

preparing a PLLA solution with the concentration of 2.5 weight percent, wherein the solvent is THF; preparing 2.0wt% gamma PGA solution with TFA as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The procedure for the preparation of example 7 is:

preparing a PLLA solution with the concentration of 2.5 weight percent, wherein the solvent is THF; preparing 2.0wt% gamma PGA solution with THF as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation procedure of example 8 is:

preparing 7.0wt% PLLA solution, wherein the solvent is THF; preparing 6.0wt% gamma PGA solution with TFA as solvent; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the other steps were the same as in example 1.

The preparation process of comparative example 1 is:

only 5.0wt% of a solution of L-polylactic acid (PLLA) was prepared, the solvent was Tetrahydrofuran (THF), and after sufficient dissolution, freeze-drying was performed to obtain a gel.

The preparation process of comparative example 2 is:

preparing only 5.0wt% of L-polylactic acid (PLLA) solution, wherein the solvent is Tetrahydrofuran (THF), preparing 0.5wt% of Vitamin P (VP) solution, and the solvent is deionized water;

after mixing the two solutions according to the volume ratio of 6:1, 450mL of PLLA solution, 90mL of VP solution, 9mL of 0.02M acetic acid solution, uniformly stirring at 45 ℃ until the solution is fully dissolved, simultaneously adding 9mL of 0.02M acetic acid solution, wherein the rate of adding the acetic acid solution is 0.2mL/min, stopping immediately after rapid mixing, and standing at room temperature to form primary gel. Freeze drying to obtain final gel.

The preparation process of comparative example 3 is:

preparing 7.5wt% of L-polylactic acid (PLLA) solution, wherein the solvent is Tetrahydrofuran (THF); preparing 6.5wt% gamma PGA solution and solvent THF; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the subsequent steps are the same as in example 1.

The preparation process of comparative example 4 is:

preparing 2.0wt% of L-polylactic acid (PLLA) solution, wherein the solvent is Tetrahydrofuran (THF); preparing 1.5wt% gamma PGA solution and solvent THF; preparing 0.5wt% of vitamin P (VP for short) solution, wherein the solvent is deionized water; the subsequent steps are the same as in example 1.

The preparation process of comparative example 5 is: the procedure and conditions were the same as in example 1 except that no acetic acid solution was added during the gel formation.

Performance analysis of modified L-polylactic acid gel

1. Analysis method

1.1 morphology analysis

To observe the microscopic morphology of the modified L-polylactic acid gels formed in the above examples and comparative examples, each gel was cut into pieces of appropriate size in a liquid nitrogen environment, and then adhered to an electron microscope stage with a conductive adhesive, and the cross section of each gel was observed with a Scanning Electron Microscope (SEM) at a voltage of 15.0kV. All electron microscope samples were subjected to a metal spraying treatment to enhance the conductivity of the material.

1.2 analysis of mechanical Properties

Compression modulus: compression modulus testing was performed according to national standard UB/T1041-2008. The compression properties of the modified L-polylactic acid gels prepared in each example and comparative example were measured by an electronic tester (QJ 211-compression modulus tester, shanghai titling instruments and meters Co., ltd.) at a uniaxial compression rate of 1mm/min and a test temperature of 25 ℃. And obtaining a corresponding stress strain curve graph of the sample from the relation curve of the stress and the deformation, fitting the curve, and obtaining the slope of the straight line, namely the compression modulus of the sample, and averaging through multiple measurements.

Tensile strength and elongation at break: tensile strength testing was performed according to national standard UB/T1040.3-2006. The modified L-polylactic acid gel formed in each example and comparative example was cut into strip-shaped samples of 0.5mm thickness, and the thickness and width of each sample were measured, and both ends thereof were fixed on a brute force machine (Tianjin Flora Automation technology Co., ltd.). The stretching operation was conducted at a stretching speed of 0.25mm/min until the samples were broken, and the tensile strength (. Sigma.) and elongation at break (. Eta.) of the different samples were measured.

1.3 Water absorption

The modified L-polylactic acid gel formed by each dried example and comparative example is taken, cut into sample blocks, record the initial treatment, soak the sample blocks in a centrifuge tube filled with 30mL PBS solution, swell the sample blocks in an oven at 37 ℃ for 24 hours, weigh the swelled material, and calculate the swelling rate of the material by using the formula (2).

Water absorption= (W-W) ₀ )/W ₀ X 100%, wherein W represents the mass of the material after swelling in PBS for 24 hours, mg; w (W) ₀ Represents the mass of the material in dry form, mg.

1.4 in vitro cytotoxicity experiments

The dried modified L-polylactic acid gel formed in each example and comparative example was taken, placed in a plate, sterilized by ultraviolet irradiation overnight in a super clean bench, the gel mass (about 5 mL) was transferred to a 50mL centrifuge tube, 15mL of spare DMEM medium (Gibco, siemeco) was added and fully swelled in a cell incubator for 24 hours. Filtering the supernatant with 0.22 μm filter membrane, sterilizing, and collecting filtrate as the prepared leaching solution, making label, and preserving at 4deg.C. Sterilized PBS was used as an experimental control and MTT assay was performed after culturing second generation chondrocytes (prinocetal). The MTT method is used for detecting the cell activity, the percentage of the light absorption value of the obtained experimental group and the light absorption value (RGR value) of the blank group reflect the cell survival rate, and the cytotoxicity grade is first-grade when the RGR value is more than 75% by referring to the national standard GB/T16886.5-2003 cytotoxicity grade, and the cytotoxicity of the sample to be detected is considered to be in accordance with the requirements, so that the related application can be carried out.

1.5 gel seeding cells

Cutting gel into required size and shape, placing into an ultra-clean workbench, sterilizing the front and back surfaces respectively with ultraviolet rays for 30min, placing into medical alcohol for sterilization for 30min, taking out gel, and cleaning with PBS solution for 3 times for 5min each time. The gel was then placed in a corresponding size cell culture plate, the cell culture broth (DMEM/F12 cell culture broth containing 15% fbs, 100units/mL penicillin and 100mg/mL streptomycin, gibco, zemoer) was added to submerge the gel, placed in a 37 ℃ cell incubator overnight, the cell culture broth was aspirated the next morning, the liquid on the gel was blotted with sterile absorbent paper, and again placed in a 37 ℃ cell incubator for micro-drying l h.

Preparing cell suspension with proper density from second generation chondrocyte (Punuocele) with cell concentration not less than 5×10 ⁵ And (3) inoculating on gel in a pore plate, placing in a cell culture box for incubation for 2 hours, then adding DMEM/F12 cell culture solution until the surface of the cell-gel complex is completely soaked, continuously placing in the cell culture box for culture, and changing the solution every 2-3 days.

1.6 observations of cell-gel complexes

At 1 day and 7 days of culture, respectively, a part of the cell-gel complex was taken out as an observation sample. The sample is washed by PBS solution, mixed into 2.5wt% glutaraldehyde solution, treated for 24 hours in the environment of 4 ℃, then treated for 30 minutes by 1wt% hundredth acid at 4 ℃, washed by PBS solution, dehydrated by gradient alcohol (30%, 50%,70%,80%,90%,95%,100%, 100%) in sequence, dried overnight at 37 ℃ in a vacuum drying oven, sprayed with gold, observed by a scanning electron microscope, including microscopic observation of gel before cell inoculation.

Meanwhile, when the cells are cultured for 1 day and 7 days respectively, taking out part of the cell-gel complex, washing the cell-gel complex by using a PBS solution, fixing the cell-gel complex for 20 minutes at room temperature by using 4% paraformaldehyde, removing a fixing solution, adding a 5 mu g/mL DAPI solution, and staining the cell-gel complex for 2 minutes at room temperature in a dark place, and observing the cell on the surface of the gel by using a fluorescence microscope and a laser confocal microscope respectively.

After 14 days of culture, a part of the cell-gel complex was taken and fixed, dehydrated, transparent, wax-impregnated, embedded, sliced, hematoxylin and eosin stained, dehydrated, transparent, and sealed in order, and the cell-gel complex was observed from the longitudinal section direction.

1.7 biochemical quantitative analysis

Chondrocyte-gel experiments:

50 mu L of the mixture was taken to have a density of 5X 10 ⁶ Per mL of chondrocyte suspension, inoculated into a gel in a 24-well culture plate containing the gels prepared in each of the above examples and comparative examples (5 replicates per group). The experiment adopts the surface of the tissue culture plate as a positive control group, and the surface (Tissue culture plate surface, TCPS) of the tissue culture plate is treated to ensure that the tissue culture plate has proper hydrophilic performance, thereby being more beneficial to the adhesion and proliferation of cells and being used as the positive control group under the normal condition. After each cell was cultured for 21 days, a portion of the cell-gel complex was removed, washed with PBS solution, the complex was cut into pieces, lml papain digest (l 0. Mu.g/ml, containing papain 0.5g, penonine 0.039g, disodium hydrogen phosphate 1.79g,EDTA 0.093g, and PBS to 50m 1) was added, and the mixture was put into a constant temperature shaker to digest for 16 hours at 65℃and blow evenly, and the supernatant was centrifuged to give a sample to be tested.

Quantitative detection of cell glycosaminoglycans (GAGs): the GAG content in the cultured cells of the different sets of cell experiments was detected using the dimethylmethylene blue (DMMB) colorimetric method. Samples to be tested were taken, 25mL per well, and 125mL of DMMB solution (aqueous solution containing 26.25mg/mL DMMB, 2.5g/mL sodium formate, 1.25v/v% absolute ethanol, ph=3.5) was added to each well, and the absorbance was measured at 595nm using an enzyme-labeled instrument. And drawing a standard curve by using the 6-chondroitin sulfate as a standard substance.

Quantitative detection of collagen: the content of the total collagen is detected by detecting the content of hydroxyproline in the sample. Adding 50 mu L of a sample to be tested into a clean freezing tube, adding 50 mu L of 1M hydrochloric acid solution according to the volume ratio of 1:1, covering a tube cover, hydrolyzing at 120 ℃ for 30min, taking out the freezing tube, adding 50 mu L of chloramine-T solution (glacial acetic acid-citrate buffer solution with pH of 14.1mg/mL chloramine-T and 26v/v% isopropanol and 6.5) into the freezing tube, uniformly mixing, reacting at room temperature for 15min, adding 2, 2-dimethylolbutyric acid (p-DMBA for short) solution (0.7 g p-DMBA is dissolved in 3.5M1 of n-propanol, adding 1.5M1 of perchloric acid and uniformly mixing to obtain the product), reacting at 37 ℃ for 30min, and measuring the absorbance value at 550nm by using an enzyme-labeling instrument. Drawing a standard curve by taking 4-hydroxyproline as a standard substance.

Quantitative determination of osteocalcin (BGP): and detecting the content of BGP in the sample to be detected by using a BGP enzyme-linked immunoassay kit (Shanghai heart language biotechnology Co., ltd.).

Content detection of deoxypyridinium enzyme (D-Pyd): D-Pyd enzyme-linked immunosorbent assay kit (Sieimer fly) detects the content of D-Pyd in the sample to be detected.

1.8, RT-PCR detection of chondrocyte-related Gene expression

PLLA and blank TCPS were used as control groups. 50mL of each cell suspension is taken, RNA is extracted by a trizol method, RNA is reversely transcribed into cDNA, a housekeeping gene GAPDH is taken as an internal reference gene, and relative expression levels of type I collagen (COL 1A 2), osteocalcin (BGP), inflammatory factors (COX-2), matrix catabolism genes (MMP-3), anti-catabolism genes (TIMP-1), sox-9 and anabolism promoting genes (aggrecan) are detected by Real-time PCR.

The specific experimental steps are as follows:

1) Extraction of Total RNA

The sample solution was taken and subjected to total RNA extraction using Invitrogen Ambionrna extraction kit (Sesameira) according to the instructions.

2) Reverse transcription system:

the first system: total volume 5 μl: RNA L. Mu.g, primer L. Mu. L, DEPC water was made up to 5. Mu.L, total volume 5. Mu.L; the first system is subjected to water bath at 70 ℃ for 5min and ice bath for 5min;

the second system: total volume 15 μl:5 Xbuffer 4 mu L, mgCl ₂ 2.4. Mu.L, dNTP. Mu.L, reverse transcriptase. Mu.L, DEPC water 6.6. Mu.L

Then, 15. Mu.L of the second system and 5. Mu.L of the first system after the ice bath were mixed, respectively, and reverse transcription was performed.

Reverse transcription conditions: 25 ℃ for 5min,42 ℃ for 60min and 70 ℃ for 15min; mu.L of DEPC water was added to 20. Mu.L of the resulting reverse transcription product to dilute it, and then cDNA concentration was measured.

3) RT-PCR system

Total volume 25 μl: primer 3. Mu.L (1.5. Mu.L for each of the upstream and downstream primers), cDNA 3. Mu.L, SYBR reagent 12.5. Mu.L, water 6.5. Mu.L.

Real-Time PCR conditions: 95 DEG CPre-denaturation for 5min, denaturation at 95℃for 10s, annealing at 60℃for 10s, extension at 72℃for 20s,45 cycles, complete extension at 72℃for 5min, and cooling to room temperature of 25 ℃. Obtaining an amplification curve and a dissolution curve from a Real-Time PCR instrument, reading Ct values of all samples, and adopting 2 ^-ΔΔCt The relative fold of expression of each gene was analyzed by the method (TCPS control group 1).

The primer sequentially comprises: GAPDH-F atggtgaaggtcggagtgaa as shown in SEQ ID NO. 1; GAPDH-R cgtgggtggaatcatactgg as shown in SEQ ID NO. 2;

COL1A2-F ggcaacagcaggttcactta, shown in SEQ ID NO. 3; COL1A2-R ggcaaacgagatggcttatt as shown in SEQ ID NO. 4;

cggaattctacctggatcctgggctgg, shown as SEQ ID NO. 5; atttgcggccgcgtggtggtggtggtggtgc, shown as SEQ ID NO. 6;

cacgcaggtggagatgatctac COX-2-F is shown in SEQ ID NO. 7; caggcaccagaccaaagactt of COX-2-R is shown in SEQ ID NO. 8;

MMP-3-F agccaatggaaatgaaaactcttc, shown in SEQ ID NO. 9; MMP-3-R ccagtggataggctgagcaaa is shown as SEQ ID NO. 10;

TIMP-1-F agcagagcctgcacctgtgt, shown as SEQ ID NO. 11; TIMP-1-R ccacaaacttggccctgatg, shown as SEQ ID NO. 12;

AGGRECAN-F aggtctcgctgcccaacta as shown in SEQ ID NO. 13; AGGRECAN-R gtagcctcgctgtcctcaag as shown in SEQ ID NO. 14;

SOX-9-F gggaagctctggagactgct, as shown in SEQ ID NO. 15; SOX-9-R tgtagtccgggtggtctttc, as shown in SEQ ID NO. 16.

1.9 data analysis

Experimental data were statistically consolidated using Excel 2013 and SPSS 22.0 statistical software for data analysis, each measured multiple times and represented by mean and its standard deviation, and single-factor analysis of variance (One-way ANOVA) and DunCan's multiple comparisons were performed with SPSS 22.0, respectively.

2. Results

Table 1 mechanical properties

Table 1 shows the mechanical properties of the modified L-polylactic acid gels prepared in examples 1 to 8 and comparative examples 1 to 5 described above. Examples 1-8 have significantly higher compressive modulus than comparative examples 1-5, and also have significantly higher tensile strength and elongation at break than comparative examples 1-5, respectively. From this, it is shown that the modified L-polylactic acid gel prepared by the embodiment of the application has better mechanical properties. This benefits from the addition of γpga to the prepared modified levorotatory polylactic acid gel of examples 1-8, and the reasonable control of PLLA and γpga content, and slow gelling using acetic acid during gelling.

Fig. 1 to 4 show the microstructures of the levorotatory polylactic acid gels prepared in example 1 and comparative examples 1 to 3, and the pore structures of the prepared porous gels are clearly visible, whereas the gels of example 1 have larger internal pore channels, uniform pore size, thinner pore walls, and more number of pores, while the gels of comparative examples 1 to 3 have a complex structure and smaller pore channels.

TABLE 2

Description of the embodiments	Water absorption (%)	RGR
			Example 1	212.32±23.41％b	93.45±3.45％ab
Example 2	232.14±18.24％ab	92.86±1.32％ab
			Example 3	226.25±17.36％b	94.82±2.12％ab
Example 4	217.27±19.12％b	97.29±2.88％ab
			Example 5	232.27±21.11％a	105.35±2.67％a
Example 6	251.37±15.27％a	103.17±1.68％a
			Example 7	243.06±16.24％a	101.21±1.49％a
Example 8	236.56±21.19％ab	98.25±1.63％ab
			Comparative example 1	132.15±16.32％c	86.65±2.12％b
Comparative example 2	124.79±32.15％c	83.77±1.67％b
			Comparative example 3	126.26±27.23％c	84.63±2.27％b
Comparative example 4	130.05±16.57％c	85.39±5.21％b
			Comparative example 5	126.24±19.35％c	86.12±1.68％b

Table 2 lists the water absorption and RGR values of the modified left-handed polylactic acid gels prepared in the above examples and comparative examples. The RGR values of the gel are all larger than 75%, meet the requirements of national standard GB/T16886.5-2003 cytotoxicity, and have the prospect of being applied to medical fillers. In addition, the modified L-polylactic acid gels prepared in examples 1 to 8 have higher water absorption and have more space gaps on the surface and inside, which is also known from the observation of the microstructure of the cell-gel composite. This provides more room for the implanted cell body and interstitial fluid to be the basis for its growth and adequate fusion with the body when used as a filler or implant. Fig. 5 and 6 show laser confocal microscopic images of the modified levorotatory polylactic acid gel corresponding to example 1 and comparative example 1 after 21 days of culture with chondrocytes, wherein two points are chondrocytes, and it can be seen that the chondrocytes in fig. 5 survive more and adhere more, and the survival is due to the chondrocytes in fig. 6.

FIGS. 7 and 8 show a microscopic view of the longitudinal section of the gel-cells of example 1 and comparative example 1, respectively. The cells in fig. 7 partially go deep into the gel, while the cells in fig. 8 mainly stay on the surface of the gel, so that it can be seen that the l-modified polylactic acid gel prepared in example 1 is more advantageous for adhesion and penetration of chondrocytes into the gel interior to obtain fusion and growth with the gel.

TABLE 3 Table 3

Description of the embodiments	Collagen (μg/L)	GAG(μg/L)	BGP(ng/L)	D-Pyd(ng/L)
					Example 1	24.67±3.14b	59.48±2.32b	72.45±4.68a	68.56±3.45a
Example 2	23.48±2.75c	62.12±1.84ab	72.36±2.47a	71.18±2.78a
					Example 3	24.35±2.29b	60.23±1.68b	73.61±1.59a	69.12±1.62a
Example 4	25.14±3.68ab	61.82±2.45b	72.72±2.43a	72.23±1.24a
					Example 5	24.53±2.65b	64.25±1.63a	72.33±2.16a	67.35±2.01a
Example 6	26.12±1.85a	62.17±1.85ab	72.68±2.01a	69.34±1.82a
					Example 7	25.42±2.10ab	61.25±2.16b	71.08±2.01a	67.12±2.04a
Example 8	25.24±2.61ab	61.11±1.34b	71.36±1.52a	68.13±1.68a
					Comparative example 1	13.65±2.02d	46.27±1.02c	33.62±2.17c	54.12±1.72b
Comparative example 2	12.51±1.73de	44.35±2.17d	32.47±1.36c	53.02±1.46b
					Comparative example 3	12.29±1.61de	44.24±2.06d	34.68±2.39c	55.21±1.77b
Comparative example 4	12.37±2.01de	44.37±1.84d	35.68±6.17c	56.07±2.02b
					Comparative example 5	13.16±1.72d	42.75±1.63e	38.15±2.64b	55.03±1.86b

Table 3 shows the contents of collagen, GAG, BGP and D-Pyd in chondrocyte suspensions obtained after the cell-gel complex culture experiments of the modified L-polylactic acid gels prepared in examples 1 to 8 and comparative examples 1 to 5. As can be seen from table 3, the chondrocytes secrete collagen on the levopolylactic acid gel prepared in each of examples 1 to 8 and comparative example, and after 21 days of culture, the collagen content of the chondrocyte suspension obtained in the corresponding group of examples 1 to 8 is significantly higher than that of comparative examples 1 to 5, and the GAG, BGP and D-Pyd contents thereof are also significantly higher than those of comparative examples 1 to 5. The increased collagen content indicates that the chondrocytes have a differentiation tendency, which has a normal differentiation function on the levorotatory polylactic acid gel. The secretion of GAGs indicates that the chondrocytes have good adhesive properties, so that they can be sufficiently adhered and fused with the levorotatory polylactic acid gel.

Osteocalcin (BGP) is produced and secreted by osteoblasts and is an effective marker of bone turnover in its resorption and coupling formation, and its content is reflective of the metabolic state of bone. As can be seen from the results in table 3, the BGP content of the cell suspension after the gel-chondrocyte experiments corresponding to examples 1 to 8 is significantly higher than that of the comparative example, which indicates that the chondrocytes on the gel have a greater tendency to bone formation and have higher growth and differentiation activities.

D-Pyd is a derivative of collagen linkage, a specific index of collagen in bones and cartilage, and reflects the degree of absorption of bone matrix, and is widely found in COL1 in bone tissues. The results in Table 3 above show that the L-polylactic acid gels prepared in examples 1-8 are more favorable for chondrocytes to grow and differentiate thereon, so that they secrete more D-Pyd.

Table 4 relative expression fold (1)

Description of the embodiments	COL1A2	BGP	COX-2	MMP-3
					Example 1	2.02±0.36b	1.12±0.05ab	0.48±0.06b	1.68±0.14a
Example 2	2.16±0.32b	1.23±0.07ab	0.45±0.04b	1.72±0.06a
					Example 3	2.63±0.12a	1.36±0.11a	0.55±0.07b	1.82±0.17a
Example 4	2.79±0.24a	1.26±0.07ab	0.49±0.03b	1.77±0.11a
					Example 5	2.84±0.17a	1.32±0.14a	0.53±0.07b	1.92±0.23a
Example 6	3.08±0.23a	1.45±0.08a	0.48±0.06b	1.89±0.16a
					Example 7	2.91±0.14a	1.42±0.03a	0.52±0.04b	1.87±0.17a
Example 8	2.86±0.22a	1.36±0.02a	0.46±0.08b	1.79±0.13a
					Comparative example 1	2.02±0.36b	0.62±0.12c	0.96±0.12a	0.82±0.06b
Comparative example 2	2.02±0.36b	0.58±0.07c	0.98±0.06a	0.75±0.13b
					Comparative example 3	2.02±0.36b	0.54±0.09c	1.05±0.07a	0.71±0.11b
Comparative example 4	2.02±0.36b	0.58±0.13c	0.94±0.04a	0.64±0.26c
					Comparative example 5	2.02±0.36b	0.61±0.08c	0.97±0.02a	0.73±0.08b

Table 5 relative expression fold (2)

Description of the embodiments	TIMP-1	sox-9	aggrecan
				Example 1	2.12±0.14a	1.92±0.53a	1.68±0.14a
Example 2	2.07±0.08a	1.97±0.26a	1.72±0.06a
				Example 3	2.11±0.12a	2.13±0.17a	1.67±0.08a
Example 4	2.09±0.07a	2.09±0.24a	1.58±0.11a
				Example 5	2.06±0.05a	2.24±0.21a	1.61±0.08a
Example 6	2.24±0.17a	2.35±0.16a	1.67±0.12a
				Example 7	2.13±0.08a	2.23±0.24a	1.64±0.09a
Example 8	2.03±0.15a	2.18±0.13a	1.57±0.02a
				Comparative example 1	0.75±0.32b	0.67±0.32b	0.82±0.02b
Comparative example 2	0.71±0.18b	0.70±0.23b	0.79±0.06b
				Comparative example 3	0.68±0.06b	0.65±0.17b	0.83±0.04b
Comparative example 4	0.73±0.13b	0.64±0.13b	0.85±0.01b
				Comparative example 5	0.67±0.09b	0.62±0.06b	0.87±0.03b

Tables 4 and 5 show the expression of the relevant genes in cell suspensions after the gel-chondrocyte composite experiments described above, where each set of data is a relative fold after normalization using GAPDH.

Among them, the levels of expression of the type I collagen gene (COL 1A 2), osteocalcin gene (BGP), matrix catabolism gene (MMP-3), anti-catabolism gene (TIMP-1), sox-9 and anabolism-promoting gene (aggrecan) corresponding to examples 1 to 8 were significantly higher than those of comparative examples 1 to 5, and the levels of expression of inflammatory factor gene were significantly lower than those of comparative examples 1 to 5. The expression conditions of the type I collagen and osteocalcin genes are identical with the results of the table 3, which shows that the modified levorotatory polylactic acid gel provided by the application has promotion effect on the growth and differentiation of chondrocytes.

Wherein the expression of inflammatory factor gene (COX-2) was down-regulated and sox-9 expression was promoted, which indicates that the chondrocytes on the modified L-polylactic acid gel prepared in the above example were not abnormal in inflammation and were normal in cell growth.

MMP-3 is one of the most important matrix metalloproteinases, has a strong function of decomposing matrix, and plays an important role in the intervertebral disc degeneration process mainly by improving the structure, function and content of biological macromolecules such as proteoglycan, collagen, elastin and the like in bone cells. TIMP-1 is a specific inhibitor of MMP-3, and can specifically bind to zinc ions in the catalytic center of MMP-3, thereby blocking the catalytic activity thereof, inactivating active MMP-3, or activating active MMP-3 in the remote corner L. The levels of MMP-3 and TIMP-1 expression in the chondrocytes corresponding to examples 1-8 were significantly higher than comparative examples 1-5, indicating that their corresponding chondrocytes were stimulated in metabolic activity on the prepared modified L-polylactic acid gels and produced an imbalance in matrix synthesis and catabolism. Examples 1 to 8 showed higher levels of anabolic gene (agalecan) expression than comparative examples 1 to 5, indicating that the anabolism of chondrocytes corresponding to examples 1 to 8 was promoted.

Animal experiment

1. Materials and methods

1.1, laboratory animals

Female Balb/c mice (Jiangsu Ai Lingfei) with SPF grade of 6-8 weeks have a weight of 20+ -2 g, and are free to eat standard granular animal feed and drink tap water at a constant temperature of 22 ℃ and a relative humidity of 65% -70% and a lighting period of 12h:12h, and are suitable for starting experiments after 1 week of feeding.

1.2, experimental grouping:

the mice were randomly divided into 5 groups, 10 l groups, and gel implantation experiments were performed using gels prepared in the above examples and comparative examples. The method comprises the following steps:

negative control group: the other operations were the same as the gel implant set except that no gel was implanted;

gel implant group: the implantation dosage is 0.6 mL/piece, and 0.2 intestinal lidocaine which is diluted 10 times by normal saline is injected subcutaneously at the position 1/4 of the lower right part of the back of the mouse when the implantation is carried out is about 0.1 mL/piece; then, the gel was injected into the mouse subcutaneously by pushing the gel into the mouse subcutaneously at a desired dose by using an ilium puncture needle at about 1/4 of the lower right back of the mouse and connecting a 1mL syringe pre-filled with the gel to the ilium puncture needle.

Positive control group: a0.6 mL/1 mixed emulsion of Freund's complete adjuvant was injected subcutaneously in the same manner as described above, and the mixture was boosted once after 14 days, and after 24 days of the first immunization, 0.1 mL/1 more was injected with a BSA solution containing no Freund's complete adjuvant at 2 mg/mL.

The mice were weighed the day after the material implantation, and then were observed and weighed weekly, and treated 2 months after the material implantation, the treatment steps were as follows:

1.3 serological testing

The peripheral blood of the mice was collected at 20. Mu.L by orbit, diluted with 2mL of 0.65% biological saline, and then examined on a blood cell analyzer for serological examination. Serological assays involve the detection of RBC, HGB, PLT, WBC, LYM and neet.

1.4 humoral immune function detection

Serum sample preparation: after each group of mouse materials are implanted for 2 months, eyeballs are removed, blood is collected to 1.5mL, the mixture is stood at room temperature until serum is separated out, and the mixture is centrifuged at 3000rpm for 10min for standby; serum detection was performed using IgG and IgM ELISA kits (Abcam china), specifically with reference to the kit instructions.

1.5, NK cell Activity assay

Preparation of spleen lymphocyte suspension: each group of mice was sacrificed by pulling the neck, the abdominal cavity of the mice was cut off with sterile ophthalmic scissors in an ultra clean bench, the spleens of the mice were peeled off and removed with sterile forceps, and placed in a sterile dish. A small amount of 1640 culture solution (Jino biomedical technology Co., ltd.) was poured into the dish, and the spleen was ground with the piston of a disposable syringe, and the spleen cells were separated by repeated movement; flushing with 1640 culture solution, collecting flushing liquid and transferring to a sterile centrifuge tube; centrifuging at 2000rpm for 5min, discarding supernatant, re-suspending the precipitate with erythrocyte lysate (Beijing Soy Bao technology Co., ltd.), reacting for 1min, adding 1640 culture solution (10 mL), and stopping the reaction; centrifuging at 2000rpm for 5min, discarding supernatant, and adding 1640 culture solution to resuspend to obtain spleen lymphocyte suspension.

Spleen cell suspension samples were centrifuged to remove the medium, resuspended in lysis Solution, centrifuged at 3000rpm for 5min, and the supernatant was discarded after centrifugation, followed by centrifugation with Cell Staining Buffer (BioLegend Corp.)) Regulating spleen lymphocyte concentration to 1×10 ⁶ And each mL. According to the recommended use of the flow type antibody specification, adding the corresponding labeled Hangzhou body and spleen cell suspension into a flow type tube, and fully and uniformly mixing: adding PBS with the same volume as the detection antibody into the blank control; isotype control was mixed with CD3FITC/IgG1 PE/IgG2a APC; detecting tube CD3 FITC/CD69 PE/CD49b APC, adding antibody into flow tube according to the above set mixing item to prepare 10uL antibody mixing system, mixing with spleen lymphocyte, reacting at room temperature in dark for 30min, adding 2mL Cell Staining Buffer resuspended cells into each tube, centrifuging at 3000rpm for 5min, discarding supernatant, adding 0.5mL Cell Staining Buffer into each tube, resuspending cells, and detecting above flow cell.

2. Results

TABLE 6 serological test results (1)

TABLE 7 serological test results (2)

As can be seen from tables 6 and 7, the mice of examples 1 to 8 in the gel-implanted group were not significantly different in serological parameters from the negative control group after 2 months of the experiment, while the mice of comparative examples 1 to 5 in the gel-implanted group were significantly different in serological parameters. Specifically, the RBCs of the mice of comparative examples 1-5 were elevated relative to the negative control, HGBC was reduced relative to the negative control, PLT was reduced relative to the negative control, WBC was elevated relative to the negative control, LYM was elevated relative to the negative control, and NEUT was elevated relative to the negative control, indicating that the gels prepared in comparative examples 1-5 caused their inflammatory response in the mice.

TABLE 8 humoral immune function test results

/>

Table 8 shows that after 2 months of the experiment, the mice in the gel-implanted group had no significant change in serum total IgG and IgM relative to the negative control group.

TABLE 9 NK cells and NK-T cells and number of activated groups thereof

Table 9 lists the NK and NK-T cell numbers and the percentage of activation in spleen lymph of each group of mice. The number of NK cells in the mice splenomegaly corresponding to the gel implantation group is not significantly different from that of the negative control group. However, the number of activated NK, NK-T cells and activated NK-T cells in the spleen lymph of mice corresponding to examples 1-8 in the gel-implanted group was significantly higher than that of the negative control group, and also significantly higher than that of comparative examples 1-5.

Activation of NK and NK-T cells is affected by a variety of signals, the activation of which may exhibit a variety of biological functions. NK cells can kill tumor cells, virus infected cells, fungi, intracellular parasitic bacteria and the like, have an immunoregulatory function, have a regulatory effect on macrophages and CTLs, and play an important role in an innate immune network. NK-T cells have immunomodulating and cytotoxic effects, and upon activation, secrete a variety of cytokines and chemokines to modulate immune function. From the above results, it was found that the numbers of activated NK cells and activated NK-T cells of spleen lymph of mice corresponding to examples 1-8 of silastic were higher than those of the negative control group, and that some of the immune functions of the mice of the gel-implanted group were in an activated state.

The results of the animal experiments show that after the mice are implanted with the gel prepared in each example and comparative example, the blood items of the mice are not obviously abnormal, humoral immune reaction is not generated, but only activation of NK and NK-T cell numbers in spleen and gonorrhea of the mice is promoted, and thus, some immune functions of the mice are activated, which may be related to implantation of foreign matters, but no obvious immune toxicity is generated on the mice in the whole. The modified L-polylactic acid gel prepared by the application has application prospect of being developed into a plastic medical filler.

The application discloses a novel medical shaping filler modified L-polylactic acid gel. The gel is prepared by fully mixing a L-polylactic acid solution, a polyglutamic acid solution and a vitamin P solution, then forming a preliminary gel with acetic acid, and then obtaining a final gel through freezing treatment. The gel has excellent mechanical properties, has promotion effect on growth and metabolism of chondrocytes, and can promote collagen regeneration without immunotoxic effect.

The gel provided by the application has no toxic effect on chondrocytes, has obvious collagen regeneration promoting effect, has no obvious immune toxicity, is very suitable for being used as a medical filler test, is excellent in elasticity, is applied to the fields of breast enlargement, buttocks enlargement and face filling, can increase the gloss and elasticity of breasts while enlarging the breasts, and has very good effects on repairing the problems of postpartum relaxation, breast deformation, chest shape defect, external expansion sagging, breast hypofunction and the like of female breasts.

The present application is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present application are intended to be included in the scope of the present application.

Claims

1. The preparation method of the modified L-polylactic acid gel comprises the following steps:

and freezing the preliminary gel to obtain the final gel.

2. The method according to claim 1, wherein the solvent in the solution of l-polylactic acid is one selected from tetrahydrofuran, hexafluoroisopropanol and dimethyl sulfoxide, the solvent in the solution of polyglutamic acid is one selected from tetrahydrofuran, trifluoroacetic acid and dimethyl sulfoxide, and the solvent in the solution of vitamin P is water.

3. The preparation method according to claim 1, wherein the solution of the L-polylactic acid, the solution of the polyglutamic acid and the solution of the vitamin P are mixed according to a volume ratio of 6:4:1, and uniformly stirred at 45 ℃ until the mixture is fully dissolved.

4. The method according to claim 1, wherein the acetic acid solution is added at a concentration of 0.02M in the same volume as the vitamin P solution.

5. The method of claim 1, wherein the acetic acid solution is added at a rate of 0.2mL/min.

6. The method according to claim 1, wherein the mass concentration of the L-polylactic acid in the L-polylactic acid solution is 2.5 to 7wt% and the mass concentration of the polyglutamic acid in the polyglutamic acid solution is 2.0 to 6.0wt%.

7. The method of manufacturing according to claim 1, wherein the freezing process comprises:

8. The modified levorotatory polylactic acid gel obtained by the production method according to any one of claims 1 to 7.

9. A novel medical cosmetic filler comprising the modified left-handed polylactic acid gel of claim 8.

10. The use of the modified levorotatory polylactic acid gel of claim 8 in the preparation of a medical plastic product.