CN116940669A - Systems and methods for modulating gene expression or activity - Google Patents

Abstract

Certain aspects of the present disclosure provide systems, compositions, and methods for modulating expression or activity of an endogenous cytokine in a cell. In some cases, the present disclosure provides a system comprising an actuation moiety capable of complexing with a target gene encoding an endogenous cytokine to regulate expression or activity of the endogenous cytokine. The actuation portion may be heterologous to the cell. The actuation portion may be activated after exposing the cells to an external stimulus. Upon exposure of the cells to an external stimulus, the activating moiety may be activated to regulate expression or activity of the endogenous cytokine.

Description

Systems and methods for modulating gene expression or activity

Cross reference

The application claims the benefit of U.S. provisional application No. 63/111,053 filed 11/08 in 2020 and U.S. provisional application No. 63/216,659 filed 6/30 in 2021, each of which is incorporated herein by reference in its entirety.

Background

Cancer (e.g., neoplasm, tumor) is a large group of diseases involving abnormal cell growth in many body tissues. Cancer can invade or spread to other parts of the body. As a major cause of death worldwide, about 1000 tens of thousands die annually from cancer. Non-limiting examples of body tissue invaded by cancer include lung, prostate, colorectal, stomach, liver, breast, colon, rectum, cervix and thyroid. Different therapies have been developed with the aim of treating or controlling cancer, such as small molecules, antibodies and adoptive cell therapies (e.g., cellular immunotherapy).

Disclosure of Invention

The present disclosure provides methods and systems for adoptive cell therapy to treat subjects having or suspected of having a condition such as cancer. The methods and systems of the present disclosure can be used, for example, to enhance the activity (e.g., anti-tumor activity) of cellular immunotherapy (e.g., cancer therapy using autologous or allogeneic immune cells).

In one aspect, the present disclosure provides a system for modulating expression or activity of an endogenous cytokine of a cell, the system comprising: an activating moiety capable of complexing with a target gene encoding an endogenous cytokine to regulate expression or activity of the endogenous cytokine, wherein the activating moiety is heterologous to the cell and is activatable upon exposure of the cell to an external stimulus, wherein upon exposure of the cell to the external stimulus the activating moiety is activated to regulate expression or activity of the endogenous cytokine, thereby causing the cell to exhibit one or more characteristics selected from the group consisting of: (i) The expression or activity of the endogenous cytokine is altered by at least 20% as compared to a control; (ii) The expression or activity of a different endogenous cytokine of the cell is altered by at least 20% compared to a control; (iii) Enhanced cytotoxicity to the target cell population, as determined by a reduction in the size of the target cell population of at least 20% compared to the control; (iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising cells as compared to the control; and (v) a decrease in tumor size compared to a control.

In some embodiments of any of the systems disclosed herein, the external stimulus is a ligand, and the system comprises: a chimeric receptor polypeptide (receptor) that undergoes modification upon binding to a ligand, wherein an actuating moiety is activatable upon modification of the receptor. In some embodiments of any of the systems disclosed herein, the activation of the actuation portion comprises (1) releasing the actuation portion from the substrate or (2) modifying the actuation portion.

In some embodiments of any of the systems disclosed herein, the cell is caused to exhibit two or more of (i) to (v). In some embodiments of any of the systems disclosed herein, the cell is caused to exhibit three or more of (i) to (v). In some embodiments of any of the systems disclosed herein, the cell is caused to exhibit four or more of (i) to (v). In some embodiments of any of the systems disclosed herein, the cell is caused to exhibit all of (i) to (v).

In some embodiments of any of the systems disclosed herein, the cells are caused to exhibit an increase in the expression level of the endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% as compared to control cells.

In some embodiments of any of the systems disclosed herein, the endogenous cytokine comprises an Interleukin (IL) selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36. In any of the embodiments of the system disclosed herein, endogenous cytokines include IL-12. In some embodiments of any of the systems disclosed herein, the target gene comprises a first gene encoding IL-12A (p 35) and a second gene encoding IL-12B (p 40). In some embodiments of any of the systems disclosed herein, the endogenous cytokine comprises IL-21.

In some embodiments of any of the systems disclosed herein, the actuation moiety is capable of complexing with a target polynucleotide sequence of the target gene, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the target gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the target gene.

In some embodiments of any of the systems disclosed herein, (1) the first actuating portion of the actuating portion is capable of complexing with a first gene of the target gene, and (2) the second actuating portion of the actuating portion is capable of complexing with a second gene of the target gene, thereby modulating expression or activity of an endogenous cytokine, wherein expression or activity of the endogenous cytokine is under control of the first gene and the second gene, the first gene and the second gene being different.

In some embodiments of any of the systems disclosed herein, the actuating portion comprises a nucleic acid-guided actuating portion, and wherein the system further comprises a guide nucleic acid complexed with the actuating portion. In some embodiments of any of the systems disclosed herein, the system further comprises two or more guide nucleic acids having complementarity to different portions of the target gene. In some embodiments of any of the systems disclosed herein, the guide nucleic acid comprises a guide ribonucleic acid (RNA).

In some embodiments of any of the systems disclosed herein, the cells are caused to exhibit an alteration in the expression or activity of an endogenous cytokine of at least 20% as compared to control cells. In some embodiments of any of the systems disclosed herein, the expression level of a cell exhibiting a different endogenous cytokine is increased by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%.

In some embodiments of any of the systems disclosed herein, the different endogenous cytokines comprise an Interferon (IFN) selected from the group consisting of IFN- α (α), IFN- β (β), IFN- κ (κ), IFN- δ (δ), IFN- ε (ε), IFN- τ (τ), IFN- ω (ω), IFN- ζ (ζ), IFN- γ (γ), and IFN- λ (λ). In some embodiments of any of the systems disclosed herein, the different endogenous cytokines comprise IFN- γ (γ).

In some embodiments of any of the systems disclosed herein, the different endogenous cytokines comprise Tumor Necrosis Factor (TNF) protein selected from tnfβ, tnfα, tnfγ, CD252 (OX 40 ligand), CD154 (CD 40 ligand), CD178 (Fas ligand), CD70 (CD 27 ligand), CD153 (CD 30 ligand), 4-1BBL (CD 137 ligand), CD253 (TRAIL), CD254 (RANKL), APO-3L (TWEAK), CD256 (APRIL), CD257 (BAFF), CD258 (LIGHT), TL1 (VEGI), GITRL (TNFSF 18), and ectodermal dysplasia protein a. In some embodiments of any of the systems disclosed herein, the different endogenous cytokines comprise tnfα.

In some embodiments of any of the systems disclosed herein, the expression level of a cell exhibiting a different endogenous cytokine is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

In some embodiments of any of the systems disclosed herein, the different endogenous cytokine is not IL-12. In some embodiments of any of the systems disclosed herein, the different endogenous cytokine is not IL-21. In some embodiments of any of the systems disclosed herein, the different endogenous cytokines comprise IL-2.

In some embodiments of any of the systems disclosed herein, the increase in cytotoxicity to the target cell population is determined by a decrease in the size of the target cell population by at least 20%, at least 30%, at least 40%, at least 50%, or at least 60%.

In some embodiments of any of the systems disclosed herein, the target cell population comprises diseased cells and the ligand is an antigen of the diseased cells. In some embodiments of any of the systems disclosed herein, the diseased cell comprises a cancer cell or a tumor cell.

In some embodiments of any of the systems disclosed herein, the increase in proliferation is determined by an increase in the size of the target cell population of at least 20%, at least 30%, at least 40%, at least 60%, at least 80%, or at least 100%.

In some embodiments of any of the systems disclosed herein, the tumor size is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% as compared to a control.

In some embodiments of any of the systems disclosed herein, the actuating moiety comprises an effector domain configured to regulate expression of the target gene. In some embodiments of any of the systems disclosed herein, the effector domain is selected from a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain. In some embodiments of any of the systems disclosed herein, the effector domain is a transcriptional activation domain. In some embodiments of any of the systems disclosed herein, the effector domain is a transcriptional repression domain.

In some embodiments of any of the systems disclosed herein, the actuating moiety comprises a heterologous endonuclease or variant thereof. In some embodiments of any of the systems disclosed herein, the modification is a conformational change or a chemical modification.

In some embodiments of any of the systems disclosed herein, the cell is an immune cell. In some embodiments of any of the systems disclosed herein, the cell is a T cell or NK cell.

In one aspect, the present disclosure provides an engineered cell population comprising any of the systems disclosed herein. In some embodiments of any of the engineered cell populations disclosed herein, the population comprises engineered immune cells. In some embodiments of any of the engineered immune cell populations disclosed herein, the population comprises engineered T cells.

In one aspect, the present disclosure provides a composition comprising any of the engineered cell populations disclosed herein. In some embodiments of any of the compositions disclosed herein, the composition further comprises a co-therapeutic agent.

In one aspect, the present disclosure provides a system comprising a guide-nucleic acid molecule designed to bind to a target polynucleotide sequence of an Interleukin (IL) gene of a cell, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the IL gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the IL gene, and wherein the guide-nucleic acid molecule is heterologous to the cell. In some embodiments of any of the systems disclosed herein, the guide-nucleic acid molecule is capable of recruiting an activating moiety to a target polynucleotide sequence of an IL gene to regulate expression or activity of the IL, and wherein the system further comprises an activating moiety.

In one aspect, the present disclosure provides a system comprising an actuation portion of a target polynucleotide sequence of an Interleukin (IL) gene capable of binding to a cell, wherein the target polynucleotide sequence (i) comprises at least a portion of a transcription initiation site (TSS) of the IL gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the IL gene, and wherein the actuation portion is heterologous to the cell.

In some embodiments of any of the systems disclosed herein, the actuating moiety comprises a heterologous endonuclease or variant thereof.

In some embodiments of any of the systems disclosed herein, the IL gene is endogenous to the cell. In some embodiments of any of the systems disclosed herein, the TSS is endogenous to the cell.

In some embodiments of any of the systems disclosed herein, the IL is selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36. In any of the embodiments of the system disclosed herein, IL is IL-12. In any of the embodiments of the system disclosed herein, IL is IL-12A and/or IL-12B. In some embodiments of any of the systems disclosed herein, the IL is IL-21.

In some embodiments of any of the systems disclosed herein, the system further comprises (i) a first guide nucleic acid molecule designed to bind to a first portion of the TSS and (ii) a second guide nucleic acid molecule designed to bind to a second portion of the TSS. In some embodiments of any of the systems disclosed herein, the system comprises (i) a first nucleic acid molecule that is designed to bind a first target polynucleotide sequence of an IL gene (e.g., an IL-12A gene) and (ii) a second nucleic acid molecule that is designed to bind a second target polynucleotide sequence of a target polynucleotide sequence of an IL gene (e.g., an IL-12B gene). In some embodiments of any of the systems disclosed herein, the guide nucleic acid molecule comprises a guide ribonucleic acid (RNA).

In some embodiments of any of the systems disclosed herein, the TSS has at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity with SEQ ID No. 1. In some embodiments of any of the systems disclosed herein, the TSS has at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity with SEQ ID No. 2.

In some embodiments of any of the systems disclosed herein, the cell is an immune cell. In some embodiments of any of the systems disclosed herein, the cell is a T cell or NK cell.

In one aspect, the present disclosure provides an engineered cell population comprising any of the systems disclosed herein. In some embodiments of any of the engineered cell populations disclosed herein, the population comprises engineered immune cells. In some embodiments of any of the engineered immune cell populations disclosed herein, the population comprises engineered T cells.

In one aspect, the present disclosure provides a composition comprising any of the engineered cell populations disclosed herein. In some embodiments of any of the compositions disclosed herein, the composition further comprises a co-therapeutic agent.

In one aspect, the present disclosure provides a method for modulating expression or activity of an endogenous cytokine in a cell, comprising: (a) exposing the cells to an external stimulus; and (b) forming a complex between the activating moiety and a target gene encoding an endogenous cytokine in response to exposure to an external stimulus to regulate expression or activity of the endogenous cytokine, thereby causing the cell to exhibit one or more characteristics selected from the group consisting of: (i) The expression or activity of the endogenous cytokine is altered by at least 20% as compared to a control; (ii) The expression or activity of a different endogenous cytokine of the cell is altered by at least 20% compared to a control; (iii) Enhanced cytotoxicity to the target cell population, as determined by a reduction in the size of the target cell population of at least 20% compared to the control; (iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising cells; (v) tumor size is reduced compared to control.

In some embodiments of any of the methods disclosed herein, the external stimulus is a ligand, and (a) comprises exposing the chimeric receptor polypeptide (receptor) to the ligand to cause modification of the receptor. In some embodiments of any of the methods disclosed herein, (b) comprises activating the actuation moiety via (1) releasing the actuation moiety from the substrate or (2) modifying the actuation moiety.

In some embodiments of any of the methods disclosed herein, the cell is caused to exhibit two or more of (i) to (v). In some embodiments of any one of the methods disclosed herein, the cell is caused to exhibit three or more of (i) to (v). In some embodiments of any one of the methods disclosed herein, the cell is caused to exhibit four or more of (i) to (v). In some embodiments of any of the methods disclosed herein, the cell is caused to exhibit all of (i) to (v).

In some embodiments of any of the methods disclosed herein, the cells are caused to exhibit an increase in the expression level of the endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% as compared to control cells.

In some embodiments of any of the methods disclosed herein, the endogenous cytokine comprises an Interleukin (IL) selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36. In any of the methods disclosed herein in some embodiments, the endogenous cytokine comprises IL-12. In some embodiments of any of the methods disclosed herein, the target gene comprises a first gene encoding IL-12A (p 35) and a second gene encoding IL-12B (p 40). In some embodiments of any of the methods disclosed herein, the endogenous cytokine comprises IL-21.

In some embodiments of any of the methods disclosed herein, the actuating moiety is capable of complexing with a target polynucleotide sequence that (i) comprises at least a portion of a Transcription Start Site (TSS) of the target gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the target gene.

In some embodiments of any of the methods disclosed herein, (b) further comprises (1) complexing a first activating moiety of the activating moiety with a first gene of the target gene, and (2) complexing a second activating moiety of the activating moiety with a second gene of the target gene, thereby modulating expression or activity of the endogenous cytokine, wherein the expression or activity of the endogenous cytokine is under control of the first gene and the second gene, the first gene and the second gene being different.

In some embodiments of any of the methods disclosed herein, the actuating portion comprises a nucleic acid-guided actuating portion, and wherein the system further comprises a guide nucleic acid complexed with the actuating portion. In some embodiments of any of the methods disclosed herein, the system further comprises two or more guide nucleic acids having complementarity to different portions of the target gene. In some embodiments of any of the methods disclosed herein, the guide nucleic acid comprises a guide ribonucleic acid (RNA).

In some embodiments of any of the methods disclosed herein, the cell is caused to exhibit an alteration in the expression or activity of an endogenous cytokine of at least 20% as compared to a control cell. In some embodiments of any of the methods disclosed herein, the expression level of a cell exhibiting a different endogenous cytokine is increased by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%.

In some embodiments of any of the methods disclosed herein, the different endogenous cytokines comprise an Interferon (IFN) selected from the group consisting of IFN- α (α), IFN- β (β), IFN- κ (κ), IFN- δ (δ), IFN- ε (ε), IFN- τ (τ), IFN- ω (ω), IFN- ζ (ζ), IFN- γ (γ), and IFN- λ (λ). In some embodiments of any of the methods disclosed herein, the different endogenous cytokines comprise IFN- γ (γ).

In some embodiments of any of the methods disclosed herein, the different endogenous cytokines comprise a Tumor Necrosis Factor (TNF) protein selected from the group consisting of tnfβ, tnfα, tnfγ, CD252 (OX 40 ligand), CD154 (CD 40 ligand), CD178 (Fas ligand), CD70 (CD 27 ligand), CD153 (CD 30 ligand), 4-1BBL (CD 137 ligand), CD253 (TRAIL), CD254 (RANKL), APO-3L (TWEAK), CD256 (APRIL), CD257 (BAFF), CD258 (LIGHT), TL1 (VEGI), GITRL (TNFSF 18), and ectodermal dysplasia protein a. In some embodiments of any of the methods disclosed herein, the different endogenous cytokines comprise tnfα.

In some embodiments of any of the methods disclosed herein, the expression level of a cell exhibiting a different endogenous cytokine is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

In any of the methods disclosed herein in some embodiments, the different endogenous cytokine is not IL-12. In some embodiments of any of the methods disclosed herein, the different endogenous cytokine is not IL-21. In some embodiments of any of the methods disclosed herein, the different endogenous cytokines comprise IL-2.

In some embodiments of any of the methods disclosed herein, the increase in cytotoxicity to the target cell population is determined by a decrease in the size of the target cell population by at least 20%, at least 30%, at least 40%, at least 50%, or at least 60%.

In some embodiments of any of the methods disclosed herein, the target cell population comprises diseased cells and the ligand is an antigen of the diseased cells. In some embodiments of any of the methods disclosed herein, the diseased cell comprises a cancer cell or a tumor cell.

In some embodiments of any of the methods disclosed herein, the increase in proliferation is determined by an increase in the size of the target cell population of at least 20%, at least 30%, at least 40%, at least 60%, at least 80%, or at least 100%.

In some embodiments of any of the methods disclosed herein, the tumor size is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% as compared to a control.

In some embodiments of any of the methods disclosed herein, the actuating moiety comprises an effector domain configured to regulate expression of the target gene. In some embodiments of any of the methods disclosed herein, the effector domain is selected from a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain. In some embodiments of any of the methods disclosed herein, the effector domain is a transcriptional activation domain. In some embodiments of any of the methods disclosed herein, the effector domain is a transcriptional repression domain.

In some embodiments of any of the methods disclosed herein, the actuating moiety comprises a heterologous endonuclease or variant thereof.

In some embodiments of any of the methods disclosed herein, the modification is a conformational change or a chemical modification.

In some embodiments of any of the methods disclosed herein, the cell is an immune cell. In some embodiments of any of the methods disclosed herein, the cell is a T cell or NK cell.

In some embodiments of any of the methods disclosed herein, the method further comprises administering the cell to a subject in need thereof. In some embodiments of any of the methods disclosed herein, the cell is autologous or allogenic to the subject.

In some embodiments of any of the methods disclosed herein, the method further comprises administering to the subject a co-therapeutic agent.

In some embodiments of any of the methods disclosed herein, the subject is a mammal. In some embodiments of any of the methods disclosed herein, the subject is a human.

Other aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments and its several details are capable of modification in various obvious respects, all without departing from the present disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.

Incorporation by reference

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. If a publication or patent application, which is incorporated by reference, contradicts the disclosure contained in this specification, this specification is intended to supercede and/or take precedence over any such contradictory material.

Drawings

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also referred to herein as "figures") of which:

figures 1A-1D schematically illustrate the release of an actuation moiety from GMP in a system comprising a receptor undergoing phosphorylation; figures 1E-1H schematically illustrate the release of an actuation moiety from GMP in a system comprising a receptor undergoing a conformational change.

Figures 2A-2D schematically illustrate release of an activating moiety from GMP in different systems comprising a receptor undergoing phosphorylation following ligand binding; figures 2E-2H schematically illustrate the release of an actuation moiety from GMP in a system comprising a receptor undergoing a conformational change.

Figures 3A-3D schematically illustrate release of an activating moiety from GMP in a system comprising at least two adaptor polypeptides and a receptor undergoing phosphorylation; figures 3E-3H schematically illustrate release of an activating moiety from GMP in a system comprising at least two adaptor polypeptides and a receptor undergoing conformational change.

Figure 4 schematically illustrates the conditionally inducible expression of an actuating moiety via chimeric receptor signaling.

Figure 5 schematically illustrates background secretion of Interleukin (IL) -12 by Chimeric Antigen Receptor (CAR) signaling in immune cells.

FIG. 6 schematically illustrates an expression cassette encoding at least a CAR, an actuating portion, and/or one or more guide-nucleic acid molecules capable of binding to the IL-12 gene.

Figures 7A-7D show enhancement of endogenous IL-12 secretion (figures 7A and 7B) and endogenous ifnγ secretion (figures 7C and 7D) in two different human CAR T cells after activation of the CAR T cells by antigen presenting beads.

FIG. 8 shows the effect of different combinations of guide molecules on conditional expression of endogenous IL-2.

FIG. 9A shows cancer cell-mediated activation of CAR T cells, which enhances expression of endogenous IL-12 and endogenous IFNγ; FIG. 9B shows a control setting using cancer cells engineered to constitutively express IL-12.

FIG. 10A shows cytotoxicity and proliferation of tumor cells of a CAR T cell after the CAR T cell conditionally expresses endogenous IL-12; FIG. 10B shows a control setting using cancer cells engineered to constitutively express IL-12.

Figures 11A-11D show the expression profile of CAR T cells for different cytokines after binding of the CAR to a specific ligand to conditionally induce expression of endogenous IL-12.

Figures 12A-12D show tumor cytotoxicity of CAR T cells and enhancement of proliferation of CAR T cells after binding of CAR to specific ligand to conditionally induce expression of endogenous IL-12.

FIGS. 13A and 13B illustrate different screening methods for identifying guide nucleic acid molecules directed against IL-12 to regulate the expression level of IL-12.

FIG. 14A shows the region of the IL-12B (P40) gene targeted by the guide molecule (bottom) (green arrow), and the relative expression level of the guide molecule for IL-12B.

FIG. 14B shows the region of the IL-12A (P35) gene targeted by the guide molecule (bottom) (green arrow), and the relative expression levels of the guide molecule to IL-12 heterodimer (P70).

FIGS. 15 and 16 show the relative expression levels of the activating moiety and one or more guide-nucleic acid molecules directed against the IL-12A gene and/or the IL-12B gene for IL-12 heterodimers.

FIG. 17 shows an example of a guide nucleic acid molecule directed against the IL-21 gene and the relative expression levels of IL-21 after activation by the guide nucleic acid molecule.

Detailed Description

While various embodiments of the present application have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Many changes, modifications and substitutions will now occur to those skilled in the art without departing from the application. It should be understood that various alternatives to the embodiments of the application described herein may be employed.

As used in the specification and in the claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

The term "about" or "approximately" generally refers to an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean within 1 or more than 1 standard deviation, as practiced in the art. Alternatively, "about" may refer to a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term may refer to within an order of magnitude, preferably within a factor of 5, and more preferably within a factor of 2. Where specific values are described in the present disclosure and claims, unless otherwise stated, the term "about" shall be assumed to mean within an acceptable error range for the specific value.

The use of alternatives (e.g., "or") should be understood to mean either, both, or any combination thereof. The term "and/or" should be understood to mean either or both of the alternatives.

The term "cell" generally refers to a biological cell. The cells may be the basic structure, function and/or biological unit of a living organism. The cells may be derived from any organism having one or more cells. Some non-limiting examples include: prokaryotic cells, eukaryotic cells, bacterial cells, archaebacterial cells, cells of unicellular eukaryotic organisms, protozoal cells, cells from plants (e.g., from plant crops, fruits, vegetables, grains, soybeans, corn, maize, wheat, seeds, tomatoes, rice, tapioca, sugarcane, pumpkin, hay, potatoes, cotton, hemp, tobacco, flowering plants, conifers, gymnosperms, ferns, pinus, hornworts, bryophytes), algal cells (e.g., botrytis (Botryococcus braunii), chlamydomonas (Chlamydomonas reinhardtii), nannochloropsis (Nannochloropsis gaditana), pyrenoidosa (Chlorella pyrenoidosa), sargassum (Sargassum) c. Agadh), seaweed (e.g., kelp), fungal cells (e.g., yeast cells, cells from mushrooms), animal cells, cells from invertebrates (e.g., birds, spines, echinoderms, nematodes, etc.), cells from vertebrates (e.g., fish, amphibians, rodents, rats, humans, mice, etc.), cells from mammals, such as described herein, rats, humans, mice, etc. Sometimes the cells are not derived from a natural organism (e.g., the cells may be synthetically prepared, sometimes referred to as artificial cells).

The terms "hematopoietic stem cells", "hematopoietic progenitor cells" or "hematopoietic precursor cells" are used interchangeably herein to generally refer to cells that are committed to the hematopoietic lineage but are capable of further hematopoietic differentiation (e.g., differentiation into T cells), and include multipotent hematopoietic stem cells (hematopoietic cells), myeloid progenitor cells, megakaryocyte progenitor cells, erythroid progenitor cells, and lymphoid progenitor cells. Hematopoietic Stem Cells (HSCs) are multipotent stem cells that produce all blood cell types including: myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T cells, B cells, NK cells).

The term "immune cells" or "lymphocytes" generally refers to differentiated hematopoietic cells. Non-limiting examples of immune cells may include T cells, NK cells, monocytes, congenital lymphocytes, tumor-infiltrating lymphocytes, macrophages, granulocytes, and the like.

The term "nucleotide" as used herein generally refers to a base-sugar-phosphate combination. The nucleotides may comprise synthetic nucleotides. The nucleotide may comprise a synthetic nucleotide analogue. Nucleotides may be monomeric units of nucleic acid sequences, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term nucleotide may include ribonucleoside triphosphates (adenosine triphosphate (ATP), uridine Triphosphate (UTP), cytosine Triphosphate (CTP), guanosine Triphosphate (GTP)) and deoxyribonucleoside triphosphates (e.g., dATP, dCTP, dITP, dUTP, dGTP, dTTP or derivatives thereof). Such derivatives may include, for example, [ αS ] dATP, 7-deaza-dGTP and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance on nucleic acid molecules containing them. The term nucleotide as used herein may refer to dideoxyribonucleoside triphosphates (ddntps) and derivatives thereof. Illustrative examples of dideoxyribonucleoside triphosphates can include, but are not limited to ddATP, ddCTP, ddGTP, ddITP and ddTTP. The nucleotides may be unlabeled or detectably labeled by well-known techniques. Marking can also be performed with quantum dots. Detectable labels may include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels. Fluorescent labels for nucleotides may include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7' -dimethoxy-4 ' 5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N, N, N ', N ' -tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-Rhodamine (ROX), 4- (4 ' -dimethylaminophenylazo) benzoic acid (DABCYL), cascade blue, oregon green, texas red, cyanine, and 5- (2 ' -aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS). Specific examples of the fluorescent-labeled nucleotide may include [ R6G ] dUTP, [ TAMRA ] dUTP, [ R110] dCTP, [ R6G ] dCTP, [ TAMRA ] dCTP, [ JOE ] ddATP, [ R6G ] ddATP, [ FAM ] ddCTP, [ R110] ddCTP, [ TAMRA ] ddGTP, [ ROX ] ddTTP, [ dR6G ] ddATP, [ dR110] ddCTP, [ dTARRA ] ddGTP and [ dROX ] ddTTP, available from Perkin Elmer, foster City, calif.; fluoLink deoxynucleotides FluoLink Cy3-dCTP, fluoLink Cy5-dCTP, fluoroLink Fluor X-dCTP, fluoLink Cy3-dUTP and FluoLink Cy5-dUTP available from Amersham, arlington Heights, ill; fluorescein-15-dATP, fluorescein-12-dUTP, tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP and fluorescein-15-2' -dATP, available from Boehringer Mannheim, indianapolis, ind; and chromosome-labeled nucleotides BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, cascading blue-7-UTP, cascading blue-7-dUTP, fluorescein-12-UTP, fluorescein-12-dUTP, oreg green 488-5-dUTP, rhodamine green-5-dUTP, tetramethylrhodamine-6-UTP, tetramethylrhodamine-6-dUTP, texas red-5-UTP, texas red-5-dUTP, and Texas red-12-dUTP available from Molecular Probes, eugene, oreg. Nucleotides may also be labeled or tagged by chemical modification. The chemically modified single nucleotide may be biotin-dNTP. Some non-limiting examples of biotinylated dNTPs may include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).

The terms "polynucleotide", "oligonucleotide" or "nucleic acid" are used interchangeably herein to refer generally to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or analogs thereof, whether in single-stranded, double-stranded or multi-stranded form. The polynucleotide may be exogenous or endogenous to the cell. The polynucleotide may be present in a cell-free environment. The polynucleotide may be a gene or fragment thereof. The polynucleotide may be DNA. The polynucleotide may be RNA. Polynucleotides may have any three-dimensional structure and may perform any known or unknown function. Polynucleotides may comprise one or more analogs (e.g., altered backbones, sugars, or nucleobases). In the case where modification is present, the nucleotide structure may be modified before or after assembly of the polymer. Some non-limiting examples of analogs include: 5-bromouracil, peptide nucleic acids, xenogenic nucleic acids, morpholinos, locked nucleic acids, ethylene glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to sugars), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, cpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, braided and huperzian. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci defined by linkage analysis (loci or locus), exons, introns, messenger RNAs (mRNA), transfer RNAs (tRNA), ribosomal RNAs (rRNA), short interfering RNAs (siRNA), short hairpin RNAs (shRNA), micrornas (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers. The sequence of nucleotides may be interrupted by non-nucleotide components.

The term "gene" as used herein refers to nucleic acids (e.g., DNA, such as genomic DNA and cDNA) and their corresponding nucleotide sequences that are involved in encoding RNA transcripts. The term as used herein with respect to genomic DNA includes intervening non-coding regions as well as regulatory regions, and may include both 5 'and 3' ends. In some uses, the term encompasses transcribed sequences, including the 5 'and 3' untranslated regions (5 '-UTR and 3' -UTR), exons, and introns. In some genes, the transcribed region will contain an "open reading frame" encoding the polypeptide. In some uses of this term, a "gene" comprises only the coding sequences (e.g., an "open reading frame" or "coding region") necessary to encode a polypeptide. In some cases, the gene does not encode a polypeptide, such as a ribosomal RNA (rRNA) gene and a transfer RNA (tRNA) gene. In some cases, the term "gene" includes not only transcribed sequences, but also non-transcribed regions, including upstream and downstream regulatory regions, enhancers, and promoters. A gene may refer to an "endogenous gene" or a native gene in its natural location in the genome of an organism. Genes may be referred to as "exogenous genes" or non-native genes. Non-native genes may refer to genes that are not normally present in the host organism, but are introduced into the host organism by gene transfer. Non-native genes may also refer to genes that are not in their native location in the genome of an organism. Non-native genes may also refer to naturally occurring nucleic acid or polypeptide sequences (e.g., non-native sequences) that comprise mutations, insertions, and/or deletions.

The term "transfection" or "transfected" refers to the introduction of a nucleic acid into a cell by a non-viral or viral-based method. The nucleic acid molecule may be a gene sequence encoding the complete protein or a functional part thereof.

The term "expression" refers to one or more processes by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and/or by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides may be collectively referred to as "gene products". If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells. With respect to expression, "up-regulated" generally refers to an increase in the level of expression of a polynucleotide (e.g., RNA, such as mRNA) and/or polypeptide sequence relative to its level of expression in a wild-type state, while "down-regulated" generally refers to a decrease in the level of expression of a polynucleotide (e.g., RNA, such as mRNA) and/or polypeptide sequence relative to its level of expression in a wild-type state. Expression of the transfected gene may occur transiently or stably in the cell. During "transient expression", the transfected gene will not transfer into daughter cells during cell division. Since its expression is limited to transfected cells, the expression of the gene will disappear over time. In contrast, stable expression of the transfected gene occurs when the gene is co-transfected with another gene that confers a selective advantage on the transfected cell. Such selection advantage may be against certain toxins presented to the cells.

The terms "expression cassette", "expression construct" or "expression vector" refer to a nucleic acid comprising nucleotide sequences, such as coding sequences and template sequences, as well as sequences necessary for expression of the coding sequences. The expression cassette may be viral or non-viral. For example, an expression cassette includes a nucleic acid construct that, when introduced into a host cell, results in transcription and/or translation of RNA or polypeptide, respectively. The definition explicitly includes untranslated or untranslated antisense constructs or sense constructs. Those skilled in the art will recognize that the inserted polynucleotide sequence need not be identical to the gene sequence from which it is derived but may be only substantially similar.

"plasmid" as used herein generally refers to a non-viral expression vector, e.g., a nucleic acid molecule encoding a gene and/or regulatory elements necessary for gene expression. As used herein, "viral vector" generally refers to a virus-derived nucleic acid capable of transporting another nucleic acid into a cell. When present in a suitable environment, the viral vector is capable of directing the expression of one or more proteins encoded by one or more genes carried by the vector. Examples of viral vectors include, but are not limited to, retroviral vectors, adenoviral vectors, lentiviral vectors, and adeno-associated viral vectors.

The term "promoter" as used herein refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell. Thus, promoters used in the polynucleotide constructs of the present disclosure include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or regulating the timing and/or rate of gene transcription. For example, a promoter may be a cis-acting transcriptional control element involved in transcriptional regulation, including enhancers, promoters, transcriptional terminators, origins of replication, chromosomal integration sequences, 5 'and 3' untranslated regions, or intron sequences. These cis-acting sequences typically interact with proteins or other biomolecules to perform (turn on/off, regulate, modulate, etc.) gene transcription. A "constitutive promoter" is a promoter capable of initiating transcription in almost all tissue types, whereas a "tissue-specific promoter" initiates transcription in only one or a few specific tissue types. An "inducible promoter" is a promoter that initiates transcription only under specific environmental conditions, developmental conditions, or pharmaceutical or chemical conditions.

The terms "complementary", "complementary" and "complementarity" as used herein generally refer to sequences that are fully complementary to a given sequence and that are hybridizable. In some cases, a sequence that hybridizes to a given nucleic acid is said to be "complementary" or "reverse complement" of the given molecule if the base sequence of the sequence that hybridizes to the given nucleic acid is capable of complementary binding to the base sequence of its binding partner at a given region such that, for example, A-T, A-U, G-C and G-U base pairs are formed. In general, a first sequence that hybridizes to a second sequence can specifically or selectively hybridize to the second sequence such that hybridization to the second sequence or set of second sequences is preferred over hybridization to a non-target sequence during a hybridization reaction (e.g., thermodynamically more stable under a given set of conditions such as the stringent conditions commonly used in the art). Typically, the hybridizable sequences share a degree of sequence complementarity, such as 25% -100% complementarity, including at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence complementarity, between all or a portion of their respective lengths. Sequence identity, as for the purpose of assessing percent complementarity, may be measured by any suitable alignment algorithm, including, but not limited to, the Needleman-Wunsch algorithm (see, e.g., the embos Needle aligners available at www.ebi.ac.uk/Tools/psa/embos_needle/nucleic acid. Html, optionally using default settings), the BLAST algorithm (see, e.g., the BLAST alignment Tools available at BLAST. Ncbi. Nrm. Nih. Gov/BLAST. Cgi, optionally using default settings), or the Smith-Waterman algorithm (see, e.g., the embos Water aligners available at www.ebi.ac.uk/Tools/psa/embos_water/nucleic acid. Html, optionally using default settings). Any suitable parameters of the selected algorithm (including default parameters) may be used to evaluate the optimal alignment.

Complementarity may be complete or substantial/sufficient. Complete complementarity between two nucleic acids may mean that the two nucleic acids may form a duplex, wherein each base in the duplex binds to a complementary base through Watson-Crick pairing. Substantial or sufficient complementarity may mean that the sequence in one strand is incomplete and/or incompletely complementary to the sequence in the opposite strand, but that sufficient binding occurs between the bases on both strands under the set of hybridization conditions (e.g., salt concentration and temperature) to form a stable hybrid complex. Such conditions may be predicted by predicting Tm of the hybridized strand using sequences and standard mathematical calculations or empirically determining Tm using conventional methods.

The terms "peptide", "polypeptide" or "protein" are used interchangeably herein to refer generally to a polymer of at least two amino acid residues joined by peptide bonds. The term does not denote a particular length of polymer nor is it intended to suggest or distinguish whether the peptide was produced using recombinant techniques, chemical or enzymatic synthesis or naturally occurring. The term applies to naturally occurring amino acid polymers and amino acid polymers comprising at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acids. The term includes amino acid chains of any length, including full-length proteins as well as proteins with or without secondary and/or tertiary structures (e.g., domains). The term also encompasses amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation to a labeling component. The term "amino acid" as used herein generally refers to natural and unnatural amino acids, including but not limited to modified amino acids and amino acid analogs. Modified amino acids may include natural amino acids and unnatural amino acids that have been chemically modified to include groups or chemical moieties that do not naturally occur on the amino acid. Amino acid analogs may refer to amino acid derivatives. The term "amino acid" includes D-amino acids and L-amino acids.

The term "derivative", "variant" or "fragment" as used herein with respect to a polypeptide generally refers to a polypeptide that is related to a wild-type polypeptide, e.g., in terms of amino acid sequence, structure (e.g., secondary and/or tertiary), activity (e.g., enzymatic activity), and/or function. Derivatives, variants, and fragments of the polypeptides may comprise one or more amino acid changes (e.g., mutations, insertions, and deletions), truncations, modifications, or combinations thereof, as compared to the wild-type polypeptide.

The term "gene-regulatory polypeptide" or "GMP" as used herein refers to a polypeptide comprising an activating portion capable of modulating at least the expression or activity of a gene and/or editing a nucleic acid sequence. GMP may comprise additional peptide sequences not involved in regulating gene expression, e.g. cleavage recognition sites, linker sequences, targeting sequences, etc.

The terms "actuating portion," "actuating domain," and "gene regulatory domain" as used herein refer to a portion, whether exogenous or endogenous, that can regulate expression or activity of a gene and/or edit a nucleic acid sequence. The actuating moiety can regulate gene expression at the transcriptional and/or translational level. The activating moiety can regulate gene expression at the transcriptional level, for example, by regulating production of mRNA from DNA (e.g., chromosomal DNA or cDNA). In some embodiments, the activating moiety recruits at least one transcription factor that binds to a specific DNA sequence, thereby controlling the rate of transcription of genetic information from DNA to mRNA. The actuating moiety itself can bind to DNA and regulate transcription by physical obstruction, e.g., preventing proteins (e.g., RNA polymerase) and other related proteins from being assembled on the DNA template. The actuating moiety can regulate gene expression at the translational level, for example, by regulating the production of a protein from an mRNA template. In some embodiments, the activating moiety modulates gene expression by affecting the stability of mRNA transcripts. In some embodiments, the actuating portion modulates expression of a gene by editing a nucleic acid sequence (e.g., a region of a genome). In some embodiments, the actuating moiety modulates expression of the gene by editing the mRNA template. In some cases, editing the nucleic acid sequence may alter the potential template for gene expression.

The term "targeting sequence" as used herein refers to a nucleotide sequence and corresponding amino acid sequence encoding a targeting polypeptide that mediates localization (or retention) of a protein to a subcellular location, such as the plasma membrane or membrane of a given organelle, nucleus, cytosol, mitochondria, endoplasmic Reticulum (ER), golgi apparatus, chloroplast, apoplast, peroxisome, or other organelle. For example, the targeting sequence can utilize a Nuclear Localization Signal (NLS) to direct a protein (e.g., a receptor polypeptide or an adapter polypeptide) to the nucleus; directing the protein out of the nucleus of the cell, for example to the cytoplasm, using a Nuclear Export Signal (NES); directing the protein to mitochondria using a mitochondrial targeting signal; directing the protein to the Endoplasmic Reticulum (ER) using an ER retention signal; directing the protein to the peroxisome using a peroxisome targeting signal; directing the protein to the plasma membrane using the membrane localization signal; or a combination thereof.

As used herein, "fusion" may refer to a protein and/or nucleic acid comprising one or more non-native sequences (e.g., portions). A fusion may comprise one or more identical non-native sequences. The fusion may comprise one or more different non-native sequences. The fusion may be a chimeric. The fusion may comprise a nucleic acid affinity tag. The fusion may comprise a barcode. The fusion may comprise a peptide affinity tag. The fusion can provide subcellular localization of the site-directed polypeptide (e.g., nuclear Localization Signal (NLS) for targeting to the nucleus, mitochondrial localization signal for targeting to mitochondria, chloroplast localization signal for targeting to chloroplasts, endoplasmic Reticulum (ER) retention signal, etc.). The fusion may provide a non-native sequence (e.g., an affinity tag) that can be used for tracking or purification. The fusion may be a small molecule such as biotin or a dye (e.g., alexa fluor dye, cyanine 3 dye, cyanine 5 dye).

Fusion may refer to any protein having a functional effect. For example, the fusion protein may comprise methyltransferase activity, demethylase activity, disproportionation enzyme activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photo-or glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, threylation activity, deglutination activity, ribosylation activity, myristoylation activity, remodeling activity, protease activity, oxidoreductase activity, transferase activity, hydrolase activity, lyase activity, isomerase activity, synthase activity or myristoylation activity. Effector proteins may modify genomic sites. The fusion protein may be a fusion in a Cas protein. The fusion protein may be a non-native sequence in the Cas protein.

"non-native" as used herein may refer to a nucleic acid or polypeptide sequence that is not present in a native nucleic acid or protein. Non-natural may refer to an affinity tag. Non-natural may refer to fusion. Non-naturally may refer to naturally occurring nucleic acid or polypeptide sequences that comprise mutations, insertions, and/or deletions. The non-native sequence may exhibit and/or encode an activity (e.g., enzymatic activity, methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitination activity, etc.), which may also be exhibited by the nucleic acid and/or polypeptide sequence to which the non-native sequence is fused. The non-native nucleic acid or polypeptide sequence may be genetically engineered to join to a naturally occurring nucleic acid or polypeptide sequence (or variant thereof) to produce a chimeric nucleic acid and/or polypeptide sequence encoding the chimeric nucleic acid and/or polypeptide.

The term "antibody" generally refers to a protein binding molecule having immunoglobulin-like functions. The term antibody includes antibodies (e.g., monoclonal and polyclonal antibodies), and derivatives, variants, and fragments thereof. Antibodies include, but are not limited to, immunoglobulins (Ig) of different classes (i.e., igA, igG, igM, igD and IgE) and subclasses (e.g., igG1, igG2, etc.). A derivative, variant, or fragment thereof may refer to a functional derivative or fragment that retains the binding specificity (e.g., whole and/or part) of the corresponding antibody. Antigen binding fragments include Fab, fab ', F (ab') 2, variable fragments (Fv), single chain variable fragments (scFv), minibodies, diabodies, and single domain antibodies ("sdabs" or "nanobodies" or "camelidaes"). The term antibody includes antibodies and antigen-binding fragments of antibodies that have been optimized, engineered or chemically conjugated. Examples of antibodies that have been optimized include affinity matured antibodies. Examples of antibodies that have been engineered include Fc-optimized antibodies (e.g., antibodies optimized in the fragment crystallizable region) and multispecific antibodies (e.g., bispecific antibodies).

The term "antigen binding portion" or "antigen binding domain" as used interchangeably herein generally refers to a construct that exhibits preferential binding to a specific target antigen. The antigen binding domain may be a polypeptide construct, such as an antibody, a modification thereof, a fragment thereof, or a combination thereof. The antigen binding domain may be any antibody or functional variant thereof disclosed herein. Non-limiting examples of antigen binding domains may include murine antibodies, human antibodies, humanized antibodies, camelid igs, shark pure heavy chain antibodies (VNARs), ig NARs, chimeric antibodies, recombinant antibodies, or antibody fragments thereof. Non-limiting examples of antibody fragments include Fab, fab ', F (ab) '2, F (ab) '3, fv, single chain antigen binding fragment (scFv), (scFv) 2, disulfide stabilized Fv (dsFv), minibodies, diabodies, triabodies, tetrabodies, single domain antigen binding fragments (sdabs, nanobodies), recombinant pure heavy chain antibodies (VHHs), and other antibody fragments that retain the binding specificity of the whole antibody.

The terms "enhanced activity", "increased activity", or "up-regulated activity" generally refer to the modification of the activity of a portion of interest (e.g., a polynucleotide or polypeptide) to a level that is higher than the normal activity level of the portion of interest in a host strain (e.g., host cell). The normal activity level may be substantially zero (or null) or above zero. The target moiety may comprise a polypeptide construct of the host strain. The target moiety may comprise a heterologous polypeptide construct introduced into or into the host strain. For example, a heterologous gene encoding a polypeptide of interest may be knocked-in (KI) into the genome of a host strain to enhance the activity of the polypeptide of interest in the host strain.

The terms "reduced activity", "reduced activity" or "down-regulated activity" generally refer to a modification of the activity of a portion of interest (e.g., a polynucleotide or polypeptide) to a level that is lower than the normal activity level of the portion of interest in a host strain (e.g., host cell). Normal activity levels are above zero. The target portion may comprise an endogenous gene or polypeptide construct of the host strain. In some cases, the target moiety may be knocked out or knocked down in the host strain. In some examples, the reduction in activity of the target moiety may include completely inhibiting such activity in the host strain.

The terms "subject," "individual," and "patient" are used interchangeably herein to refer generally to a vertebrate, preferably a mammal, such as a human. Mammals include, but are not limited to, mice, apes, humans, farm animals, sports animals, and pets. Tissues, cells, and their progeny of biological entities obtained in vivo or cultured in vitro are also contemplated.

The term "treatment" generally refers to a method for achieving a beneficial or desired result, including but not limited to a therapeutic benefit and/or a prophylactic benefit. For example, treatment may include administration of a system or cell population as disclosed herein. Therapeutic benefit refers to any treatment-related improvement or effect on one or more diseases, conditions or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more physiological symptoms of the disease, even though the disease, condition, or symptom may not have yet developed.

"administration" and derivatives thereof as used herein refers to methods that may be used to enable delivery of a pharmaceutical agent or composition to a desired biological site of action. These methods include, but are not limited to, parenteral administration (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intravascular, intrathecal, intranasal, intravitreal, infusion and local injection), transmucosal injection, oral administration, administration as suppositories, and topical administration. Administration is by any route, including parenteral administration. Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intraventricular and intracranial. Other modes of delivery include, but are not limited to, use of liposomal formulations, intravenous infusion, transplantation, and the like.

The term "effective amount" or "therapeutically effective amount" generally refers to an amount (e.g., one or more unit doses) of a composition (e.g., a composition disclosed herein) that is sufficient to produce a desired activity upon administration to a subject in need thereof. In the context of the present disclosure, the term "therapeutically effective" generally refers to an amount of a composition sufficient to delay the manifestation of, inhibit the progression of, alleviate or mitigate at least one symptom of a disorder treated by the methods of the present disclosure.

I. Introduction to the invention

Immune cells (e.g., T cells, NK cells) can be engineered to exhibit specific affinity for one or more specific antigens (e.g., cancer or tumor antigens) for adoptive immunotherapy for treating cancer (e.g., solid tumors, lymphomas, etc.). In some cases, immune cells can be engineered to express a heterologous receptor (e.g., a chimeric antigen receptor or "CAR") capable of binding to one or more specific antigens, thereby targeting cancer cells of a subject. However, the therapeutic efficacy of engineered immune cells may be limited, for example, by: poor trafficking, limited persistence in serum of the subject, or inhibitory activity of cancer cells or immune cells of the subject on engineered immune cells.

In some cases, a number of recombinant cytokines (e.g., interleukins or "ILs") can be administered to a subject along with engineered immune cells to improve their efficacy (e.g., cytotoxic activity, persistence, proliferation). However, co-administration of such recombinant cytokines may also exhibit undesirable adverse effects, such as reduced blood volume, nausea, liver dysfunction, systemic toxicity, and even death.

Thus, there remains a significant unmet need to control the expression or activity of cytokines (e.g., endogenous cytokines) to enhance the efficacy of adoptive immunotherapy for treating cancer but to suppress or reduce the extent of adverse reactions.

Systems for gene regulation

In one aspect, the present disclosure provides a system for conditionally modulating expression or activity of an endogenous protein of a cell. The system may comprise an actuating moiety capable of complexing with a target gene encoding an endogenous protein disclosed herein to regulate expression or activity of the endogenous protein. The actuation moiety may be activated upon an external stimulus (e.g., binding of a cell to a specific ligand). In some cases, the endogenous protein may be an endogenous cytokine. In some cases, the endogenous protein may be a protein involved in immune cell regulation (e.g., T cell or NK cell regulation). In some cases, endogenous cytokines may be examples of proteins involved in immune cell regulation.

In some cases, activation of the actuation portion may include modification (e.g., conformational change, chemical modification) of the actuation portion. In some cases, activation of the actuation portion may include releasing the actuation portion from a substrate (e.g., a polypeptide substrate). In such cases, the actuating portion may not be activated upon binding to the substrate.

In one aspect, the present disclosure provides a system for conditionally modulating expression or activity of an endogenous protein of a cell. The system may comprise a chimeric receptor polypeptide (receptor) that undergoes modification upon binding to a ligand. The system may comprise an actuating moiety capable of complexing with a target gene encoding an endogenous protein disclosed herein to regulate expression or activity of the endogenous protein. The actuating moiety may be activated after modification of the receptor. In some cases, the endogenous protein may be an endogenous cytokine.

In some cases, the receptor may comprise an antigen binding portion capable of specifically binding to at least one ligand (e.g., at least 1, 2, 3, 4, 5, or more ligands). The antigen binding moiety may be (a) monovalent or multivalent, and (B) monospecific or multispecific.

In some cases, following receptor modification, the activating moiety may be activated to modulate expression or activity of an endogenous protein (e.g., an endogenous cytokine) such that the cell exhibits one or more of the following characteristics: (i) The expression or activity of an endogenous protein (e.g., an endogenous cytokine) is altered by at least 20% as compared to a control; (ii) The expression or activity of a different endogenous protein (e.g., a different endogenous cytokine) of the cell is altered by at least 20% as compared to the control; (iii) Enhanced cytotoxicity to the target cell population, as determined by a reduction in the size of the target cell population of at least 20% compared to the control; (iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising the cells as compared to a control; or (v) a decrease in tumor size compared to a control. In some examples, the cells may be caused to exhibit two or more of (i) to (v). In some examples, the cells may be caused to exhibit three or more of (i) to (v). In some examples, the cells may be caused to exhibit four or more of (i) to (v). In some cases, the cells may be caused to exhibit all of (i) to (v). In some examples, the cells may be caused to exhibit one or more of (i) and (ii), (iii), (iv) and/or (v). In some examples, the cell may be caused to exhibit two or more of (i) and (ii), (iii), (iv) and/or (v). In some examples, the cell may be caused to exhibit three or more of (i) and (ii), (iii), (iv) and/or (v). In some examples, the cells may be caused to exhibit one or more of (ii) and (i), (iii), (iv) and/or (v). In some examples, the cell may be caused to exhibit two or more of (ii) and (i), (iii), (iv) and/or (v). In some examples, the cell may be caused to exhibit three or more of (ii) and (i), (iii), (iv) and/or (v). In some examples, the cells may be caused to exhibit one or more of (iii) and (ii), (i), (iv) and/or (v). In some examples, the cell may be caused to exhibit two or more of (iii) and (ii), (i), (iv) and/or (v). In some examples, the cell may be caused to exhibit three or more of (iii) and (ii), (i), (iv) and/or (v). In some examples, the cells may be caused to exhibit one or more of (iv) and (ii), (iii), (i) and/or (v). In some examples, the cell may be caused to exhibit two or more of (iv) and (ii), (iii), (i) and/or (v). In some examples, the cell may be caused to exhibit three or more of (iv) and (ii), (iii), (i) and/or (v). In some examples, the cells may be caused to exhibit one or more of (v) and (ii), (iii), (iv) and/or (i). In some examples, the cells may be caused to exhibit two or more of (v) and (ii), (iii), (iv) and/or (i). In some examples, the cell may be caused to exhibit three or more of (v) and (ii), (iii), (iv) and/or (i). In some examples, the cell may be caused to exhibit (i). In some examples, the cells may be caused to exhibit (ii). In some examples, the cell may be caused to exhibit (iii). In some examples, the cell may be caused to exhibit (iv). In some examples, the cells may be caused to exhibit (v).

In some cases, the actuation portion may be activated without a signaling pathway involving one or more transcription factors (e.g., endogenous transcription factors). Alternatively, the activating moiety may be activated via a signaling pathway involving one or more transcription factors (e.g., endogenous transcription factors).

In some cases, a target gene disclosed herein can be an endogenous gene. Alternatively or additionally, the target gene may be a heterologous gene encoding an endogenous protein (e.g., an endogenous cytokine). For example, the heterologous gene may comprise the native amino acid sequence of the endogenous protein.

In some cases, the activating moiety disclosed herein (e.g., an activating moiety that is part of a gene-regulatory polypeptide or GMP) can be heterologous to the cell. GMP may be a substrate and activating the actuation moiety may include releasing the actuation moiety from GMP after receptor modification, as disclosed herein. GMP may be part of a larger protein (e.g., a receptor polypeptide or an adaptor polypeptide as disclosed herein).

In some cases, the actuating moiety disclosed herein may be capable of complexing with an endogenous promoter of a target gene. In some cases, the actuation moiety disclosed herein may be capable of complexing with a target polynucleotide sequence of a target gene. In some cases, the actuating moiety disclosed herein may be capable of complexing with an intron of a target gene. In some cases, the actuating moiety disclosed herein may be capable of complexing with an exon of a target gene.

The target polynucleotide sequences of the target genes disclosed herein may comprise at least a portion of the transcription initiation site (TSS) of the target genes. The target polynucleotide sequence of the target gene may comprise at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of the TSS of the target gene. The target polynucleotide sequence of the target gene may comprise up to about 100%, up to about 99%, up to about 98%, up to about 97%, up to about 96%, up to about 95%, up to about 90%, up to about 85%, up to about 80%, up to about 75%, up to about 70%, up to about 65%, up to about 60%, up to about 55%, up to about 50%, up to about 40%, up to about 30%, up to about 20%, up to about 15%, up to about 10%, up to about 5% or less of the TSS of the target gene. Alternatively or additionally, the target polynucleotide sequence of the target gene may be up to about 20,000 bases, up to about 10,000 bases, up to about 9,000 bases, up to about 8,000 bases, up to about 7,000 bases, up to about 6,000 bases, up to about 5,000 bases, up to about 4,000 bases, up to about 3,000 bases, up to about 2,500 bases, up to about 2,000 bases, up to about 1,900 bases, up to about 1,800 bases, up to about 1,700 bases, up to about 1,600 bases, up to about 1,500 bases, up to about 1,400 bases, up to about 1,300 bases, up to about 1,200 bases, up to about 1,100 bases, up to about 1,000 bases, up to about 900 bases, up to about 800 bases, up to about 700 bases, up to about 600 bases, up to about 500 bases, up to about 450 bases, up to about 400 bases, up to about 350 bases, up to about 300 bases, up to about 200 bases, up to about 150 bases, or more upstream of the target gene (e.g., about the number of the TSS). At least a portion of the target polynucleotide sequence of the target gene may be downstream of the target gene TSS. Alternatively or in addition, at least a portion of the target polynucleotide sequence of the target gene may be upstream of the target gene TSS. In some examples, multiple target polynucleotide sequences in a target gene can be utilized by the systems and methods disclosed herein (e.g., in combination with the actuating portions disclosed herein), and the multiple target polynucleotide sequences can comprise one or more members (e.g., 1 member, 2 members, or all 3 members) selected from the group consisting of: (1) a target polynucleotide sequence at least partially downstream of the TSS of the target gene, (2) a target polynucleotide sequence at least partially upstream of the TSS of the target gene, and (3) the TSS of the target gene.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 10,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 10,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be from about 10,000 bases to about 9,000 bases, from about 10,000 bases to about 8,000 bases, from about 10,000 bases to about 7,000 bases, from about 10,000 bases to about 6,000 bases, from about 10,000 bases to about 5,000 bases, from about 10,000 bases to about 4,000 bases, from about 10,000 bases to about 3,000 bases, from about 10,000 bases to about 2,000 bases, from about 10,000 bases to about 1,000 bases, from about about 10,000 bases to about 500 bases, about 10,000 bases to about 1 base, about 9,000 bases to about 8,000 bases, about 9,000 bases to about 7,000 bases, about 9,000 bases to about 6,000 bases, about 9,000 bases to about 5,000 bases, about 9,000 bases to about 4,000 bases, about 9,000 bases to about 3,000 bases, about 9,000 bases to about 2,000 bases, about 9,000 bases to about 1,000 bases, about 9,000 bases, about about 9,000 bases to about 500 bases, about 9,000 bases to about 1 base, about 8,000 bases to about 7,000 bases, about 8,000 bases to about 6,000 bases, about 8,000 bases to about 5,000 bases, about 8,000 bases to about 4,000 bases, about 8,000 bases to about 3,000 bases, about 8,000 bases to about 2,000 bases, about 8,000 bases to about 1,000 bases, about 8,000 bases to about 500 bases, about 8,000 bases to about 1 base, about 8,000 bases, about about 7,000 bases to about 6,000 bases, about 7,000 bases to about 5,000 bases, about 7,000 bases to about 4,000 bases, about 7,000 bases to about 3,000 bases, about 7,000 bases to about 2,000 bases, about 7,000 bases to about 1,000 bases, about 7,000 bases to about 500 bases, about 7,000 bases to about 1 base, about 6,000 bases to about 5,000 bases, about 6,000 bases to about 4,000 bases, about 6,000 bases to about 3,000 bases, about, about 6,000 bases to about 2,000 bases, about 6,000 bases to about 1,000 bases, about 6,000 bases to about 500 bases, about 6,000 bases to about 1 base, about 5,000 bases to about 4,000 bases, about 5,000 bases to about 3,000 bases, about 5,000 bases to about 2,000 bases, about 5,000 bases to about 1,000 bases, about 5,000 bases to about 500 bases, about 5,000 bases to about 1 base, about 4,000 bases to about 3,000 bases, about 4,000 bases to about 2,000 bases about 4,000 bases to about 1,000 bases, about 4,000 bases to about 500 bases, about 4,000 bases to about 1 base, about 3,000 bases to about 2,000 bases, about 3,000 bases to about 1,000 bases, about 3,000 bases to about 500 bases, about 3,000 bases to about 1 base, about 2,000 bases to about 1,000 bases, about 2,000 bases to about 500 bases, about 2,000 bases to about 1 base, about 1,000 bases to about 500 bases, about 1,000 bases to about 1,000 bases, about 1,000 bases to about 1 base, or about 500 bases to about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 10,000 bases, about 9,000 bases, about 8,000 bases, about 7,000 bases, about 6,000 bases, about 5,000 bases, about 4,000 bases, about 3,000 bases, about 2,000 bases, about 1,000 bases, about 500 bases, or about 1 base.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 5,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 5,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be from about 5,000 bases to about 4,500 bases, from about 5,000 bases to about 4,000 bases, from about 5,000 bases to about 3,500 bases, from about 5,000 bases to about 3,000 bases, from about 5,000 bases to about 2,500 bases, from about 5,000 bases to about 2,000 bases, from about 5,000 bases to about 1,500 bases, from about 5,000 bases to about 1,000 bases, from about 5,000 bases to about 500 bases, from about 5,000 bases, from about about 5,000 bases to about 100 bases, about 5,000 bases to about 1 base, about 4,500 bases to about 4,000 bases, about 4,500 bases to about 3,500 bases, about 4,500 bases to about 3,000 bases, about 4,500 bases to about 2,500 bases, about 4,500 bases to about 2,000 bases, about 4,500 bases to about 1,500 bases, about 4,500 bases to about 1,000 bases, about 4,500 bases to about 500 bases, about 4,500 bases to about 100 bases, about about 4,500 bases to about 1 base, about 4,000 bases to about 3,500 bases, about 4,000 bases to about 3,000 bases, about 4,000 bases to about 2,500 bases, about 4,000 bases to about 2,000 bases, about 4,000 bases to about 1,500 bases, about 4,000 bases to about 1,000 bases, about 4,000 bases to about 500 bases, about 4,000 bases to about 100 bases, about 4,000 bases to about 1 base, about 3,500 bases to about 3,000 bases, about 3,500 bases to about 2,500 bases, about 3,500 bases to about 2,000 bases, about 3,500 bases to about 1,000 bases, about 3,500 bases to about 1,500 bases, about 3,500 bases to about 100 bases, about 3,500 bases to about 1,500 bases, about 3,000 bases to about 2,000 bases, about 2,500 bases, about 3,500 bases to about 2,500 bases, about 3,000 bases to about 1,000 bases, about 3,000 bases to about 500 bases, about 3,000 bases to about 100 bases, about 3,000 bases to about 1 base, about 2,500 bases to about 2,000 bases, about 2,500 bases to about 1,500 bases, about 2,500 bases to about 1,000 bases, about 2,500 bases to about 500 bases, about 2,500 bases to about 100 bases, about 2,500 bases to about 1 base, about 2,000 bases to about 1,500 bases, about 2,000 bases to about 1,000 bases, about 2,000 bases to about 100 bases, about 2,000 bases to about 1 base, about 1,000 bases, about 1,500 bases to about 1,500 bases, about 1,500 bases to about 500 bases, about 1,500 bases to about 1,500 bases, about 1,000 bases to about 1,000 bases, about 1,000 bases to about 1,000 bases, or about 1,000 bases to about 1,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 5,000 bases, about 4,500 bases, about 4,000 bases, about 3,500 bases, about 3,000 bases, about 2,500 bases, about 2,000 bases, about 1,500 bases, about 1,000 bases, about 500 bases, about 100 bases, or about 1 base.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 2,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 2,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be from about 2,000 bases to about 1,800 bases, from about 2,000 bases to about 1,600 bases, from about 2,000 bases to about 1,400 bases, from about 2,000 bases to about 1,200 bases, from about 2,000 bases to about 1,000 bases, from about 2,000 bases to about 800 bases, from about 2,000 bases to about 600 bases, from about 2,000 bases to about 400 bases, from about 2,000 bases to about 200 bases, from about 2,000 bases to about 1 base, from about 1,800 bases to about 1,600 bases, from about 1,800 bases to about 1,400 bases, from about 1,800 bases to about 1,200 bases, from about 1,800 bases to about 1,000 bases, from about 1,800 bases to about 800 bases, from about 1,800 bases to about 600 bases, from about 1,000 bases, from about 1,800 bases to about 600 bases, from about 1,800 bases to about 400 bases, from about 1,800 bases to about 1,800 bases, from about 1,800 bases to about 1,800 bases, from about 1,800 bases. About 1,600 bases to about 1,200 bases, about 1,600 bases to about 1,000 bases, about 1,600 bases to about 800 bases, about 1,600 bases to about 600 bases, about 1,600 bases to about 400 bases, about 1,600 bases to about 200 bases, about 1,600 bases to about 1 base, about 1,400 bases to about 1,200 bases, about 1,400 bases to about 1,000 bases, about 1,400 bases to about 800 bases, about 1,400 bases to about 600 bases, about about 1,400 bases to about 400 bases, about 1,400 bases to about 200 bases, about 1,400 bases to about 1 base, about 1,200 bases to about 1,000 bases, about 1,200 bases to about 800 bases, about 1,200 bases to about 600 bases, about 1,200 bases to about 400 bases, about 1,200 bases to about 200 bases, about 1,200 bases to about 1 base, about 1,000 bases to about 800 bases, about, about 1,000 bases to about 600 bases, about 1,000 bases to about 400 bases, about 1,000 bases to about 200 bases, about 1,000 bases to about 1 base, about 800 bases to about 600 bases, about 800 bases to about 400 bases, about 800 bases to about 200 bases, about 800 bases to about 1 base, about 600 bases to about 400 bases, about 600 bases to about 200 bases, about 600 bases to about 1 base, about 400 bases to about 200 bases, about 400 bases to about 1 base, or about 200 bases to about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 2,000 bases, about 1,800 bases, about 1,600 bases, about 1,400 bases, about 1,200 bases, about 1,000 bases, about 800 bases, about 600 bases, about 400 bases, about 200 bases, or about 1 base.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 1,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 1,000 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be from about 1,000 bases to about 900 bases, from about 1,000 bases to about 800 bases, from about 1,000 bases to about 700 bases, from about 1,000 bases to about 600 bases, from about 1,000 bases to about 500 bases, from about 1,000 bases to about 400 bases, from about 1,000 bases to about 300 bases, from about 1,000 bases to about 200 bases, from about 1,000 bases to about 100 bases, from about 1,000 bases to about 1 base, from about 900 bases to about 800 bases, from about 900 bases to about 700 bases, from about 900 bases to about 600 bases, from about 900 bases to about 500 bases, from about 900 bases to about 400 bases, from about 900 bases to about 300 bases, from about 900 bases to about 200 bases, from about 900 bases to about 100 bases, from about 1,000 bases to about 1 base, from about 900 bases, from about 1,000 bases to about 1 base, from about 800 bases, from about 900 bases to about 700 bases, from about 900 bases to about 600 bases, from about 900 bases to about 500 bases, from about 900 bases to about 500 bases, from about 300 bases. About 800 bases to about 700 bases, about 800 bases to about 600 bases, about 800 bases to about 500 bases, about 800 bases to about 400 bases, about 800 bases to about 300 bases, about 800 bases to about 200 bases, about 800 bases to about 100 bases, about 800 bases to about 1 base, about 700 bases to about 600 bases, about 700 bases to about 500 bases, about 700 bases to about 400 bases, about 700 bases to about 300 bases, about 700 bases to about 200 bases, about 700 bases to about 100 bases, about 700 bases to about 1 base, about 600 bases to about 500 bases, about 600 bases to about 400 bases, about 600 bases to about 300 bases, about 600 bases to about 200 bases, about 600 bases to about 100 bases, about 600 bases to about 1 base, about 500 bases to about 400 bases, about, about 500 bases to about 300 bases, about 500 bases to about 200 bases, about 500 bases to about 100 bases, about 500 bases to about 1 base, about 400 bases to about 300 bases, about 400 bases to about 200 bases, about 400 bases to about 100 bases, about 400 bases to about 1 base, about 300 bases to about 200 bases, about 300 bases to about 100 bases, about 300 bases to about 1 base, about 200 bases to about 100 bases, about 200 bases to about 1 base, or about 100 bases to about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 1,000 bases, about 900 bases, about 800 bases, about 700 bases, about 600 bases, about 500 bases, about 400 bases, about 300 bases, about 200 bases, about 100 bases, or about 1 base.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 500 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 500 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be from about 500 bases to about 450 bases, from about 500 bases to about 400 bases, from about 500 bases to about 350 bases, from about 500 bases to about 300 bases, from about 500 bases to about 250 bases, from about 500 bases to about 200 bases, from about 500 bases to about 150 bases, from about 500 bases to about 100 bases, from about 500 bases to about 50 bases, from about 500 bases to about 1 base, from about 450 bases to about 400 bases, from about 450 bases to about 350 bases, from about 450 bases to about 300 bases, from about 450 bases to about 250 bases, from about 450 bases to about 200 bases, from about 450 bases to about 150 bases, from about 450 bases to about 100 bases, from about 450 bases to about 50 bases, from about 450 bases to about 1 base, from about 400 bases to about 350 bases about 400 bases to about 300 bases, about 400 bases to about 250 bases, about 400 bases to about 200 bases, about 400 bases to about 150 bases, about 400 bases to about 100 bases, about 400 bases to about 50 bases, about 400 bases to about 1 base, about 350 bases to about 300 bases, about 350 bases to about 250 bases, about 350 bases to about 200 bases, about 350 bases to about 150 bases, about 350 bases to about 100 bases, about 350 bases to about 50 bases, about 350 bases to about 1 base, about 300 bases to about 250 bases, about 300 bases to about 200 bases, about 300 bases to about 150 bases, about 300 bases to about 100 bases, about 300 bases to about 50 bases, about 300 bases to about 1 base, about 250 bases to about 200 bases, about, about 250 bases to about 150 bases, about 250 bases to about 100 bases, about 250 bases to about 50 bases, about 250 bases to about 1 base, about 200 bases to about 150 bases, about 200 bases to about 100 bases, about 200 bases to about 50 bases, about 200 bases to about 1 base, about 150 bases to about 100 bases, about 150 bases to about 50 bases, about 150 bases to about 1 base, about 100 bases to about 50 bases, about 100 bases to about 1 base, or about 50 bases to about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 500 bases, about 450 bases, about 400 bases, about 350 bases, about 300 bases, about 250 bases, about 200 bases, about 150 bases, about 100 bases, about 50 bases, or about 1 base.

In some cases, the distance between the target polynucleotide sequence of the target gene (e.g., the central nucleobase of the target polynucleotide sequence) and the TSS of the target gene (e.g., the central nucleobase of the TSS) can be about 1 base to about 250 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be at least about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene may be up to about 250 bases. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be from about 250 bases to about 225 bases, from about 250 bases to about 200 bases, from about 250 bases to about 175 bases, from about 250 bases to about 150 bases, from about 250 bases to about 125 bases, from about 250 bases to about 100 bases, from about 250 bases to about 75 bases, from about 250 bases to about 50 bases, from about 250 bases to about 25 bases, from about 250 bases to about 1 base, from about 225 bases to about 200 bases, from about 225 bases to about 175 bases, from about 225 bases to about 150 bases, from about 225 bases to about 125 bases, from about 225 bases to about 100 bases, from about 225 bases to about 75 bases, from about 225 bases to about 50 bases, from about 225 bases to about 25 bases, from about 225 bases to about 1 base, from about 200 bases to about 175 bases about 200 bases to about 150 bases, about 200 bases to about 125 bases, about 200 bases to about 100 bases, about 200 bases to about 75 bases, about 200 bases to about 50 bases, about 200 bases to about 25 bases, about 200 bases to about 1 base, about 175 bases to about 150 bases, about 175 bases to about 125 bases, about 175 bases to about 100 bases, about 175 bases to about 75 bases, about 175 bases to about 50 bases, about 175 bases to about 25 bases, about 175 bases to about 1 base, about 150 bases to about 125 bases, about 150 bases to about 100 bases, about 150 bases to about 75 bases, about 150 bases to about 50 bases, about 150 bases to about 25 bases, about 150 bases to about 1 base, about 125 bases, about 100 bases, about 125 bases, about 125 bases to about 75 bases, about 125 bases to about 50 bases, about 125 bases to about 25 bases, about 125 bases to about 1 base, about 100 bases to about 75 bases, about 100 bases to about 50 bases, about 100 bases to about 25 bases, about 100 bases to about 1 base, about 75 bases to about 50 bases, about 75 bases to about 25 bases, about 75 bases to about 1 base, about 50 bases to about 25 bases, about 50 bases to about 1 base, or about 25 bases to about 1 base. The distance between the target polynucleotide sequence of the target gene and the TSS of the target gene can be about 250 bases, about 225 bases, about 200 bases, about 175 bases, about 150 bases, about 125 bases, about 100 bases, about 75 bases, about 50 bases, about 25 bases, or about 1 base.

In some cases, the cell may not contain a heterologous gene encoding a protein (e.g., an endogenous cytokine). Alternatively or additionally, the cell may not comprise a heterologous gene encoding an endogenous protein receptor.

In some cases, the endogenous protein (e.g., endogenous cytokine) may be a secreted protein.

In some cases, the cells may be caused to exhibit an alteration in the expression or activity level of an endogenous protein (e.g., an endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, the cells may be caused to exhibit an increase in the expression or activity level of an endogenous protein (e.g., an endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, the cells can be caused to exhibit a reduction in the expression or activity level of an endogenous protein (e.g., an endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, a change (e.g., an increase, decrease) in the expression or activity level of an endogenous protein (e.g., an endogenous cytokine) can be observed after at least or up to about 6 hours, at least or up to about 12 hours, at least or up to about 18 hours, at least or up to about 24 hours, at least or up to about 2 days, at least or up to about 3 days, at least or up to about 4 days, at least or up to about 5 days, at least or up to about 6 days, at least or up to about 7 days, at least or up to about 2 weeks, at least or up to about 3 weeks, or at least or up to about 4 weeks of the receptor modification disclosed herein as compared to a control cell.

In some cases, the alteration (e.g., increase, decrease) in the expression or activity level of an endogenous protein (e.g., an endogenous cytokine) can occur in vitro, ex vivo, or in vivo (or can be observed in vitro, ex vivo, or in vivo).

In some cases, an endogenous protein disclosed herein (e.g., an endogenous cytokine) can comprise an Interleukin (IL). In some cases, the endogenous cytokine may comprise one or more members selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36. In some cases, endogenous cytokines can include at least a portion of IL-12. In some cases, the target gene can comprise a first gene encoding IL-12A (p 35) or a second gene encoding IL-12B (p 40). In some cases, the target gene can comprise a first gene encoding IL-12A (p 35) and a second gene encoding IL-12B (p 40). In some cases, the endogenous cytokine may comprise at least a portion of IL-21. In some cases, endogenous cytokines may not, and need not be, IL-2, IL-6, and/or IL-8.

In some cases, cells can be caused to exhibit at least 20% increase in the expression or activity of IL-12 (e.g., IL-12A and/or IL-12B) and/or IL-21 as compared to a control.

In some cases, (1) a first actuating portion of the actuating portion may be capable of complexing with a first gene of the target gene, and (2) a second actuating portion of the actuating portion may be capable of complexing with a second gene of the target gene, thereby modulating expression or activity of an endogenous cytokine, wherein expression or activity of the endogenous cytokine may be under control of the first gene and the second gene, the first gene and the second gene being different.

In some cases, (i) the first gene may encode a first polypeptide of an endogenous cytokine, and (ii) the second gene may encode a second portion of an endogenous cytokine. In some cases, the first portion and the second portion may be capable of complexing with each other to form at least a portion of an endogenous cytokine. Alternatively, the first gene and the second gene may be different portions of the promoter of the target gene, or may be different promoters of the target gene.

In some examples, the first gene may encode a first portion of an endogenous cytokine (e.g., IL-12A) and the second gene may encode a second portion of an endogenous cytokine (e.g., IL-12B).

In some cases, the actuation portion may comprise a nucleic acid guided actuation portion. In some cases, the system may further comprise a guide nucleic acid complexed with the actuation portion. In some cases, the system further comprises two or more guide nucleic acids (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more guide nucleic acids) that have complementarity to different portions of the target gene. In some cases, a guide disclosed herein can comprise a guide ribonucleic acid (RNA). In some examples, the cells disclosed herein can comprise (1) a first guide nucleic acid (e.g., a first guide RNA) capable of binding to a first gene encoding a first portion of an endogenous cytokine (e.g., IL-12A) and (2) a second guide nucleic acid (e.g., a second guide RNA) capable of binding to a second gene encoding a second portion of an endogenous cytokine (e.g., IL-12B).

In some cases, the cells may be caused to exhibit an alteration in the expression or activity level of a different endogenous protein (e.g., a different endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, the cells may be caused to exhibit an increase in expression or activity level of a different endogenous protein (e.g., a different endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, the cells may be caused to exhibit a reduction in expression or activity level of a different endogenous protein (e.g., a different endogenous cytokine) by at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000%, or at least or up to about 5,000% as compared to a control cell.

In some cases, a change (e.g., an increase, decrease) in expression or activity level of a different endogenous protein (e.g., a different endogenous cytokine) as compared to a control cell can be observed after at least or up to about 6 hours, at least or up to about 12 hours, at least or up to about 18 hours, at least or up to about 24 hours, at least or up to about 2 days, at least or up to about 3 days, at least or up to about 4 days, at least or up to about 5 days, at least or up to about 6 days, at least or up to about 7 days, at least or up to about 2 weeks, at least or up to about 3 weeks, or at least or up to about 4 weeks of the receptor modification disclosed herein.

In some cases, the alteration (e.g., increase, decrease) in the expression or activity level of a different endogenous protein (e.g., a different endogenous cytokine) can occur in vitro, ex vivo, or in vivo (or can be observed in vitro, ex vivo, or in vivo).

In some cases, the different endogenous cytokines may comprise IFN. In some cases, the different endogenous cytokines may be selected from IFN- α (α), IFN- β (β), IFN- κ (κ), IFN- δ (δ), IFN- ε (ε), IFN- τ (τ), IFN- ω (ω), IFN- ζ (ζ), IFN- γ (γ), and IFN- λ (λ). In some cases, the different endogenous cytokines may comprise IFN- γ (γ). In some cases, the cells may be caused to exhibit an increase in the expression or activity level of IFN (e.g., IFN-gamma).

In some cases, the different endogenous cytokines may comprise TNF proteins. In some cases, the different endogenous cytokines may be selected from tnfβ, tnfα, tnfγ, CD252 (OX 40 ligand), CD154 (CD 40 ligand), CD178 (Fas ligand), CD70 (CD 27 ligand), CD153 (CD 30 ligand), 4-1BBL (CD 137 ligand), CD253 (TRAIL), CD254 (RANKL), APO-3L (TWEAK), CD256 (APRIL), CD257 (BAFF), CD258 (LIGHT), TL1 (VEGI), GITRL (TNFSF 18), and ectodermal dysplasia protein a. In some cases, the different endogenous cytokines may comprise tnfα. In some cases, the cells may be caused to exhibit an increase in the expression or activity level of TNF (e.g., tnfα).

In some cases, the different endogenous cytokines can comprise an IL (e.g., different IL). In some cases, the different endogenous cytokine may be IL-2. In some cases, the different endogenous cytokine may not be and need not be IL-12. In some cases, the different endogenous cytokine may not be and need not be IL-21. In some cases, cells can be caused to exhibit a reduction in the expression or activity level of a different IL (e.g., IL-2). In some examples, cells can be caused to exhibit (1) an increase in the expression or activity level of an endogenous IL (e.g., IL-12 or IL-21) and (2) a decrease in the expression or activity level of a different endogenous IL (e.g., IL-2).

In some cases, the increase in cytotoxicity to the target cell population can be determined by a decrease in the size of the target cell population of at least or up to about 20%, at least or up to about 25%, at least or up to about 30%, at least or up to about 35%, at least or up to about 40%, at least or up to about 45%, at least or up to about 50%, at least or up to about 55%, at least or up to about 60%, at least or up to about 65%, at least or up to about 70%, at least or up to about 75%, at least or up to about 80%, at least or up to about 85%, at least or up to about 90%, or at least or up to about 95%.

In some cases, an increase in cytotoxicity of the subject disclosure to a target cell population can be observed after at least or up to about 6 hours, at least or up to about 12 hours, at least or up to about 18 hours, at least or up to about 24 hours, at least or up to about 2 days, at least or up to about 3 days, at least or up to about 4 days, at least or up to about 5 days, at least or up to about 7 days, at least or up to about 2 weeks, at least or up to about 3 weeks, at least or up to about 4 weeks, at least or up to about 1 month, at least or up to about 2 months, at least or up to about 3 months, at least or up to about 4 months, at least or up to about 5 months, or at least or up to about 6 months of the subject modification.

In some cases, the enhanced cytotoxicity to the target cell population disclosed herein can occur in vitro, ex vivo, or in vivo (or can be observed in vitro, ex vivo, or in vivo).

In some cases, the ligands disclosed herein may be antigens of diseased cells. In some cases, a target cell population disclosed herein can comprise diseased cells. In some cases, a diseased cell disclosed herein may comprise a cancer cell or a tumor cell.

In some cases, the increase in proliferation of a cell may be determined by an increase in the size of a cell population comprising the cell of at least or up to about 20%, at least or up to about 30%, at least or up to about 40%, at least or up to about 50%, at least or up to about 60%, at least or up to about 70%, at least or up to about 80%, at least or up to about 90%, at least or up to about 100%, at least or up to about 200%, at least or up to about 300%, at least or up to about 400%, at least or up to about 500%, at least or up to about 600%, at least or up to about 700%, at least or up to about 800%, at least or up to about 900%, at least or up to about 1,000%, at least or up to about 2,000%, at least or up to about 3,000%, at least or up to about 4,000% or at least or up to about 5,000%.

In some cases, an increase in proliferation of a cell or population of cells comprising a cell disclosed herein can be observed after at least or up to about 6 hours, at least or up to about 12 hours, at least or up to about 18 hours, at least or up to about 24 hours, at least or up to about 2 days, at least or up to about 3 days, at least or up to about 4 days, at least or up to about 5 days, at least or up to about 6 days, at least or up to about 7 days, at least or up to about 2 weeks, at least or up to about 3 weeks, at least or up to about 4 weeks, or at least or up to about 1 month of the receptor modification disclosed herein.

In some cases, the enhancement of proliferation of a cell or population of cells comprising a cell disclosed herein can occur in vitro, ex vivo, or in vivo (or can be observed in vitro, ex vivo, or in vivo).

In some cases, the size of a tumor (e.g., a solid tumor) of a subject can be reduced by at least or up to about 5%, at least or up to about 10%, at least or up to about 15%, at least or up to about 20%, at least or up to about 25%, at least or up to about 30%, at least or up to about 35%, at least or up to about 40%, at least or up to about 45%, at least or up to about 50%, at least or up to about 55%, at least or up to about 60%, at least or up to about 65%, at least or up to about 70%, at least or up to about 75%, at least or up to about 80%, at least or up to about 85%, at least or up to about 90%, or at least or up to about 95%.

In some cases, a decrease in tumor size may occur (or may be observed) after at least or up to about 24 hours, at least or up to about 2 days, at least or up to about 3 days, at least or up to about 4 days, at least or up to about 5 days, at least or up to about 6 days, at least or up to about 7 days, at least or up to about 2 weeks, at least or up to about 3 weeks, at least or up to about 4 weeks, at least or up to about 1 month, at least or up to about 2 months, at least or up to about 3 months, at least or up to about 4 months, at least or up to about 5 months, or at least or up to about 6 months of the receptor modifications disclosed herein.

In some cases, the cells may be Hematopoietic Stem Cells (HSCs). In some cases, the cells may be immune cells (lymphocytes). In some cases, the immune cells may be selected from T cells, NK cells, monocytes, congenital lymphocytes, tumor-infiltrating lymphocytes, macrophages, and granulocytes.

In some cases, a control disclosed herein may be a control cell that does not comprise one or more of the following: (i) a functional chimeric receptor polypeptide, (ii) a functional actuation moiety, (iii) a functional guide nucleic acid sequence (e.g., a functional guide RNA) designed to target a target gene, (iv) a chimeric adapter polypeptide operatively coupled to the chimeric receptor polypeptide (as discussed below). In some cases, the cells may utilize a guide nucleic acid sequence, and the control cells may contain a control nucleic acid sequence that is not designed to complex with the target gene. In some cases, the cell can utilize two different guide sequences (e.g., one for IL-12A, another for IL-12B, two for IL-21, etc.), and the control cell can contain no or only one of the two different guide sequences.

In some cases, the systems of the present disclosure may enhance the immune response of a subject. Non-limiting immune response enhancements may include an increase in cd4+ helper T cell activity and the generation of cytolytic T cells. Enhancement of the immune response may be assessed using a number of in vitro or in vivo measurements known to those of skill in the art, including but not limited to cytotoxic T lymphocyte assays, cytokine release (e.g., production of IL-12, IL-2, or IFN- γ). Tumor regression, tumor-bearing animal survival, antibody production, immune cell proliferation, expression of cell surface markers, and cytotoxicity.

In some cases, the regulated expression and/or activity of a protein disclosed herein (e.g., an endogenous cytokine) can be determined by a number of methods via Western blot or Polymerase Chain Reaction (PCR) techniques, including, but not limited to, (I) phosphorylation of downstream signaling proteins (e.g., either (a) TYK2, JAK2, or STAT4 for IL-12 signaling, (B) JAK1, JAK2, STAT1, STAT2, or STAT3 for IL-21 signaling, (c) JAK1, JAK2, or STAT3 for IFN- γ signaling, (d) PI3K, akt, ikb kinase, STAT5, etc. for tnfα signaling, or (ii) expression of downstream genes (e.g., IFN- γ or tnfα).

In one aspect, the present disclosure provides a population of cells comprising any of the systems disclosed herein. In some cases, the population of cells may comprise engineered immune cells. In some cases, the engineered immune cells comprise engineered T cells. In some cases, the engineered immune cells comprise engineered NK cells.

Chimeric receptor polypeptides

In some cases, the chimeric receptor polypeptides (receptors) disclosed herein can be operatively coupled to a chimeric adapter polypeptide (adapter). In some cases, the receptor and the adapter may be configured to form a complex (e.g., a signaling complex) upon binding of the ligand to the receptor (e.g., upon contact of a cell comprising the receptor with the ligand) and/or upon modification of the receptor. The adapter may be a transmembrane protein. Alternatively, the adapter may be an intracellular protein. In some cases, the adapter may be a signaling protein of a receptor signaling pathway that is recruited towards the receptor after modification of the receptor.

In some cases, the complexing of the receptor and the adapter may be direct and/or indirect. In direct complexation, one of the receptor and the adapter may be configured to bind directly to the other of the receptor and the adapter (e.g., via covalent and/or non-covalent interactions). In some examples, one of the receptor and the adapter can comprise a binding domain (e.g., a polypeptide sequence) configured to bind to at least a portion (e.g., an intracellular portion) of the other of the receptor and the adapter. In indirect complexation, the receptor and the adapter may be configured to be closer to each other (e.g., recruit one to the other) without any direct binding after receptor modification relative to the case without receptor modification. In some examples, the receptor may comprise a Chimeric Antigen Receptor (CAR) or a modified immune cell receptor (e.g., a modified T cell receptor or "TCR"), and the adapter may comprise at least a portion of a T cell activating Linker (LAT) that is recruited as part of the signaling cascade of the receptor after modification of the receptor.

In some cases, one of the receptor and the adapter may comprise a gene-regulatory polypeptide comprising an actuation moiety linked to a cleavage recognition site, and the other of the receptor and the adapter may comprise a cleavage moiety configured to cleave the cleavage recognition site to release the actuation moiety from GMP. In some examples, cleavage of the cleavage recognition site by the cleavage moiety may occur after direct complexation between the receptor and the adapter. In some examples, cleavage of the cleavage recognition site by the cleavage moiety may occur after indirect complexation between the receptor and the adapter. Upon modification of the receptor, the receptor and the adapter may be recruited toward each other such that the cleavage moiety may cleave the actuation moiety from the GMP, thereby activating the actuation moiety to modulate the expression or activity of an endogenous protein (e.g., an endogenous cytokine), as disclosed herein.

In some cases, the chimeric receptor polypeptides (receptors) disclosed herein can be operatively coupled to a first chimeric adapter polypeptide (first adapter) and a second chimeric adapter polypeptide (second adapter). In some cases, the first adapter and the second adapter may be signaling proteins of a receptor signaling pathway that recruit towards the receptor or towards another signaling protein of the receptor signaling pathway upon modification of the receptor. In some examples, the first adapter and the second adapter may recruit toward each other after receptor modification. As disclosed herein, the first adapter and the second adapter may form a complex via direct binding. Alternatively, the first adapter and the second adapter may form a complex via indirect binding (e.g., in proximity to each other). In some cases, the first adaptor may comprise GMP (comprising an actuation moiety linked to a cleavage recognition site), and the second adaptor may comprise a cleavage moiety, as disclosed herein. Upon modification of the receptor, the first adapter and the second adapter may recruit toward each other such that the cleavage moiety may cleave the actuation moiety from the GMP, thereby activating the actuation moiety to regulate expression or activity of an endogenous protein (e.g., an endogenous cytokine).

In some cases, one of the first adapter and the second adapter may comprise a gene-regulatory polypeptide comprising an actuation moiety linked to a cleavage recognition site, and the other of the first adapter and the second adapter may comprise a cleavage moiety configured to cleave the cleavage recognition site to release the actuation moiety from GMP. In some examples, cleavage of the cleavage recognition site by the cleavage moiety can occur after direct complexation between the first adapter and the second adapter. In some examples, cleavage of the cleavage recognition site by the cleavage moiety may occur after indirect complexation between the first adapter and the second adapter.

In some cases, the receptors disclosed herein can undergo receptor modifications upon binding to a ligand, including conformational changes or chemical modifications (e.g., phosphorylation or dephosphorylation).

Figures 1A-1D schematically illustrate the release of the actuation moiety from GMP. FIG. 1A shows the binding of an antigen to a transmembrane chimeric receptor polypeptide. The transmembrane chimeric receptor polypeptide comprises an extracellular region having an antigen interaction domain 101 and an intracellular region comprising GMP. GMP includes an actuation moiety 102a linked to a cleavage recognition site 102 b. In response to antigen binding, the receptor is modified by phosphorylation 103 in the intracellular region of the receptor (fig. 1B). Following receptor modification (e.g., phosphorylation), an adapter protein comprising a receptor binding moiety is recruited to the receptor, as shown in fig. 1C. The receptor comprises a cleavage moiety 104; the cleavage moiety may be complexed with the adapter or may be linked to the receptor binding moiety, for example, by a peptide bond and/or a peptide linker. When approaching the cleavage recognition site, the cleavage moiety can cleave the recognition site to release the actuation moiety from the GMP, as shown in fig. 1D. Upon release, the actuating moiety can enter the nucleus to regulate expression and/or activity of the target gene or edit the nucleic acid sequence. FIGS. 1E-1H show a similar system in which receptor modifications comprise conformational changes. In some embodiments, the adaptor protein is tethered to the membrane (e.g., as a membrane-bound protein).

Figures 2A-2D schematically illustrate the release of the actuation moiety from GMP. Figure 2A shows the binding of an antigen to a transmembrane chimeric receptor polypeptide. The transmembrane chimeric receptor polypeptide comprises an extracellular region having an antigen-interacting domain 205 and an intracellular region comprising a cleavage portion 206. The cleavage moiety may be complexed with the receptor or may be linked to the receptor, for example, by a peptide bond and/or a peptide linker. GMP forms part of a chimeric adaptor polypeptide. GMP linked to the receptor binding moiety 201 includes an actuation moiety 202a linked to a cleavage recognition site 202 b. In response to antigen binding, the receptor is modified by phosphorylation 203 at the intracellular region of the receptor (fig. 2B). Following receptor modification (e.g., phosphorylation), the chimeric adapter polypeptide is recruited to the receptor, as shown in fig. 3C. The receptor comprises a cleavage moiety 206. When approaching the cleavage recognition site, the cleavage moiety can cleave the recognition site to release the actuation moiety from the GMP, as shown in fig. 2D. Upon release, the actuating moiety can enter the nucleus to regulate expression and/or activity of the target gene or edit the nucleic acid sequence. FIGS. 2E-2H show a similar system in which receptor modification comprises conformational changes. In some embodiments, the chimeric adapter protein is tethered to a membrane (e.g., as a membrane-bound protein).

Figures 3A-D schematically illustrate the release of the actuation moiety from GMP. Figure 3A shows binding of an antigen to a transmembrane chimeric receptor polypeptide. The transmembrane chimeric receptor polypeptide comprises an extracellular region having an antigen-interacting domain 305 and an intracellular region. GMP comprising an actuation moiety linked to a cleavage recognition site forms part of a chimeric adaptor polypeptide. Flanking the cleavage recognition site 302b are a receptor binding portion 301 and an actuation portion 302a. In response to antigen binding, the receptor is modified in the intracellular region by phosphorylation 303 (fig. 3B). Following receptor modification (e.g., phosphorylation), the chimeric adapter polypeptide is recruited to the receptor, as shown in fig. 3B. A second adapter polypeptide 307 comprising a cleavage portion 306 is also recruited to the modified receptor (fig. 3C). The cleavage moiety may be complexed with the second adaptor polypeptide or may be linked to the adaptor, for example by a peptide bond and/or a peptide linker. When approaching the cleavage recognition site, the cleavage moiety can cleave the recognition site to release the actuation moiety from the GMP, as shown in fig. 3D. Upon release, the actuating moiety can enter the nucleus to regulate expression and/or activity of the target gene or edit the nucleic acid sequence. Figures 3E-H show a similar system in which the receptor modification comprises a conformational change. In some embodiments, the chimeric adapter protein is tethered to a membrane (e.g., as a membrane-bound protein). In some embodiments, the second adaptor protein is tethered to the membrane (e.g., as a membrane-bound protein).

In some cases, a chimeric receptor polypeptide (receptor) can comprise a ligand binding domain, a transmembrane domain, and a signaling domain. The signaling domain may activate a signaling pathway of the cell upon binding of the ligand to the ligand binding domain. The cell may further comprise an expression cassette comprising a polynucleotide sequence encoding an actuation moiety disclosed herein (e.g., GMP comprising the actuation moiety) placed under the control of a promoter. The actuating moiety may comprise a heterologous endonuclease. The promoter may be activated to drive expression of the actuating portion upon binding of the ligand to the ligand binding domain. The activating portion of expression can be complexed with a target gene encoding an endogenous protein disclosed herein (e.g., an endogenous cytokine) to regulate expression or activity of the endogenous protein. The promoter may comprise a promoter endogenous to the cell. Endogenous promoters can be activated upon binding of a ligand to the ligand binding domain of a receptor.

FIG. 4 illustrates an illustrative system comprising transmembrane receptors that can be used to regulate the expression of at least one target gene. Upon binding of the ligand to the chimeric receptor polypeptide (e.g., scFv-CAR), the intrinsic signal transduction pathway is activated, resulting in recruitment of at least one cellular transcription factor (e.g., an endogenous transcription factor) to its natural site of the promoter region of the endogenous gene (signature gene). The activating moiety coding sequence (e.g., a GMP coding sequence comprising the activating moiety coding sequence) is integrated into the genome and placed under the control of a signature gene promoter. Transcriptional activation of a promoter results in expression of an activating moiety (e.g., comprising dCas linked to a transcriptional activator (e.g., VPR) or transcriptional repressor (e.g., KRAB)). The activating portion of expression, upon complexing (e.g., constitutive or conditional expression) with a guide RNA (e.g., sgRNAa, sgRNAb), can regulate (activate or inhibit) expression of an endogenous protein disclosed herein (e.g., gene a such as IL-12A, gene B such as IL-12B).

In some cases, the chimeric receptor polypeptides (receptors) disclosed herein can be Chimeric Antigen Receptors (CARs) and/or modified T Cell Receptors (TCRs).

In some cases, the CARs disclosed herein can be first, second, third, or fourth generation CAR systems, functional variants thereof, or any combination thereof. The first generation CARs (e.g., CD19R or CD19 CAR) include an antigen binding domain (e.g., an antibody or antigen binding fragment thereof, such as scFv, fab fragment, VHH domain, or VH domain of a pure heavy chain antibody) that is specific for a particular antigen, a transmembrane domain derived from an adaptive immune receptor (e.g., a transmembrane domain derived from a CD28 receptor), and a signaling domain derived from an adaptive immune receptor (e.g., one or more (e.g., three) ITAM domains derived from the cd3ζ receptor or fcεrlγ intracellular regions). The second generation CARs modify the first generation CARs by adding a co-stimulatory domain (e.g., derived from a co-stimulatory receptor that works with T cell receptors such as CD28, CD137/4-1BB, and CD134/OX 40) to the intracellular signaling domain portion of the CAR, which does not require administration of a cofactor (e.g., IL-2) as compared to the first generation CARs. Third generation CARs add multiple costimulatory domains (e.g., cd3ζ -CD28-OX40 or cd3ζ -CD28-41 BB) to the intracellular signaling domain portion of the CAR. The fourth generation CARs modify the second generation CARs or third generation CARs by adding an activating cytokine (e.g., IL-23 or IL-27) under the control of the intracellular signaling portion of the CAR (e.g., between one or more co-stimulatory domains and the cd3ζitam domain) or a CAR-induced promoter (e.g., NFAT/IL-2 minimal promoter).

Actuating part

The actuation moiety disclosed herein (e.g., as part of GMP) may be capable of editing a target gene (e.g., via insertion and/or deletion (indel), homology Directed Repair (HDR), non-homologous end joining (NHEJ)) to regulate expression or activity of an endogenous protein (e.g., an endogenous cytokine such as IL-12 or IL-21). Alternatively, the actuation moiety may not be capable of editing the target gene, but still exhibit the ability to complex with the target gene (e.g., an inactivated or dead CRISPR/Cas protein, as provided herein).

The actuation moiety disclosed herein (e.g., as part of GMP) can be operatively coupled to at least one effector domain. The at least one effector domain may be configured to regulate expression or activity of an endogenous protein (e.g., an endogenous cytokine), and in some cases, the actuation moiety may be fused to the at least one effector domain to form a fused moiety. In some cases, the actuation moiety can comprise a first coupling moiety (e.g., a polynucleotide) and the at least one effector domain can comprise a second coupling moiety (e.g., a second polynucleotide having complementarity to the first polynucleotide) such that the actuation moiety and the at least one effector domain can be coupled to each other. In some examples, at least one effector domain may be a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain to modulate expression or activity of an endogenous protein (e.g., an endogenous cytokine).

Non-limiting examples of the function of at least one effector domain disclosed herein can include methyltransferase activity, demethylase activity, disproportionation enzyme activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photo-or glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, threylation activity, deglutition activity, ribosylation activity, myristoylation activity, remodeling activity, protease activity, oxidoreductase activity, transferase activity, hydrolase activity, lyase activity, isomerase activity, synthase activity and deglutition activity.

Non-limiting examples of at least one effector domain disclosed herein can include methyltransferases, demethylases, dismutases, alkylating enzymes, apurines, oxidases, pyrimidine dimer forming enzymes, integrases, transposases, recombinases, polymerases, ligases, helicases, photocleavages or glycosylases, acetyltransferases, deacetylases, kinases, phosphatases, ubiquitin ligases, deubiquitinases, adenylases, degadenylases, threases, desuzzinases, ribosylases, deglutarimides, remodelling enzymes, proteases, oxidoreductases, transferases, hydrolases, lyases, isomerases, synthases, and deglutarimides.

The actuating moiety disclosed herein can comprise a nuclease, such as an endonuclease (e.g., cas). Endonucleases can be heterologous to any of the cells disclosed herein.

The actuation moiety disclosed herein may comprise a Cas endonuclease, a Zinc Finger Nuclease (ZFN), a zinc finger-related gene regulatory polypeptide, a transcription activator-like effector nuclease (TALEN), a transcription activator-like effector-related gene regulatory polypeptide, a meganuclease, a native major transcription factor, an epigenetic modification enzyme, a recombinase, a invertase, a transposase, an RNA Binding Protein (RBP), an Argonaute protein, any derivative thereof, any variant thereof, or any fragment thereof. In some embodiments, the actuation moiety comprises a Cas protein, and the system further comprises a guide RNA (gRNA) complexed with the Cas protein. In some embodiments, the actuation moiety comprises an RBP complexed with a gRNA capable of forming a complex with a Cas protein. In some embodiments, the gRNA comprises a targeting segment that exhibits at least 80% sequence identity with a target polynucleotide. In some embodiments, the Cas protein has substantially no DNA cleaving activity (i.e., dead Cas, inactive Cas, or dCas). For example, the Cas protein is mutated and/or modified to produce a nuclease-deficient protein or a protein with reduced nuclease activity relative to the wild-type Cas protein. Nuclease-deficient proteins may retain the ability to bind DNA, but may lack or reduce nucleic acid cleavage activity.

In some cases, suitable actuation moieties comprise a CRISPR-associated (Cas) protein or Cas nuclease, including a type I CRISPR-associated (Cas) polypeptide, a type II CRISPR-associated (Cas) polypeptide, a type III CRISPR-associated (Cas) polypeptide, a type IV CRISPR-associated (Cas) polypeptide, a type V CRISPR-associated (Cas) polypeptide, and a type VI CRISPR-associated (Cas) polypeptide; zinc Finger Nucleases (ZFNs); transcription activator-like effector nucleases (TALENs); meganucleases; RNA Binding Proteins (RBPs); CRISPR-associated RNA binding proteins; a recombinase; a invertase; a transposase; argonaute (Ago) proteins (e.g., prokaryotic Argonaute (pAgo), archaebacteria Argonaute (aAgo), and eukaryotic Argonaute (eAgo)); any derivative thereof, any variant thereof and any fragment thereof.

Cas proteins referred to herein may be one type of protein or polypeptide. Cas protein may refer to a nuclease. Cas protein may refer to an endoribonuclease. Cas protein may refer to any modified (e.g., shortened, mutated, lengthened) polypeptide sequence or homolog of Cas protein. Cas proteins may be codon optimized. The Cas protein may be a codon optimized homolog of the Cas protein. Cas proteins may be enzymatically inactive, partially active, constitutively active, fully active, inducible active, and/or more active (e.g., more active than wild type homologs of the protein or polypeptide). The Cas protein may be Cas9. The Cas protein may be Cpf1. The Cas protein may be C2.Cas proteins (e.g., variant, mutant, enzymatically inactive, and/or conditionally enzymatically inactive site-directed polypeptides) can bind to a target nucleic acid. Cas proteins (e.g., variant, mutant, enzymatically inactive, and/or conditionally enzymatically inactive endoribonucleases) can bind to target RNA or DNA.

Non-limiting examples of Cas proteins include C2C1, C2, C2C3, cas1B, cas2, cas3, cas4, cas5e (CasD), cas6e, cas6f Cas7, cas8a1, cas8a2, cas8b, cas8C, cas9 (Csn 1 or Csx 12), cas10d, cas1O, cas1Od, casF, casG, casH, cpf1, csy2, csy3 Cse1 (CasA), cse2 (CasB), cse3 (CasE), cse4 (CasC), csc1, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmr1, cmr3, cmr4, cmr5, cmr6, csb1, csb2, csb3, csx17, csx14, csx1O, csx16, csaX, csx3, csx1, csx15, csf1, csf2, csf3, csf4, and Cul966, and homologs or modified versions thereof.

In some cases, a nuclease disclosed herein (e.g., cas) can be a nucleic acid-guided nuclease (e.g., an RNA-guided endonuclease). The term "guide nucleic acid" generally refers to a nucleic acid that hybridizes to another nucleic acid. The guide nucleic acid may be RNA. The guide nucleic acid may be DNA. The guide nucleic acid may be programmed to bind site-specifically to the nucleic acid sequence. The nucleic acid or target nucleic acid to be targeted may comprise nucleotides. The guide nucleic acid may comprise nucleotides. A portion of the target nucleic acid may be complementary to a portion of the guide nucleic acid. The strand of the double-stranded target polynucleotide that is complementary to and hybridizes to the guide nucleic acid may be referred to as the complementary strand. The strand of the double-stranded target polynucleotide that is complementary to the complementary strand and thus may not be complementary to the guide nucleic acid may be referred to as the non-complementary strand. The guide nucleic acid may comprise a polynucleotide strand and may be referred to as a "unidirectional guide nucleic acid". The guide nucleic acid may comprise two polynucleotide strands and may be referred to as a "bidirectional guide nucleic acid". The term "guide" may be inclusive, meaning both unidirectional and bidirectional, if not otherwise specified.

The guide nucleic acid may comprise a segment that may be referred to as a "nucleic acid targeting segment" or a "nucleic acid targeting sequence". The nucleic acid targeting segment may comprise a subsection that may be referred to as a "protein binding segment" or a "protein binding sequence" or a "Cas protein binding segment".

The guide nucleic acid may comprise two separate nucleic acid molecules, which may be referred to as a bidirectional guide nucleic acid. The guide nucleic acid may comprise a single nucleic acid molecule, which may be referred to as a unidirectional guide nucleic acid (e.g., sgRNA). In some cases, the guide nucleic acid is a unidirectional guide nucleic acid comprising a fusion CRISPR RNA (crRNA) and transactivation crRNA (tracrRNA). In some cases, the guide is a unidirectional guide comprising crRNA. In some cases, the guide is a unidirectional guide comprising crRNA but lacking tracrRNA. In some cases, the guide is a bi-directional guide comprising non-fused crrnas and tracrRNA. Exemplary bidirectional nucleic acids may comprise crRNA-like molecules and tracrRNA-like molecules. Exemplary unidirectional nucleic acids may comprise crRNA-like molecules. Exemplary unidirectional nucleic acids may comprise fused crRNA-like and tracrRNA-like molecules.

The term "crRNA" as used herein generally refers to a nucleic acid having at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or about 100% sequence identity and/or sequence similarity to a wild-type exemplary crRNA (e.g., crrnas from streptococcus pyogenes). crrnas may generally refer to nucleic acids having up to about 5%, up to about 10%, up to about 20%, up to about 30%, up to about 40%, up to about 50%, up to about 60%, up to about 70%, up to about 80%, up to about 90%, or about 100% sequence identity and/or sequence similarity to wild-type exemplary crrnas (e.g., crrnas from streptococcus pyogenes). crRNA can refer to a modified form of crRNA that can comprise nucleotide changes (e.g., deletions, insertions, or substitutions), variants, mutations, or chimeras. The crRNA can be a nucleic acid having at least about 60% sequence identity over a stretch of at least 6 contiguous nucleotides to a wild-type exemplary crRNA (e.g., crRNA from streptococcus pyogenes) sequence. For example, the crRNA sequence can be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a wild-type exemplary crRNA sequence (e.g., crRNA from streptococcus pyogenes) over a stretch of at least 6 contiguous nucleotides.

The term "tracrRNA" as used herein generally refers to a nucleic acid having at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% sequence identity and/or sequence similarity to a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from streptococcus pyogenes). tracrRNA may refer to a nucleic acid having at most about 5%, at most about 10%, at most about 20%, at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 70%, at most about 80%, at most about 90%, or about 100% sequence identity and/or sequence similarity to a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from streptococcus pyogenes). tracrRNA may refer to modified forms of tracrRNA, which may comprise nucleotide changes (e.g. deletions, insertions or substitutions), variants, mutations or chimeras. tracrRNA may refer to a nucleic acid that is at least about 60% identical in a stretch of at least 6 contiguous nucleotides to a wild-type exemplary tracrRNA (e.g., tracrRNA from streptococcus pyogenes) sequence. For example, the tracrRNA sequence may be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to the wild-type exemplary tracrRNA sequence over a stretch of at least 6 contiguous nucleotides.

The crRNA can comprise a nucleic acid targeting segment (e.g., a spacer region) of the guide nucleic acid and a stretch of nucleotides that can form half of a duplex of the Cas protein binding segment of the guide nucleic acid.

the tracrRNA can comprise a stretch of nucleotides that forms the other half of the duplex of the Cas protein binding segment of the gRNA. A stretch of nucleotides of the crRNA can be complementary to and hybridize with a stretch of nucleotides of the tracrRNA to form a duplex of the Cas protein binding domain of the guide nucleic acid.

The crRNA and tracrRNA may hybridize to form a guide nucleic acid. crrnas can also provide single-stranded nucleic acid targeting segments (e.g., spacer regions) that hybridize to target nucleic acid recognition sequences (e.g., pre-spacer sequences). The sequence of the crRNA or the tracrRNA molecule comprising the spacer region may be designed to be specific for the species in which the guide nucleic acid is to be used.

In some cases, the effector domain may be a transcriptional activation domain selected from GAL4, VP16, VP64, p65, rta, VPR, and variants thereof (e.g., mini-VPR). In some examples, the actuation moiety can be a Cas protein (e.g., dCas, such as dCas 9) fused to a transcriptional activation domain, as disclosed herein.

In some cases, the effector domain may be a transcriptional repression domain selected from KRAB, SID, ERD and variants thereof. In some examples, the actuation moiety can be a Cas protein (e.g., dCas, such as dCas 9) fused to a transcription repression domain disclosed herein.

In one aspect, the present disclosure provides a system comprising an actuation moiety as disclosed herein that is capable of binding to a target polynucleotide sequence in a cell to modulate the expression or activity of an endogenous cytokine (e.g., interleukin (IL)) as disclosed herein in the cell. In some cases, the actuation portion is heterologous to the cell. For example, IL may be IL-12 (e.g., IL-12A and/or IL-12B) or IL-21.

V. guide nucleic acid

In one aspect, the present disclosure provides a system comprising a guide nucleic acid molecule designed to bind to a target polynucleotide sequence in a cell to regulate expression or activity of an endogenous cytokine (e.g., interleukin (IL)) in the cell, as disclosed herein. In some cases, the guide-nucleic acid molecule may be capable of recruiting an actuation moiety to a target polynucleotide sequence in a cell to regulate expression or activity of the IL. In some cases, the system may include an actuation portion. For example, IL may be IL-12 (e.g., IL-12A and/or IL-12B) or IL-21.

In some cases, the IL gene may be endogenous to the cell. In some cases, the TSS may be endogenous to the cell.

In some cases, the system may comprise at least or up to 2, at least or up to 3, at least or up to 4, at least or up to 5, at least or up to 6, at least or up to 7, at least or up to 8, at least or up to 9, or at least or up to 10 different guide nucleic acid molecules having different nucleic acid sequences. In some cases, the guide nucleic acid molecule may comprise a guide ribonucleic acid (RNA). In some examples, the system may comprise a multi-guide nucleic acid (e.g., a multi-guide RNA).

In some cases, the system can comprise (i) a first nucleic acid molecule designed to bind to a first target polynucleotide sequence of a target polynucleotide sequence disclosed herein and (ii) a second nucleic acid molecule designed to bind to a second target polynucleotide sequence of a target polynucleotide sequence disclosed herein. In some examples, the system can comprise (i) a first guide nucleic acid molecule designed to bind to a first portion of a TSS and (ii) a second guide nucleic acid molecule designed to bind to a second portion of the TSS. In some examples, the first target polynucleotide sequence and the second target polynucleotide sequence may be formed from at least or up to about 1 base, at least or up to about 2 bases, at least or up to about 3 bases, at least or up to about 4 bases, at least or up to about 5 bases, at least or up to about 6 bases, at least or up to about 7 bases, at least or up to about 8 bases, at least or up to about 9 bases, at least or up to about 10 bases, at least or up to about 15 bases, at least or up to about 20 bases, at least or up to about 30 bases, at least or up to about 40 bases, at least or up to about 50 bases, at least or up to about 60 bases, at least or up to about 70 bases, at least or up to about 80 bases, at least or up to about 90 bases, at least or up to about 100 bases, at least or up to about 200 bases, at least or up to about 300 bases, at least or up to about 400 bases, at least or up to about 500 bases, at least or up to about 600 bases, at least or up to about 700 bases, at least or up to about 800, at least or up to about 000 bases, at least or up to about 1,000 bases. The first target polynucleotide sequence and the second target polynucleotide sequence may be on the same strand of a target nucleic acid molecule (e.g., a target genome of a cell). Alternatively, the first target polynucleotide sequence and the second target polynucleotide sequence may be on different strands of a target nucleic acid molecule.

In some cases, the IL gene can comprise a plurality of TSSs comprising a first TSS and a second TSS. Each of the first TSS and the second TSS may encode a different portion of the IL gene. For example, the IL may be IL-12 and the first TSS may be part of the IL-12A gene and the second TSS may be part of the IL-12B gene. Thus, in some examples, a first nucleic acid molecule can (1 a) comprise at least a portion of a first TSS or (1 b) be a distance from a first TSS provided herein, and a second nucleic acid molecule can (2 a) comprise at least a portion of a second TSS or (2 b) be a distance from a second TSS provided herein.

In some cases, a TSS (e.g., a first TSS) can have at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% sequence identity with SEQ ID No. 1.

In some cases, a TSS (e.g., a second TSS) can have at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% sequence identity with SEQ ID No. 2.

Expression of delivery systems in cells

In one aspect, the present disclosure provides a cell (e.g., an immune cell) comprising (or expressing) any of the subject systems disclosed herein.

In one aspect, the present disclosure provides a population of cells (e.g., immune cell population) comprising (or expressing) any of the subject systems disclosed herein.

RNA or DNA virus-based systems can be used to deliver one or more genes encoding any of the polypeptides and/or polynucleotides disclosed herein (e.g., chimeric receptors, chimeric adaptors, actuating portions with or without effector domains, or genes encoding the same) into cells of the disclosure. Viral vectors can be used to treat cells in vitro, and modified cells can optionally be administered (ex vivo). Alternatively, the viral vector may be administered directly (in vivo) to a subject. Viral-based systems may include retroviral, lentiviral, adenoviral, adeno-associated viral and herpes simplex viral vectors for gene transfer. Integration in the host genome can be performed using gene transfer methods for retroviruses, lentiviruses, and adeno-associated viruses, which can result in long-term expression of the inserted transgene.

In some cases, non-viral delivery methods can be used to deliver any of the polypeptides and/or polynucleotides disclosed herein (e.g., chimeric receptors, chimeric adaptors, actuating portions with or without effector domains, or genes encoding the same) into the cells of the present disclosure. Non-viral delivery methods of such substances may include lipid infection, nuclear infection, microinjection, gene gun, virosomes, liposomes, immunoliposomes, exosomes, polycations or lipids: substance conjugates (or aggregates), naked polypeptides (e.g., recombinant polypeptides), naked DNA, artificial virions, and agent-enhanced uptake of the polypeptide or DNA. Cationic and neutral lipids suitable for lipid delivery can be identified using effective receptors for the polynucleotide or polypeptide.

VII methods and compositions

In one aspect, the present disclosure provides a method of conditionally modulating expression or activity of an endogenous protein (e.g., an endogenous cytokine, such as IL-12 or IL-21) of a cell by introducing (or expressing) any of the subject systems disclosed herein.

In one aspect, the present disclosure provides a method of conditionally modulating expression or activity of an endogenous protein (e.g., an endogenous cytokine) of a cell. The method can include (a) exposing a chimeric receptor polypeptide (receptor) to a ligand, wherein the receptor undergoes modification upon binding to the ligand. The method may include (b) forming a complex between the activating moiety and a target gene encoding the endogenous protein in response to the receptor modification to regulate expression or activity of the endogenous protein.

In some cases, following receptor modification, the actuation moiety may be activated to modulate the expression or activity of an endogenous protein (e.g., an endogenous cytokine) to cause the cell to exhibit one or more of the features disclosed herein, e.g., comprising one or more of the following: (i) The expression or activity of an endogenous protein (e.g., an endogenous cytokine) is altered by at least 20% as compared to a control; (ii) The expression or activity of a different endogenous protein (e.g., a different endogenous cytokine) of the cell is altered by at least 20% as compared to the control; (iii) Enhanced cytotoxicity to the target cell population, as determined by a reduction in the size of the target cell population of at least 20% compared to the control; (iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising cells as compared to the control; and (v) a decrease in tumor size compared to a control.

In some cases, the method further comprises administering a co-therapeutic agent.

In some cases, the cells administered to the subject may be autologous or allogenic to the subject. For example, the cells administered to the subject may be autoimmune cells or allogeneic immune cells.

In one aspect, the present disclosure provides a composition comprising a cell or cell population (e.g., an engineered immune cell population) comprising (or expressing) any of the subject systems disclosed herein. The composition may be administered to a subject to treat a condition (e.g., cancer, tumor) in the subject. The composition may comprise at least or up to about 1 dose, at least or up to about 2 doses, at least or up to about 3 doses, at least or up to about 4 doses, at least or up to about 5 doses, at least or up to about 6 doses, at least or up to about 7 doses, at least or up to about 8 doses, at least or up to about 9 doses, or at least or up to about 10 doses.

In some cases, the composition further comprises a co-therapeutic agent.

The compositions disclosed herein may be pharmaceutical compositions. The pharmaceutical composition may be in any suitable form (depending on the desired method of administration). The pharmaceutical composition may be provided in unit dosage form, may be provided in a sealed container, and/or may be provided as part of a kit. Such kits may include instructions for use. The kit may comprise a plurality of said unit dosage forms.

Non-limiting examples of co-therapeutic agents may include cytotoxic agents, chemotherapeutic agents, growth inhibitory agents, agents for radiation therapy, anti-angiogenic agents, apoptotic agents, anti-tubulin agents, and other agents for treating cancer, e.g., anti-CD 20 antibodies, anti-PD 1 antibodies (e.g., pembrolizumab), platelet-derived growth factor inhibitors (e.g., GLEEVEC ^TM (imatinib mesylate)), COX-2 inhibitors (e.g., celecoxib), interferons, cytokines, and the following targets: antagonists (e.g., neutralizing antibodies) to which one or more of PDGFR- β, blyS, APRIL, BCMA receptors, TRAIL/Apo2 bind, other bioactive agents, organic chemicals, and the like.

The term "cytotoxic agent" generally refers to a substance that inhibits or prevents cellular function and/or causes damage to cells. Non-limiting examples of cytotoxic agents may include radioisotopes (e.g., at211, I131, I125, Y90, re186, re188, sm153, bi212, P32, and radioactive isotopes of Lu), chemotherapeutic agents (e.g., methotrexate, adriamycin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin, or other intercalating agents), enzymes and fragments thereof such as nucleolytic enzymes, antibiotics, and toxins of bacterial, fungal, plant, or animal origin, such as small molecule toxins or enzymatically active toxins.

Non-limiting examples of chemotherapeutic agents may include alkylating agents, such as thiotepa andcyclophosphamide; alkyl sulfonates such as busulfan, imperoshu and piposhu; aziridines, such as benzodopa, carboquinone, mitotepa and uretifolia; ethyleneimine and methylmelamines, including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphamide, and trimethylol melamine; polyacetyl (especially bullatacin and bullatacin ketone); delta-9-tetrahydrocannabinol (dronabinol,)>) The method comprises the steps of carrying out a first treatment on the surface of the Beta-lapachone; lapatiol; colchicine; betulinic acid; camptothecins (including the synthetic analogue topotecan->CPT-11 (irinotecan,/-)>) Acetylcamptothecin, scopoletin, and 9-aminocamptothecin); bryostatin; calistatin; CC-1065 (including adoxolone, calzelone and bizelone analogues thereof); podophyllotoxin; podophylloic acid; teniposide; nostoc (in particular, nostoc 1 and nostoc 8); dolastatin; the sesqui-carcinomycin (including synthetic analogues KW-2189 and CB1-TM 1); soft corallool; a podophylline; stoloniferol; spongosine; nitrogen mustards, such as chlorambucil, napthalene mustards, cholesteryl phosphoramide, estramustine, ifosfamide, methyldichlorodiethylamine oxide hydrochloride, melphalan, new enbicine, chlorambucil cholesterol, melphalan, chlorocyclophosphamide, uracil mustards; nitrosoureas such as carmustine, chlorourea, fotemustine, lomustine, nimustine and ramustine; antibiotics, such as enediyne antibiotics; dada (Chinese character) Nimustine, including danimicin a; epothilone; and neocarcinomycin chromophore and related chromoprotein enediyne antibiotic chromophore), acarmycin, actinomycin, anglerin, azaserine, bleomycin, actinomycin C, carmubicin, carminomycin, carcinophilins, chromomycin, actinomycin D, daunorubicin, dithiin, 6-diazo-5-oxo-L-norleucine, and combinations thereof>Doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrroline-doxorubicin, and deoxydoxorubicin), epirubicin, eldrorubicin, idarubicin, doxycycline, mitomycin such as mitomycin C, mycophenolic acid, norgamycin, olivomycin, pelomycin, pofemycin, puromycin, tri-iron doxorubicin, rodubicin, streptozocin, streptozotocin, tuberculin, ubenimex, clean statin, zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as, for example, dimethyl folic acid, methotrexate, pterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thioadenine, thioguanine; pyrimidine analogs such as cytarabine, azacytidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, deoxyfluorouridine, enocitabine, fluorouridine; androgens such as calotron, drotasone propionate, epithioandrosterol, emandrostane, and testosterone; anti-adrenal agents such as aminoglutethimide, mitotane, and trilostane; folic acid supplements, such as folinic acid; acetyldextran esters; aldehyde phosphoramide glycosides; aminolevulinic acid; enuracil; amsacrine; amoustine; a specific group; eda traxas; deformamine; dimecoxin; deaquinone; efronidine; ammonium elegance; epothilones; eggshell robust; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mo Tanmo mol; qu Rui resistance; penstatin; egg ammonia nitrogen mustard; pirarubicin; losoxantrone; 2-ethyl hydrazide; methyl benzyl hydrazine; / >Polysaccharide complex (JHS Natural Products, eugene, oreg.); carrying out a process of preparing the raw materials; rhizopus extract; cilaphland; germanium spiroamine; tenuazonic acid; triiminoquinone; 2,2',2 "-trichlorotriethylamine; trichothecene toxins (especially T-2 toxins, verakulin a, plaque fungus a, and serpentine fungus element); a urethane; vindesine->Dacarbazine; mannitol nitrogen mustard; dibromomannitol; dibromodulcitol; pipobromine; new calicheat; cytarabine ("Ara-C"); thiotepa; taxoids, e.g. taxanes, comprising +.>Paclitaxel (Bristol-Myers Squibb Oncology, princeton, N.J.), ABRAXANE ^TM Albumin engineered nanoparticle formulations of paclitaxel without polyoxyethylated castor oil (American Pharmaceutical Partners, schaumberg, ill.) and +.>Docetaxel (>Poulenc Rorer, antonny, france); chlorambucil; gemcitabine>6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinca alkaloid->Platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine->Oxaliplatin; folinic acid; vinorelbine->Mitoquinone hydrochloride; eda traxas; daunomycin; aminopterin; ibandronate; topoisomerase inhibitor RFS 2000; difluoromethyl ornithine (DMFO); retinoids, such as retinoic acid; card culture Talbine A pharmaceutically acceptable salt, acid or derivative of any of the above; and combinations of two or more of the foregoing, such as CHOP, which is an abbreviation for combination therapy of cyclophosphamide, doxorubicin, vincristine, and prednisolone, and FOLFOX, which is a therapy using oxaliplatin (ELOXATIN ^TM ) Abbreviations for treatment regimen in combination with 5-FU and folinic acid. For example, additional chemotherapeutic agents include cytotoxic agents useful as antibody drug conjugates, such as maytansinoids (e.g., DM 1) and auristatins MMAE and MMAF.

Examples of chemotherapeutic agents may also include "anti-hormonal agents" or "endocrine therapeutic agents" that are used to regulate, reduce, block, or inhibit the action of hormones that may promote the growth of cancer, and are typically in the form of systemic or general treatment. They may be hormones themselves. Examples include antiestrogens and Selective Estrogen Receptor Modulators (SERMs), including, for example, tamoxifen (includingTamoxifen), ->Raloxifene, droloxifene, 4-hydroxy tamoxifen, troxifene, kagaxifene, LY117018, onapristone and +.>Toremifene; antiprogestins; estrogen receptor down-regulation (ERD); agents for suppressing or closing the ovaries, e.g. Luteinizing Hormone Releasing Hormone (LHRH) agonists (e.g.) >And ELIGARD), leuprorelin acetate, goserelin acetate, buserelin acetate, and triptorelin; other antiandrogens such as flutamide, nilutamide and bicalutamide; and aromatase inhibitors which inhibit the enzyme aromatase which regulates estrogen production in the adrenal gland, such as, for example, 4 (5) -imidazole, aminoglutethimide,/-for example>Megestrol acetate,Exemestane, formestane, fadrozole, and->Fucloxazole,/-herba Cichorii>Letrozole and->Anastrozole. In addition, such chemotherapeutic agent definitions include bisphosphonates, such as chlorophosphonate (e.g., +.>Or->)、Etidronate, NE-58095,Zoledronic acid/zoledronate, < >>Alendronate, < - > j>Pamidronate, < - > A>Telophosphonate or->Risedronate; troxacitabine (1, 3-dioxolane nucleoside cytosine analogue); antisense oligonucleotides, in particular antisense oligonucleotides that inhibit the expression of genes involved in signaling pathways of abnormal cell proliferation, such as, for example, PKC- α, raf, H-Ras and Epidermal Growth Factor Receptor (EGFR); vaccines, e.g.)>Vaccines and gene therapy vaccines, e.g. +.>Vaccine, & gt>Vaccine and->A vaccine;Topoisomerase 1 inhibitors;rmRH; lapatinib xylene sulfonate (ErbB-2 and EGFR dual tyrosine kinase small molecule inhibitor, also known as GW 572016); and pharmaceutically acceptable salts, acids or derivatives of any of the above.

Examples of chemotherapeutic agents may also include antibodies, such as alemtuzumab (Campath), bevacizumab @Genentech); cetuximab (+)>Imclone); panitumumab @Amgen), rituximab (+.>Genentech/Biogen Idec), pertuzumab (/ i)>2C4, genentech), trastuzumab (++>Genentech), tositumomab (Bexxar, corixia) and antibody drug conjugates, gemtuzumab ozagrel @Wyeth). Additional humanized monoclonal antibodies having therapeutic potential as agents in combination with the compounds of the invention include: alpozumab, alemtuzumab, bapidizumab, bivalizumab maytansine, katuzumab maytansine, cetrimab, pezilimizumab, cetuximab, daclizumab Ekuizumab, efalizumab, epalzhuzumab, early Ulipizumab, non-mu zhuzumab, artuzumab, gituzumab ozagrimocin, ointuzumab, ituzumab, la Bei Tuozhu monoclonal antibody, lintuzumab trastuzumab, mepiquat bead mab, motavizumab, natalizumab, nituzumab, novavizumab, noose Ma Weizhu mab, oreuzumab, omauzumab, palivizumab, peruzumab, pertuzumab, peruzumab, lei Weizhu mab, ranibizumab, rituximab, retiuzumab, rituximab, luo Weizhu mab, lu Lizhu mab, siruzumab, cetrimuzumab, soluzumab, tacaruzumab Anti-tetan, tadalaximab, talbizumab, tifeizumab, tolizumab, toluzu Shan Kangxi Mo Baijie, tussah bezeizumab, wu Mazhu mab, wu Tuozhu mab, wu Sinu mab, velizumab and anti-interleukin-12 (ABT-874/J695, wyeth Research and Abbott Laboratories), which is a full length IgG1 lambda antibody genetically modified to recognize recombinant human-only sequences of interleukin-12 p40 protein.

Examples of chemotherapeutic agents may also include "tyrosine kinase inhibitors," such as EGFR targeting agents (e.g., small molecules, antibodies, etc.); small molecule HER2 tyrosine kinase inhibitors such as TAK165 available from Takeda; CP-724,714, an oral selective inhibitor of ErbB2 receptor tyrosine kinase (Pfizer and OSI); dual HER inhibitors such as EKB-569 (available from Wyeth) that preferentially bind EGFR but inhibit both HER2 and EGFR-overexpressing cells; lapatinib (GSK 572016; available from Glaxo-SmithKline), an oral HER2 and EGFR tyrosine kinase inhibitor; PKI-166 (available from Novartis); ubiquitin inhibitors such as karatinib (CI-1033; pharmacia); raf-1 inhibitors, such as the antisense agent ISIS-5132 available from ISIS Pharmaceuticals that inhibits Raf-1 signaling; non-HER targeted TK inhibitors, e.g. imatinib mesylate Available from Glaxo SmithKline); multi-targeted tyrosine kinase inhibitors, such as sunitinib (>Available from Pfizer); VEGF receptor tyrosine kinase inhibitors, such as Watpanib (PTK 787/ZK222584, available from Novartis/Schering AG); MAPK extracellular regulated kinase I inhibitor CI-1040 (available from Pharmacia); quinazolines, such as PD 153035,4- (3-chloroanilino) quinazoline; pyridopyrimidine; pyrimidopyrimidines; pyrrolopyrimidines, such as CGP 59326, CGP 60261, and CGP 62706; pyrazolopyrimidines, 4- (anilino) -7H-pyrrolo [2,3-d]Pyrimidine; curcumin (diferuloylmethane, 4, 5-bis (4-fluoroanilino) phthalimide); containing nitrothiophene moietiesIs a casein; PD-0183805 (Warner-Lamber); antisense molecules (e.g., those that bind to HER-encoding nucleic acids); quinoxaline (U.S. patent No. 5,804,396); casein (U.S. patent No. 5,804,396); ZD6474 (Astra-Zeneca); PTK-787 (Novartis/Schering AG); pan HER inhibitors such as CI-1033 (Pfizer); affinitac (ISIS-3521; isis/Lilly); imatinib mesylatePKI-166 (Novartis); GW2016 (Glaxo SmithKline); CI-1033 (Pfizer); EKB-569 (Wyeth); drillansamy (Pfizer); ZD6474 (AstraZeneca); PTK-787 (Novartis/Schering AG); INC-1C11 (Imclone); and rapamycin (sirolimus), )。

Examples of chemotherapeutic agents may also include dexamethasone, interferon, colchicine, chlorphenidine, cyclosporin, amphotericin, metronidazole, alemtuzumab, aliskirilowic acid, allopurinol, amifostine, arsenic trioxide, asparaginase, live BCG, bevacizumab, bexarotene, cladribine, clofarabine, dapoxetine alpha, dimesleukin, dexrazoxane, epoetin alpha, erlotinib, fegliptin, histrelin acetate, temozolomab, interferon alpha-2 a, interferon alpha-2 b, lenalidomide, levamisole, mevalonate, methoxaline, benorine, nelarabine, nopalizumab, opril, palivimin, pamamate, garcinase, pegine, fepristine, melem, plicamycin, phenoxagline sodium, quinacrine, xagline, britizosin, tolnaftate, and ATPastezoic acid, and other pharmaceutically acceptable salts thereof.

Examples of chemotherapeutic agents may also include hydrocortisone, hydrocortisone acetate, hydrocortisone, tizopitavaester, triamcinolone acetonide, triamcinolone Long Chun, mometasone, ambetanide, budesonide, fluocinolone acetonide, betamethasone, and combinations thereof Sodium pinocembronate, dexamethasone sodium phosphate, flucortisone, hydrocortisone-17-butyrate, hydrocortisone-17-valerate, beclomethasone dipropionate, betamethasone valerate, betamethasone dipropionate, prednisolide, clobetasone-17-butyrate, clobetasone-17-propionate, flucobolone caproate, flucobolone pivalate and fluoromethylene acetate; immunoselective anti-inflammatory peptides (ImSAID), such as phenylalanine-glutamine-glycine (FEG) and D-isomer forms (feG) thereof (IMULAN BioTherapeutics, LLC); antirheumatic drugs, such as azathioprine, cyclosporine (cyclosporine A), D-penicillamine, gold salts, hydroxychloroquine, leflunomide, minocycline, sulfasalazine, tumor necrosis factor alpha (TNF alpha) blockers (such as etanercept)Infliximab->Adalimumab->Pezilizumab +.>Golimumab->) Interleukin 1 (IL-1) blocker (e.g. anakinra +)>) T cell costimulatory blockers (e.g. Abapyric->) Interleukin 6 (IL-6) blocker (e.g. tolizumab +)>) The method comprises the steps of carrying out a first treatment on the surface of the Interleukin 13 (IL-13) blocking agents, such as leuprolide; interferon alpha (IFN) blockers, e.g. Luo DaliBead monoclonal antibodies; beta 7 integrin blockers, such as rhuMAb beta 7; igE pathway blockers, such as Anti-M1 prime; secreted homotrimeric LTa3 and membrane-bound heterotrimeric LTa1/β2 blockers, such as anti-lymphotoxin α (LTa); hybrid investigational agents, such as carbosulfan, PS-341, phenylbutyrate, ET-18-OCH3 or farnesyl transferase inhibitors (L-739749, L-744832); polyphenols such as quercetin, resveratrol, piceatannol, epigallocatechin gallate, theaflavins, flavanols, procyanidins, betulinic acid and derivatives thereof; autophagy inhibitors such as chloroquine; delta-9-tetrahydrocannabinol (dronabinol,) >) The method comprises the steps of carrying out a first treatment on the surface of the Beta-lapachone; lapaol; colchicine; betulinic acid; acetylcamptothecin, scopoletin and 9-aminocamptothecin; podophyllotoxin; tegafur->Bexarotene->Bisphosphonates, such as chlorophosphonate (e.g.)>Or->) Etidronate sodium->NE-58095, zoledronic acid/zoledronate->Arrendronate->Pamidronate->Tiludronate->Or risedronate->And epidermal growth factor receptor (EGF-R); vaccines, e.g.)>A vaccine; pirifaxin, COX-2 inhibitors (e.g., celecoxib or etoricoxib), proteosome inhibitors (e.g., PS 341); CCI-779; tipifanib (R11577); sorafenib, ABT510; bcl-2 inhibitors, e.g. sodium o Mo Sen->Peking raw agar; inhibitors of farnesyl transferase, e.g. lenafinib (SCH-6636, SARASAR) ^TM ) The method comprises the steps of carrying out a first treatment on the surface of the And pharmaceutically acceptable salts, acids or derivatives of any of the above; and combinations of two or more of the foregoing.

The term "growth inhibitory agent" generally refers to a compound or composition that inhibits the growth and/or proliferation of cells (e.g., cells whose growth depends on PD-L1 expression) in vitro or in vivo. The growth inhibitory agent may be one that significantly reduces the percentage of cells in S phase. Non-limiting examples of growth inhibitors include agents that block cell cycle progression (at locations other than S phase), such as agents that induce G1 arrest and M phase arrest. Classical M-phase blockers include vinca (vincristine and vinblastine), taxanes and topoisomerase II inhibitors, such as the anthracycline doxorubicin ((8S-cis) -10- [ (3-amino-2, 3, 6-trideoxy-alpha-L-lyxohexapyranosyl) oxy group ]-7,8,9, 10-tetrahydro-6, 8, 11-trihydroxy-8- (hydroxyacetyl) -1-methoxy-5, 12-naphthacenedione), epirubicin, daunomycin, etoposide and bleomycin. Those agents that arrest G1 also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, nitrogen mustard, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Taxane (paclitaxel and polyp)Docetaxel) are anticancer drugs derived from the yew tree. Docetaxel derived from jerseyRhone-Poulenc Rorer) is paclitaxelBristol-Myers Squibb). Paclitaxel and docetaxel promote microtubule assembly from tubulin dimers and stabilize microtubules by preventing depolymerization, resulting in inhibition of cell mitosis.

Therapeutic application

The subject systems can be introduced into a variety of immune cells, including any cells involved in an immune response. In some embodiments, the immune cells comprise granulocytes, such as basophils, eosinophils, and neutrophils; mast cells; monocytes that can develop into macrophages; antigen presenting cells, such as dendritic cells; and lymphocytes such as natural killer cells (NK cells), B cells, and T cells. In some embodiments, the immune cell is an immune effector cell. Immune effector cells refer to immune cells that can perform a specific function in response to a stimulus. In some embodiments, the immune cell is an immune effector cell that can induce cell death. In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is an NK cell. In some embodiments, the lymphocyte is a T cell. In some embodiments, the T cell is an activated T cell. T cells include both naive and memory cells (e.g., central memory or T _CM Effect memory or T _EM And effector memory RA or T _EMRA ) Effector cells (e.g., cytotoxic T cells or CTL or Tc cells), helper cells (e.g., th1, th2, th3, th9, th7, TFH), regulatory cells (e.g., treg and Trl cells), natural killer T cells (NKT cells), tumor Infiltrating Lymphocytes (TIL), lymphocyte activated killer cells (LAK), αβt cells, γδ T cells, and similar unique classes of T cell lineages. T cells can be divided into two major classes: cd8+ T cells and cd4+ T filamentsCells are based on which proteins are present on the cell surface. T cells expressing the subject system can perform a variety of functions, including killing infected cells and activating or recruiting other immune cells. Cd8+ T cells are known as cytotoxic T cells or Cytotoxic T Lymphocytes (CTLs). CTLs expressing the subject system can be involved in the recognition and removal of virally infected cells and cancer cells. CTLs have specialized compartments or particles that contain cytotoxins that cause apoptosis (e.g., programmed cell death). Cd4+ T cells can be subdivided into four subsets-Th 1, th2, th17 and Treg, where "Th" refers to "T helper cells", but other subsets may also be present. Th1 cells can coordinate immune responses against intracellular microorganisms, especially bacteria. They can produce and secrete molecules that alert and activate other immune cells such as macrophages that phagocytose bacteria. Th2 cells are involved in the coordination of immune responses against extracellular pathogens such as worms (parasitic worms) by alerting B cells, granulocytes and mast cells. Th17 cells produce interleukin 17 (IL-17), a signaling molecule that activates immune and non-immune cells. Th17 cells are critical for recruitment of neutrophils.

The ligand or antigen of the antigen binding portion disclosed herein (i.e., the target antigen) may be a cell surface marker, a secretion marker, or an intracellular marker.

Non-limiting examples of antigens (i.e., target antigens) of the antigen binding portion disclosed herein can include ADGRE2, carbonic anhydrase IX (CA 1X), CCRI, CCR4, carcinoembryonic antigen (CEA), CD3 zeta, CD5, CD7, CD8, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44V6, CD49f, CD56, CD70, CD74, CD99, CD123, CD133, CD138, CD269 (BCMA), CD S, CLEC12A, antigens of Cytomegalovirus (CMV) infected cells (e.g., cell surface antigens), epithelial glycoprotein 2 (EGP 2), epithelial glycoprotein-40 (EGP-40), epithelial cell adhesion molecule (EpCAM), EGFRvIII, receptor tyrosine protein kinase erb-B2,3,4, EGFIR, EGFR-VIII, ERBB Folate Binding Protein (FBP), fetal acetylcholine receptor (AChR), folate receptor-a, ganglioside G2 (GD 2), ganglioside G3 (GD 3), gp100, human EGF receptor 2 (HER-2), human telomerase reverse transcriptase (hTERT), ICAM-1, integrin B7, interleukin-13 receptor subunit alpha-2 (IL-13 Ralpha 2), kappa-light chain, kinase insert domain receptor (KDR), kappa, lewis A (CA 19.9), lewis Y (LeY), L1 cell adhesion molecule (L1-CAM), LILRB2, MART-1, melanoma antigen family A1 (MAGE-A1), MICA/B, mucin 1 (Muc-1), mucin 16 (Muc-16), muc-16, mesothelin (MSLN), NKBI, NKG2D ligand, c-Met, cancer-testis antigen NY-ESO-1, NY-ESO-2, cancer embryo antigen (h 5T 4), PRAIVIE, prostate Stem Cell Antigen (PSCA), PRAME Prostate Specific Membrane Antigen (PSMA), ROR1, tumor-associated glycoprotein 72 (TAG-72), TIM-3, TRBCI, TRBC2, vascular endothelial growth factor R2 (VEGF-R2), wilms tumor protein (WT-1), and various pathogen antigens (e.g., pathogen antigens derived from viruses, bacteria, fungi, parasites and protozoa that are capable of causing disease). In some examples, the pathogen antigen is derived from HIV, HBV, EBV, HPV, lasse virus, influenza virus or coronavirus.

Additional examples of antigens for the antigen binding portion disclosed herein may include 1-40-beta-amyloid, 4-1BB, 5AC, 5T4, activin receptor-like kinase 1, ACVR2B, adenocarcinoma antigen, AGS-22M6, alpha-fetoprotein, angiopoietin 2, angiopoietin 3, anthrax toxin, AOC3 (VAP-1), B7-H3, bacillus anthracis (Bacillus anthracis) anthrax, BAFF, beta-amyloid, B-lymphoma cells, C242 antigen, C5, CA-125, canine (Canis lupus familiaris) IL31, carbonic anhydrase 9 (CA-IX), cardiac myoglobin, CCL11 (eosinophil chemokine-1), CCR4, CCR5, CD11, CD18, CD125, CD140a, CD147 (baskin), CD15, CD152, CD154 (CD 40L), CD19, CD2, CD20, CD200, CD22, CD221 CD23 (IgE receptor), CD25 (alpha chain of IL-2 receptor), CD27, CD274, CD28, CD3 epsilon, CD30, CD33, CD37, CD38, CD4, CD40 ligand, CD41, CD44 v6, CD5, CD51, CD52, CD56, CD6, CD70, CD74, CD79B, CD80, CEA-related antigen, CFD, ch4D5, CLDN18.2, clostridium difficile (Clostridium difficile), clotting factor A, CSF1R, CSF, A-4, C-X-C chemokine receptor type 4, cytomegalovirus glycoprotein B, dabigatran, DLL4, DPP4, DR5, E.coli (E.coli) shiga toxin type 1, E.coli shiga toxin type 2, EGFL7, EGFR, endotoxin, epCAM, episialoprotein, ERBB3, E.coli, F protein of respiratory syncytial virus FAP, fibrin II beta chain, fibronectin extra domain-B, folate hydrolase, folate receptor 1, folate receptor alpha, frizzled receptor, ganglioside GD2, GD3 ganglioside, glypican 3, GMCSF receptor alpha chain, GPNMB, growth differentiation factor 8, GUCY2C, hemagglutinin, hepatitis B surface antigen, hepatitis B virus, HER1, HER2/neu, HER3, HGF, HHGFR, histone complex, HIV-1, HLA-DR, HNGF, hsp90, human scatter factor receptor kinase, human TNF, human beta amyloid, ICAM-1 (CD 54), IFN-alpha, IFN-gamma, igE Fc region, IGF-1 receptor, IGF-1, IGHE 17, IL17A, IL F, IL, IL-12, IL-13, IL-17, IL-1 beta, IL-17, IL-52 IL-22, IL-23, IL-31RA, IL-4, IL-5, IL-6 receptor, IL-9, ILGF2, influenza A hemagglutinin, insulin-like growth factor I receptor, integrin alpha 4 beta 7, integrin alpha 4, integrin alpha 5 beta 1, integrin alpha 7 beta 7, integrin alpha IIb beta 3, integrin alpha v beta 3, interferon alpha/beta receptor, interferon gamma induction protein, ITGA2, ITGB2 (CD 18), KIR2D, lewis-Y antigen, LFA-1 (CD 11 a), LINGO-1, lipoteichoic acid, LOXL2, L-selectin (CD 62L), LTA, MCP-1, mesothelin, MIF, MS4A1, MSLN, MUC1, mucin Canag, myelin-associated glycoprotein, myogenesis inhibitory protein, NCA-90 (granulocyte antigen), neuronal apoptosis-regulating protease 1, NGF, N-glycolylneuraminic acid, NOGO-A, notch receptor, NRP1, cave rabbit (Oryctolagus cuniculus), OX-40, oxLDL, PCSK9, PD-1, PDCD1, PDGF-Rα, sodium phosphate cotransporter, phosphatidylserine, platelet-derived growth factor receptor β, prostate cancer cells, pseudomonas aeruginosa (Pseudomonas aeruginosa), rabies glycoprotein, RANKL, respiratory syncytial virus, RHD, rhesus factor, RON, RTN4, sclerostin, SDC1, selectin P, SLAMF7, SOST, sphingosine-1-phosphate, staphylococcus aureus (Staphylococcus aureus), STEAP1, TAG-72, T cell receptor, TEM1, tenascin C, TFPI, TGF- β1, TGF- β2, TGF- α, TRAIL-R1, TRAIL-R2, tumor antigen 16.88, tumor-specific glycosylation of MUC1, tumor-associated calcium signaling protein, EAK 2, VEGFR1, TWAR 1, TWA 2, and VEGFR1, and waveform proteins (VEGFR 1, VEGFR 2).

Additional examples of antigens for the antigen binding portion disclosed herein may include 707-AP, biotinylated molecules, A-Actin-4, abl-bcr alb-B3 (B2 a 2), abl-bcr alb-B4 (B3 a 2), adiposity-related proteins, AFP, AIM-2, annexin II, ART-4, BAGE, B-catenin, bcr-abl p190 (e 1a 2), bcr-abl p210 (B2 a 2), bcr-abl p210 (B3 a 2), BING-4, CAG-3, CAIX, CAMEL, caspase-8, CD171, CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44v7/8, CDC27, CD-4, CDK CEA, CLCA2, cyp-B, DAM-10, DAM-6, DEK-CAN, EGFRvIII, EGP-2, EGP-40, ELF2, ep-CAM, ephA2, ephA3, erb-B2, erb-B3, erb-B4, ES-ESO-1a, ETV6/AML, FBP, fetal acetylcholine receptor, FGF-5, FN, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, GAGE-8, GD2, GD3, gnT-V, gp100, gp75, her-2, HLA-A 0201-R170I, HMW-MAA, HSP 70-2M, HST-2 (FGF 6), HST-2/neu, hTERT, iCE, IL-11R alpha, IL-13R alpha 2, KDR, AA0205, K-RAS, L-1-LAS, LAGE-1, LDR/LDT, LDT-1/FUGE, lewis Y, MAGE-1, MAGE-10, MAGE-12, MAGE-2, MAGE-3, MAGE-4, MAGE-6, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A6, MAGE-B1, MAGE-B2, malic enzyme, mammaglobin-A, MART-1/melanin-A, MART-2, MC1R, M-CSF, mesothelin, MUC1, MUC16, MUC2, MUM-1, MUM-2, MUM-3, myosin, NA88-A, neo-PAP, NKG2D, NPM/ALK, N-RAS NY-ESO-1, OA1, OGT, carcinoembryonic antigen (h 5T 4), OS-9, P polypeptide, P15, P53, PRAME, PSA, PSCA, PSMA, PTPRK, RAGE, ROR1, RU2, SART-1, SART-2, SART-3, SOX10, SSX-2, survivin-2B, SYT/SSX, TAG-72, TEL/AML1, TGFaRII, TGFbRII, TP1, TRAG-3, TRG, TRP-1, TRP-2/INT2, TRP-2-6B, tyrosinase, VEGF-R2, WT1, alpha-folate receptor and kappa-light chain.

Additional examples of antigens of the antigen binding moieties disclosed herein may include antibodies, fragments thereof, or variants thereof. Such antibodies may be natural antibodies (e.g., naturally secreted by immune cells such as B cells of the subject), synthetic antibodies, or modified antibodies. In some cases, an antigen of an antigen binding portion disclosed herein can include an Fc domain of an antibody from the group comprising: 20- (74) - (74) (Mi Latuo bead mab; veltuzumab), 20-2B-2B, 3F8, 74- (20) - (20) (Mi Latuo bead mab; veltuzumab), 8H9, a33, AB-16B5, aba Fu Shan antibody, acipimab, arbitumomab, nimotuzumab, acttopark Shu Shankang, adalimumab, ADC-1013, ADCT-301, ADCT-402, adalimumab, a Du Nashan antibody, aframomumab, AFM13, a Fu Tuozhu mab, AGEN1884, AGS15E, AGS-16C3F, AGS E, pego-alasmazumab, ALD518, alemtuzumab, a Mo Luobu mab, triamtuzumab, amatuximab, AMG 228, AMG 820, amantadine Mo Shankang mefenacetuximab, anetuzumab Shan Kangla tamarin, anilurumab An Luzhu mab, APN301, APN311, apozetimibe mab, algozumab APX003/SIM-BD0801 (cervacizumab), APX005M, acipimox, ARX788, atorvastatin Su Shankang, asenapizumab, ASG-15ME, alemtuzumab, atenolizumab, ATL101, alemtuzumab (also known as tozumab), atropuzumab, avermectin, B-701, bapidizumab, basiliximab, bavisuximab, BAY1129980, BAY1187982, bei Tuo mo-mab, bei Geluo mab, belimumab, bei Nazhu mab, bai Ti mab, bei Suoshan, betalutin (177 Lu-tetan-tetomilast mab), bevacizumab, VZ92 (bevacizumab antibiotic analog), bei Luotuo Shu Shan, BGB-A317, BHQ880, BI 836880, BI-505, biximab, bixilizumab, specific Ma Luren mAb, specific metalizumab, specific valizumab, BIW-8962, bonafizumab, busuzumab, BMS-936559, BMS-986012, BMS-986016, BMS-986148, BMS-986178, BNC101, bercaxezumab, phenytoin Shan Kangwei statin, brevaRex, breuzumab, buduzumab, bromozumab, bu Long Tuozhu mAb, C2-2B, kanamab, canduzumab, carbouzumab, carboxib, carbouzumab, CBR 96-doxorubicin immunoconjugate, CBT124 (bevacizumab), CC-90002, CDX-014, CDX-1401, ceridazumab, celecoxib, cetuximab, cg15001-15022, cg15029-15029, cg150en-15029; CGEN-15052, CGEN-15092, ch.14.18, poxitamab, cetuximab, clavizumab, crizomib, krituximab, tataman, CM-24, cotrastuzumab, kutuximab Shan Kangla tamoxifen, kenatamumab, kang Xizhu mab, cotara (iodine I-131 De Lu Tuo sibutramine), cR6261, krabuzumab, DA-3111 (trastuzumab biosurfactant), daclizumab, darbevacizumab, daratumumab Enhanze (daclizumab), darleukin, de Qu Kushan, denciclizumab, dituximab Shan Kangmo, de Lu Tuo sibutrab, dituzumab, DI-4, dituximab, daclizumab, utilize vomumab, DKN-01, DMOT4039A, attorney MAb, de Luo Tuoshan antibody, DS-1123, DS-8895, du Lituo MAb, duluzumab, exemestane, elkuizumab, eplimumab, ibritumomab, efalizumab, ifenprimab, ifencotuzumab, ideruzumab, exendimab, erltuzumab, ai Ximo MAb, ai Matuo bead MAb, imatuzumab, enatuzumab, eno Shan Kangwei dobutatin, en Mo Shankang pegol, enotuzumab, enrouzumab, enokutuzumab, antuximab, eplimumab, idauzumab, irinotecan, efuzumab, ivermectin, enouzumab, 3924, enoxaprop-4, ai Weishan, fabruzumab, henatuzumab, 4605, enotuzumab, and fabizumab ubiquitin, non-zanomab, FF-21101, FGFR2 antibody-drug conjugate, fibrakun, non-clavulan, phenytoin, feverruczumab, valvulumab, frekuku MAb, aryltozumab, fu Lei Lushan, furanavimab, FPA144, non-sappan MAb, FS102, furanomab, futuximab, gancicumab, ganitumumab, gancicumab, gambirumab, gemtuzumab ozagrimon, golizumab, ji Fuzhu MAb, ji Tuo sibutrab, gbatuzumab Shan Kangwei, GNR-006, GNR-011, golimumab, goliku MAb, GSK2849330, GSK2857916, GSK3174998, GSK3359609, gulicku MAb, 14.18K322A, hu3S193, hu8F4, UK 7, equidambarin, equib, equidambar-5, equib IGN002, IGN523, igofuzumab, IMAB362 (claudiximab), imelurumab, IMC-CS4, IMC-D11, iceromoab, igakutuzumab, IMGN529, IMMU-102 (Yttrium Y-90 epazucchinab) IMMU-114, immuTune IMP701 antagonist antibody, INCAGN1876, enkularab, INCSHR1210, indaxib Shan Kangla tamoxi, indoto Shan Kangwei dobutamine, infliximab, inomab, otozuccab, indomab, intertiarymumab, ipalepb, IPH4102, ipinumab, dacuzumab, I Sha Tuo sibutrab, ai Situo monoclonal antibody, ituzumab, igazuccharuab, JN-56022473, JNJ-61610588, kaliximab, KTN3379, L19/IL 2/L19, ulizumab Bei Tuozhu, ofjoram-95, ulizumab, ofjoumab 525; lanpalivizumab, L-DOS47, lespedezumab Ma Suoshan, rankine-MAb, lu Kutuo-MAb, lespedezumab, li Weishan-MAb, lifazurituximab Shan Kangwei-Dutin, li Gezhu-MAb, lilotomomab sauce-Stant, lituuzu MAb, li Ruilu-MAb, LKZ145, lodicuximab, lo Ji Weishan-MAb, lo Wo Tuozhu-MAb maytansine, lu Kamu-MAb, pego-Lu Lizhu-MAb, lu Xishan-MAb, lu Tuozhu-MAb LY3164530, ma Pamu mab, MAGtuximab, ma Pamu mab, MATUUZHUM, MAVELIMUX, MB311, MCS-110, MEDI0562, MEDI-0639, MEDI0680, MEDI-3617, MEDI-551 (Inelizumab), MEDI-565, MEDI6469, mepozumab, metiuximab, MGB453, MGD006/S Ma Pamu, MGD007, MGD009, MGD011, ma Pamu bead mab-SN-38, minremimumab, sorrow-rituximab, mi Tuomo mab, MK-4166, MM-111, MM-151, MM-302, mo Geli bead mab, MOR202, MOR208, MORAB-066, mo Luomu mab, movezumab, motuximab Shan Kangpa-sofalco, moreoxymab-CD 3, nakelomab tafenamidine, nanorumumab, naproximab Mo Shankang-etaphenytoin, narafatomab, natalizumab, nabar-mab, bezomab, rituximab, naphthalene Mo Lizhu mab, nereimomab, nevacizumab, nituzumab, nawumomab, mercaptomomab, NOV-10, obrituximab, obitumomab You Tuozhu mab, oxcarbatozumab, ond, ondropuzumab, onduzumab, oxlimumab, ofuzumab, oramomab, lomab, omab, OMP-305, OMP-131; onatrazumab, onduximab, omphalimab, mo Tuozhu Shan Kangmo natuximab, ago Fu Shan antibody, octreotide Su Shankang, oxuzumab, OX002/MEN1309, oxepizumab, ozantinizumab, orlizumab, pargemumab, palivizumab, panitumumab, pan Keshan antibody, pan Keshan antibody-GEX, panabamectin, pasatozumab Paracozumab, pertuzumab Qu Tuoshan, PAT-SC1, PAT-SM6, pembrolizumab, pervzbezumab, pertuzumab, peruzumab, PF-05082566 (Wu Tuomi mab), PF-06647263, PF-06671008, PF-06801591, pertuzumab, pinacol Shan Kangwei statin, pertuzumab, plakuuzumab, polobutyrozu Shan Kangwei statin, ponesomab, prizetimab, prituximab, PRO 140, proxinium, PSMA ADC, quinizumab, lei Tuomo mab, lei Qu tomab, lei Weishan antibody, lei Saizumab, ramucirumab, ranibizumab, raschikunomab, rexib MAb, reganizumab, REGN1400, REGN2810/SAR439684, retelizumab, RFM-203, RG7356, RG7386, RG7802, RG7813 RG7841, RG7876, RG7888, RG7986, rituximab, lei Nuku mab, rituximab, RM-1929, RO7009789, luo Tuomu mab, ocimicifugal mab, luo Mo mab, luo Dali bead mab, luo Weizhu mab, lu Lizhu mab, cetuximab, gossypol, sha Mazhu mab, SAR Sha Mazhu, sha Mazhu mab, SAT 012, sha Mazhu moxidectin, SCT200, SCT400, SEA-CD40, secukinumab, span Sha Mazhu mab, sequoyitol Setuxazumab, saxifragab Sha Mazhu, SGN-CD 19-Sha Mazhu-CD 70-LIV 1A, cetuximab, sha Mazhu mab, cetrimab Western Sha Mazhu antibody, sofossa bead Sha Mazhu multi-agent, sofossa bead monoclonal antibody, sta Luma monoclonal antibody, suosuma monoclonal antibody, sha Mazhu monoclonal antibody, SYD985, sofossa bead monoclonal antibody, sofossa monoclonal antibody, sofossa monoclonal antibody, soha antibody, sodama antibody SYM004 (Futuximab and Ztuximab), sym015, TAB08, tabanuzumab, takazumab tetan, tadoluzumab, tali-zumab, tani-zumab, ta5237 toxib, tarituximab, TB-403, tifezumab, teleukin, ti5237 anti-Arrituximab, tinosumab, tinetuximab, tili-zumab, tiprumumab, T-zumab, tituolomab, TG-1303, TGN1412, thorium-227-epazumab conjugate, trimethoprim mab (ticilimiumab), tigezumab, tiramer mab, temozolomide Shan Kangwei, TNX-650, tozumab, tolagumab, tositumomab Sha Tuo, tositumomab, toximomab, tovinitumomab, qu Luolu mab, trastuzumab Shan Kangen tamarin, TRBS07, TRC105, qu Jiazhu mab, trastuzumab, qu Fushan antibody, TRPH 011, TRX518, TSR-042, TTI-200.7, totuzumab Shan Kangxi Mo Baijie, touweimab, U3-1565, U3-1784 Wu Lituo, wu Luolu, wu Ruilu, wu Tuozhu, wu Sinu, vaditumumab Shan Kangda Li Lin, vanadoxostat, vedioxetitumumab, valdecoxib, valirudin, valatizumab, VB6-845, vedolizumab, velutinab, velumomab, velsen kuizumab, velocizumab, fu Luoxi, wo Setuo beads Shan Kangmo fotin, fu Mushan, YYB-101, zalumumab, zanolimumab, zanoluximab, ji Lamu mab and zomozumab apritumumab.

Any of the systems disclosed herein can be used to regulate the expression or activity of an endogenous protein of a cell. Exemplary genes encoding endogenous proteins disclosed herein are provided in tables 1, 2 and 3. Exemplary genes associated with certain diseases and conditions are provided in tables 1 and 2. Examples of signaling genes and polynucleotides associated with biochemical pathways are listed in table 3.

TABLE 1

TABLE 2

TABLE 3 Table 3

Any of the systems and methods disclosed herein can be used to treat a target cell, target tissue, target condition, or target disease in a subject.

The target disease may be a viral, bacterial and/or parasitic infection; inflammatory and/or autoimmune diseases; or neoplasms, such as cancers and/or tumors.

The target cell may be a diseased cell. The diseased cells may have altered metabolic, gene expression, and/or morphological characteristics. The diseased cells may be cancer cells, diabetic cells, and apoptotic cells. The diseased cells may be cells from a diseased subject. Exemplary diseases may include hematological disorders, cancers, metabolic disorders, ocular disorders, organ disorders, musculoskeletal disorders, heart diseases, and the like.

Any of the methods or compositions disclosed herein can be used to kill a variety of target cells. Target cells may include a wide variety of cell types. The target cells may be in vitro. The target cell may be in vivo. The target cells may be ex vivo. The target cell may be an isolated cell. The target cell may be a cell within an organism. The target cell may be an organism. The target cell may be a cell in a cell culture. The target cell may be one of a collection of cells. The target cell may be a mammalian cell or derived from a mammalian cell. The target cell may be a rodent cell or derived from a rodent cell. The target cell may be a human cell or derived from a human cell. The target cells may be prokaryotic cells or derived from prokaryotic cells. The target cell may be a bacterial cell or may be derived from a bacterial cell. The target cell may be an archaebacterium cell or derived from an archaebacterium cell. The target cell may be a eukaryotic cell or derived from a eukaryotic cell. The target cells may be pluripotent stem cells. The target cell may be a plant cell or derived from a plant cell. The target cell may be an animal cell or derived from an animal cell. The target cell may be an invertebrate cell or derived from an invertebrate cell. The target cell may be a vertebrate cell or derived from a vertebrate cell. The target cell may be a microbial cell or derived from a microbial cell. The target cell may be a fungal cell or derived from a fungal cell. The target cells may be from a particular organ or tissue.

The target cells may be stem cells or progenitor cells. Target cells may include stem cells (e.g., adult stem cells, embryonic stem cells, induced Pluripotent Stem (iPS) cells) and progenitor cells (e.g., cardiac progenitor cells, neural progenitor cells, etc.). Target cells may include mammalian stem cells and progenitor cells, including rodent stem cells, rodent progenitor cells, human stem cells, human progenitor cells, and the like. The cloned cells may comprise the progeny of the cells. The target cell may comprise a target nucleic acid. The target cell may be in a living organism. The target cell may be a genetically modified cell. The target cell may be a host cell.

The target cell may be a totipotent stem cell, however, in some embodiments of the present disclosure, the term "cell" may be used, but may not refer to a totipotent stem cell. The target cell may be a plant cell, but in some embodiments of the present disclosure, the term "cell" may be used, but may not refer to a plant cell. The target cell may be a pluripotent cell. For example, the target cell may be a pluripotent hematopoietic cell that may differentiate into other cells in the hematopoietic cell lineage, but may not differentiate into any other non-hematopoietic cells. The target cell may be capable of developing into a whole organism. The target cell may or may not be able to develop into a whole organism. The target cell may be a whole organism.

The target cell may be a primary cell. For example, a culture of primary cells may be passaged 0, 1, 2, 4, 5, 10, 15, or more times. The cell may be a single cell organism. Cells may be grown in culture.

The target cell may be a diseased cell. The diseased cells may have altered metabolic, gene expression, and/or morphological characteristics. The diseased cells may be cancer cells, diabetic cells, and apoptotic cells. The diseased cells may be cells from a diseased subject. Exemplary diseases may include hematological disorders, cancers, metabolic disorders, ocular disorders, organ disorders, musculoskeletal disorders, heart diseases, and the like.

If the target cells are primary cells, they may be harvested from the individual by any method. For example, the white blood cells may be harvested by apheresis, white blood cell separation, density gradient separation, or the like. Cells from tissues such as skin, muscle, bone marrow, spleen, liver, pancreas, lung, intestine, stomach, etc. can be harvested by biopsy. Suitable solutions may be used for dispersion or suspension of the harvested cells. Such solutions may typically be balanced salt solutions (e.g., physiological saline, phosphate Buffered Saline (PBS), hank balanced salt solution, etc.), conveniently supplemented with fetal bovine serum or other naturally occurring factors, combined with an acceptable buffer at low concentrations. Buffers may include HEPES, phosphate buffer, lactate buffer, and the like. The cells may be used immediately, or they may be stored (e.g., by freezing). Frozen cells may be thawed and may be able to be reused. Cells can be frozen in DMSO, serum, medium buffers (e.g., 10% DMSO, 50% serum, 40% buffered medium), and/or some other such commonly used solutions for preserving cells at freezing temperatures.

Non-limiting examples of cells that can be targeted cells include, but are not limited to, lymphoid cells such as B cells, T cells (cytotoxic T cells, natural killer T cells, regulatory T cells, T helper cells), natural killer cells, cytokine-induced killing (CIK) cells (see, e.g., US 20080241194); myeloid cells such as granulocytes (basophils, eosinophils, neutrophils/polymorphonuclear neutrophils), monocytes/macrophages, erythrocytes (reticulocytes), mast cells, platelets/megakaryocytes, dendritic cells; cells from the endocrine system, including thyroid (thyroid epithelial cells, follicular paracellular), parathyroid (parathyroid main cells, parathyroid eosinophils), adrenal (pheochromocytes), pineal (pineal cells) cells; cells of the nervous system, including glial cells (astrocytes, microglia), large cell neurosecretory cells, astrocytes, burchel cells and pituitary (gonadotrophin cells, corticotropin cells, thyrotropin cells, voxel cells, prolactin cells); cells of the respiratory system, including lung cells (type I lung cells, type II lung cells), clara cells, goblet cells, dust cells; cells of the circulatory system, including cardiomyocytes, pericytes; cells of the digestive system, including the stomach (gastric primary cells, peripheral cells), goblet cells, paneth cells, G cells, D cells, ECL cells, I cells, K cells, S cells; enteroendocrine cells including enterochromaffin cells, APUD cells, liver (hepatocytes, liver macrophages), cartilage/bone/muscle; bone cells, including osteoblasts, osteocytes, osteoclasts, teeth (cementoblasts, enamel cells); chondrocytes, including chondroblasts, chondrocytes; skin cells, including hair cells, keratinocytes, melanocytes (nevus cells); muscle cells, including muscle cells; urinary system cells including podocytes, peribulbar cells, mesangial/extraglomerular cells, renal proximal tubule brush border cells, compact plaque cells; cells of the reproductive system, including sperm, supporting cells, testicular interstitial cells, ova; other cells including adipocytes, fibroblasts, tendinocytes, epidermal keratinocytes (differentiated epidermal cells), epidermal basal cells (stem cells), nail and toenail keratinocytes, nail bed basal cells (stem cells), medullary hair stem cells, cortical hair stem cells, horny layer hair root sheath cells, hunter sheath cells of the Hunter layer, outer hair root sheath cells, hair matrix cells (stem cells), moisture-stratified barrier epithelial cells, surface epithelial cells of the multilayer squamous epithelium of the cornea, tongue, mouth, esophagus, anal canal, distal urethra and vagina, basal cells (stem cells) of the epithelium of cornea, tongue, mouth, esophagus, anal canal, distal urinary tract and vagina, urothelial cells (lining bladder and urinary canal), exocrine secretory epithelial cells, salivary gland mucous cells (polysaccharide-rich secretion), salivary gland serum cells (glycoprotein-rich enzyme secretion), fengai buna gland cells in tongue (cleansing taste bud), breast cells (milk secretion), lacrimal gland cells (lacrimal secretion), cerumen gland cells in ear (wax secretion), exocrine sweat gland dark cells (glycoprotein secretion), exosweat gland clear cells (small molecule secretion), apocrine sweat gland cells (odorous substance secretion, sex hormone sensitivity), mo Erxian cells in eyelid (specialized sweat gland), sebaceous gland cells (lipid-rich sebum secretion), baumann gland cells in the nose (cleansing olfactory epithelium), and the like, brenner gland cells (enzyme and alkaline mucus) in the duodenum, seminal vesicle cells (secretion of semen components, including fructose for swimming sperm), prostate cells (secreting semen components), bulbar urinary gland cells (secreting mucus), papanicolaou gland cells (secreting vaginal lubrication), li Telei gland cells (secreting mucus), endometrial cells (secreting carbohydrates), isolated goblet cells of the respiratory and digestive tracts (secreting mucus), gastric mucosal mucus cells (secreting mucus), gastric gland gastric enzyme cells (secreting pepsinogen), gastric gland wall cells (secreting hydrochloric acid), pancreatic acinar cells (secreting bicarbonate and digestive enzymes), paneth cells of the small intestine (secreting lysozyme), type II lung cells of the lung (secreting surface active substances), clara cells of the lung, hormone secreting cells anterior pituitary cells, voxel-promoting cells, lactogen cells, thyrotropin cells, gonadotrophin cells, corticotropin cells, middle pituitary cells, large cell nerve secreting cells, intestinal and respiratory cells, thyroid epithelial cells, follicular paracellular, parathyroid cells, parathyroid main cells, parathyroid eosinophils, adrenal cells, pheochromocytes, leydig cells of the testes, endomembrane cells of the follicles, corpus luteum cells of ruptured follicles, granular corpus luteum cells, follicular membrane corpus luteum cells, peribulbar cells (renin secretion), dense plaque cells of the kidneys, metabolic and storage cells, barrier function cells (lung ), intestinal, exocrine glands and genitourinary tract), kidney, type I lung cells (lining air cavities of the lung), pancreatic duct cells (acinar cells), non-striated duct cells (non-striated duct cells of sweat glands, salivary glands, mammary glands, etc.), ductal cells (ductal cells of seminal vesicles, prostate, etc.), epithelial cell lining closed internal body cavities, ciliated cells with propulsion function, extracellular matrix secreting cells, contractile cells; skeletal muscle cells, stem cells, cardiomyocytes, blood and immune system cells, erythrocytes (erythrocytes), megakaryocytes (platelet precursors), monocytes, connective tissue macrophages (of various types), epidermal langerhans cells, osteoclasts (in bone), dendritic cells (in lymphoid tissue), microglial cells (in the central nervous system), neutrophils, eosinophils, basophils, mast cells, helper T cells, suppressor T cells, cytotoxic T cells, natural killer T cells, B cells, natural killer cells, reticulocytes, stem cells and committed progenitors of the blood and immune system (of various types), pluripotent stem cells, totipotent stem cells, induced pluripotent stem cells, adult stem cells, sensory sensor cells, autonomic neurons, sensory organs and peripheral neuron support cells, central nervous system neurons and glial cells, lens cells, pigment cells, melanocytes, retinal pigment epithelium, germ cells, organelles/oocytes, sperm cells, spermatocytes, spermatogenic cells (spermatocytes), testicular cells, glandular cells, thymic cells, mesenchyme cells, sperm cells, and sperm cells.

Cancer cells are of particular concern. In some embodiments, the target cell is a cancer cell. Non-limiting examples of cancer cells include cells of cancer, cancers include acanthoma, acinar cell carcinoma, auditory neuroma, acrofreckle-like melanoma, acrospirama, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute myeloblastic leukemia with maturation, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, enamel tumor, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenoid tumor, adrenal cortical carcinoma, adult T cell leukemia, invasive NK cell leukemia, AIDS-related cancer, AIDS-related lymphoma, soft tissue acinar sarcoma, ameloblastic fibroma, rectal cancer, anaplastic large cell lymphoma, undifferentiated thyroid carcinoma, angioimmunoblastic T cell lymphoma, angiomyolipoma, angiosarcoma appendix tumor, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, basal-like carcinoma, B-cell leukemia, B-cell lymphoma, berini ductal carcinoma, biliary tract carcinoma, bladder carcinoma, blastoma, bone carcinoma, bone tumor, brain stem glioma, brain tumor, breast carcinoma, brenner tumor, bronchial tumor, bronchioloalveolar carcinoma, brown tumor, burkitt lymphoma, cancer of unknown primary origin, carcinoid tumor, carcinoma in situ, penile carcinoma, unknown primary origin, carcinoma sarcoma, kasmann disease, central nervous system embryonoma, cerebellar astrocytoma, cerebral astrocytoma, cervical carcinoma, biliary epithelium carcinoma, chondroma, chondrosarcoma, chordoma, choriocarcinoma, chorioallantoic papilloma, chronic lymphocytic leukemia, chronic monocytic leukemia, chronic myelogenous leukemia, carcinoma, chronic myeloproliferative disease, chronic neutrophil leukemia, clear cell tumor, colon cancer, colorectal cancer, craniopharyngeal carcinoma, cutaneous T-cell lymphoma, degos ' disease, carina-type dermatofibrosarcoma, epidermoid cyst, connective tissue proliferative microcylindrical tumor, diffuse large B-cell lymphoma, embryonic dysplastic neuroepithelial tumors, embryonic carcinoma, endodermal sino, endometrial carcinoma, ovarian endometrioid tumor, enteropathy-associated T-cell lymphoma, ependymal blastoma, ependymal tumor, epithelioid sarcoma, erythroleukemia, esophageal carcinoma, nasal glioma, ewing's tumor family, ewing's family sarcoma, ewing's sarcoma, extracranial nerve cell tumor, extrahepatic duct carcinoma, extramammary paget's disease, fallopian tube carcinoma, fetal embryo, fibroma, fibrosarcoma follicular lymphoma, follicular thyroid carcinoma, gall bladder carcinoma, ganglioglioma, ganglioma, gastric cancer, gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, blastoma, germ cell tumor, gestational choriocarcinoma, gestational trophoblastoma, bone giant cell tumor, glioblastoma multiforme, glioma, cerebral glioma disease, angiogloboma, glucagon tumor, gonadoblastoma, granulomatosis, hairy cell leukemia, head and neck cancer, heart cancer, angioblastoma, vascular crust cell tumor, angiosarcoma, myelomalignancy, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, hereditary breast cancer ovarian cancer syndrome, hodgkin lymphoma, hypopharyngeal carcinoma, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell cancer, islet cell tumor, juvenile myelomonocytic leukemia, kaposi's sarcoma, renal cancer, klatsky's tumor, kunkin's tumor, laryngeal cancer, malignant freckle-like melanoma, leukemia, lip and mouth cancer, liposarcoma, lung cancer, luteal tumor, lymphomas, lymphotube sarcoma, lymphoepithelial tumors, lymphoid leukemia, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, bone malignant fibrous histiocytoma, malignant glioma, malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rhabdoid tumor, malignant salamander tumor, MALT lymphoma, mantle cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid tumor, medulloblastoma, megaloblastic tumor medullary epithelioma, melanoma, meningioma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, metastatic urothelial carcinoma, miylor-type mixed tumor, monocytic leukemia, oral cancer, myxoma, multiple endocrine tumor syndrome, multiple myeloma, mycosis fungoides, myelodysplastic diseases, myelodysplastic syndrome, myeloid leukemia, myeloid sarcoma, myeloproliferative disease, myxoma, nasal cancer, nasopharyngeal cancer, neoplasm, schwannoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-hodgkin's lymphoma, non-melanoma skin cancer, non-small cell lung cancer, ocular tumor, parathyroid cancer, penile cancer, perivascular epithelial-like cell tumor, pharyngeal cancer, pheochromocytoma, mesogenic pineal parenchymal tumor, and pineal blastoma, pituitary cytoma, pituitary adenoma, pituitary tumor, plasmacytoma parathyroid cancer, penile cancer, perivascular epithelial-like cytoma, pharyngeal cancer, pheochromocytoma, mesogenic pineal parenchymal tumor, pineal blastoma, pituitary cytoma, pituitary adenoma, pituitary tumor, plasmacytoma pleural and pulmonary blastomas, multiple blastomas, precursor T lymphoblastic lymphomas, primary central nervous system lymphomas, primary effusion lymphomas, primary hepatocellular carcinoma, primary liver cancer primary peritoneal carcinoma, primary neuroectodermal tumors, prostate cancer, pseudomyxoma peritoneal, rectal cancer, renal cell carcinoma, respiratory tract cancer involving the NUT gene on chromosome 15, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, richterse transformation, sacral caudal teratoma, salivary gland carcinoma, sarcoma, schwannoma, sebaceous gland carcinoma, secondary tumors, seminoma, serous tumors, seltoril-Leide cell tumor, sex cord mesoma, szecheny syndrome, seal ring cell carcinoma, skin carcinoma, small blue cell tumor, small cell carcinoma, small cell lung carcinoma, small cell lymphoma, small intestine carcinoma, soft tissue sarcoma, somatostatin tumor, soot warts, spinal cord tumor, splenic marginal zone lymphoma, squamous cell carcinoma, gastric carcinoma, superficial diffuse melanoma, supratentorial primary neuroectodermal tumor, superficial mesothelioma, sedge tumor, synovial sarcoma, T cell acute lymphoblastic leukemia, T cell macroparticle lymphoblastic leukemia, T cell lymphoma, T cell prolymphocytic leukemia, teratoma, terminal lymphoma, testicular cancer, follicular cytoma, laryngeal carcinoma, thymus cancer, thymoma, thyroid cancer, renal pelvis and ureter transitional cell carcinoma, umbilical duct carcinoma, urinary tract carcinoma, genitourinary tumor, uterine sarcoma, uveal melanoma, vaginal carcinoma, frena-mollissen syndrome, warty cancer, visual pathway glioma, vulval carcinoma, waldenstrom macroglobulinemia, wo Xinliu, wilms' tumor, and combinations thereof. In some embodiments, the targeted cancer cells represent a subpopulation within a population of cancer cells, such as cancer stem cells. In some embodiments, the cancer belongs to the hematopoietic lineage, such as lymphoma. The antigen may be a tumor-associated antigen.

In some cases, the subject may have or may be suspected of having an autoimmune disease. Non-limiting examples of autoimmune diseases may include Acute Disseminated Encephalomyelitis (ADEM), acute necrotizing hemorrhagic leukoencephalitis, addison's disease, agaropectinemia, allergic asthma, allergic rhinitis, alopecia areata, amyloidosis, ankylosing spondylitis, antibody-mediated graft rejection, anti-GBM/anti-TBM nephritis, anti-phospholipid syndrome (APS), autoimmune angioedema, autoimmune aplastic anemia, autoimmune autonomic nerve dysfunction, autoimmune hepatitis, autoimmune hyperlipidemia, autoimmune immunodeficiency, autoimmune Inner Ear Disease (AIED), autoimmune myocarditis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune Thrombocytopenic Purpura (ATP), autoimmune thyroid disease autoimmune urticaria, axons and neuronal neuropathies, baluo disease, behcet's disease, bullous pemphigoid, cardiomyopathy, kalman's disease, celiac disease, trypanosomiasis, chronic fatigue syndrome, chronic Inflammatory Demyelinating Polyneuropathy (CIDP), chronic Recurrent Multifocal Osteomyelitis (CRMO), allergic granulomatous vasculitis, cicatricial pemphigoid/benign mucosal pemphigoid, crohn's disease, covan syndrome, condensed hormonal diseases, congenital heart block, coxsackie viral myocarditis, CREST disease, idiopathic mixed cryoglobulinemia, demyelinating neuropathy, dermatitis herpetiformis, dermatomyositis, de-vic disease (neuromyelitis optica), discoid lupus, post myocardial infarction syndrome, endometriosis, eosinophilic fasciitis, melon vine entanglement, experimental allergic encephalomyelitis, evan's syndrome, fibromyalgia, fibroalveolar inflammation, giant cell arteritis (temporal arteritis), glomerulonephritis, pneumococcal nephritis syndrome, granulomatous Polyangiitis (GPA), graves ' disease, guillain-Barre syndrome, hashimoto's encephalitis, hashimoto thyroiditis, hemolytic anemia, allergic purpura, herpes gestation, hypogammaglobulinemia, gao Bingqiu proteinemia, idiopathic Thrombocytopenic Purpura (ITP), igA nephropathy, igG 4-related sclerotic diseases, immunoregulatory lipoproteins, inclusion body myositis, inflammatory bowel disease, insulin dependent diabetes mellitus (type 1), interstitial cystitis, juvenile arthritis, juvenile diabetes, kawasaki syndrome lambert-eaton syndrome, white blood cell dividing vasculitis, lichen planus, lichen sclerosus, wood-like conjunctivitis, linear IgA disease (LAD), lupus (SLE), lyme disease, meniere's disease, microscopic polyangiitis, mixed Connective Tissue Disease (MCTD), meaningless Monoclonal Gammaglobulinosis (MGUS), keratolytic ulceration, mucha Habermann disease, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neuromyelitis optica (Devic's disease), neutropenia, ocular cicatricial pemphigoid, optic neuritis, recurrent rheumatism, PANDAS (pediatric autoimmune neuropsychiatric conditions associated with streptococci), paraneoplastic cerebellar degeneration, paroxysmal sleep hemoglobinuria (PNH), pa-Luo Ershi syndrome, parsonnage-Turner syndrome, pars plana (uveitis intermedia), pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia, POEMS syndrome, polyarteritis nodosa, autoimmune polycystic glandular syndrome types I, II and III, polymyositis rheumatica, polymyositis, post myocardial infarction syndrome, post pericardial osteotomy syndrome, progestogenic dermatitis, primary biliary cirrhosis, primary sclerosing cholangitis, psoriasis, psoriatic arthritis, idiopathic pulmonary fibrosis, pyoderma gangrene, pure red cell regeneration disorder, raynaud's phenomenon, reflex sympathetic neurotrophic disorder, lyter's syndrome, recurrent polychondritis, restless lower limb syndrome retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, schmitt syndrome, scleritis, scleroderma, sjogren's syndrome, sperm and testis autoimmunity, stiff person syndrome, subacute Bacterial Endocarditis (SBE), susac syndrome, sympathoophthalmitis, aortic inflammation, temporal arteritis/giant cell arteritis, thrombocytopenic purpura (TTP), toloxa-hunter syndrome, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease (uccd), uveitis, vasculitis, vesicular bullous dermatosis, vitiligo, waldenstrom's Macroglobulinemia (WM) and wegener's granulomatosis (granulomatosis polyangiitis (GPA)).

In some cases, the autoimmune disease comprises one or more members selected from the group consisting of: rheumatoid arthritis, type 1 diabetes mellitus, systemic lupus erythematosus (lupus or SLE), myasthenia gravis, multiple sclerosis, scleroderma, additively disease, bullous pemphigoid, pemphigus vulgaris, gill-barre syndrome, sjogren's syndrome, dermatomyositis, thrombotic thrombocytopenic purpura, gao Bingqiu proteinemia, unknown Monoclonal Gammaglobulinopathy (MGUS), waldenstrom's Macroglobulinemia (WM), chronic Inflammatory Demyelinating Polyneuropathy (CIDP), hashimoto's disease (HE), hashimoto's thyroiditis, graves 'disease, wegener's granulomatosis, and antibody-mediated graft rejection (e.g., for tissue grafts such as kidney grafts). In examples, the autoimmune disease may be type 1 diabetes, lupus, or rheumatoid arthritis.

In some cases, the target cells form a tumor (i.e., a solid tumor). Tumors treated with the methods herein can result in stable tumor growth (e.g., one or more tumors increase in size by no more than 1%, 5%, 10%, 15% or 20%, and/or do not metastasize). In some cases, the tumor is stabilized for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more weeks. In some cases, the tumor is stabilized for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months. In some cases, the tumor is stabilized for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years. In some cases, the size of the tumor or the number of tumor cells is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more. In some cases, the tumor is completely eliminated or reduced below the detection level. In some cases, the subject remains tumor-free (e.g., in remission) for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more weeks after treatment. In some cases, the subject remains tumor-free for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months after treatment. In some cases, the subject remains tumor-free for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years after treatment.

Examples

Example 1: CAR T cells conditionally secrete endogenous IL-12 to treat cancer or tumor

Interleukin (IL) -12 can activate T cells and macrophages, turning a switch that converts chronic inflammation into acute inflammation, and can lead to cancer rejection. However, despite the powerful antitumor effects in preclinical models, the clinical use of IL-12 (e.g., recombinant IL-12) may be limited by a number of side effects, such as severe systemic toxicity. Thus, a conditional, antigen-dependent, non-genetically edited CRISPR activation (CRISPR) loop capable of activating or upregulating endogenous IL-12 expression of an engineered immune cell (e.g., CAR T cell) can be used to promote autocrine activation of the engineered immune cell.

CAR T cell design

T cells can be engineered to express a CAR (i.e., CAR T cells), as shown in fig. 5. CAR T cells can express CARs designed to bind to HER2 of a specific antigen, such as a tumor cell. Subsequent receptor modification of the CAR after HER2 binds to the CAR can trigger the intracellular activity of the CAR T cell to modulate the expression or activity of endogenous IL-12 of the CAR T cell (fig. 5, left). The CAR T cells can be engineered to express a CAR (e.g., comprising an antigen binding scFv, a transmembrane domain, and an intracellular domain comprising CD28, CD3 ζ, and TEV protease) and a chimeric adapter (e.g., comprising a LAT fused to a dCas9-VPR actuation moiety via a TEV cleavable site), the CAR and chimeric adapter being operatively coupled to each other. In the absence of antigen of the CAR ("no antigen"), the chimeric adapter cannot be recruited to the CAR, so the actuation moiety can remain coupled to the chimeric adapter and remain inactive (fig. 5, middle). In contrast, in the presence of antigen of the CAR ("+ antigen), the chimeric adapter can be recruited to the CAR, allowing the TEV protease of the CAR to cleave the actuating moiety from the chimeric adapter to activate the actuating moiety (in combination with the sgRNA) to complex with the endogenous gene encoding IL-12, thereby activating or enhancing expression of endogenous IL-12 (fig. 5, right).

Non-engineered cells can be used as controls. CAR T cells lacking sgrnas can be used as different controls.

B. Guide RNA sequences

Based at least in part on the TSS nucleotide sequence of human IL-12A (SEQ ID NO. 1): GCTTTCATTTTGGGCCGAGCTGGA one or more guide RNAs are designed.

Based at least in part on the TSS nucleotide sequence of human IL-12B (SEQ ID NO. 2): AGAAGAAACAACATCTGTTTCAGG one or more guide RNAs are designed.

Generation of CAR T cells

CAR T cells are engineered to conditionally express IL-12 heterodimers via conditional transcription of their two endogenous subunits, p35 and p 40. The first expression cassette encodes a lentiviral construct encoding an anti-HER 2 (4D 5) single-chain variable fragment, wherein the CD28 and CD3 ζ co-stimulatory domains are linked to a Tobacco Etch Virus (TEV) protease and two single guide RNAs (sgrnas) targeting the IL-12A or IL-12B promoter regions (i.e., IL12Asg, IL12 Bsg), as shown in fig. 6 (i.e., LV # 1). The second expression cassette encodes a linker for activating T cells that is complexed with nuclease-inactivated/dead Cas9 (dCas 9) -VP64-p65-Rta (dCas 9-VPR) transcriptional activator (VPR) via a TEV cleavable linker (LdCV), as shown in fig. 6 (i.e., LV # 2). Upon binding of the CAR to HER2, activation of the CAR and subsequent receptor modification can bring the TEV of the CAR close to the ldcr, releasing dCas9-VPR for nuclear localization to regulatory regions, and conditionally and reversibly inducing nanoscale expression of the p70 heterodimer (i.e., IL-12).

D. Regulated expression of endogenous cytokines

Isolated T cells from human donors were engineered with the constructs shown in fig. 6 to generate CAR T cells (i.e., RG1874, RG 1654) as disclosed herein. CAR T cells are incubated with beads (e.g., polymeric beads, magnetic beads, etc.) coated with HER2 extracellular domain (e.g., at high surface density) to activate the CAR T cells. The ratio of beads to CAR T cells (e.g., the number of beads to the number of CAR T cells) is about 1:1 ("HER 2 1:1") or 2:1 ("HER 2:1"). Subsequently (e.g., after 3 days), the expression (or secretion) of endogenous IL-12 and endogenous ifnγ is measured from the cells (e.g., via an enzyme-linked immunosorbent assay or "ELISA"). In two engineered human CAR T cells (RG 1874, RG 1654) comprising dCAS9-VPR actuating portions, secretion of endogenous IL-12 was enhanced in the presence of guide RNA ("IL 12 sg") for IL-12A and IL-12B, as compared to the absence of guide RNA ("NOsg"). In RG1874 CAR T cells, secretion of endogenous IL-12 was enhanced when activated by HER 2-beads at a 1:1 bead to cell ratio and a 2:1 bead to cell ratio (FIG. 7A). In RG1874 CAR T cells, secretion of endogenous IFNγ was enhanced when activated by HER 2-beads at a 1:1 bead to cell ratio and 2:1 bead to cell ratio (FIG. 7C). In RG1654 CAR T cells, secretion of endogenous IL-12 was enhanced when activated by HER 2-beads at a 1:1 bead to cell ratio and a 2:1 bead to cell ratio (FIG. 7B). In RG1654 CAR T cells, secretion of endogenous IFNγ was enhanced when activated by HER 2-beads at a 1:1 bead to cell ratio and 2:1 bead to cell ratio (FIG. 7D).

E. Target sequence dependence

The first guide RNA ("# 38") was designed to target the IL-12A gene TSS (SEQ ID NO. 1). The second guide RNA ("# 49") and the third guide RNA ("# 55") were designed to target different regions of the IL-12B gene TSS (SEQ ID NO. 2). As discussed above, CAR-T cells are produced with (i) no guide RNA ("NOsg"), (ii) multiple IL-12gRNA with #48 and #49gRNA, and (iii) multiple IL-12gRNA with #48 and #55 gRNA. Upon activation by HER2 presenting beads, the #38+ #49 multiple gRNA system induced higher levels of endogenous IL12 secretion than the #38+ #55 multiple gRNA system, indicating which region of TSS of each gene was important to target.

F. Activation of CAR T cells by tumor cells

As discussed above, CAR-T cells are produced in the presence of (i) no guide RNA ("NOsg") or (ii) multiple gRNAs for IL-12A TSS and IL-12B TSS ("IL 12 sg"). Non-engineered human donor T cells were also used as controls ("NTs"). CAR T cells were cultured with her2+fadu cells (hypopharyngeal carcinoma cell line) to activate CAR T cells. After activation of FaDu cells, CAR-T cells containing multiple grnas exhibited the highest degree of endogenous IL-12 and ifnγ expression (fig. 9A).

To confirm the effect of secreted IL12, control anti-HER 2 CAR T cells were generated without an activating moiety and guide RNA against the IL12 gene ("her2.car-T"), and CAR T cells were incubated with either (i) her2+fadu cells engineered to constitutively express IL-12 (p 70, p35 and p40 heterodimers) ("FaDuIL 12") or (ii) her2+fadu cells without any modified expression of IL-12 ("FaDu") (the ratio of CAR T cells to FaDu cells was about 1:1). As expected, faDuIL12 cells secreted more IL-12 on day 3 than control FaDu cells (FIG. 9B, left). In addition, since IL-12 secreted by FaDuIL12 cells activated CAR T cells, higher levels of ifnγ secretion were observed on day 3 when CAR T cells were incubated with FaDuIL12 cells (fig. 9B, right).

G. Targeting FaDu tumor cells

As discussed above, CAR-T cells are produced in the presence of (i) no guide RNA ("NOsg") or (ii) multiple gRNAs for IL-12A TSS and IL-12B TSS ("IL 12 sg"). Non-engineered human donor T cells were also used as controls ("NTs"). Cells were cultured with her2+fadu cells that did not constitutively express IL-12 (CAR T cells to FaDu cells ratio of about 1:1). CAR T cells capable of conditionally enhancing expression of endogenous IL12 upon binding to HER2 (IL 12sg cells) showed the greatest decrease in the number of FaDu tumor cells after about 3 days (fig. 10A, left). In addition, IL12sg CAR T cells showed the greatest degree of cell proliferation after about 3 days (fig. 10A, right).

To assess the significance of relying on endogenous IL-12 expression of CAR T cells, control anti-HER 2 CAR T cells without activating moiety and sgRNA molecules ("her2.car-T") were cultured with FaDu cells or FaDuIL12 cells, as discussed above. When CAR T cells were unable to conditionally regulate expression of endogenous IL12, the presence of IL-12 secreted by FaDuIL12 cells alone was insufficient to enhance tumor cytotoxicity of CAR T cells after about 3 days (fig. 10B, left). FaDuIL12 cells promote enhanced proliferation of CAR T cells compared to FaDu cells.

H. Targeting MDAMB231 tumor cells

Similarly, control human donor T cells ("NTs"), CAR T cells without IL-12 multiple gRNA ("NOsg"), and CAR T cells with IL-12 multiple gRNA ("IL 12 sg") were cultured with her2+mdamb231 tumor cells for about 3 days (ratio of CAR T cells to MDAMB231 cells about 1:1 or 1:3). CAR T cells capable of conditionally enhancing endogenous IL12 expression upon binding to HER2 (IL 12sg cells) exhibited the highest endogenous IL12 expression levels (fig. 11A). IL12sg cells showed the highest endogenous IFN gamma expression levels (FIG. 11B). IL12sg cells showed the highest endogenous TNFα expression levels (FIG. 11C). IL12sg cells exhibited a decrease in IL-2 expression (or secretion) as compared to NOsg control cells.

In addition, after CAR T cells were cultured with MDAMB231 tumor cells, the number of remaining MDAMB231 tumor cells (as an indication of tumor cytotoxicity of CAR T cells) and the number of CAR T cells (as an indication of CAR T cell proliferation) were measured on days 3 and 6. Minimal numbers of tumor cells were observed when incubated with CAR T cells capable of conditionally enhancing endogenous IL12 expression after binding to HER2 (IL 12sg cells) for about 3 days or 6 days (fig. 12A and 12C). IL12sg cells also exhibited a greater degree of cell proliferation compared to control NOsg CAR T cells (FIGS. 12B and 12D).

I. Tumor reduction in vivo

CAR T cells (IL 12sg cells) capable of conditionally enhancing endogenous IL12 expression upon binding to HER2 were tested in mice with established tumors derived from FaDu cells (FaDu xenografts). FaDu cells (about 5X10 ⁶ The FaDu cells) were inoculated subcutaneously into CB17 SCID mice. Animals with similarly sized tumors were randomized to the following treatment cohort (n=9/group): vehicle (e.g., buffer), IL12sg cells (e.g., about 1x10 ⁵ Up to about 1x10 ⁶ Individual cells/kg), and control NOsg cells (e.g., about 1x 10) ⁵ Up to about 1x10 ⁶ Individual cells/kg). Treatment was administered on the day of randomization (e.g., intravenous administration) and continued weekly for a total of four treatments. During the study, tumors were measured twice weekly with calipers. The persistence of CAR T cells in blood was measured at different time points. Conditional expression of endogenous IL-12 by CAR T cells (after binding to HER2 in tumor xenografts) can promote enhanced persistence in blood and enhanced tumor killing in vivo.

Without wishing to be bound by theory, the conditional induction of expression of Th1 polarized components such as endogenous IL-12, and its subsequent activation of CAR-T cells (i.e., the conditional induction of autocrine IL-12 signaling) can increase the efficacy of reprogramming CAR-T cells by combining enhanced effector function with the suitability of the cells. At the same time, the autocrine effects of nanoscale IL-12 can limit the risk of extravasation and systemic toxicity.

Example 2: screening for guide RNA that modulates endogenous IL-12

Transfection of Jurkat cells

IL-2 may be an essential inducer of Th1 cell development. IL-12 is a heterodimer composed of 2 subunits, these 2 subunits being encoded by two separate genes: IL-12 beta (P40) and IL-12 alpha (P35). In some cases, to successfully secrete IL-12, both genes may need to be transcribed and both proteins may need to be produced to together form the complete (e.g., functional) P70 protein.

Jurkat cells (immortalized lines of human T lymphocytes) were transfected with a combination of a vector encoding dCAS9-VPR and multiple gRNAs designed to bind different target polynucleotide sequences of the gene encoding IL-12 (e.g., about 500 nanograms (ng) to about 1 microgram (μg) of each vector for transfection). The vector was transfected (e.g., using Invitrogen Neon electroporation, voltage 1325, width 30, and pulse 1). Prior to measuring cytokine secretion, cells are plated (e.g., in 96-well plates) in a medium (e.g., RPMI1640+10% fcs) and incubated (e.g., 48-72 hours at 37 ℃) to assess the feasibility and effectiveness of one or more grnas of the plurality of anti-IL-12 grnas.

B. Measurement of cytokine secretion

To measure cytokines secreted by transfected Jurkat cells, supernatants were collected from Jurkat cell cultures and subjected to an enzyme-linked immunosorbent assay (ELISA), e.g., using an Invitrogen ELISA kit. The P40 kit was used to measure secretion of P40 (IL-12β), and the P70 kit (IL-12α+β) was used to measure secretion of all cytokines.

C.gRNA screening

In some examples, can test for IL-12A (p 35) design of gRNA (for example, in the test for IL-12B (p 40) design of gRNA before).

In some examples, can test for IL-12B (p 40) design of gRNA (for example, in the test for IL-12A (p 35) design of gRNA before).

In some examples, one or more grnas designed for IL-12A (p 35) and one or more grnas designed for IL-12B (p 40) can be tested together.

In some examples (as shown in FIG. 13A), a gRNA designed for IL-12A (p 35) can be tested, and the combination of an anti-IL-12A gRNA set (e.g., the most advanced gRNA) with multiple gRNAs for IL-12B (p 40) can be tested to identify an anti-IL-12 BgRNA set (e.g., the most advanced gRNA). Thus, the anti-IL-12A gRNA pool and the anti-IL-12B gRNA pool can be used together to regulate the expression or activity of IL-12 in target cells.

In some examples (as shown in FIG. 13B), a gRNA designed for IL-12B (p 40) can be tested, and the anti-IL-12B gRNA pool (e.g., the most advanced gRNA) can be tested in combination with a plurality of gRNAs for IL-12A (p 35) to identify the anti-IL-12 AgRNA pool (e.g., the most advanced gRNA). Thus, the anti-IL-12B gRNA repertoire and the anti-IL-12A gRNA repertoire can be used together to regulate the expression or activity of IL-12 in target cells.

D. Screening results

anti-IL-12 gRNA screening was performed in 2 steps. First, jurkat cells were used for IL-12BgRNA screening, as this subunit can be secreted and detected as a monomer (e.g., by ELISA). Screening was performed by transfection of putative gRNA together with dCAS 9-VPR. About 100 gRNAs designed for IL-12B were analyzed. Cytokine secretion was measured using ELISA, as provided herein. Screening experiments (e.g., 3 screening experiments) were performed and several grnas capable of activating IL-12B transcription were identified. The most leading gRNA for IL-12B exhibits complementarity to a region near the IL-12B gene transcription start point (TSS) (e.g., within 300 bases upstream of the TSS), as shown by the arrow in fig. 14A.

Next, to screen the gRNA of the IL-12A gene, jurkat cells were transfected with a combination of the leading IL-12BgRNA, dCAS9-VPR, and putative IL-12A gRNA. Subsequently, intact IL-12 (P70) cytokine secretion was measured by ELISA. Several potent anti-IL-12A gRNAs were identified. With a few exceptions/outliers, the most advanced gRNA for IL-12A exhibits complementarity to a region near the IL-12A gene transcription start point (TSS) upstream (e.g., within 250 bases upstream of the TSS), as shown by the arrow in fig. 14B.

A collection of grnas (e.g., 2-3 grnas) for each gene was selected and tested in different combinations to verify their activity in Jurket cells (see fig. 15). The expression level of IL-12 (P70) exhibited using a combination of anti-IL-12A gRNA and anti-IL-12B gRNA (see 38+55 in FIG. 15) is about 10 to about 15 times (e.g., about 10, 11, 12, 13, 14, or 15 times) the expression level of IL-12 (P70) exhibited with only a single gRNA for IL-12A or IL-12B (see 55, 50, and 38 in FIG. 15). IL-12 (P70) expression levels exhibited using a combination of anti-IL-12A gRNA and anti-IL-12B gRNA (see 38+55 in FIG. 15) are about 2 to about 10 times (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10 times) the IL-12 (P70) expression levels exhibited using a different combination of anti-IL-12A gRNA and anti-IL-12 BgRNA (see 50+55, 50+49, or 38+49 in FIG. 15). Guides 38 and 50 are designed to target IL12A (p 35). Guides 49 and 55 are designed to target IL-12B (P40).

A collection of grnas (e.g., 2-3 grnas) for each gene was selected and tested in different combinations to verify their activity in primary T cells (see fig. 16). The use of a combination of anti-IL-12A gRNA and anti-IL-12B gRNA (see 38+49 in FIG. 16) promotes an increase in the level of IL-12 (P70) expression compared to control primary T cells without the gRNA combination.

Example 3: regulation of endogenous IL-21

Jurkat cells were transduced with lentiviruses containing ef1a-dCAs9-VPR-Q8 (hereinafter "Q8"), followed (e.g., after about 1 week) by sorting of Q8 positive cells. The sorted Q8 positive cells are then sorted again (e.g., after about 2 weeks) to establish dCas9-VPR expressing cell lines. These cells (e.g., about 200,000 cells per reaction) are then transfected with sgrnas (e.g., about 250-500ng of sgrnas) using transfection reagents. Prior to gene expression analysis, cells are plated (e.g., in 96-well plates) in medium (e.g., RPMI1640+10% FCS) and incubated for a period of time (e.g., 48-72 hours) at 37 ℃. FIG. 17 (top) shows the positions of the target polynucleotide sequences of a plurality of guide RNAs with respect to the gene encoding IL-21, and FIG. 17 (bottom left) provides the sequences of a plurality of guide RNAs for IL-21.

Gene expression was measured using the ΔΔct method using SYBR green qPCR. Primers were designed to encode IL-21 (forward primer: TAGAGACAAACTGTGAGTGGTCA; reverse primer: GGGCATGTTAGTCTGTTTCTG) and GAPDH was used as a reference gene.

FIG. 17 (bottom right) shows enhanced expression of endogenous IL-21 in Jurkat cells after activation by a system comprising Q8 and one of a plurality of guide RNAs for IL-21. In some cases, use of such a system promotes an increase in the expression level of endogenous IL-21 to about 10-fold (e.g., IL-21_up_gr8r), about 100-fold (e.g., IL-21_up_gr16r), or about 1,000-fold (e.g., IL-21_up_gr42f) compared to control Jurket cells using control gRNA (e.g., IL 21_up_gr92f) that bind to a different location of the IL-21 gene or that do not exhibit specific binding affinity to the IL-21 gene.

It is to be understood that the different aspects of the invention may be understood individually, collectively, or in combination with each other. The various aspects of the invention described herein may be applied to any particular application disclosed herein. The systems disclosed herein for modulating the expression or activity of a cytokine (e.g., an endogenous cytokine) of a cell can be used in a method section, including the methods of use and production disclosed herein, or vice versa. Such systems may be used in compositions of matter, including any cells comprising the system, as disclosed herein.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. The invention is not intended to be limited to the specific examples provided in the specification. While the invention has been described with reference to the foregoing specification, the description and illustration of embodiments herein are not meant to be construed in a limiting sense. Many changes, modifications and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it should be understood that all aspects of the invention are not limited to the specific descriptions, configurations, or relative proportions set forth herein in terms of various conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the present invention will also cover any such alternatives, modifications, variations or equivalents. The following claims are intended to define the scope of the invention and to cover methods and structures within the scope of these claims and their equivalents.

Claims (108)

1. A system for modulating expression or activity of an endogenous cytokine by a cell, the system comprising:

an actuation moiety capable of complexing with a target gene encoding the endogenous cytokine to regulate expression or activity of the endogenous cytokine, wherein the actuation moiety is heterologous to the cell and is activatable upon exposure of the cell to an external stimulus,

wherein upon exposure of the cell to the external stimulus, the activating moiety is activated to modulate expression or activity of the endogenous cytokine, thereby causing the cell to exhibit one or more characteristics selected from the group consisting of:

(i) The expression or activity of the endogenous cytokine is altered by at least 20% as compared to a control;

(ii) The expression or activity of a different endogenous cytokine of the cell is altered by at least 20% as compared to a control;

(iii) Enhanced cytotoxicity to a target cell population, as determined by a reduction in the size of the target cell population of at least 20% as compared to a control;

(iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising the cells as compared to a control; and

(v) Tumor size was reduced compared to the control.

2. The system of claim 1, wherein the external stimulus is a ligand, and the system comprises: a chimeric receptor polypeptide (receptor) that undergoes a modification upon binding to the ligand, wherein the actuation moiety is activatable upon modification of the receptor.

3. The system of any one of the preceding claims, wherein activation of the actuation portion comprises (1) releasing the actuation portion from a substrate or (2) modifying the actuation portion.

4. The system of any one of the preceding claims, wherein the cells are caused to exhibit two or more of (i) to (v).

5. The system of any one of the preceding claims, wherein the cells are caused to exhibit three or more of (i) to (v).

6. The system of any one of the preceding claims, wherein the cells are caused to exhibit an increase in the expression level of the endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% as compared to control cells.

7. The system of any one of the preceding claims, wherein the endogenous cytokine comprises an Interleukin (IL) selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36.

8. The system of any one of the preceding claims, wherein the endogenous cytokine comprises IL-12.

9. The system of any one of the preceding claims, wherein the target gene comprises a first gene encoding IL-12A (p 35) and a second gene encoding IL-12B (p 40).

10. The system of any one of the preceding claims, wherein the endogenous cytokine comprises IL-21.

11. The system of any one of the preceding claims, wherein the actuation moiety is capable of complexing with a target polynucleotide sequence of the target gene, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the target gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the target gene.

12. The system of any one of the preceding claims, wherein (1) a first actuation portion of the actuation portion is capable of complexing with a first gene of the target gene and (2) a second actuation portion of the actuation portion is capable of complexing with a second gene of the target gene, thereby modulating expression or activity of the endogenous cytokine, wherein expression or activity of the endogenous cytokine is under control of the first gene and the second gene, the first gene and the second gene being different.

13. The system of any one of the preceding claims, wherein the actuation portion comprises a nucleic acid-guided actuation portion, and wherein the system further comprises a guide nucleic acid complexed with the actuation portion.

14. The system of any one of the preceding claims, wherein the system further comprises two or more guide nucleic acids having complementarity to different portions of the target gene.

15. The system of any one of the preceding claims, wherein the guide nucleic acid comprises a guide ribonucleic acid (RNA).

16. The system of any one of the preceding claims, wherein the cells are caused to exhibit an alteration in expression or activity of the endogenous cytokine of at least 20% as compared to control cells.

17. The system of any one of the preceding claims, wherein the cells are caused to exhibit an increase in the expression level of the different endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%.

18. The system of any one of the preceding claims, wherein the different endogenous cytokines comprise an Interferon (IFN) selected from IFN- α (α), IFN- β (β), IFN- κ (κ), IFN- δ (δ), IFN- ε (ε), IFN- τ (τ), IFN- ω (ω), IFN- ζ (ζ), IFN- γ (γ), and IFN- λ (λ).

19. The system of any one of the preceding claims, wherein the different endogenous cytokines comprise IFN- γ (γ).

20. The system of any one of the preceding claims, wherein the different endogenous cytokines comprise Tumor Necrosis Factor (TNF) proteins selected from tnfβ, tnfα, tnfγ, CD252 (OX 40 ligand), CD154 (CD 40 ligand), CD178 (Fas ligand), CD70 (CD 27 ligand), CD153 (CD 30 ligand), 4-1BBL (CD 137 ligand), CD253 (TRAIL), CD254 (RANKL), APO-3L (TWEAK), CD256 (APRIL), CD257 (BAFF), CD258 (LIGHT), TL1 (VEGI), GITRL (TNFSF 18), and ectodermal dysplasia protein a.

21. The system of any one of the preceding claims, wherein the different endogenous cytokines comprise tnfa.

22. The system of any one of the preceding claims, wherein the cells are caused to exhibit a reduction in the expression level of the different endogenous cytokine by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

23. The system of any one of the preceding claims, wherein the different endogenous cytokine is not IL-12.

24. The system of any one of the preceding claims, wherein the different endogenous cytokines comprise IL-2.

25. The system of any one of the preceding claims, wherein the increase in cytotoxicity to the target cell population is determined by a reduction in size of the target cell population of at least 20%, at least 30%, at least 40%, at least 50%, or at least 60%.

26. The system of any one of the preceding claims, wherein the target cell population comprises diseased cells and the ligand is an antigen of the diseased cells.

27. The system of any one of the preceding claims, wherein the diseased cells comprise cancer cells or tumor cells.

28. The system of any one of the preceding claims, wherein the proliferation enhancement is determined by an increase in the size of the target cell population of at least 20%, at least 30%, at least 40%, at least 60%, at least 80%, or at least 100%.

29. The system of any one of the preceding claims, wherein the tumor size is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% as compared to the control.

30. The system of any one of the preceding claims, wherein the actuation portion comprises an effector domain configured to regulate expression of the target gene.

31. The system of any one of the preceding claims, wherein the effector domain is selected from a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain.

32. The system of claim 30, wherein the effector domain is a transcriptional activation domain.

33. The system of claim 30, wherein the effector domain is a transcriptional repression domain.

34. The system of any one of the preceding claims, wherein the actuation moiety comprises a heterologous endonuclease or variant thereof.

35. The system of any one of the preceding claims, wherein the modification is a conformational change or a chemical modification.

36. The system of any one of the preceding claims, wherein the cell is an immune cell.

37. The system of any one of the preceding claims, wherein the cell is a T cell or NK cell.

38. An engineered cell population comprising the system of any one of the preceding claims.

39. The engineered population of claim 37, comprising engineered immune cells.

40. The engineered population of claim 38, comprising engineered T cells.

41. A composition comprising the engineered population of any one of the preceding claims.

42. The composition of claim 40, further comprising a co-therapeutic agent.

43. A system comprising a guide-nucleic acid molecule designed to bind to a target polynucleotide sequence of an Interleukin (IL) gene of a cell, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the IL gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the IL gene, and wherein the guide-nucleic acid molecule is heterologous to the cell.

44. The system of claim 42, wherein the guide-nucleic acid molecule is capable of recruiting an actuation moiety to the target polynucleotide sequence of the IL gene to regulate expression or activity of the IL, and wherein the system further comprises the actuation moiety.

45. A system comprising an actuation portion of a target polynucleotide sequence capable of binding an Interleukin (IL) gene of a cell, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the IL gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the IL gene, and wherein the actuation portion is heterologous to the cell.

46. The system of any one of the preceding claims, wherein the actuation moiety comprises a heterologous endonuclease or variant thereof.

47. The system of any one of the preceding claims, wherein the IL gene is endogenous to the cell.

48. The system of any one of the preceding claims, wherein the TSS is endogenous to the cell.

49. The system of any one of the preceding claims, wherein the IL is selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36.

50. The system of any one of the preceding claims, wherein the IL is IL-12.

51. The system of any one of the preceding claims, wherein the IL is IL-12A and/or IL-12B.

52. The system of any one of the preceding claims, wherein the IL is IL-21.

53. The system of any one of the preceding claims, comprising (i) a first guide nucleic acid molecule designed to bind to a first portion of the TSS and (ii) a second guide nucleic acid molecule designed to bind to a second portion of the TSS.

54. The system of any one of the preceding claims, comprising (i) a first nucleic acid molecule designed to bind a first target polynucleotide sequence of the IL gene and (ii) a second nucleic acid molecule designed to bind a second target polynucleotide sequence of the IL gene.

55. The system of any one of the preceding claims, wherein the guide nucleic acid molecule comprises a guide ribonucleic acid (RNA).

56. The system of any one of the preceding claims, wherein the TSS has at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity with SEQ ID No. 1.

57. The system of any one of the preceding claims, wherein the TSS has at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity with SEQ ID No. 2.

58. The system of any one of the preceding claims, wherein the cell is an immune cell.

59. The system of any one of the preceding claims, wherein the cell is a T cell or NK cell.

60. An engineered cell population comprising the system of any one of the preceding claims.

61. The engineered population of claim 58, comprising engineered immune cells.

62. The engineered population of claim 59, comprising engineered T cells.

63. A composition comprising the engineered population of any one of the preceding claims.

64. A composition comprising the system of any of the preceding claims.

65. The composition of any one of the preceding claims, further comprising a co-therapeutic agent.

66. A method for modulating expression or activity of an endogenous cytokine in a cell, comprising:

(a) Exposing the cells to an external stimulus; and

(b) In response to exposure to the external stimulus, a complex is formed between the activating moiety and a target gene encoding the endogenous cytokine to regulate expression or activity of the endogenous cytokine, thereby causing the cell to exhibit one or more characteristics selected from the group consisting of:

(i) The expression or activity of the endogenous cytokine is altered by at least 20% as compared to a control;

(ii) The expression or activity of a different endogenous cytokine of the cell is altered by at least 20% as compared to a control;

(iii) Enhanced cytotoxicity to a target cell population, as determined by a reduction in the size of the target cell population of at least 20% as compared to a control;

(iv) Proliferation enhancement, as determined by at least a 20% increase in the size of the cell population comprising the cells;

(v) Tumor size was reduced compared to the control.

67. The method of claim 64, wherein the external stimulus is a ligand, and (a) comprises exposing a chimeric receptor polypeptide (receptor) to the ligand to cause modification of the receptor.

68. The method of any one of the preceding claims, wherein (b) comprises activating the actuation portion via (1) releasing the actuation portion from a substrate or (2) modifying the actuation portion.

69. The method of any one of the preceding claims, wherein the cells are caused to exhibit two or more of (i) to (v).

70. The method of any one of the preceding claims, wherein the cells are caused to exhibit three or more of (i) to (v).

71. The method of any one of the preceding claims, wherein the cells are caused to exhibit an increase in the expression level of the endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% as compared to control cells.

72. The method of any one of the preceding claims, wherein the endogenous cytokine comprises an Interleukin (IL) selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and IL-36.

73. The method of any one of the preceding claims, wherein the endogenous cytokine comprises IL-12.

74. The method of any one of the preceding claims, wherein the target gene comprises a first gene encoding IL-12A (p 35) and a second gene encoding IL-12B (p 40).

75. The method of any one of the preceding claims, wherein the endogenous cytokine comprises IL-21.

76. The method of any one of the preceding claims, wherein the actuation moiety is capable of complexing with a target polynucleotide sequence of the target gene, wherein the target polynucleotide sequence (i) comprises at least a portion of a Transcription Start Site (TSS) of the target gene or (ii) is about 1,000 bases to about 900 bases, about 900 bases to about 800 bases, about 800 bases to about 700 bases, about 700 bases to about 600 bases, about 600 bases to about 500 bases, about 500 bases to about 400 bases, about 400 bases to about 300 bases, about 300 bases to about 200 bases, about 200 bases to about 100 bases, or about 100 bases to about 1 base from the TSS of the target gene.

77. The method of any one of the preceding claims, wherein (b) further comprises (1) complexing a first actuating moiety of the actuating moiety with a first gene of the target gene, and (2) complexing a second actuating moiety of the actuating moiety with a second gene of the target gene, thereby modulating expression or activity of the endogenous cytokine, wherein expression or activity of the endogenous cytokine is under control of the first gene and the second gene, the first gene and the second gene being different.

78. The method of any one of the preceding claims, wherein the actuation portion comprises a nucleic acid-guided actuation portion, and wherein the system further comprises a guide nucleic acid complexed with the actuation portion.

79. The method of any one of the preceding claims, wherein the system further comprises two or more guide nucleic acids having complementarity to different portions of the target gene.

80. The method of any one of the preceding claims, wherein the guide nucleic acid comprises a guide ribonucleic acid (RNA).

81. The method of any one of the preceding claims, wherein the cells are caused to exhibit an alteration in the expression or activity of the endogenous cytokine of at least 20% as compared to control cells.

82. The method of any one of the preceding claims, wherein the cells are caused to exhibit an increase in the expression level of the different endogenous cytokine by at least 20%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500%.

83. The method of any one of the preceding claims, wherein the different endogenous cytokines comprise an Interferon (IFN) selected from IFN- α (α), IFN- β (β), IFN- κ (κ), IFN- δ (δ), IFN- ε (ε), IFN- τ (τ), IFN- ω (ω), IFN- ζ (ζ), IFN- γ (γ), and IFN- λ (λ).

84. The method of any one of the preceding claims, wherein the different endogenous cytokines comprise IFN- γ (γ).

85. The method of any one of the preceding claims, wherein the different endogenous cytokines comprise Tumor Necrosis Factor (TNF) proteins selected from tnfβ, tnfα, tnfγ, CD252 (OX 40 ligand), CD154 (CD 40 ligand), CD178 (Fas ligand), CD70 (CD 27 ligand), CD153 (CD 30 ligand), 4-1BBL (CD 137 ligand), CD253 (TRAIL), CD254 (RANKL), APO-3L (TWEAK), CD256 (APRIL), CD257 (BAFF), CD258 (LIGHT), TL1 (VEGI), GITRL (TNFSF 18), and ectodermal dysplasia protein a.

86. The method of any one of the preceding claims, wherein the different endogenous cytokines comprise tnfa.

87. The method of any one of the preceding claims, wherein the cells are caused to exhibit a reduction in the expression level of the different endogenous cytokine by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

88. The method of any one of the preceding claims, wherein the different endogenous cytokine is not IL-12.

89. The method of any one of the preceding claims, wherein the different endogenous cytokine is not IL-21.

90. The method of any one of the preceding claims, wherein the different endogenous cytokines comprise IL-2.

91. The method of any one of the preceding claims, wherein the increase in cytotoxicity to the target cell population is determined by a reduction in the size of the target cell population of at least 20%, at least 30%, at least 40%, at least 50% or at least 60%.

92. The method of any one of the preceding claims, wherein the target cell population comprises diseased cells and the ligand is an antigen of the diseased cells.

93. The method of any one of the preceding claims, wherein the diseased cell comprises a cancer cell or a tumor cell.

94. The method of any one of the preceding claims, wherein the increase in proliferation is determined by an increase in the size of the target cell population of at least 20%, at least 30%, at least 40%, at least 60%, at least 80%, or at least 100%.

95. The method of any one of the preceding claims, wherein the tumor size is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% as compared to the control.

96. The method of any one of the preceding claims, wherein the actuation moiety comprises an effector domain configured to regulate expression of the target gene.

97. The method of any one of the preceding claims, wherein the effector domain is selected from a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain.

98. The method of claim 93, wherein the effector domain is a transcriptional activation domain.

99. The method of claim 93, wherein the effector domain is a transcriptional repression domain.

100. The method of any one of the preceding claims, wherein the actuating moiety comprises a heterologous endonuclease or variant thereof.

101. The method of any one of the preceding claims, wherein the modification is a conformational change or a chemical modification.

102. The method of any one of the preceding claims, wherein the cell is an immune cell.

103. The method of any one of the preceding claims, wherein the cell is a T cell or NK cell.

104. The method of any one of the preceding claims, further comprising administering the cell to a subject in need thereof.

105. The method of any one of the preceding claims, wherein the cells are autologous or allogenic to the subject.

106. The method of any one of the preceding claims, further comprising administering a co-therapeutic agent to the subject.

107. The method of any one of the preceding claims, wherein the subject is a mammal.

108. The method of any one of the preceding claims, wherein the subject is a human.