CN116940666A

CN116940666A - Universal donor cells

Info

Publication number: CN116940666A
Application number: CN202180094941.4A
Authority: CN
Inventors: A·雷扎尼亚; 瓦伦汀·斯卢奇
Original assignee: CRISPR Therapeutics AG
Current assignee: CRISPR Therapeutics AG
Priority date: 2020-12-31
Filing date: 2021-12-31
Publication date: 2023-10-24
Also published as: CN117043319A

Abstract

Provided herein are genetically modified cells, e.g., universal donor cells, that are compatible with more than one subject, and methods of producing the genetically modified cells. The universal donor cell comprises at least one genetic modification within or near a gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components of MHC-I or MHC-II complexes or transcriptional regulator, wherein the genetic modification comprises insertion of a polynucleotide encoding a tolerogenic and/or survival factor. The universal donor cell may also comprise at least one genetic modification within or near the gene encoding the survival factor, wherein the genetic modification comprises insertion of a polynucleotide encoding the second tolerogenic factor and/or a different survival factor.

Description

Universal donor cells

Cross Reference to Related Applications

The present application claims the benefit of U.S. provisional application Ser. No. 63/132,890 filed on month 12 and 31 of 2020, U.S. provisional application Ser. No. 63/234,997 filed on month 8 and 19 of 2021, and U.S. provisional application Ser. No. 63/288,356 filed on month 12 and 10 of 2021, the disclosures of each of which are incorporated herein by reference in their entirety.

Incorporated by reference into the sequence listing

The present application comprises a sequence listing submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy generated at month 22 of 2021 was named CT154 Sequence Listing st25.Txt and was about 131,000 bytes in size.

Technical Field

The present application relates to the field of gene editing and, in some embodiments, to genetic modification for the purpose of producing cells (e.g., universal donor cells) that are compatible with more than one subject.

Background

Various approaches have been proposed to overcome allograft rejection of transplanted or implanted cells, including HLA matching, blocking the pathway triggering T cell activation with antibodies, using immunosuppressive drug cocktail (cocktail), and autologous cell therapy. Another strategy to inhibit graft rejection involves minimizing allogeneic differences between the transplanted or implanted cells and the recipient. Cell surface expressed Human Leukocyte Antigens (HLA) are molecules encoded by genes located in the human major histocompatibility complex on chromosome 6, the major mediators of immune rejection. Mismatch of individual HLA genes between donor and subject can elicit a robust immune response (Fleischhauer K. Et al. "Bone marrow-allograft rejection by T lymphocytes recognizing a single amino acid difference in HLA-B44," N Engl J Med.,1990, 323:1818-1822). HLA genes are classified into MHC class I (MHC-I) and MHC class II (MHC-II). MHC-I genes (HLA-A, HLA-B and HLA-C) are expressed in almost all tissue cell types, presenting "non-self" antigen processing peptides to CD8+ T cells, thereby facilitating their activation into cytolytic CD8+ T cells. Transplantation or implantation of cells expressing "non-self" MHC-I molecules will elicit a robust cellular immune response against these cells and ultimately lead to the death of these cells by activated cytolytic cd8+ T cells. The MHC-I protein is closely related to beta-2-microglobulin (B2M) in the endoplasmic reticulum, which is necessary for the formation of functional MHC-I molecules on the cell surface.

Unlike extensive cellular expression of MHC-I genes, expression of MHC-II genes is limited to antigen presenting cells such as dendritic cells, macrophages and B cells. HLA antigen genes are the most abundant genes for polymorphisms observed in the human genome (the most polymorphic genes) (Rubinstein P., "HLA matching for bone marrow transplantation-how much is enough. The generation of "universal donor" cells compatible with any HLA genotype provides an alternative strategy that can address immune rejection and the associated economic costs of current immune evasion methods.

To generate such universal donor cell lines, one approach has been to functionally disrupt the expression of MHC-I and MHC-II genes. This can be achieved by genetic disruption of, for example, two genetic alleles encoding the MHC-I light chain B2M. The resulting B2M null cell line (B2M-null cell line) and its derivatives (derivatives) are expected to exhibit greatly reduced surface MHC-I, thereby reducing immunogenicity to allogeneic CD8+ T cells. Methods of targeting transcription activator-like effector nucleases (TALENs) have been used to generate B2M-deficient hESC lines by deleting several nucleotides in exon 2 of the B2M gene (Lu, p. Et al, "Generating hypoimmunogenic human embryonic Stem cells by the disruption of beta 2-microglobulin," Stem Cell rev.2013, 9:806-813). Although B2M-targeting hescs appear to be surface HLA-I deficient, they were found to still contain specific mRNA for B2M and MHC-I. B2M and MHC-I mRNA are expressed at levels (constitutive and IFN-g induced) equivalent to non-targeted hescs. Therefore, there is a concern that these TALEN B2M-targeting hESC lines may express residual cell surface MHC-I sufficient to cause immune rejection, as observed with B2M2/2 mouse cells that still express B2M mRNA (Gross, r. And Rappuoli, r. "Pertussis toxin promoter sequences involved in modulation," Proc Natl Acad Sci,1993, 90:3913-3917). Although off-target cleavage events of the hESC line targeting TALEN B2M were not examined, the occurrence of non-specific cleavage was still an important issue when TALEN was used, which would create major safety issues with respect to its clinical use (Grau, j. Et al, "TALENoffer: genome-wide TALEN off-target prediction," bioenformatics, 2013,29:2931-2932;Guilinger J.P et al, "Broad specificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity," Nat Methods 2014, 11:429-435). In addition, another report generated IPS cells that escaped allorecognition by knocking out the first B2M allele and knocking in the HLA-E gene at the second B2M allele, which resulted in surface expression of HLA-E dimers or trimers, but not HLA-a, HLA-B or HLA-C (Gornalusse, g.g. et al, "HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells," Nature Biotechnology,2017,35,765-773).

A potential limitation of some of the above strategies is that MHC class I negative cells are susceptible to lysis by Natural Killer (NK) cells, as HLA molecules are the primary ligand inhibitors of Natural Killer (NK) cells. Host NK cells have been shown to eliminate transplanted or implanted B2M-/-donor cells and similar phenomena occur in vitro in the case of MHC class I negative Human leukemia lines (Bix, M. Et al, "Rejection of class I MHC-deficient haemopoietic cells by irradiated MHC-matched mice," Nature,1991,349,329-331; zarcone, D. Et al, "Human leukemia-derived cell lines and clones as models for mechanistic analysis of natural killer cell-mediated cytotoxicity," Cancer Res.1987,47, 2674-2682). Thus, there is a need to improve upon previous methods to generate universal donor cells capable of evading immune responses, and to generate cells capable of surviving implantation. As described herein, cell survival after implantation or after transplantation can be mediated by many other pathways independent of allograft rejection, such as hypoxia, reactive oxygen species, nutrient deprivation and oxidative stress. Also as described herein, genetic introduction of survival factors (genes and/or proteins) can help cells survive post implantation. As described herein, universal donor cell lines can combine the properties of addressing both allograft rejection and post-implantation survival.

SUMMARY

In some aspects, the present disclosure encompasses in vitro methods for producing universal donor cells, the methods comprising delivering to stem cells: (a) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a first target locus and a first nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a neurotrophic factor of midbrain astrocyte origin (MANF), cluster of differentiation 39 (Cd 39) and/or cluster of differentiation 73 (Cd 73), wherein the first target locus is cleaved at the target site and the first nucleic acid comprising a nucleotide sequence encoding TNFAIP3, MANF, cd39 and/or Cd73 is inserted into the target locus, thereby disrupting the target gene; and/or (B) an RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus, wherein the B2M locus is cleaved at the target site, thereby disrupting the B2M gene; and/or (c) an RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a thioredoxin interaction protein (TXNIP) locus, wherein the TXNIP locus is cleaved at the target site, thereby disrupting the TXNIP gene; and/or (d) an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a class II transactivator (CIITA) locus, wherein the CIITA locus is cleaved at the target site, thereby disrupting the CIITA gene; and/or (e) an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a transforming growth factor beta (tgfβ) locus, wherein the tgfβ locus is cleaved at the target site, thereby disrupting the tgfβ gene.

In some aspects, the methods provided herein may further comprise delivering (f) another RNA-guided nuclease and another guide RNA (gRNA) targeting a target site in a target locus to the stem cell, and a nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a midbrain astrocyte-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA class I histocompatibility antigen alpha chain E (HLA-E), and/or programmed death ligand 1 (PD-L-1), wherein the target locus is cleaved at the target site, and a nucleic acid comprising a nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E, and/or PD-L-1 is inserted into the target locus, thereby disrupting the target gene.

In some aspects, the methods provided herein may further comprise delivering (g) another RNA-guided nuclease and another guide RNA (gRNA) targeting a target site in a target locus to a stem cell, and a nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a midbrain astrocyte-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E, and/or PD-L-1, wherein the target locus is cleaved at the target site, and a nucleic acid comprising a nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E, and/or PD-L-1 is inserted into the target locus, thereby disrupting the target gene.

In some aspects, the methods provided herein may further comprise delivering (h) another RNA-guided nuclease and another guide RNA (gRNA) targeting a target site in a target locus, and a nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a midbrain astrocyte-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E, and/or PD-L-1 to the stem cell, wherein the target locus is cleaved at the target site, and a nucleic acid comprising a nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E, and/or PD-L-1 is inserted into the target locus, thereby disrupting the target gene.

While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof have been shown by way of example in the drawings and will herein be described in detail. It should be understood, however, that the drawings and detailed description presented herein are not intended to limit the disclosure to the particular embodiment disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the disclosure as defined by the appended claims.

Other features and advantages of the present disclosure will become apparent in the following detailed description of embodiments of the invention, which proceeds with reference to the accompanying drawings.

Brief Description of Drawings

FIG. 1 shows a plasmid map of a B2M-CAGGS-MANF-P2A-TNFAIP3-P2A-PD-L-1 donor vector.

FIG. 2 shows a plasmid map of the CIITA-CAGGS-CD39 donor vector.

FIG. 3 shows a plasmid map of the B2M-CAGGS-CD39-P2A-PD-L-1 donor vector.

FIG. 4 shows a plasmid map of the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor vector.

FIG. 5 shows a plasmid map of a TXNIP-CAGGS-MANF-P2A-HLA-E donor vector.

FIG. 6 shows flow cytometry of L3V003B and L3V004B cell lines with respect to CD39 expression.

FIG. 7 shows the morphology of PEC and stage 6 (S6) cells differentiated from wild-type (WT) cells (upper panel) or X1 cells (i.e., TXNIP KO/MANF-P2A-HLA-EKI & B2M KO/TNFAIP3 (A20) -P2A-PD-L-1 KI).

FIG. 8 shows selected gene expression in PEC and stage 6 (S6) cells differentiated from wild-type (WT) cells (upper panel) or X1 ("X1") cells (i.e., TXNIP KO/MANF-P2A-HLA-EKI & B2M KO/TNFAIP3 (A20) -P2A-PD-L-1 KI).

FIG. 9 shows flow cytometry of CHGA, PDX1 and NKX6.1 in PEC cells differentiated from wild-type (WT) cells or TXNIP KO/MANF-P2A-HLA-E KI & B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI cells (L1V 028-C3, L1V 028-24).

FIG. 10A shows flow cytometry of CHGA, PDX1 and NKX6.1 in stage 6 (S6) cells differentiated from wild-type (WT) cells.

FIG. 10B shows flow cytometry of CHGA, PDX1 and NKX6.1 in stage 6 (S6) cells differentiated from X1 cells (i.e., TXNIP KO/MANF-P2A-HLA-E KI & B2M KO/TNFAIP3 (A20) -P2A-PD-L-1 KI).

FIG. 11 shows C-peptide levels in blood samples obtained from athymic nude rats transplanted with either L1V009B bulk cells (GRP 1) or L1V008 clone isolate (B2M KO/MANF-P2A-TNFAIP3-P2A-PD-L-1KI; cell aggregates of GRP 2 and GRP 3) or control cells (GRP 4) at 12, 16, 20, 24 weeks, 90 minutes after intraperitoneal administration of 3g/kg glucose for GRP 1-3, and 60 minutes after administration for GRP 4.

FIG. 12 shows the C-peptide levels in blood samples obtained from athymic nude rats transplanted with cell aggregates from B2M KO/CD39-P2A-PD-L-1KI or control cells 90 minutes (60 minutes read for 24 weeks) after intraperitoneal administration of 3g/kg glucose at 12, 16, 20, 24 weeks.

FIG. 13 shows C-peptide levels in blood samples obtained from NSG mice transplanted with capsules (capsule) containing differentiated cell aggregates of PEC stage or stage 6 (S6) unmodified (NCG) or B2M KO/TNFAIP3-P2A-PD-L-1KI & TXNIP KO/MANF-P2A-HLA-E KI (X1) after 12 weeks and 16 weeks of glucose stimulation.

FIG. 14 shows the average C-peptide levels after glucose stimulation in PEC control (NCG) and PEC-X1 (B2M KO/TNFAIP3-P2A-PD-L-1KI and TXNIP KO/MANF-P2A-HLA-EKI) groups of mice at 12, 16, 20, 24 weeks.

FIG. 15 shows C-peptide levels in NSG mice transplanted with vesicles containing cells differentiated from unmodified (CON) cells or B2M KO/TNFAIP3-P2A-PD-L-1KI & TXNIP KO/MANF-P2A-HLA-E KI (X1) cells (i.e., 6D09, 6H07 and 5C 10) at weeks 12, 16 and 20.

FIG. 16 shows a plasmid map of the B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 donor vector.

FIG. 17 shows flow cytometry of SOX17 and FOXA2 expression in L1V017B cells (i.e., CD39-P2A-PD-L-1KI and B2M KO), L1V018B cells (i.e., CD39-P2A-CD73-P2A-PD-L-1KI and B2M KO), and L1V019B cells (i.e., TNFAIP3 (A20) -P2A-PD-L-1KI and B2M KO).

FIG. 18 shows flow cytometry of CHGA, NKX6.1 and PDX1 expression in L1V017B cells (i.e., CD39-P2A-PD-L-1KI and B2M KO), L1V018B cells (i.e., CD39-P2A-CD73-P2A-PD-L-1KI and B2M KO) and L1V019B cells (i.e., TNFAIP3 (A20) -P2A-PD-L-1KI and B2M KO).

FIG. 19 shows the time course of gene expression of various markers in L1V017B cells (i.e., CD39-P2A-PD-L-1KI and B2M KO), L1V018B cells (i.e., CD39-P2A-CD73-P2A-PD-L-1KI and B2M KO), and L1V019B cells (i.e., TNFAIP3 (A20) -P2A-PD-L-1KI and B2M KO).

FIG. 20A shows TIDE analysis, showing that significant +1 and-7 edits result in a frame shift of the coding region with 90% KO of the TGF-. Beta.2 gene in X1 (B2M KO/TNFAIP3-P2A-PD-L-1KI & TXNIP KO/MANF-P2A-HLA-E KI) +TGF-. Beta.2 KO cells ("L3V 002B").

FIG. 20B shows a TIDE analysis showing that 90% KO of the TGF-. Beta.2 gene in X4 (B2M KO/TNFAIP3-P2A-PD-L-1KI & TXNIP KO/MANF-P2A-HLA-E KI & CIITA KO/CD39 KI) +TGF-. Beta.2 cells ("L3V 004B") significant +1 and-7 edits result in a frame shift of the coding region.

FIG. 21 shows the data of an immune evasion assay using a peripheral blood mononuclear cell proliferation assay in the presence of X1 and B2M KO edited cells in culture medium and in the presence or absence of a TGF-beta blocker.

FIG. 22A shows data from ELISA assays against secreted TGF-beta 2 in conditioned medium containing differentiated wild-type, V1B (HLA-E KI, TXNIP KO, PD-L-1KI, B2M KO) and TGF-beta 2KO PEC cells for 72 hours.

FIG. 22B shows data from ELISA assays against secreted TGF-beta 1 in conditioned medium containing differentiated wild-type, V1B (HLA-E KI, TXNIP KO, PD-L-1KI, B2M KO) and TGF-beta 2KO PEC cells for 72 hours.

FIG. 23A provides data for the secretion of TGF-beta by V1B and TGF-beta 2KO PEC cells.

FIG. 23B provides data for the secretion of GDF-9 by V1B and TGF-. Beta.2KO PEC cells.

FIG. 23C provides data for secretion of PDGF-AA by V1B and TGF-. Beta.2KO PEC cells.

FIGS. 24A-24B show fibroblast migration assays using human lung fibroblast (MRC-5) cells and conditioned medium from WT, V1B and X1 PEC cells (FIG. 24A) and WT and TGF-. Beta.2KO PEC cells (FIG. 24B).

FIGS. 25A-25C show fibroblast migration assays using human fibrosarcoma (HT 1080) cells and conditioned media from WT, V1B and X1 PEC cells (FIG. 25A), WT and TGF-. Beta.2KO PEC cells (FIG. 25B), and WT, X4 (L3V 003B) and X4+ TGF-. Beta.2KO (L3V 004B) PEC cells (FIG. 25C).

Detailed description of the preferred embodiments

I. Definition of the definition

Deletion: as used herein, the term "deletion" is used interchangeably with the term "genetic deletion" or "knockout," and generally refers to the removal of a genetic modification of a site or region of genomic DNA by any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. Any number of nucleotides may be deleted. In some embodiments, the deletion includes the removal of at least one, at least two, at least three, at least four, at least five, at least ten, at least fifteen, at least twenty, or at least 25 nucleotides. In some embodiments, the deletion includes the removal of 10-50, 25-75, 50-100, 50-200, or more than 100 nucleotides. In some embodiments, the deletion includes partial or complete removal of a target gene, such as a B2M gene, TXNIP gene, CIITA gene, or TGF- β2 gene. In some embodiments, the deletion includes partial or complete removal of two target genes, three target genes, or four target genes. In some embodiments, removing a portion of a target gene refers to removing all or a portion of the promoter and/or coding sequence of the gene. In some embodiments, the deletion includes removal of transcriptional regulators, e.g., promoter regions, of the target gene. In some embodiments, the deletion includes the removal of all or part of the coding region such that the product normally expressed by the coding region is no longer expressed, expressed in truncated form, or expressed at a reduced level. In some embodiments, the deletion results in reduced expression of the gene relative to an unmodified cell. In some embodiments, the deletion results in a deletion of the gene relative to the expression of the unmodified cell.

And (3) damage: as used herein, the term "disruption" or "disruption" refers to a genetic modification that alters the expression level of a target gene. In some aspects, the disruption may be due to a deletion of at least one nucleotide within or near the target gene, or a partial or complete deletion of the target gene, as described above. In other aspects, the disruption may also be due to substitution of at least one nucleotide and/or insertion of at least one nucleotide within or near the target gene. In further aspects, the disruption may be due to insertion of one or more exogenous polynucleotides within or near the target gene. In general, as used herein, disrupted expression refers to a reduction or elimination of target gene expression. In some embodiments, the disruption may be a decrease in expression level (e.g., less than 30%, less than 25%, less than 20%, less than 10%, or less than 5% of the level of the unmodified cell is expressed). In some embodiments, disruption may be elimination of expression (e.g., no expression or no detectable level of RNA and/or protein expression). Expression can be measured using any standard RNA-based, protein-based, and/or antibody-based detection methods (e.g., RT-PCR, ELISA, flow cytometry, immunocytochemistry, etc.). The detectable level is defined as being above the limit of detection (LOD), which is the lowest concentration of statistical significance that can be measured (detected) by a given detection method.

Endonuclease: as used herein, the term "endonuclease" generally refers to an enzyme that cleaves a phosphodiester bond within a polynucleotide. In some embodiments, the endonuclease specifically cleaves phosphodiester bonds within a DNA polynucleotide. In some embodiments, the endonuclease is a Zinc Finger Nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Homing Endonuclease (HE), a meganuclease (meganuclease), a MegaTAL, or a CRISPR-associated endonuclease. In some embodiments, the endonuclease is an RNA-guided endonuclease. In certain aspects, the RNA-guided endonuclease is a CRISPR nuclease, such as a type II CRISPR Cas9 endonuclease or a type V CRISPR Cpf1 endonuclease. In some embodiments, the endonuclease is a Cas1, cas1B, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9 (also known as Csn1 and Csx 12), cas100, csy1, csy2, csy3, cse1, cse2, csc1, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmr1, cmr3, cmr4, cmr5, cmr6, csb1, csb2, csb3, csx17, csx14, csx10, csx16, csaX 3, csx1, csx15, csf1, csf2, csf3, csf4, or Cpf1 endonuclease, or a homolog thereof, a recombinant, codon-optimized form thereof, or a modified form thereof, or a combination thereof, of the naturally occurring molecule. In some embodiments, the endonuclease may introduce one or more Single Strand Breaks (SSBs) and/or one or more Double Strand Breaks (DSBs).

Exogenous: the term "exogenous" as used herein refers to a polynucleotide sequence that originates from outside the recipient cell or organism, that is assembled outside the recipient cell or organism, or that originates from the recipient cell or organism but is integrated into the recipient genome at a location other than the naturally occurring location. The exogenous polynucleotide sequence may comprise a gene sequence, may comprise a coding sequence (CDS) for a gene, may comprise coding sequences from more than one gene, may comprise promoter sequences, enhancer sequences and/or other regulatory elements, may comprise ribosome jump sequences, and/or may comprise artificial sequences. The exogenous polynucleotide may be codon optimized to ensure efficient translation in the recipient cell or organism.

Genetic modification: as used herein, the term "genetic modification" generally refers to a genomic DNA site that has been genetically edited or manipulated using any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. Exemplary genetic modifications include insertions, deletions, duplications, inversions, and translocations, as well as combinations thereof. In some embodiments, the genetic modification is a deletion. In some embodiments, the genetic modification is an insertion. In other embodiments, the genetic modification is an insertion-deletion mutation (or insertion deletion (indel)) such that the reading frame of the target gene is shifted, resulting in an altered gene product or no gene product.

Guide RNA (gRNA): as used herein, the term "guide RNA" or "gRNA" generally refers to a short ribonucleic acid capable of interacting (e.g., binding) with an endonuclease and binding or hybridizing to a target genomic site or region. In some embodiments, the gRNA is a single molecule guide RNA (sgRNA). In some embodiments, the gRNA may comprise a spacer extension region. In some embodiments, the gRNA may comprise a tracrRNA extension region. In some embodiments, the gRNA is single stranded. In some embodiments, the gRNA comprises naturally occurring nucleotides. In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA is a gRNA that includes at least one nucleotide with a chemical modification (e.g., a 2' -O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises a 2' -O-methyl-phosphorothioate residue. In some embodiments, the gRNA may be precomplexed with a DNA endonuclease.

Insertion: as used herein, the term "insert" is used interchangeably with the term "genetic insert" or "knock-in" and generally refers to a genetic modification in which a polynucleotide is introduced or added to a site or region of genomic DNA by any molecular biological method, such as the methods described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. In some embodiments, insertion of the exogenous polynucleotide occurs within or near the target gene. In some embodiments, insertion of the exogenous polynucleotide may occur within or near a site of genomic DNA that has been the site of a previous genetic modification, such as a deletion or an insertion-deletion mutation. In some embodiments, the insertion occurs at a genomic DNA site that partially overlaps, completely overlaps, or is contained within a site of a previous genetic modification (e.g., a deletion or an insertion-deletion mutation). In some embodiments, the insertion simultaneously results in gene disruption at the inserted target site. In some embodiments, the insertion occurs at a safe harbor locus. In some embodiments, the inserting comprises introducing a polynucleotide encoding a protein of interest. In some embodiments, the inserting comprises introducing a polynucleotide encoding a tolerogenic factor. In some embodiments, the inserting comprises introducing a polynucleotide encoding a survival factor. In some embodiments, the inserting comprises introducing a polynucleotide encoding MANF, TNFAIP3, CD39, CD73, PD-L-1, and/or HLA-E. In some embodiments, the insertion includes introducing an exogenous promoter, such as a constitutive promoter, e.g., a CAG or CAGGS promoter. In some embodiments, the inserting comprises introducing a polynucleotide encoding a non-coding gene. Typically, the polynucleotide to be inserted is flanked by sequences (e.g., homology arms) that have substantial sequence homology to genomic DNA at or near the insertion site.

Major histocompatibility complex class I (MHC-I): as used herein, the term "major histocompatibility complex class I" or "MHC-I" generally refers to being found on the cell surface of all nucleated cells of a vertebrate (including a mammal, such as a human); and has the function of displaying peptides that are not self or foreign antigens (e.g., proteins) from within cells (i.e., cytoplasm) to cytotoxic T cells (e.g., cd8+ T cells) in order to stimulate an immune response. In some embodiments, the MHC-I biomolecule is an MHC-I gene or MHC-I protein. The complexing of MHC-I proteins with beta-2 microglobulin (B2M) proteins is necessary for cell surface expression of all MHC-I proteins. In some embodiments, decreasing expression of an MHC-I Human Leukocyte Antigen (HLA) relative to an unmodified cell comprises decreasing (or reducing) MHC-I gene expression. In some embodiments, decreasing expression of an MHC-I Human Leukocyte Antigen (HLA) relative to an unmodified cell comprises a decrease (or decrease) in cell surface expression of an MHC-I protein. In some embodiments, the MHC-I biomolecule is HLA-A (NCBI gene ID number: 3105), HLA-B (NCBI gene ID number: 3106), HLA-C (NCBI gene ID number: 3107), or B2M (NCBI gene ID number: 567).

Major histocompatibility complex class II (MHC-II): as used herein, the term "major histocompatibility complex class II" or "MHC-II" generally refers to that which is typically found on the cell surface of antigen presenting cells of vertebrates (including mammals, e.g., humans); and has the function of displaying peptides of non-self or foreign antigens (e.g., proteins) from outside (extracellular) the cell to cytotoxic T cells (e.g., cd8+ T cells) in order to stimulate an immune response. In some embodiments, the antigen presenting cell is a dendritic cell, macrophage or B cell. In some embodiments, the MHC-II biomolecule is an MHC-II gene or MHC-II protein. In some embodiments, decreasing expression of an MHC-II Human Leukocyte Antigen (HLA) relative to an unmodified cell comprises decreasing (or reducing) expression of an MHC-II gene. In some embodiments, decreasing the expression of an MHC-II Human Leukocyte Antigen (HLA) relative to an unmodified cell comprises a decrease (or decrease) in cell surface expression of an MHC-II protein. In some embodiments, the MHC-II biomolecule is HLA-DPA (NCBI gene ID number: 3113), HLA-DPB (NCBI gene ID number: 3115), HLA-DMA (NCBI gene ID number: 3108), HLA-DMB (NCBI gene ID number: 3109), HLA-DOA (NCBI gene ID number: 3111), HLA-DOB (NCBI gene ID number: 3112), HLA-DQA (NCBI gene ID number: 3117), HLA-DQB (NCBI gene ID number: 3119), HLA-DRA (NCBI gene ID number: 3122), or HLA-DRB (NCBI gene ID number: 3123).

Polynucleotide (c): as used herein, the term "polynucleotide" is used interchangeably with the term "nucleic acid" and generally refers to a biological molecule comprising two or more nucleotides. In some embodiments, the polynucleotide comprises at least two, at least five, at least ten, at least twenty, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides. For example, a polynucleotide may comprise at least 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 4500 nucleotides, or at least about 5000 nucleotides. The polynucleotide may be a DNA or RNA molecule or a hybrid DNA/RNA molecule. The polynucleotide may be single-stranded or double-stranded. In some embodiments, the polynucleotide is a site or region of genomic DNA. In some embodiments, the polynucleotide is an endogenous gene contained in the genome of the unmodified cell or universal donor cell. In some embodiments, the polynucleotide is an exogenous polynucleotide that is not integrated into the genomic DNA. In some embodiments, the polynucleotide is an exogenous polynucleotide integrated into genomic DNA. In some embodiments, the polynucleotide is a plasmid or an adeno-associated viral vector. In some embodiments, the polynucleotide is a circular or linear molecule.

Safe harbor locus: as used herein, the term "safe harbor locus" refers generally to any location, site or region of genomic DNA capable of accommodating genetic insertion therein without adversely affecting the cell. In some embodiments, the safe harbor locus is an intragenic or extragenic region. In some embodiments, the safe harbor locus is a region of genomic DNA that is normally transcriptionally silent. In some embodiments, the safe harbor locus is an AAVS1 (PPP 1R 12C), ALB, angptl3, apoC3, ASGR2, CCR5, FIX (F9), G6PC, gys2, HGD, lp (a), pcsk9, serpina1, TF, or TTR locus. In some embodiments, the safe harbor locus is described in Sadelain, m. et al, "Safe harbours for the integration of new DNA in the human genome," Nature Reviews Cancer,2012, vol 12, pages 51-58.

Safety switch: as used herein, the term "safety switch" generally refers to a biological molecule that directs a cell to undergo apoptosis. In some embodiments, the safety switch is a protein or gene. In some embodiments, the safety switch is a suicide gene. In some embodiments, a safety switch, such as herpes simplex virus thymidine kinase (HSV-tk), causes cells to undergo apoptosis by metabolizing a prodrug, such as ganciclovir. In some embodiments, the presence of overexpression of the safety switch (overexpressed presence of a safety switch) itself causes the cell to undergo apoptosis. In some embodiments, the safety switch is a p 53-based molecule, HSV-tk, or inducible caspase-9.

The subject: as used herein, the term "subject" refers to a mammal. In some embodiments, the subject is a non-human primate or rodent. In some embodiments, the subject is a human. In some embodiments, the subject has, is suspected of having, or is at risk of having, a disease or disorder. In some embodiments, the subject has one or more symptoms of the disease or disorder.

Survival factor: as used herein, the term "survival factor" generally refers to a protein (e.g., expressed by a polynucleotide described herein) that, when increased or decreased in a cell, enables the cell, e.g., a universal donor cell, to survive at a higher survival rate relative to an unmodified cell upon transplantation or implantation into a host subject. In some embodiments, the survival factor is a human survival factor. In some embodiments, the survival factor is a member of a critical pathway involved in cell survival. In some embodiments, the critical pathways involved in cell survival involve hypoxia, reactive oxygen species, nutrient deprivation and/or oxidative stress. In some embodiments, the genetic modification, e.g., deletion or insertion, of at least one survival factor enables the universal donor cell to survive longer than the unmodified cell, e.g., at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold longer after implantation. In some embodiments, the survival factor is MANF (NCBI gene ID number: 7873), ZNF143 (NCBI gene ID number: 7702), TXNIP (NCBI gene ID number: 10628), FOXO1 (NCBI gene ID number: 2308), or JNK (NCBI gene ID number: 5599). In some embodiments, the survival factor is inserted into a cell, such as a universal donor cell. In some embodiments, the survival factor is deleted from the cell, e.g., a universal donor cell. In some embodiments, insertion of a polynucleotide encoding MANF enables cells, e.g., universal donor cells, to survive higher survival rates relative to unmodified cells after transplantation or implantation into a host subject. In some embodiments, the deletion or insertion-deletion mutation within or near the TXNIP gene enables cells, e.g., universal donor cells, to survive at a higher survival rate relative to unmodified cells after transplantation or implantation into a host subject.

Tolerogenic factors: as used herein, the term "tolerogenic factors" generally refers to proteins (e.g., expressed by the polynucleotides described herein) that, when increased or decreased in a cell, enable the cell, e.g., a universal donor cell, to inhibit or evade immune rejection at a higher rate (rate) relative to an unmodified cell upon transplantation or implantation into a host subject. In some embodiments, the tolerogenic factors are human tolerogenic factors. In some embodiments, the genetic modification of at least one tolerogenic factor (e.g., insertion or deletion of at least one tolerogenic factor) causes a cell, such as a universal donor cell, to inhibit or evade immune rejection at a rate that is at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold higher than an unmodified cell after implantation. In some embodiments, the tolerogenic factors are TNFAIP3 (NCBI gene ID number: 7128), CD39 (NCBI gene ID number: 953), CD73 (NCBI gene ID number: 4907), PD-L-1 (NCBI gene ID number: 29126), HLA-E (NCBI gene ID number: 3133), HLA-G (NCBI gene ID number: 3135), CTLA-4 (NCBI gene ID number: 1493), or CD47 (NCBI gene ID number: 961). In some embodiments, the tolerogenic factors are inserted into cells, such as universal donor cells. In some embodiments, the tolerogenic factors are deleted from the cells, e.g., universal donor cells. In some embodiments, insertion of polynucleotides encoding TNFAIP3, CD39, CD73, HLA-E, PD-L-1, HLA-G, CTLA-4, and/or CD47 enables a cell, e.g., a universal donor cell, to inhibit or evade immune rejection upon transplantation or implantation into a host subject.

Transcriptional regulator of MHC-I or MHC-II: as used herein, the term "MHC-I or MHC-II transcriptional regulator" generally refers to a biological molecule that regulates, e.g., increases or decreases, MHC-I and/or MHC-II human leukocyte antigen expression. In some embodiments, the biomolecule is a polynucleotide, such as a gene or protein. In some embodiments, the transcriptional regulator of MHC-I or MHC-II will increase or decrease cell surface expression of at least one MHC-I or MHC-II protein. In some embodiments, the transcriptional regulator of MHC-I or MHC-II will increase or decrease the expression of at least one MHC-I or MHC-II gene. In some embodiments, the transcriptional regulator is CIITA (NCBI gene ID number: 4261) or NLRC5 (NCBI gene ID number: 84166). In some embodiments, the deletion or reduction of expression of CIITA or NLRC5 reduces expression of at least one MHC-I or MHC-II gene.

Universal donor cell: as used herein, the term "universal donor cell" generally refers to a genetically modified cell that is less prone to allograft rejection during cell transplantation and/or exhibits increased survival after transplantation relative to an unmodified cell. In some embodiments, the genetically modified cells described herein are universal donor cells. In some embodiments, the universal donor cell has increased immune evasion and/or survival after transplantation as compared to an unmodified cell. In some embodiments, the universal donor cell has increased cell survival as compared to an unmodified cell. In some embodiments, the universal donor cell may be a stem cell. In some embodiments, the universal donor cell may be an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem or progenitor cell (HSPC) (also known as a Hematopoietic Stem Cell (HSC)). In some embodiments, the universal donor cell may be a differentiated cell. In some embodiments, the universal donor cell can be a somatic cell (e.g., an immune system cell). In some embodiments, the universal donor cell is administered to the subject. In some embodiments, the universal donor cell is administered to a subject having, suspected of having, or at risk of having a disease. In some embodiments, the universal donor cell is capable of differentiating into a lineage restricted progenitor cell or a fully differentiated somatic cell. In some embodiments, the lineage restricted progenitor cell is a pancreatic endodermal progenitor cell, a pancreatic endocrine progenitor cell, a mesenchymal progenitor cell, a muscle progenitor cell, a maternal cell, a hematopoietic progenitor cell, or a neural progenitor cell. In some embodiments, the fully differentiated somatic cells are endocrine cells (endocrine secretory cell) such as pancreatic β cells, epithelial cells, endodermal cells, macrophages, hepatocytes, adipocytes, kidney cells, blood cells, or cells of the immune system. In some embodiments, the fully differentiated somatic cell is a cardiomyocyte.

Unmodified cells: as used herein, the term "unmodified cell" refers to a cell that has not been genetically modified with respect to a polynucleotide or gene encoding a transcriptional regulator, survival and/or tolerogenic factor of MHC-I, MHC-I, MHC-I or MHC-II. In some embodiments, the unmodified cell may be a stem cell. In some embodiments, the unmodified cell may be an Embryonic Stem Cell (ESC), an Adult Stem Cell (ASC), an Induced Pluripotent Stem Cell (iPSC), or a hematopoietic stem or progenitor cell (HSPC) (also known as a Hematopoietic Stem Cell (HSC)). In some embodiments, the unmodified cell may be a differentiated cell. In some embodiments, the unmodified cell may be selected from a somatic cell (e.g., an immune system cell, such as a T cell, e.g., a cd8+ T cell). If the universal donor cell is compared "to an unmodified cell," the universal donor cell and the unmodified cell are the same cell type or share a common parent cell line, e.g., the universal donor iPSC is compared to the unmodified iPSC.

Within or near the gene: as used herein, the term "intra-or nearby" refers to a site or region of genomic DNA that is an intron or exon component of the gene or that is located proximal to the gene. In some embodiments, a locus of genomic DNA is within a gene if the locus comprises at least a portion of an intron or exon of the gene. In some embodiments, the site of genomic DNA located near a gene may be at the 5 'or 3' end of the gene (e.g., the 5 'or 3' end of the coding region of the gene). In some embodiments, the site of genomic DNA located near a gene may be a promoter region or a repressor region that regulates expression of the gene. In some embodiments, the locus of genomic DNA located near a gene may be on the same chromosome as the gene. In some embodiments, a locus or region of genomic DNA is near the gene if the locus or region is within 50Kb, 40Kb, 30Kb, 20Kb, 10Kb, 5Kb, 1Kb of the 5 'or 3' end of the gene (e.g., the 5 'or 3' end of the gene coding region), or closer to the 5 'or 3' end of the gene.

As used herein, the terms "comprises" or "comprising" are inclusive or open-ended and do not exclude additional, unrecited elements, components, or method steps; the phrase "consisting of …" or "consisting of …" is closed and does not include any unspecified elements, steps or components; and the phrase "consisting essentially of (consisting essentially of)" or "consisting essentially of … (consists essentially)" means that certain other components may be present, i.e., those components that do not materially affect the basic properties of the compound, composition, or method. The phrase "consisting essentially of … (consisting essentially of)" or "consisting essentially of … (consists essentially)" when used in the context of a sequence means that the sequence may contain substitutions and/or additional sequences that do not alter the essential function or nature of the sequence.

Strategies for evading immune responses and improving survival

Strategies are described herein for increasing the survival or viability of genetically modified cells, i.e., universal donor cells, and/or evading an immune response after implantation into a subject. In some embodiments, these strategies enable universal donor cells to survive and/or evade immune responses with a higher success rate than unmodified cells. In some embodiments, the genetically modified cell comprises introducing at least one genetic modification within or near at least one gene encoding a surviving factor, wherein the genetic modification comprises insertion of a polynucleotide encoding a tolerogenic factor. The universal donor cell may also comprise at least one genetic modification within or near a gene encoding one or more MHC-I or MHC-II human leukocyte antigens or components of MHC-I or MHC-II complexes or transcriptional regulator, wherein the genetic modification comprises insertion of a polynucleotide encoding a second tolerogenic factor.

In some embodiments, the genetically modified cell comprises introducing at least one genetic modification within or near the at least one gene that reduces expression of one or more MHC-I and MHC-II human leukocyte antigens relative to the unmodified cell; at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and at least one genetic modification that alters expression of at least one gene encoding a survival factor relative to an unmodified cell. In other embodiments, the genetically modified cell comprises at least one deletion or insertion-deletion mutation within or near the at least one gene that alters expression of one or more MHC-I and MHC-II human leukocyte antigens relative to the unmodified cell; and at least one insertion of a polynucleotide encoding at least one tolerogenic factor at a site partially overlapping, fully overlapping or comprised within the site of gene deletion that alters expression of one or more MHC-I and MHC-II HLA. In yet other embodiments, the genetically modified cell comprises at least one genetic modification that alters expression of at least one gene encoding a survival factor relative to an unmodified cell.

The gene encoding the Major Histocompatibility Complex (MHC) is located on human chromosome 6p 21. The resulting proteins encoded by MHC genes are a range of surface proteins necessary for donor compatibility during cell transplantation. MHC genes are classified into MHC class I (MHC-I) and MHC class II (MHC-II). MHC-I genes (HLA-A, HLA-B and HLA-C) are expressed in almost all tissue cell types, presenting "non-self" antigen processing peptides to CD8+ T cells, thereby facilitating their activation into cytolytic CD8+ T cells. Transplantation or implantation of cells expressing "non-self" MHC-I molecules will elicit a robust cellular immune response against these cells and ultimately lead to the death of these cells by activated cytolytic cd8+ T cells. The MHC-I protein is closely related to B2M in the endoplasmic reticulum, B2M being necessary for the formation of functional MHC-I molecules on the cell surface. In addition, there are three atypical MHC-Ib molecules (HLA-E, HLA-F, HLA-G) which have immunomodulatory functions. MHC-II biomolecules include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR. Due to their primary function in the immune response, MHC-I and MHC-II biomolecules contribute to immune rejection after cell implantation in non-host cells, e.g. for regenerative medicine purposes.

MHC-I cell surface molecules consist of MHC encoded heavy chains (HLA-A, HLA-B or HLA-C) and the invariant subunit B2M. Thus, a decrease in intracellular B2M concentration allows for an effective way of reducing cell surface expression of MHC-I cell surface molecules.

In some embodiments, the cell comprises genomic modifications of one or more MHC-I or MHC-II genes. In some embodiments, the cell comprises genomic modifications of one or more polynucleotide sequences that modulate MHC-I and/or MHC-II expression. In some embodiments, genetic modifications of the present disclosure are made using any gene editing method, including but not limited to those described herein.

In some embodiments, reducing expression of one or more MHC-I and MHC-II human leukocyte antigens relative to an unmodified cell is achieved by direct targeting of MHC-I and/or MHC-II genes, such as genetic deletions and/or insertions of at least one base pair therein. In some embodiments, decreasing expression of one or more MHC-I and MHC-II human leukocyte antigens relative to an unmodified cell is achieved by targeting a CIITA gene, e.g., a genetic deletion. In some embodiments, decreasing expression of one or more MHC-I and MHC-II human leukocyte antigens relative to unmodified cells is achieved by targeting at least one transcriptional regulator of MHC-I or MHC-II, e.g., genetic deletion. In some embodiments, the transcriptional regulator of MHC-I or MHC-II is the NLRC5 or CIITA gene. In some embodiments, the transcriptional regulator of MHC-I or MHC-II is the RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, IRF-1 and/or TAP1 gene.

In some embodiments, the genome of the cell has been modified to delete all or part of HLA-A, HLA-B and/or HLA-C genes. In some embodiments, the genome of the cell has been modified to delete all or part of the promoter regions of HLA-A, HLA-B and/or HLA-C genes. In some embodiments, the genome of the cell has been modified to delete all or part of a gene encoding a transcriptional regulator of MHC-I or MHC-II. In some embodiments, the genome of the cell has been modified to delete all or part of the promoter region of a gene encoding a transcriptional regulator of MHC-I or MHC-II.

In some embodiments, the genome of the cell has been modified to disrupt or reduce expression of beta-2-microglobulin (B2M) (also known as beta 2 microglobulin, B2 microglobulin, or IMD 43). B2M is a non-polymorphic gene encoding a common protein subunit required for heavy chain expression of all polymorphic MHC class I. The HLA-I protein is closely related to B2M in the endoplasmic reticulum, B2M being necessary for the formation of functional cell surface-expressed HLA-I molecules. In some embodiments, the gRNA targets a site within the B2M gene that contains the 5'-GCTACTCTCTCTTTCTGGCC-3' sequence (SEQ ID NO: 1). In some embodiments, the gRNA targets a site within the B2M gene that contains the 5'-GGCCGAGATGTCTCGCTCCG-3' sequence (SEQ ID NO: 2). In some embodiments, the gRNA targets a site within the B2M gene that contains the 5'-CGCGAGCACAGCTAAGGCCA-3' sequence (SEQ ID NO: 3). In alternative embodiments, the gRNA targets a site within the B2M gene comprising any one of the following sequences: 5'-TATAAGTGGAGGCGTCGCGC-3' (SEQ ID NO: 4), 5'-GAGTAGCGCGAGCACAGCTA-3' (SEQ ID NO: 5), 5'-ACTGGACGCGTCGCGCTGGC-3' (SEQ ID NO: 6), 5'-AAGTGGAGGCGTCGCGCTGG-3' (SEQ ID NO: 7), 5-GGCCACGGAGCGAGACATCT-3' (SEQ ID NO: 8), 5'-GCCCGAATGCTGTCAGCTTC-3' (SEQ ID NO: 9), 5'-CTCGCGCTACTCTCTCTTTC-3' (SEQ ID NO: 10), 5'-TCCTGAAGCTGACAGCATTC-3' (SEQ ID NO: 11), 5'-TTCCTGAAGCTGACAGCATT-3' (SEQ ID NO: 12) or 5'-ACTCTCTCTTTCTGGCCTGG-3' (SEQ ID NO: 13). In some embodiments, the gRNA comprises an RNA form of the polynucleotide sequence of SEQ ID NO. 2. In other embodiments, the gRNA comprises an RNA form of any of SEQ ID NOs 1 or 3-13. The gRNA/CRISPR nuclease complex targets and cleaves a target site in the B2M locus. Repair of the double strand break by NHEJ may result in deletion of at least one nucleotide and/or insertion of at least one nucleotide, thereby disrupting or eliminating expression of B2M. Alternatively, the B2M locus can be targeted by at least two CRISPR systems, each comprising a different gRNA, such that cleavage at two sites in the B2M locus results in a sequence deletion between the two nicks, thereby eliminating expression of B2M.

In some embodiments, the genetically modified cell comprises at least one genetic modification that disrupts expression of at least one gene encoding an survival factor, such as TXNIP, relative to an unmodified cell. In some embodiments, the genome of the cell has been modified to reduce expression of a thioredoxin interacting protein (TXNIP), also known as EST01027, HHCPA78, thin, VDUP1, or ARRDC6.TXNIP is a metabolic gene involved in redox regulation and can also act as a tumor suppressor. Down-regulation or knockout of TXNIP may protect cells from metabolic stress. In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-GAAGCGTGTCTTCATAGCGC-3' sequence (SEQ ID NO: 32). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-TTACTCGTGTCAAAGCCGTT-3' sequence (SEQ ID NO: 33). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-TGTCAAAGCCGTTAGGATCC-3' sequence (SEQ ID NO: 34). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-GCCGTTAGGATCCTGGCTTG-3' sequence (SEQ ID NO: 35). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-GCGGAGTGGCTAAAGTGCTT-3' sequence (SEQ ID NO: 36). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-TCCGCAAGCCAGGATCCTAA-3' sequence (SEQ ID NO: 37). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-GTTCGGCTTTGAGCTTCCTC-3' sequence (SEQ ID NO: 38). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-GAGATGGTGATCATGAGACC-3' sequence (SEQ ID NO: 39). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-TTGTACTCATATTTGTTTCC-3' sequence (SEQ ID NO: 40). In some embodiments, the gRNA targets a site within the TXNIP gene that contains the 5'-AACAAATATGAGTACAAGTT-3' sequence (SEQ ID NO: 41). IN some embodiments, the gRNA comprises an RNA form of the polynucleotide sequence of SEQ ID NO. 37. In other embodiments, the gRNA comprises an RNA form of any of SEQ ID NOs 32-36 or 38-41. The gRNA/CRISPR nuclease complex targets and cleaves a target site in the TXNIP locus. Repair of the double strand break by NHEJ may result in deletion of at least one nucleotide and/or insertion of at least one nucleotide, thereby disrupting or eliminating expression of TXNIP. Alternatively, insertion of a polynucleotide encoding a foreign gene into the TXNIP locus may disrupt or eliminate expression of TXNIP.

In some embodiments, the genome of the cell has been modified to disrupt expression of a class II transactivator (CIITA), also known as C2TA, CIITAIV, MHC TA, NLRA or class II major histocompatibility complex transactivator. CIITA is the major regulator of Major Histocompatibility Complex (MHC) gene expression. CIITA is a member of the Leucine Rich Repeat (LRR) protein family of Nucleotide Binding Domains (NBD) and regulates MHC-II transcription by association with MHC enhancers (enhancement vesicles). Expression of CIITA is induced in B cells and dendritic cells according to developmental stage and can be induced by IFN- γ in most cell types. In some embodiments, the gRNA targets a site within the CIITA gene comprising 5'-GGTCCATCTGGTCATAGAAG-3' (SEQ ID NO: 25). In some embodiments, the gRNA targets a site within the CIITA gene comprising 5'-GCTCCAGGTAGCCACCTTCT-3' (SEQ ID NO: 48). In some embodiments, the gRNA targets a site within the CIITA gene comprising 5'-TAGGGGCCCCAACTCCATGG-3' (SEQ ID NO: 49). In some embodiments, the gRNA targets a site within the CIITA gene comprising 5'-GGCTTATGCCAATATCGGTG-3' (SEQ ID NO: 50). In some embodiments, the gRNA targets a site within the CIITA gene comprising 5'-AGGTGATGAAGAGACCAGGG-3' (SEQ ID NO: 51). In some embodiments, the gRNA comprises an RNA form of the sequence of SEQ ID NO. 25. The gRNA/CRISPR nuclease complex targets and cleaves a target site in the CIITA locus. Repair of the double strand break by NHEJ may result in deletion of at least one nucleotide and/or insertion of at least one nucleotide, thereby disrupting or eliminating expression of CIITA. Alternatively, insertion of a polynucleotide encoding a foreign gene into the CIITA locus may disrupt or eliminate expression of CIITA.

In some embodiments, the genome of the cell has been modified to disrupt expression of TGF- β2, TGF- β2 also known as TGFB2, transforming growth factor β2, glioblastoma-derived T cell inhibitor, transforming growth factor β -2 pre-protein transforming growth factor β -2, cetermin, G-TSF, transforming growth factor β -2, BSC-1 cytostatic 3, TGF- β2, polyergin, LDS4. The gene encodes a secreted ligand of the TGF-beta 2 protein superfamily. TGF-. Beta.2 is a key activator of fibroblasts, a central effector of the fibrotic response, and also promotes the fibrotic phenotype of immune and vascular cells. Disruption of TGF- β2 expression may improve long-term survival of implanted universal donor cells. In some embodiments, the genome of the cell has been modified to disrupt the TGF-beta 2 gene. The gRNA targets a site in the TGF-beta 2 gene that contains 5'-GTTCATGCGCAAGAGGATCG-3' (SEQ ID NO: 57). The gRNA/CRISPR nuclease complex targets and cleaves target sites in the TGF-beta 2 locus. Repair of the double strand break by NHEJ may result in deletion of at least one nucleotide and/or insertion of at least one nucleotide, thereby disrupting or eliminating expression of TGF- β2. Alternatively, insertion of a polynucleotide encoding a foreign gene into the TGF- β2 locus may disrupt or eliminate expression of TGF- β2.

In some embodiments, the genome of the cell has been modified to reduce expression of the NLR family CARD-containing domain 5 (NLRC 5). NLRC5 is a key regulator of MHC-I mediated immune responses, and like CIITA, NLRC5 is highly inducible by IFN-gamma and translocates into the nucleus. NLRC5 activates the promoter of MHC-I gene and induces transcription of MHC-I and related genes involved in MHC-I antigen presentation.

In some embodiments, polynucleotides encoding one or more tolerogenic factors may be inserted into cells, such as genetically modified or non-genetically modified cells, to generate universal donor cells for immune privilege. Exemplary tolerogenic factors include, but are not limited to, one or more of TNFAIP3, CD39, PD-L-1, HLA-E, CD73, HLA-C, HLA-F, HLA-G, CTLA-4-Ig, CD47, CI-inhibitor, and IL-35. In some embodiments, the tolerogenic factor is TNFAIP3 or a20, also known as OTUD7C, TNFAIP2, AISBL, or tnfα -inducing protein 3.TNFAIP3 or A20 is a key regulator of inflammation and immunity, and is known to inhibit NF- κB activation and TNF-mediated apoptosis. In some embodiments, the tolerogenic factor is CD39, which is also known as ENTPD1 (ectonucleotide triphosphate bisphosphate hydrogenase-1), NTPD enzyme 1, ATPD enzyme or SPG64. While CD39 is a tolerogenic factor, it may also provide benefits by increasing angiogenesis, anti-inflammatory activity, and/or other means. In some embodiments, the tolerogenic factor is PD-L-1 (programmed death ligand 1), also known as cluster of differentiation 274 (CD 274), B7 homolog (B7-H, B H1), PDCD1L1, PDCD1LG1 or PDL1.PD-L-1 appears to play a major role in the adaptive arm of the suppression immune system and is considered a co-suppressor of immune response. In some embodiments, the tolerogenic factor is HLA-E, also known as EA1.2, EA2.1, HLA-6.2, MHC, QA1, or class I major histocompatibility complex E. HLA-E is an important regulator of Natural Killer (NK) and Cytotoxic T Lymphocyte (CTL) activation and inhibition functions. In some embodiments, the tolerogenic factors are CD73, also known as 5 '-nucleotidase extracellular (NT 5E), 5' -nucleotidase (5 '-NT), extracellular-5' -nucleotidase, ENT, EN, NT5, NTE, or E5NT. CD73 is a plasma membrane protein that catalyzes the conversion of AMP to adenosine. CD 73-derived adenosine promotes abnormal differentiation of Dendritic Cells (DCs) by activating the A2b receptor on the DCs, thereby promoting a tolerogenic phenotype characterized by increased production of IL-6, IL-10, VEGF and IL-8 and expression of immunosuppressive proteins such as IDO, TGF-beta, arginase 2 and COX 2. In some embodiments, the genetic modification, e.g., insertion of at least one polynucleotide encoding at least one tolerogenic factor, enables the universal donor cell to inhibit or evade immune rejection at a rate that is at least 1.05, at least 1.1, at least 1.25, at least 1.5, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, or at least 50 fold higher than the unmodified cell after implantation. In some embodiments, insertion of polynucleotides encoding TNFAIP3, CD39, PD-L-1, HLA-E, CD73, HLA-G, CTLA-4, and/or CD47 enables universal donor cells to inhibit or evade immune rejection upon transplantation or implantation into a host subject.

In some embodiments, polynucleotides encoding one or more survival factors, such as MANF, may be inserted into genetically modified or non-genetically modified cells to produce universal donor cells with increased survival. In some embodiments, the survival factor is MANF, which is also known as arginine-rich in early tumor-mutated (ARMET), arginine-rich protein (ARP), or a brain astrocyte-derived neurotrophic factor. MANF is an Endoplasmic Reticulum (ER) stress-induced neurotrophic factor that promotes proliferation and survival of pancreatic beta cells, as well as survival of dopaminergic neurons. In some embodiments, insertion of a polynucleotide encoding one or more survival factors, such as MANF, enables universal donor cells to survive at a rate at least 1.05-fold, at least 1.1-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold higher than unmodified cells after transplantation or implantation into a host subject.

Polynucleotides encoding tolerogenic factors and/or survival factors typically comprise left and right homology arms flanking the nucleotide sequence encoding the tolerogenic factor. Homology arms have substantial sequence homology to genomic DNA at or near the targeted insertion site. For example, the left homology arm may be a nucleotide sequence homologous to a region located to the left or upstream of the target site or cleavage site, and the right homology arm may be a nucleotide sequence homologous to a region located to the right or downstream of the target site or cleavage site. The proximal end of each homology arm may be homologous to the genomic DNA sequence adjacent to the cleavage site. Alternatively, the proximal end of each homology arm may be homologous to a genomic DNA sequence of up to about 10, 20, 30, 40, 50, 60 or 70 nucleobases from the cleavage site. Thus, a polynucleotide encoding a tolerogenic factor may be inserted into or replace a targeted locus within about 10, 20, 30, 40, 50, 60 or 70 base pairs of the cleavage site, and additional genomic DNA adjacent to the cleavage site (and not homologous to the homology arm) may be deleted. The homology arms may range in length from about 50 nucleotides to several thousand nucleotides. In some embodiments, the homology arms can range in length from about 500 nucleobases to about 1000 nucleobases. In some embodiments, the homology arm is about 700, about 800, or about 900 nucleobases in length. In some embodiments, the homology arm is about 800 nucleobases in length. Substantial sequence homology between the homology arms and genomic DNA may be at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%. In some embodiments, the homology arm is identical to genomic DNA.

In some embodiments, the homology arms are used with B2M primers (e.g., gRNA in the form of RNA comprising SEQ ID NOS: 1-13). In some embodiments, the homology arms are designed for use with any B2M guide that will eliminate the B2M gene start site. In some embodiments, the B2M homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 15 or 22, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 15 or 22. In some embodiments, the left B2M homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 15, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 15. In some embodiments, the right B2M homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 22, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 22.

In some embodiments, the homology arm is used with a TXNIP guide (e.g., a gRNA in the form of RNA comprising SEQ ID NOS: 32-41). In some embodiments, the homology arm is designed for use with any TXNIP guide targeting TXNIP exon 1 (e.g., gRNA in the form of RNA comprising SEQ ID NOS: 32-41). In some embodiments, the TXNIP homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 26 or 28, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 26 or 28. In some embodiments, the left TXNIP homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 26, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 26. In some embodiments, the right TXNIP homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 28, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 28.

In some embodiments, the homology arm is used with CIITA primers (e.g., gRNA in the form of RNA comprising SEQ ID NOS: 25 or 48-51). In some embodiments, the CIITA homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 42 or 44, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 42 or 44. In some embodiments, the left CIITA homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 42, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 42. In some embodiments, the right CIITA homology arm may comprise or consist essentially of: the nucleotide sequence of SEQ ID NO. 44, or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 44.

In some embodiments, the homology arm is used with a TGF-. Beta.2 guide (e.g., a gRNA targeting a target sequence comprising SEQ ID NO: 57).

The at least one polynucleotide encoding the at least one tolerogenic and/or survival factor may comprise a sequence encoding one or more ribosome jumps such that a single transcript is produced upon expression, but two or more separate proteins are produced during translation due to ribosome jumps. In some embodiments, the ribosome jump may be a short peptide (-20 aa) which prevents the ribosome from creating a peptide bond between glycine and proline at the C-terminus of the growing polypeptide chain. Ribosome pauses after glycine, resulting in release of nascent polypeptide chains. Translation resumes and proline becomes the first amino acid of the second polypeptide chain. This mechanism results in a distinct co-translational cleavage of the polypeptide (co-translational cleavage). The highly conserved sequence at the C-terminus of the ribosome-hopping peptide contributes to steric hindrance and ribosome-hopping. In some embodiments, the ribosome-hopping peptide is a 2A sequence family member. Suitable 2A sequence family members include F2A, T2A, E a and P2A, wherein F2A is derived from foot-and-mouth disease virus 2A, t2A is derived from thorn vein occlusion (triosea asigna) virus 2A, e2A is derived from equine rhinitis a virus, and P2A is derived from porcine enterovirus-1 2A. In some embodiments, the ribosome-hopping peptide is P2A. In some embodiments, the sequence encoding ribosome jump P2A comprises or consists of the nucleotide sequence of SEQ ID NO: 18. In other embodiments, the ribosome jump may be an Internal Ribosome Entry Sequence (IRES), which is an RNA element that allows translation initiation in a cap-independent manner. Thus, IRES allows the production of two separate proteins from a single transcriptional unit. IRES elements are well known in the art and may be derived, for example, from viral genomes (e.g., picornaviruses), thrush viruses (aphthoviruses), pestiviruses (pestiviruses) IRES) or cellular mRNA (e.g., various growth factors, transcription factors, oncogenes, etc.).

At least one polynucleotide encoding at least one tolerogenic and/or survival factor may be operably linked to an exogenous promoter. The exogenous promoter may be a constitutive, inducible, time-specific, tissue-specific or cell type-specific promoter. In some embodiments, the exogenous promoter is a CMV, EFla, PGK, CAG/CAGGS or UBC promoter. Typically, the CAG or CAGGS promoter includes the CMV enhancer, chicken β -actin promoter and chimeric introns. In some embodiments, the CAG or CAGGS promoter comprises or consists essentially of: the nucleotide sequence of SEQ ID NO. 16 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 16.

In some embodiments, at least one polynucleotide encoding at least one tolerogenic and/or survival factor may be inserted into a safe harbor locus, such as the AAVS1 locus. In some embodiments, at least one polynucleotide encoding at least one tolerogenic and/or survival factor is inserted at a site or region of genomic DNA that overlaps, completely overlaps, or is contained within (i.e., within or near) an MHC-I gene, an MHC-II gene, a transcriptional regulator or survival factor of MHC-I or MHC-II gene.

In certain embodiments, the present disclosure contemplates universal donor cells having one or more insertions corresponding to exogenous polynucleotides of any genes listed as knockouts in table 1 and/or disrupted expression of one or more genes listed as knockouts in table 1. The engineered universal donor cell can include one polynucleotide insertion, any two polynucleotide insertion, any three polynucleotide insertion, any four polynucleotide insertion, any five polynucleotide insertion, or all six polynucleotide insertion corresponding to the genes listed in table 1 at any target genomic location (e.g., safe harbor location), and/or the engineered universal donor cell can include disrupted expression (e.g., reduced or eliminated expression) of one, two, three, or four of the target genes listed in table 1. The cell may comprise any possible combination of gene knockins and gene knockouts listed. In some embodiments, two or more polynucleotides to be inserted may be linked by one or more sequences encoding a ribosome jump such as a 2A peptide, so that two or more separate proteins may be expressed from a single RNA transcript. In some embodiments, one or more polynucleotides to be inserted into the genome of a cell are operably linked to an exogenous promoter.

Table 1: list of possible gene knockins and gene knockouts

Gene knock-in	Gene knockout
		PD-L-1	B2M
TNFAIP3(A20)	TXNIP
		MANF	CIITA
CD39	TGF-β2
		HLA-E
CD73

In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the B2M locus. In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the B2M locus at the same time or after all or part of the B2M gene or promoter is deleted. In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the TXNIP locus at the same time or after deletion of all or part of the TXNIP gene or promoter. In some embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the CIITA locus at the same time or after deletion of all or part of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding PD-L-1 is inserted at a site within or near the TGF-beta 2 locus at the same time or after the deletion of all or part of the TGF-beta 2 gene or promoter. The polynucleotide encoding PD-L-1 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the polynucleotide encoding PD-L-1 comprises the nucleotide sequence of SEQ ID NO. 20 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 20.

In some embodiments, the polynucleotide encoding TNFAIP3 is inserted into a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding TNFAIP3 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding TNFAIP3 is inserted into a site within or near the B2M locus. In some embodiments, the polynucleotide encoding TNFAIP3 is inserted into a site within or near the B2M locus at the same time or after all or part of the B2M gene or promoter is deleted. In some embodiments, the polynucleotide encoding TNFAIP3 is inserted into a site within or near the TXNIP locus at the same time or after all or part of the TXNIP gene or promoter is deleted. In some embodiments, the polynucleotide encoding TNFAIP3 is inserted into a site within or near the CIITA locus simultaneously with or following a deletion of all or part of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding TNFAIP3 is inserted at a site within or near the TGF-beta 2 locus simultaneously with or subsequent to the deletion of all or part of the TGF-beta 2 gene or promoter. The polynucleotide encoding TNFAIP3 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the polynucleotide encoding TNFAIP3 comprises the nucleotide sequence of SEQ ID NO. 19 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 19.

In some embodiments, the polynucleotide encoding MANF is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding MANF is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding MANF is inserted into a site within or near the B2M locus. In some embodiments, the polynucleotide encoding MANF is inserted at a site within or near the B2M locus simultaneously with or subsequent to the deletion of all or part of the B2M gene or promoter. In other embodiments, the polynucleotide encoding MANF is inserted at a site within or near the TXNIP locus simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, the polynucleotide encoding MANF is inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding MANF is inserted at a site within or near the TGF- β2 locus concurrently with or subsequent to the deletion of all or part of the TGF- β2 gene or promoter. The polynucleotide encoding MANF is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the polynucleotide encoding MANF comprises the nucleotide sequence of SEQ ID NO. 17 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 17.

In some embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the CIITA locus or within or near the B2M locus. In some embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the B2M locus simultaneously with or subsequent to the deletion of all or part of the B2M gene or promoter. In other embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the TXNIP locus at the same time or after all or part of the TXNIP gene or promoter is deleted. In some embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the CIITA locus at the same time or after deletion of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding CD39 is inserted at a site within or near the TGF- β2 locus concurrently with or subsequent to the deletion of all or part of the TGF- β2 gene or promoter. The polynucleotide encoding CD39 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the polynucleotide encoding CD39 comprises the nucleotide sequence of SEQ ID NO. 27 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 27.

In some embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF-beta 2 locus. In some embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the TXNIP locus. In some embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the B2M locus simultaneously with or subsequent to the deletion of all or part of the B2M gene or promoter. In other embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the TXNIP locus simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the CIITA locus at the same time or after deletion of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the TGF-beta 2 locus at the same time or after the deletion of all or part of the TGF-beta 2 gene or promoter. The polynucleotide encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide. The polynucleotide encoding HLA-E is operably linked to an exogenous promoter. The exogenous promoter may be a CMV promoter. In some embodiments, the polynucleotide encoding HLA-E comprises the nucleotide sequence of SEQ ID NO. 43 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 43.

In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the B2M locus or within or near the CIITA locus. In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the B2M locus at the same time or after deletion of the B2M gene or promoter. In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the TXNIP locus at the same time or after deletion of the TXNIP gene or promoter. In some embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the CIITA locus at the same time or after deletion of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding CD73 is inserted at a site within or near the TGF- β2 locus at the same time or after all or part of the TGF- β2 gene or promoter is deleted. The polynucleotide encoding CD73 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the polynucleotide encoding CD73 comprises the nucleotide sequence of SEQ ID NO. 46 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 46.

In some embodiments, polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted into a site within or near the B2M locus. In some embodiments, polynucleotides encoding MANF, TNFAIP3 and PD-L-1 are inserted at a site within or near the B2M locus, either simultaneously with or following deletion of all or part of the B2M gene or promoter. In some embodiments, polynucleotides encoding MANF, TNFAIP3 and PD-L-1 are inserted at a site within or near the TXNIP locus, either simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted at a site within or near the TGF- β2 locus simultaneously with or subsequent to the deletion of all or part of the TGF- β2 gene or promoter. Polynucleotides encoding MANF, TNFAIP3 and PD-L-1 comprise a sequence encoding MANF linked to a sequence encoding a first ribosome jump, a sequence encoding a first ribosome jump linked to a sequence encoding TNFAIP3, a sequence encoding TNFAIP3 linked to a sequence encoding a second ribosome jump, and a sequence encoding a second ribosome jump linked to a sequence encoding PD-L-1. The first and second ribosome jumps can be members of the 2A sequence family, for example, both can be P2A. In some embodiments, the polynucleotide comprises a MANF-P2A-TNFAIP3-P2A-PD-L-1 coding sequence. In some embodiments, the polynucleotide encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 comprises or consists of: the nucleotide sequence of SEQ ID NO. 52 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 52. In some embodiments, the polynucleotide encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor vector encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 and comprising a B2M homology arm has the nucleotide sequence of SEQ ID NO. 24. In some embodiments, the donor vector encodes MANF-P2A-TNFAIP3-P2A-PD-L-1 and comprises a TXNIP homology arm. In some embodiments, the donor vector encodes MANF-P2A-TNFAIP3-P2A-PD-L-1 and comprises a CTIA homology arm. In some embodiments, the donor vector encodes MANF-P2A-TNFAIP3-P2A-PD-L-1 and comprises a TGF- β2 homology arm.

In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF-beta 2 locus. In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the B2M locus. In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the B2M locus, either simultaneously with or following deletion of all or part of the B2M gene or promoter. In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the TXNIP locus, either simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, polynucleotides encoding TNFAIP3 and PD-L-1 are inserted at a site within or near the TGF-beta 2 locus simultaneously with or subsequent to the deletion of all or part of the TGF-beta 2 gene or promoter. The polynucleotide encoding TNFAIP3 and PD-L-1 comprises a sequence encoding TNFAIP3, the sequence encoding TNFAIP3 is linked to a sequence encoding ribosome jump, and the sequence encoding ribosome jump is linked to a sequence encoding PD-L-1. Ribosome jumps can be members of the 2A sequence family, such as P2A. In some embodiments, the polynucleotide comprises a TNFAIP3-P2A-PD-L-1 coding sequence. In some embodiments, the polynucleotide encoding TNFAIP3-P2A-PD-L-1 comprises or consists of: the nucleotide sequence of SEQ ID NO. 54 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 54. In some embodiments, the polynucleotide encoding TNFAIP3-P2A-PD-L-1 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor plasmid encoding TNFAIP3-P2A-PD-L-1 and comprising the B2M homology arm has the nucleotide sequence of SEQ ID NO. 31. In some embodiments, the donor plasmid encodes TNFAIP3-P2A-PD-L-1 and comprises a TXNIP homology arm. In some embodiments, the donor plasmid encodes TNFAIP3-P2A-PD-L-1 and comprises a CIITA homology arm. In some embodiments, the donor vector encodes TNFAIP3-P2A-PD-L-1 and comprises a TGF-beta 2 homology arm.

In some embodiments, polynucleotides encoding MANF and HLA-E are inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, polynucleotides encoding MANF and HLA-E are inserted at a site within or near the B2M locus or within or near the TXNIP locus. In some embodiments, polynucleotides encoding MANF and HLA-E are inserted into a site within or near the TXNIP locus. In some embodiments, polynucleotides encoding MANF and HLA-E are inserted at a site within or near the B2M locus simultaneously with or subsequent to the deletion of all or part of the B2M gene or promoter. In some embodiments, polynucleotides encoding MANF and HLA-E are inserted at a site within or near the TXNIP locus simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, polynucleotides encoding MANF and HLA-E are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, the polynucleotide encoding HLA-E is inserted at a site within or near the TGF-beta 2 locus at the same time or after the deletion of all or part of the TGF-beta 2 gene or promoter. Polynucleotides encoding MANF and HLA-E comprise a sequence encoding MANF linked to a sequence encoding ribosome skip linked to a sequence encoding HLA-E. Ribosome jumps can be members of the 2A sequence family, such as P2A. The sequences encoding HLA-E comprise sequences encoding HLA-E trimers comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide. In some embodiments, the polynucleotide comprises MANF-P2A-HLA-E coding sequences. In some embodiments, the polynucleotide encoding MANF-P2A-HLA-E comprises or consists of: the nucleotide sequence of SEQ ID NO. 55 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 55. In some embodiments, the polynucleotide encoding MANF-P2A-HLA-E is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor plasmid encoding MANF-P2A-HLA-E and comprising the TXNIP homology arm has the nucleotide sequence of SEQ ID NO. 45. In some embodiments, the donor plasmid encodes MANF-P2A-HLA-E and comprises a B2M homology arm. In some embodiments, the donor plasmid encodes MANF-P2A-HLA-E and comprises a CIITA homology arm. In some embodiments, the donor plasmid encodes MANF-P2A-HLA-E and comprises a TGF- β2 homology arm.

In some embodiments, the polynucleotide encoding CD39 and PD-L-1 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotide encoding CD39 and PD-L-1 is inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, polynucleotides encoding CD39 and PD-L-1 are inserted at a site within or near the B2M locus. In some embodiments, the polynucleotides encoding CD39 and PD-L-1 are inserted at a site within or near the B2M locus simultaneously with or subsequent to the deletion of all or part of the B2M gene or promoter. In some embodiments, the polynucleotides encoding CD39 and PD-L-1 are inserted at a site within or near the TXNIP locus simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, the polynucleotides encoding CD39 and PD-L-1 are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, polynucleotides encoding CD39 and PD-L-1 are inserted at a site within or near the TGF- β2 locus simultaneously with or subsequent to the deletion of all or part of the TGF- β2 gene or promoter. The polynucleotides encoding CD39 and PD-L-1 comprise a sequence encoding CD39, the sequence encoding CD39 being linked to a sequence encoding a ribosome jump, the sequence encoding a ribosome jump being linked to a sequence encoding PD-L-1. Ribosome jumps can be members of the 2A sequence family, such as P2A. In some embodiments, the polynucleotide comprises a CD39-P2A-PD-L-1 coding sequence. In some embodiments, the polynucleotide encoding CD39-P2A-PD-L-1 comprises or consists of: the nucleotide sequence of SEQ ID NO. 53 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 53. In some embodiments, the polynucleotide encoding CD39-P2A-PD-L-1 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor plasmid encoding CD39-P2A-PD-L-1 and comprising the B2M homology arm has the nucleotide sequence of SEQ ID NO. 30. In some embodiments, the donor plasmid encodes CD39-P2A-PD-L-1 and comprises a TXNIP homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-PD-L-1 and comprises a CIITA homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-PD-L-1 and comprises a TGF-beta 2 homology arm.

In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the B2M locus. In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the B2M locus, either simultaneously with or following deletion of all or part of the B2M gene or promoter. In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the TXNIP locus, either simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, polynucleotides encoding CD39, CD73, and PD-L-1 are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, polynucleotides encoding CD39, CD73 and PD-L-1 are inserted at a site within or near the TGF-beta 2 locus simultaneously with or subsequent to the deletion of all or part of the TGF-beta 2 gene or promoter. Polynucleotides encoding CD39, CD73 and PD-L-1 comprise a sequence encoding CD39, a sequence encoding CD39 linked to a sequence encoding ribosome jump, a sequence encoding CD73 linked to a sequence encoding ribosome jump, a sequence encoding ribosome jump linked to a sequence encoding PD-L-1. Ribosome jumps can be members of the 2A sequence family, such as P2A. In some embodiments, the polynucleotide comprises a CD39-P2A-CD73-P2A-PD-L-1 coding sequence. In some embodiments, the polynucleotide encoding CD39-P2A-CD73-P2A-PD-L-1 comprises or consists of: the nucleotide sequence of SEQ ID NO. 56 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 56. In some embodiments, the polynucleotide encoding CD39-P2A-CD73-P2A-PD-L-1 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor plasmid encoding CD39-P2A-CD73-P2A-PD-L-1 and comprising the B2M homology arm has the nucleotide sequence of SEQ ID NO. 47. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a TXNIP homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a CIITA homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a TGF- β2 homology arm.

In some embodiments, the polynucleotides encoding CD39 and CD73 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, within or near the CIITA locus, or within or near the TGF- β2 locus. In some embodiments, the polynucleotides encoding CD39 and CD73 are inserted at a site within or near the B2M locus, within or near the TXNIP locus, or within or near the CIITA locus. In some embodiments, polynucleotides encoding CD39 and CD73 are inserted at a site within or near the B2M locus. In some embodiments, the polynucleotides encoding CD39 and CD73 are inserted at a site within or near the B2M locus simultaneously with or after the deletion of all or part of the B2M gene or promoter. In some embodiments, the polynucleotides encoding CD39 and CD73 are inserted at a site within or near the TXNIP locus simultaneously with or subsequent to the deletion of all or part of the TXNIP gene or promoter. In some embodiments, the polynucleotides encoding CD39 and CD73 are inserted at a site within or near the CIITA locus simultaneously with or subsequent to the deletion of all or part of the CIITA gene or promoter. In other embodiments, polynucleotides encoding CD39 and CD73 are inserted at a site within or near the TGF- β2 locus simultaneously with or subsequent to the deletion of all or part of the TGF- β2 gene or promoter. The polynucleotides encoding CD39 and CD73 comprise a sequence encoding CD39, the sequence encoding CD39 being linked to a sequence encoding a ribosome jump, the sequence encoding a ribosome jump being linked to a sequence encoding CD 73. Ribosome jumps can be members of the 2A sequence family, such as P2A. In some embodiments, the polynucleotide comprises a CD39-P2A-CD73 coding sequence. In some embodiments, the polynucleotide encoding CD39-P2A-CD73 comprises or consists of: the nucleotide sequence of SEQ ID NO. 58 or a nucleotide sequence having at least 85%, 90%, 95% or 99% sequence identity to the nucleotide sequence of SEQ ID NO. 58. In some embodiments, the polynucleotide encoding CD39-P2A-CD73 is operably linked to an exogenous promoter. The exogenous promoter may be a CAG or CAGGS promoter. In some embodiments, the donor plasmid encodes CD39-P2A-CD73 and comprises a B2M homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a TXNIP homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a CIITA homology arm. In some embodiments, the donor plasmid encodes CD39-P2A-CD73-P2A-PD-L-1 and comprises a TGF- β2 homology arm.

In some embodiments, at least one multicore encoding at least one tolerogenic and/or survival factorThe nucleotide may be delivered to the cell as part of a vector. For example, the vector may be a plasmid vector. In various embodiments, the amount of plasmid vector delivered to the cells may range from about 0.5 μg to about 10 μg (per about 10 ⁶ Individual cells). In some embodiments, the amount of plasmid may range from about 1 μg to about 8 μg, from about 2 μg to about 6 μg, or from about 3 μg to about 5 μg. In particular embodiments, the amount of plasmid delivered to the cells may be about 4 μg.

In certain embodiments, cells that do not express MHC-II and cells that express moderately MHC-I are genetically modified to not express MHC-I or MHC-II on their surface. In another embodiment, cells without MHC-I/II surface expression are further edited to have PD-L-1 expression, e.g., insertion of a polynucleotide encoding PD-L-1; having MANF expression, e.g., inserting a polynucleotide encoding MANF; with CD39 expression, e.g., insertion of a polynucleotide encoding CD 39; having CD73 expression, e.g., inserting a polynucleotide encoding CD 73; having HLA-E expression, e.g., insertion of a polynucleotide encoding HLA-E; having TNFAIP3 expression, e.g., inserting a polynucleotide encoding TNFAIP3, and/or any combination thereof. In another embodiment, cells without MHC-I/II surface expression are further edited to have PD-L-1 expression, e.g., insertion of a polynucleotide encoding PD-L-1. In yet another embodiment, cells without MHC-I/II surface expression are further edited to have PD-L-1 expression, e.g., insertion of a polynucleotide encoding PD-L-1, and are also genetically modified to increase or decrease expression of at least one gene encoding a survival factor relative to unmodified cells.

In some embodiments, the cells further comprise increasing or decreasing expression of one or more additional genes, e.g., by genetic modification, which genes are not necessarily involved in immune evasion or cell survival after implantation or after transplantation. In some embodiments, the cell further comprises increased expression of one or more safety switch proteins relative to the unmodified cell. In some embodiments, the cell comprises increased expression of one or more additional genes encoding a safety switch protein. In some embodiments, the safety switch is also a suicide gene. In some embodiments, the safety switch is herpes simplex virus-1 thymidine kinase (HSV-tk) or inducible caspase-9. In some embodiments, the polynucleotide encoding at least one safety switch is inserted into the genome, e.g., into a safe harbor locus. In some other embodiments, the one or more additional genes that are genetically modified encode one or more of the following: a safety switch protein; a targeting pattern (targeting modalities); a receptor; a signaling molecule; a transcription factor; pharmaceutically active proteins or peptides; drug target candidates; and proteins integrated with the construct that promote its implantation, transport, homing, viability, self-renewal, persistence, and/or survival.

One aspect of the invention provides a method of producing a genome-engineered universal donor cell, wherein the universal donor cell comprises at least one targeted genomic modification at one or more selected sites in the genome, the method comprising genetically engineering the cell by introducing one or more constructs into a cell type described herein to allow for targeted modification at the selected sites; introducing one or more double strand breaks into the cell at the selected site using one or more endonucleases capable of recognizing the selected site; and culturing the edited cells to allow endogenous DNA repair to produce targeted insertions or deletions at the selected site; thereby obtaining a genome-modified universal donor cell. Targeted gene knockdown or knockout can be performed prior to, concurrent with, or subsequent to insertion of the targeted polynucleotide. The genetically modified universal donor cell may undergo several successive rounds of genomic modification such that more than one site is targeted and modified. The genome-modified cells are cultured, characterized, selected and expanded using techniques well known in the art. The universal donor cells produced by this method will comprise at least one functional targeted genomic modification, and wherein the genomic modified cells, if they are stem cells, are capable of differentiating into progenitor cells or fully differentiated cells.

In some other embodiments, the genome-engineered universal donor cell comprises introducing or increasing expression in at least one of HLA-E, HLA-G, CD47, PD-L-1, TNFAIP3, MANF, CD73, and/or CD 39. In some embodiments, the genome-engineered universal donor cell comprises the introduction or increased expression of HLA-E, PD-L-1, TNFAIP3, and/or MANF. In some embodiments, the genome-engineered universal donor cell comprises the introduction or increased expression of HLA-E, PD-L-1, TNFAIP3, MANF, and/or CD 39. In some embodiments, the genetically engineered universal donor cell comprises an introduced or increased expression of PD-L-1 and CD39 and/or an introduced or increased expression of PD-L-1, CD73 and CD 39. In some embodiments, the genome-engineered universal donor cell is HLA class I and/or class II deficient. In some embodiments, the genome-engineered universal donor cell comprises null or low B2M (B2M null or low). In some embodiments, the genome-engineered universal donor cells include null or low B2M and null or low TXNIP. In some embodiments, the genome-engineered universal donor cells include null or low B2M, null or low TXNIP, and null or low CIITA. In some embodiments, the genome-engineered universal donor cells include null or low B2M, null or low TXNIP, null or low CIITA, and null or low TGF- β2.

In some embodiments, the genetically engineered universal donor cell comprises an integrated or non-integrated exogenous polynucleotide encoding one or more of HLA-E, HLA-G, CD47, PD-L-1, TNFAIP3, MANF, CD73, and/or CD 39. In some embodiments, the genome-engineered universal donor cell comprises an integrated or non-integrated exogenous polynucleotide encoding one or more of HLA-E, PD-L-1, TNFAIP3, MANF, CD73, and/or CD 39. In some embodiments, the introduced expression is increased expression from a non-expressed or low-expressed gene contained in the cell. In some embodiments, the non-integrated exogenous polynucleotide is introduced using sendai virus, AAV, episome, or plasmid. In some embodiments, the universal donor cells are B2M null and TXNIP null and have introduced expression of TNFAIP3, PD-L-1, MANF, and HLA-E. In some embodiments, the universal donor cell is CIITA null. In some embodiments, the universal donor cell is TGF-beta 2 null. In some embodiments, the universal donor cell is (i) B2M null, wherein the polynucleotides encoding TNFAIP3 and PD-L-1 are inserted into or near the B2M locus, and (ii) TXNIP null, wherein the polynucleotides encoding MANF and HLA-E are inserted into or near the TXNIP locus. In some embodiments, the universal donor cell is (i) B2M null, wherein the polynucleotides encoding TNFAIP3 and PD-L-1 are inserted into or near the B2M locus, (ii) TXNIP null, wherein the polynucleotides encoding MANF and HLA-E are inserted into or near the TXNIP locus, and (iii) CIITA null, wherein the polynucleotide encoding CD39 is inserted into or near the CIITA locus. In some embodiments, the universal donor cell is (i) B2M null, wherein polynucleotides encoding TNFAIP3 and PD-L-1 are inserted into or near the B2M locus, (ii) TXNIP null, wherein polynucleotides encoding MANF and HLA-E are inserted into or near the TXNIP locus, and (iii) CIITA null, wherein polynucleotides encoding CD39 are inserted into or near the CIITA locus, and (iv) TGF- β2 null. In some embodiments, the universal donor cell is (i) B2M null, wherein a first polynucleotide encoding TNFAIP3 and PD-L-1 is inserted in or near a first site of the B2M locus, and a second polynucleotide encoding CD39 and PD-L-1 is inserted in or near a second site of the B2M locus, and (ii) TXNIP null, wherein a polynucleotide encoding MANF and HLA-E is inserted in or near the TXNIP locus. In some embodiments, the universal donor cell is (i) B2M null, wherein a first polynucleotide encoding TNFAIP3 and PD-L-1 is inserted in or near a first site of the B2M locus, and a second polynucleotide encoding CD39 and PD-L-1 is inserted in or near a second site of the B2M locus, (ii) TXNIP null, wherein a polynucleotide encoding MANF and HLA-E is inserted in or near the TXNIP locus, and (iii) TGF- β2 null. In another embodiment, the universal donor cell is B2M null, wherein the polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted into or near the B2M locus. In some embodiments, the universal donor cell is (i) B2M null, wherein the polynucleotide encoding PD-L-1 is inserted into or near the B2M locus, (ii) TXNIP null, wherein the polynucleotide encoding HLA-E is inserted into or near the TXNIP locus, and (iii) CIITA null, wherein the polynucleotide encoding CD39 is inserted into or near the CIITA locus, and (iv) TGF- β2 null. In still other embodiments, the universal donor cell is B2M null, wherein the polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted into or near the B2M locus, and optionally CIITA null, wherein the polynucleotide encoding CD39 is inserted into or near the CIITA locus. In still other embodiments, the universal donor cell is B2M null, wherein a first polynucleotide encoding MANF, TNFAIP3, and PD-L-1 is inserted in or near a first site of the B2M locus and a second polynucleotide encoding CD39 and PD-L-1 is inserted in or near a second site of the B2M locus, and optionally is TGF- β2 null. In other embodiments, the universal donor cell is (i) B2M null, wherein the polynucleotides encoding MANF, TNFAIP3, and PD-L-1 are inserted into or near the B2M locus, (ii) CIITA null, wherein the polynucleotide encoding CD39 is inserted into or near the CIITA locus, and (iii) TGF- β2 null. In further embodiments, the universal donor cell is (i) B2M null, wherein the polynucleotide encoding PD-L-1 is inserted into or near the B2M locus, (ii) TXNIP null, wherein the polynucleotide encoding HLA-E is inserted into or near the TXNIP locus, (iii) CIITA null, wherein the polynucleotide encoding CD39 is inserted into or near the CIITA locus, and (iv) TGF-beta 2 null. In yet other embodiments, the universal donor cell is (i) B2M null, wherein a first polynucleotide encoding PD-L-1 is inserted in or near a first site of the B2M locus and a second polynucleotide encoding CD39 is inserted in or near a second site of the B2M locus, and (ii) TXNIP null, wherein a polynucleotide encoding HLA-E is inserted in or near the TXNIP locus. In some embodiments, the universal donor cell is B2M null, wherein the polynucleotides encoding CD39 and PD-L-1 are inserted into or near the B2M locus. In some embodiments, the universal donor cell is B2M null, wherein the polynucleotides encoding CD39, CD73, and PD-L-1 are inserted into or near the B2M locus, and further optionally are TGF- β2 null.

In certain embodiments, the universal donor cell further comprises an increase or decrease in expression of at least one safety switch protein. It is contemplated that the methods of producing any of the genetically modified cells described herein are performed using at least any of the gene editing methods described herein.

III genome editing method

Genome editing generally refers to the process of modifying a genomic nucleotide sequence, preferably in a precise or predetermined manner. In some embodiments, the genome editing methods described herein, e.g., CRISPR-endonuclease systems, can be used to genetically modify the cells described herein, e.g., to produce universal donor cells. In some embodiments, the genome editing methods described herein, e.g., CRISPR-endonuclease systems, can be used to genetically modify the cells described herein, e.g., to introduce at least one genetic modification within or near at least one gene that reduces expression of one or more MHC-I and/or MHC-II human leukocyte antigens or other components of the MHC-I or MHC-II complex relative to an unmodified cell; introducing at least one genetic modification that increases expression of at least one polynucleotide encoding a tolerogenic factor relative to an unmodified cell; and/or introducing at least one genetic modification that increases or decreases expression of at least one gene encoding a survival factor relative to an unmodified cell.

Examples of the genome editing methods described herein include a method of cleaving deoxyribonucleic acid (DNA) at a precise target position in a genome using a site-directed nuclease, thereby generating single-stranded or double-stranded DNA breaks at specific positions within the genome. Such breaks can be and regularly repaired by natural endogenous cellular processes, such as Homology Directed Repair (HDR) and non-homologous end joining (NHEJ), as described in Cox et al, "Therapeutic genome editing: prospects and challenges,", nature Medicine,2015,21 (2), 121-31. These two main DNA repair processes consist of a range of alternative pathways. NHEJ directly links to the DNA ends resulting from double strand breaks, sometimes losing or adding nucleotide sequences, which may disrupt or enhance gene expression. HDR uses homologous or donor sequences as templates to insert defined DNA sequences at the breakpoint. Homologous sequences can be in endogenous genomes, such as sister chromatids. Alternatively, the donor sequence may be an exogenous polynucleotide, such as a plasmid, single stranded oligonucleotide, double stranded oligonucleotide (double-stranded oligonucleotide), duplex oligonucleotide (duplex oligonucleotide), or virus, having regions of high homology (e.g., left and right homology arms) to the nuclease-cleaved locus, but may also comprise additional sequences or sequence changes, including deletions that may incorporate the cleaved target locus. The third repair mechanism may be micro-homology mediated end ligation (mmoej), also known as "selective NHEJ", where the genetic result is similar to NHEJ in that small deletions and insertions may occur at the cleavage site. MMEJ can utilize homologous sequences of several base pairs flanking the DNA cleavage site to drive more favorable DNA end joining repair results, and recent reports further elucidate the molecular mechanism of this process; see, e.g., cho and Greenberg, nature,2015,518,174-76; kent et al Nature Structural and Molecular Biology,2015,22 (3): 230-7; mateos-Gomez et al Nature,2015,518,254-57; ceccaldi et al Nature,2015,528,258-62. In some cases, it is possible to predict the likely outcome of repair based on analysis of potential micro-homology to the DNA cleavage site.

Each of these genome editing mechanisms can be used to create the desired genetic modification. One step in the genome editing process may be to create one or two DNA breaks, either a double-strand break or two single-strand breaks, at the target locus near the intended mutation site. This may be achieved by using endonucleases, as described and illustrated herein.

In general, the genome editing methods described herein may be in vitro or ex vivo methods. In some embodiments, the genome editing methods disclosed herein are not methods of treating a human or animal body by therapy and/or are not processes that modify the genetic identity of a human germline.

CRISPR endonuclease system

The CRISPR-endonuclease system is a naturally occurring defense mechanism in prokaryotes and has been reused as an RNA-guided DNA targeting platform for gene editing. CRISPR systems include type I, type II, type III, type IV, type V and type VI systems. In some aspects, the CRISPR system is a type II CRISPR/Cas9 system. In other aspects, the CRISPR system is a V-type CRISPR/Cpf system. CRISPR systems rely on DNA endonucleases, such as Cas9, and two non-coding RNAs-crisprRNA (crRNA) and trans-activating RNAs (tracrRNA) -to target DNA cleavage.

crrnas drive sequence recognition and specificity of CRISPR-endonuclease complexes by Watson-Crick base pairing, typically with a sequence of about 20 nucleotides (nt) in the target DNA. Altering the 20nt sequence of 5' in crRNA allows targeting of CRISPR-endonuclease complexes to specific loci. If the target sequence is followed by a specific short DNA motif called Protospacer Adjacent Motif (PAM), with the sequence NGG, the CRISPR-endonuclease complex binds only to DNA sequences comprising sequences matching the first 20nt of single guide RNAs (sgrnas).

the tracrRNA hybridizes to the 3' end of the crRNA to form an RNA-duplex structure that is bound by the endonuclease to form a catalytically active CRISPR-endonuclease complex, which can then cleave the target DNA.

After the CRISPR-endonuclease complex binds to DNA at the target site, two independent nuclease domains within the endonuclease each cleave one of the DNA strands three bases upstream of the PAM site, leaving a Double Strand Break (DSB) where both strands of the DNA terminate in base pairs (blunt ends).

In some embodiments, the endonuclease is Cas9 (CRISPR-associated protein 9). In some embodiments, the Cas9 endonuclease is from streptococcus pyogenes (Streptococcus pyogenes), although other Cas9 homologs may be used, such as staphylococcus aureus (s.aureus) Cas9, neisseria meningitidis (n.mengitididis) Cas9, streptococcus thermophilus (s.thermophilus) CRISPR l Cas9, streptococcus thermophilus CRISPR 3Cas9, or treponema denticola (t.denticola) Cas9. In other cases, the CRISPR endonuclease is Cpf1, e.g., a bacteria of the family trichomonadaceae (l.bacteria) ND2006 Cpfl or an amino acid coccus sp. In some embodiments, the endonuclease is a Cas1, cas1B, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9 (also known as Csn1 and Csx 12), cas100, csy1, csy2, csy3, cse1, cse2, csc1, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmr1, cmr3, cmr4, cmr5, cmr6, csb1, csb2, csb3, csx17, csx14, csx10, csx16, csaX, csx3, csx1, csx15, csf1, csf2, csf3, csf4, or Cpf1 endonuclease. In some embodiments, wild-type variants may be used. In some embodiments, modified forms of the foregoing endonucleases (e.g., homologues thereof, recombination of naturally occurring molecules thereof, codon optimization thereof, or modified forms thereof) may be used.

The CRISPR nuclease can be linked to at least one Nuclear Localization Signal (NLS). At least one NLS may be located at or within 50 amino acids of the amino terminus of a CRISPR nuclease and/or at least one NLS may be located at or within 50 amino acids of the carboxy terminus of a CRISPR nuclease.

Exemplary CRISPR/Cas polypeptides include Cas9 polypeptides as published in Fonfara et al, "Phytogenesis of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type IICRISPR-Cas systems," Nucleic Acids Research,2014, 42:2577-2590. Since the discovery of Cas genes, CRISPR/Cas gene naming systems have undergone extensive rewriting. Fonfara et al also provide PAM sequences from Cas9 polypeptides of various species.

Zinc finger nucleases

Zinc Finger Nucleases (ZFNs) are modular proteins consisting of an engineered zinc finger DNA binding domain linked to the catalytic domain of a type II endonuclease fokl. Because fokl only functions as a dimer, a pair of ZFNs must be engineered to bind to homologous target "half-site" sequences on opposing DNA strands with precise spacing between them to enable the formation of catalytically active fokl dimers. When the fokl domain dimerizes, it itself has no sequence specificity, creating DNA double strand breaks between ZFN half-sites as an initial step in genome editing.

The DNA binding domain of each ZFN typically consists of 3-6 zinc fingers of a rich Cys2-His2 structure, each finger primarily recognizes a nucleotide triplet on one strand of the target DNA sequence, although cross-strand interactions with the fourth nucleotide may also be important. Altering the amino acid of a finger at a position that is in critical contact with DNA will alter the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12bp target sequence, where the target sequence is a complex of the triplet preference contributed by each finger, although the triplet preference may be affected by adjacent fingers to varying degrees. An important aspect of ZFNs is that they can easily re-target almost any genomic address simply by modifying a single finger. In most applications of ZFNs, the 4-6 finger proteins are used to recognize 12-18bp, respectively. Thus, a pair of ZFNs will typically recognize a 24-36bp combined target sequence, excluding the typical 5-7bp spacer between half-sites. The binding sites may be further separated by larger spacers (including 15-17 bp). Given that repeated sequences or gene homologs are excluded from the design process, target sequences of this length may be unique in the human genome. However, ZFN protein-DNA interactions are not absolute in their specificity, so off-target binding and cleavage events do occur, either as heterodimers between two ZFNs, or as homodimers of one or the other ZFNs. The latter possibility has been effectively eliminated by engineering the dimerization interface of the fokl domain to produce "positive" and "negative" variants (also known as obligate heterodimer variants, which can only dimerize with each other, but not with themselves). Obligatory heterodimers are forced to prevent homodimer formation. This greatly enhances the specificity of ZFNs, as well as any other nucleases employing these fokl variants.

Various ZFN-based systems have been described in the art, modifications thereto have been reported regularly, and many references describe rules and parameters for guiding the design of ZFNs; see, e.g., segal et al, proc Natl Acad Sci,199996 (6): 2758-63; dreier B et al, J Mol biol.,2000,303 (4): 489-502; liu Q et al, J Biol chem.,2002,277 (6): 3850-6; dreier et al, J Biol chem.,2005,280 (42): 35588-97; and Dreier et al, J Biol chem 2001,276 (31): 29466-78.

Transcription activator-like effector nucleases (TALENs)

TALENs represent, as with ZFNs, another form of modular nuclease whereby an engineered DNA binding domain is linked to a fokl nuclease domain, and a pair of TALENs are operated in tandem to achieve targeted DNA cleavage. The main differences from ZFNs are the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain is derived from a TALE protein, originally described in the plant bacterial pathogen Xanthomonas sp. TALEs consist of a tandem array of 33-35 amino acid repeats, each of which recognizes a single base pair in a target DNA sequence, typically up to 20bp in length, giving a total target sequence length of up to 40bp. The nucleotide specificity of each repeat is determined by the repeat variable double Residues (RVD), which include only the two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are mainly recognized by four RVDs: asn-Asn, asn-Ile, his-Asp and Asn-Gly, respectively. This constitutes a much simpler recognition code than zinc fingers and thus represents an advantage of nuclease design over zinc fingers. However, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs also benefit from the use of proprietary heterodimeric variants of fokl domains to reduce off-target activity.

Other variants have been created in which the catalytic function of the fokl domain is inactivated. If half of the TALEN or ZFN pair contains an inactive fokl domain, only single-stranded DNA cleavage (nicking) will occur at the target site, not the DSB. The results are comparable to the use of CRISPR/Cas9 or CRISPR/Cpf1 "nickase" mutants (where one of the Cas9 cleavage domains has been inactivated). DNA nicks can be used to drive genome editing of HDR, but are less efficient than DSBs. The main benefit is that off-target incisions are repaired quickly and accurately, unlike DSBs that are prone to NHEJ-mediated error repair.

Various TALEN-based systems have been described in the art and modifications thereto have been reported regularly; see, e.g., boch, science,2009 326 (5959): 1509-12; mak et al Science,2012,335 (6069):716-9; and Moscou et al Science 2009,326 (5959):1501. The use of TALENs based on a "Golden Gate" platform or cloning scheme has been described by several groups; see, e.g., cerak et al, nucleic Acids Res.,2011,39 (12): e82; li et al, nucleic Acids Res.,2011,39 (14): 6315-25; weber et al, PLoS one.,2011,6 (2): e16765; wang et al, J Genet Genomics,2014,41 (6): 339-47; and Cermak T et al Methods Mol biol.2015179:133-59.

Homing endonuclease

Homing Endonucleases (HE) are sequence-specific endonucleases with long recognition sequences (14-44 base pairs) and cleave DNA with high specificity, usually at unique sites in the genome. There are at least six known families of HEs, including GIY-YIG, his-Cis boxes, H-N-H, PD- (D/E) xK and Vsr-like, which are derived from a wide range of hosts including eukaryotes, protozoa, bacteria, archaebacteria, cyanobacteria and phages, according to their structural classification. As with ZFNs and TALENs, HE can be used to create DSBs at target loci as an initial step in genome editing. In addition, some natural and engineered HEs cleave only one DNA strand, thereby functioning as site-specific nicking enzymes. The large target sequences of HE and the specificity they provide make them attractive candidates for creating site-specific DSBs.

Various HE-based systems have been described in the art and modifications thereto have been reported periodically; see, e.g., steentoft et al, glycobiology,2014,24 (8): 663-80; belfort and Bonocora, methods Mol biol.,2014,1123:1-26; and Hafez and Hausner, genome,2012,55 (8): 553-69.

MegaTAL/Tev-mTALEN/MegaTev

As further examples of hybrid nucleases, megaTAL and Tev-mTALEN platforms use fusions of TALE DNA binding domains and catalytically active HE, exploiting both the tunable DNA binding and specificity of TALE, as well as the cleavage sequence specificity of HE; see, e.g., boissel et al, nucleic Acids Res.,2014,42:2591-2601; kleinstover et al, G3,2014,4:1155-65; and Boissel and Scharenberg, methods mol. Biol.,2015,1239:171-96.

In another variant, the MegaTev structure is a fusion of meganuclease (Mega) with a nuclease domain (Tev) derived from GIY-YIG homing endonuclease I-TevI. The two active sites are located 30bp apart on the DNA substrate and produce two DSBs with incompatible cohesive ends; see, e.g., wolfs et al, nucleic Acids res, 2014,42,8816-29. It is expected that other combinations of existing nuclease-based approaches will develop and can be used to achieve the targeted genomic modifications described herein.

dCS 9-FokI or dCPf1-Fok1 and other nucleases

Combining the structural and functional characteristics of the nuclease platform described above provides an additional approach to genome editing that can potentially overcome some of the inherent drawbacks. For example, CRISPR genome editing systems typically use a single Cas9 endonuclease to create DSBs. The specificity of targeting is driven by a 20 or 24 nucleotide sequence in the guide RNA that Watson-Crick base pairs with the target DNA (in the case of Cas9 from streptococcus pyogenes, plus the other 2 bases in the adjacent NAG or NGG PAM sequence). Such sequences are long enough that they are unique in the human genome, however, the specificity of RNA/DNA interactions is not absolute, and significant confounding can sometimes be tolerated, particularly in the 5'half (5' half) of the target sequence, which effectively reduces the number of bases driving specificity. One solution to this is to completely inactivate Cas9 or Cpf1 catalytic function-retaining only RNA-guided DNA binding function-instead fusing the fokl domain to the inactivated Cas9; see, e.g., tsai et al, nature Biotech,2014,32:569-76; and Guilinger et al, nature Biotech.2014, 32:577-82. Because fokl must dimerize to be catalytically active, two guide RNAs are required to tightly link two fokl fusions to form a dimer and cleave DNA. This essentially doubles the number of bases in the combined target site, thereby increasing the stringency of CRISPR-based system targeting.

As a further example, fusion of a TALE DNA binding domain to a catalytically active HE (such as I-TevI) takes advantage of both the tunable DNA binding and specificity of TALE, as well as cleavage sequence specificity of I-TevI, it is expected that off-target cleavage may be further reduced.

Base editing

In some embodiments, the gene is edited in the cell using base editing. Base editing is a technique that enables one nucleotide to be converted to another without double strand breaks in the DNA. Base editing allows conversion of C to T, G to a, or vice versa. An example editor for cytosines includes rAPOBEC1 fused to a catalytically inactive form of Cas 9. Cas9 helps to bind to the site of interest and the rAPOBEC1 cytidine deaminase induces point mutations. The conversion of adenine requires mutant transfer RNA adenosine deaminase (transfer RNA adenosine deaminase, tadA), cas9 nickase and sgRNA, as described herein. The construct is capable of introducing site-specific mutations without introducing strand breaks. In some embodiments, base editing is used to introduce one or more mutations in the cells described herein.

RNA-guided endonucleases

As used herein, an RNA guided endonuclease system can comprise an amino acid sequence that has at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% amino acid sequence identity to a wild-type exemplary endonuclease (e.g., cas9 from streptococcus pyogenes, SEQ ID No.8 of US2014/0068797 or sapranauskos et al, nucleic Acids Res,39 (21): 9275-9282 (2011)). Endonucleases can comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity over 10 consecutive amino acids to a wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above). Endonucleases can comprise up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity over 10 consecutive amino acids to a wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above). The endonuclease may comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above) over 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to a wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above) over 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. The endonuclease may comprise at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to the wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above) over 10 consecutive amino acids in the RuvC nuclease domain of the endonuclease. The endonuclease may comprise up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to the wild-type endonuclease (e.g., cas9 from streptococcus pyogenes, see above) over 10 consecutive amino acids in the RuvC nuclease domain of the endonuclease.

The endonuclease may comprise a modified form of a wild-type exemplary endonuclease. Modified forms of the wild-type exemplary endonucleases can comprise mutations that reduce the nucleic acid cleavage activity of the endonuclease. The modified form of the wild-type exemplary endonuclease may have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity of the wild-type exemplary endonuclease (e.g., cas9 from streptococcus pyogenes, see above). The modified form of the endonuclease may not have substantial nucleic acid cleavage activity. When an endonuclease is a modified form that does not have substantial nucleic acid cleavage activity, it is referred to herein as "no enzymatic activity".

Contemplated mutations may include substitutions, additions and deletions, or any combination thereof. The mutation converts the mutated amino acid into alanine. The mutation converts the mutated amino acid into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine or arginine). Mutations convert a mutated amino acid to an unnatural amino acid (e.g., selenomethionine). Mutations convert a mutated amino acid into an amino acid mimetic (e.g., a phosphate mimetic). The mutation may be a conservative mutation. For example, a mutation converts a mutated amino acid to an amino acid that is similar to the size, shape, charge, polarity, conformation, and/or rotamer of the mutated amino acid (e.g., a cysteine/serine mutation, a lysine/asparagine mutation, a histidine/phenylalanine mutation). Mutations may lead to a shift in the reading frame and/or the generation of a premature stop codon (premature stop codon). Mutations may result in changes in regulatory regions of genes or loci that affect the expression of one or more genes.

Guide RNA

The present disclosure provides guide RNAs (grnas) that can direct the activity of related endonucleases to specific target sites within a polynucleotide. The guide RNA can comprise at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest and a CRISPR repeat. In a type II CRISPR system, the gRNA also comprises a second RNA, known as a tracrRNA sequence. In type II CRISPR guide RNAs (grnas), a CRISPR repeat and a tracrRNA sequence hybridize to each other to form a duplex. In the V-type CRISPR system, the gRNA comprises crRNA that forms a duplex. In some embodiments, the gRNA can bind to an endonuclease such that the gRNA and the endonuclease form a complex. gRNA can provide target specificity to the complex by virtue of its association with an endonuclease. Thus, a nucleic acid targeted to the genome may direct endonuclease activity.

Exemplary guide RNAs include spacer sequences comprising 15-200 nucleotides, wherein the grnas target genomic positions based on GRCh38 human genome assembly. As will be appreciated by those of ordinary skill in the art, each gRNA may be designed to include a spacer sequence complementary to its genomic target site or region. See Jinek et al Science 2012,337,816-821 and Deltcheva et al Nature 2011,471,602-607.

The gRNA may be a bimolecular guide RNA. The gRNA may be a single molecule guide RNA.

The bimolecular guide RNA may comprise two RNA strands. The first strand comprises an optional spacer extension sequence, a spacer sequence and a minimal CRISPR repeat in the 5 'to 3' direction. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat), a 3' tracrRNA sequence, and optionally a tracrRNA extension sequence.

The single molecule guide RNA (sgRNA) may comprise an optional spacer extension sequence, spacer sequence, minimal CRISPR repeat sequence, single molecule guide linker, minimal tracrRNA sequence, 3' tracrRNA sequence and an optional tracrRNA extension sequence in the 5' to 3' direction. The optional tracrRNA extension sequence may comprise elements that contribute additional functions (e.g., stability) to the guide RNA. A single molecule guide linker can link the minimum CRISPR repeat sequence and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension sequence may comprise one or more hairpins.

In some embodiments, the sgRNA comprises a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a variable length spacer sequence having 17-30 nucleotides at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a spacer extension sequence that is greater than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides in length. In some embodiments, the sgRNA comprises a spacer extension sequence of less than 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides in length.

In some embodiments, the sgrnas comprise a spacer extension sequence that comprises another portion (e.g., a stability control sequence, an endoribonuclease binding sequence, or a ribozyme). This moiety may reduce or increase the stability of the nucleic acid targeting nucleic acid (nucleic acid targeting nucleic acid). The moiety may be a transcription terminator segment (i.e., a transcription termination sequence). This moiety may play a role in eukaryotic cells. This moiety may play a role in prokaryotic cells. This moiety may play a role in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m 7G)), a riboswitch sequence (e.g., a sequence that allows the protein and protein complex to modulate stability and/or modulate accessibility), a sequence that forms a dsRNA duplex (i.e., hairpin), a sequence that targets RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplast, etc.), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).

In some embodiments, the sgrnas comprise spacer sequences that hybridize to sequences in the target polynucleotide. The spacer region of the gRNA can interact with the target polynucleotide in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer can vary depending on the sequence of the target nucleic acid of interest.

In a CRISPR-endonuclease system, the spacer sequence can be designed to hybridize to a target polynucleotide located 5' of PAM of the endonuclease used in the system. The spacer may match the target sequence perfectly, or there may be a mismatch. Each endonuclease, e.g., cas9 nuclease, has a specific PAM sequence that it recognizes in the target DNA. For example, streptococcus pyogenes Cas9 recognizes PAM comprising the sequence 5' -NRG-3', wherein R comprises a or G, wherein N is any nucleotide, and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

The target polynucleotide sequence may comprise 20 nucleotides. The target polynucleotide may comprise less than 20 nucleotides. The target polynucleotide may comprise more than 20 nucleotides. The target polynucleotide may comprise at least: 5. 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide may comprise at most: 5. 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target polynucleotide sequence may comprise 20 bases immediately 5' to the first nucleotide of PAM.

The spacer sequence that hybridizes to the target polynucleotide may have a length of at least about 6 nucleotides (nt). The spacer sequence can be at least about 6nt, at least about 10nt, at least about 15nt, at least about 18nt, at least about 19nt, at least about 20nt, at least about 25nt, at least about 30nt, at least about 35nt, or at least about 40nt, about 6nt to about 80nt, about 6nt to about 50nt, about 6nt to about 45nt, about 6nt to about 40nt, about 6nt to about 35nt, about 6nt to about 30nt, about 6nt to about 25nt, about 6nt to about 20nt, about 6nt to about 19nt, about 10nt to about 50nt, about 10nt to about 45nt, about 10nt to about 40nt, about 10nt to about 35nt, about 10nt to about 30nt, about 10nt to about 25nt, about 10nt to about 20nt, about 10nt to about 19nt, about 19nt to about 30nt, about 19nt to about 35, about 19nt to about 40nt, about 19nt to about 45nt, about 19nt to about 19nt, about 50nt to about 20nt, about 20nt to about 20nt, about 60nt to about 20nt, about 20nt to about 20nt, or about 20nt to about 20 nt. In some examples, the spacer sequence may comprise 20 nucleotides. In some examples, the spacer may comprise 19 nucleotides. In some examples, the spacer may comprise 18 nucleotides. In some examples, the spacer may comprise 22 nucleotides.

In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99% or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six consecutive most 5' nucleotides of the target sequence of the complementary strand of the target nucleic acid. The percent complementarity between the spacer sequence and the target nucleic acid can be at least 60% over about 20 consecutive nucleotides. The spacer sequence and the target nucleic acid may differ in length by 1 to 6 nucleotides, which may be considered as one or more projections.

the tracrRNA sequence may comprise nucleotides that hybridize to a minimal CRISPR repeat in a cell. The minimum tracrRNA sequence and the minimum CRISPR repeat sequence can form a duplex, i.e., a base paired double stranded structure. Together, the minimal tracrRNA sequence and minimal CRISPR repeat can bind RNA-guided endonucleases. At least a portion of the minimal tracrRNA sequence can hybridize to the minimal CRISPR repeat. The minimum tracrRNA sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum CRISPR repeat sequence.

The minimum tracrRNA sequence may have a length of about 7 nucleotides to about 100 nucleotides. For example, the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. The minimum tracrRNA sequence may be about 9 nucleotides in length. The minimum tracrRNA sequence may be about 12 nucleotides. The minimum tracrRNA may consist of tracrRNA nt 23-48 described in jink et al (supra).

The minimum tracrRNA sequence may be at least about 60% identical to the reference minimum tracrRNA (e.g., wild-type tracrRNA from streptococcus pyogenes) sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum tracrRNA sequence may be at least about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to the reference minimum tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

The duplex between the smallest CRISPR RNA and smallest tracrRNA may comprise a duplex. The duplex between the smallest CRISPR RNA and smallest tracrRNA can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The duplex between the smallest CRISPR RNA and smallest tracrRNA can comprise up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

A duplex may contain mismatches (i.e., the two strands of the duplex are not 100% complementary). The duplex may comprise at least about 1, 2, 3, 4, or 5 or more mismatches. Duplex may contain up to about 1, 2, 3, 4, or 5 or more mismatches. Duplex may contain no more than 2 mismatches.

In some embodiments, the tracrRNA may be a 3' tracrRNA. In some embodiments, the 3' tracrRNA sequence may comprise a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., tracrRNA from streptococcus pyogenes).

In some embodiments, the gRNA may comprise a tracrRNA extension sequence. the tracrRNA extension sequence may have a length of about 1 nucleotide to about 400 nucleotides. the tracrRNA extension sequence may have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotides. the tracrRNA extension sequence may have a length of about 20 to about 5000 or more nucleotides. the tracrRNA extension sequence may have a length of less than 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides. the tracrRNA extension sequence may comprise less than 10 nucleotides in length. the tracrRNA extension sequence may be 10-30 nucleotides in length. the tracrRNA extension sequence may be 30-70 nucleotides in length.

the tracrRNA extension sequence can comprise a functional portion (e.g., stability control sequence, ribozyme, endoribonuclease binding sequence). The functional portion may comprise a transcription terminator segment (i.e., a transcription termination sequence). The functional moiety may have a total length of about 10 nucleotides (nt) to about 100 nucleotides, about 10nt to about 20nt, about 20nt to about 30nt, about 30nt to about 40nt, about 40nt to about 50nt, about 50nt to about 60nt, about 60nt to about 70nt, about 70nt to about 80nt, about 80nt to about 90nt, about 90nt to about 100nt, about 15nt to about 80nt, about 15nt to about 50nt, about 15nt to about 40nt, about 15nt to about 30nt, or about 15nt to about 25 nt.

In some embodiments, the sgrnas may comprise a linker sequence of about 3 nucleotides to about 100 nucleotides in length. For example, in Jink et al (supra), a simple 4 nucleotide "four-loop" (-GAAA-) (Jink et al Science,2012,337 (6096):816-821) is used. Illustrative linkers have a length of about 3 nucleotides (nt) to about 90nt, about 3nt to about 80nt, about 3nt to about 70nt, about 3nt to about 60nt, about 3nt to about 50nt, about 3nt to about 40nt, about 3nt to about 30nt, about 3nt to about 20nt, about 3nt to about 10 nt. For example, the linker may have a length of about 3nt to about 5nt, about 5nt to about 10nt, about 10nt to about 15nt, about 15nt to about 20nt, about 20nt to about 25nt, about 25nt to about 30nt, about 30nt to about 35nt, about 35nt to about 40nt, about 40nt to about 50nt, about 50nt to about 60nt, about 60nt to about 70nt, about 70nt to about 80nt, about 80nt to about 90nt, or about 90nt to about 100 nt. The linker of the single molecule guide nucleic acid may be between 4 and 40 nucleotides. The linker may be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker may be up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

The linker may comprise any of a variety of sequences, although in some instances the linker will not comprise a sequence having a broad region of homology to other portions of the guide RNA, which may result in intramolecular binding, thereby interfering with other functional regions of the guide. In Jink et al (supra), the simple 4 nucleotide sequence GAAA (Jink et al, science,2012,337 (6096):816-821) is used, but many other sequences may equally be used, including longer sequences.

The linker sequence may comprise a functional moiety. For example, the linker sequence may comprise one or more features including an aptamer, a ribozyme, a protein-interacting hairpin, a protein binding site, a CRISPR array, an intron, or an exon. The linker sequence may comprise at least about 1, 2,3, 4, or 5 or more functional moieties. In some examples, the linker sequence may comprise up to about 1, 2,3, 4, or 5 or more functional moieties.

In some embodiments, the sgRNA does not comprise uracil, e.g., at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA does comprise one or more uracils, e.g., at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA comprises 1, 2,3, 4, 5, 6, 7, 8, 9, or 10 uracils (U) at the 3' end of the sgRNA sequence.

The sgrnas may be chemically modified. In some embodiments, the chemically modified gRNA is a gRNA that includes at least one nucleotide with a chemical modification (e.g., a 2' -O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises a 2' -O-methyl-phosphorothioate residue. In some embodiments, the chemical modification enhances stability, reduces the likelihood or extent of an innate immune response, and/or enhances other attributes, as described in the art.

In some embodiments, the modified gRNA may comprise a modified backbone, such as phosphorothioate, phosphotriester, morpholino, methylphosphonate, short chain alkyl (alkyl) or cycloalkyl intersugar linkages or short chain heteroatom or heterocyclic intersugar linkages.

Morpholino-based compounds are described in Braasch and David Corey, biochemistry,2002,41 (14): 4503-4510; genesis,2001,Volume 30,Issue 3; heasman, dev.biol.,2002,243:209-214; nasevicius et al, nat.Genet.,2000,26:216-220; lacerra et al, proc.Natl. Acad.Sci.,2000, 97:9591-9596; and U.S. Pat. No. 5,034,506 issued 7/23/1991.

Cyclohexenyl nucleic acid oligonucleotide mimics are described in Wang et al, J.Am.chem.Soc.,2000,122:8595-8602.

In some embodiments, the modified gRNA may comprise one or more substituted sugar moieties at the 2' position, one of the following: OH, SH, SCH3, F, OCN, OCH3, OCH 3O (CH 2) n CH3, O (CH 2) n NH2, or O (CH 2) n CH3, wherein n is from 1 to about 10; C1-C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkylaryl or arylalkyl; cl; br; a CN; CF3; OCF3; o-, S-or N-alkyl; o-, S-or N-alkenyl; SOCH3; SO 2CH 3; ONO2; NO2; n3; NH2; a heterocycloalkyl group; a heterocycloalkylaryl group; aminoalkylamino groups; a polyalkylamino group; a substituted silyl group; an RNA cleavage group; a reporter group; an intercalator; 2' -O- (2-methoxyethyl); 2 '-methoxy (2' -O-CH 3); 2 '-propoxy (2' -OCH 2CH 3); and 2 '-fluoro (2' -F). Similar modifications can also be made at other positions on the gRNA, particularly at the 3 'position of the sugar on the 3' terminal nucleotide and the 5 'position of the 5' terminal nucleotide. In some examples, both the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide units can be replaced by new groups.

Additionally or alternatively, the guide RNA may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (a), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found rarely or transiently in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Mepyrimidine, especially 5-methylcytosine (also known as 5-methyl-2' deoxycytosine, commonly known in the art as 5-Me-C), 5-Hydroxymethylcytosine (HMC), glycosyl HMC and gentiobiosyl HMC, as well as synthetic nucleobases, such as 2-aminoadenine, 2- (methylamino) adenine, 2- (imidazolylalkyl) adenine, 2- (aminoalkylamino) adenine or other hetero-substituted alkyladenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine and 2, 6-diaminopurine. Kornberg, A., DNA Replication, W.H. Freeman & Co., san Francisco, pp.75-77,1980; gebeyehu et al, nucleic acids Res.1997,15:4513. "universal" bases known in the art, such as inosine, may also be included. 5-Me-C substitutions have been shown to increase the stability of nucleic acid duplex by 0.6-1.2 ℃, (Sanghvi, Y.S., in Crooke, S.T. and Lebleu, B., eds., antisense Research and Applications, CRC Press, boca Raton,1993, pp.276-278) and are aspects of base substitution.

Modified nucleobases may include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil (5-halouracil) and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halo, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaadenine and 7-deaza, 7-deaza and 3-deaza.

Complexes of genome-targeting nucleic acids and endonucleases

The gRNA interacts with an endonuclease (e.g., an RNA-guided nuclease such as Cas 9) to form a complex. The gRNA directs the endonuclease to the target polynucleotide.

The endonuclease and the gRNA may each be administered to a cell or subject, respectively. In some embodiments, the endonuclease may be precomplexed with one or more guide RNAs, or one or more crrnas and tracrRNA. The pre-compounded material may then be administered to a cell or subject. Such pre-composites are known as ribonucleoprotein particles (RNP). The endonuclease in the RNP may be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. Endonucleases can be flanked at the N-terminus, C-terminus, or both the N-and C-terminus by one or more Nuclear Localization Signals (NLS). For example, the Cas9 endonuclease may be flanked by two NLSs, one NLS at the N-terminus and the second NLS at the C-terminus. The NLS may be any NLS known in the art, such as SV40 NLS. The molar ratio of genome-targeting nucleic acid to endonuclease in the RNP can range from about 1:1 to about 10:1. For example, the molar ratio of sgRNA to Cas9 endonuclease in RNP can be 3:1.

Nucleic acids encoding system components

The present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a genomic targeting nucleic acid of the present disclosure, an endonuclease of the present disclosure, and/or any nucleic acid or protein molecule required to practice aspects of the methods of the present disclosure. The encoding nucleic acid may be RNA, DNA, or a combination thereof.

The nucleic acid encoding the genomic targeting nucleic acid of the present disclosure, the endonuclease of the present disclosure, and/or any nucleic acid or protein molecule required to practice aspects of the methods of the present disclosure may constitute a vector (e.g., a recombinant expression vector).

The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, wherein additional nucleic acid segments may be ligated into the viral genome. Certain vectors (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced. Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

In some examples, the vector may be capable of directing expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors," or more simply "expression vectors," which have equivalent functions.

The term "operably linked" refers to a nucleotide sequence of interest being linked to a regulatory sequence in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; gene Expression Technology: methods in Enzymology,1990,185,Academic Press,San Diego,CA. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, as well as those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of target cell, the desired level of expression, and the like.

Contemplated expression vectors include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., murine leukemia virus, spleen necrosis virus, and retroviral derived vectors such as rous sarcoma virus, hawy sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and breast tumor virus) and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used as long as they are compatible with the host cell.

In some examples, the vector may comprise one or more transcriptional and/or translational control elements. Any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like, depending on the host/vector system used. The vector may be a self-inactivating vector, which can inactivate viral sequences or components of the CRISPR mechanism or other elements.

Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that are functional in eukaryotic cells) include promoters from: cytomegalovirus (CMV) immediate early, herpes Simplex Virus (HSV) thymidine kinase, early and late SV40, long Terminal Repeats (LTRs) from retroviruses, human elongation factor-1 alpha promoter (EF 1 alpha), chicken beta-actin promoter (CBA), ubiquitin C promoter (UBC), hybrid constructs comprising a cytomegalovirus enhancer fused to a chicken beta-actin promoter, hybrid constructs comprising a cytomegalovirus enhancer fused to a chicken beta-actin gene (CAG or CAGGS), a first exon and a first intron, murine stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus Promoter (PGK) and mouse metallothionein-I promoter.

The promoter may be an inducible promoter (e.g., heat shock promoter, tetracycline regulated promoter, steroid regulated promoter, metal regulated promoter, estrogen receptor regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., CMV promoter, UBC promoter, CAG or CAGGS promoter). In some cases, the promoter may be a spatially limited and/or temporally limited promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.).

The complexes, polypeptides and nucleic acids of the disclosure can be introduced into cells by viral or phage infection, transfection, conjugation, protoplast fusion, lipid infection, electroporation, nuclear transfection, calcium phosphate precipitation, polyethyleneimine (PEI) -mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

Cell type

The cells described herein, e.g., universal donor cells (and corresponding unmodified cells), can be of any possible class of cell types. In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell) may be a mammalian cell. In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell) may be a human cell. In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell) may be a stem cell. In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell) can be a Pluripotent Stem Cell (PSC). In some embodiments, the cells, e.g., universal donor cells (and corresponding unmodified cells) may be Embryonic Stem Cells (ESCs), adult Stem Cells (ASCs), induced pluripotent stem cells (ipscs), or hematopoietic stem or progenitor cells (HSPCs) (also known as Hematopoietic Stem Cells (HSCs)). In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell) may be a differentiated cell. In some embodiments, the cell, e.g., universal donor cell (and corresponding unmodified cell), may be a somatic cell, e.g., an immune system cell, a pancreatic cell, or a contractile cell, e.g., a skeletal muscle cell.

Cells described herein, such as universal donor stem cells, can be differentiated into relevant cell types to assess HLA expression, as well as to assess immunogenicity of universal stem cell lines. In general, differentiation involves maintaining a cell of interest for a period of time and under conditions sufficient to differentiate the cell into a differentiated cell of interest. For example, a universal stem cell disclosed herein can differentiate into a Mesenchymal Progenitor Cell (MPC), a hypoimmunogenic cardiomyocyte, a muscle progenitor cell, a blast cell, an Endothelial Cell (EC), a macrophage, a liver cell, a beta cell (e.g., pancreatic beta cell), a pancreatic endodermal progenitor cell, a pancreatic endocrine cell, a hematopoietic progenitor cell, or a Neural Progenitor Cell (NPC). In some embodiments, the universal donor cell can differentiate into a definitive endoderm cell, a primordial intestinal canal cell, a metaintestinal tract cell, a Pancreatic Endoderm Cell (PEC), a pancreatic endocrine cell, an immature beta cell, or a mature beta cell.

Stem cells can both proliferate and produce more progenitor cells, which in turn have the ability to produce a large number of blast cells, which in turn can produce differentiated or differentiable daughter cells. The daughter cells themselves may be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells having the parental developmental potential. Thus, the term "stem cell" refers to a cell that has the ability or potential to differentiate into a more specialized or differentiated phenotype under certain circumstances, and that remains proliferative without substantial differentiation under certain circumstances. In one aspect, the term progenitor or stem cell refers to a generalized parent cell, the progeny(s) of which are typically specialized in different directions by differentiation, e.g., by achieving completely independent characteristics, as occurs in the progressive diversification of embryonic cells and tissues. Cell differentiation is a complex process that typically occurs through many cell divisions. Differentiated cells may be derived from multipotent cells, which themselves are also derived from multipotent cells, and the like. Although each of these pluripotent cells may be considered a stem cell, the range of cell types that each cell can produce may vary widely. Some differentiated cells also have the ability to produce cells with greater potential for development. Such capability may be natural or may be induced manually when treated with various factors.

For example, human embryonic stem cells (hescs) can be artificially differentiated into insulin-producing cells by a seven-stage process requiring the addition of specific growth factors and small molecules. These seven stages include 1) definitive endoderm, 2) primordial gut tube, 3) hindgut, 4) pancreatic endoderm, 5) pancreatic endoderm precursors, 6) immature beta cells, and 7) mature beta cells. For example, human pluripotent stem cells can differentiate into pancreatic lineages as described by Schulz et al (2012) PLoS ONE 7 (5): e37004, rezania et al (2014) Nat. Biotechnol.32 (11): 1121-1133 and/or US 20200208116. In many biological contexts, stem cells are also "multipotent" in that they can produce progeny of more than one different cell type, but this is not required for "stem".

A "differentiated cell" is a cell that has progressed farther in a developmental pathway than a cell to which it is compared. Thus, stem cells may differentiate into lineage-restricted precursor cells (such as myocyte progenitor cells), which in turn may differentiate further along the pathway into other types of precursor cells (such as myocyte precursor cells), and then into terminally differentiated cells, such as myocytes, which play a characteristic role in a certain tissue type, and may or may not retain the ability to proliferate further. In some embodiments, the differentiated cell may be a pancreatic β cell.

Embryonic stem cells

The cells described herein may be Embryonic Stem Cells (ESCs). ESCs are derived from embryonic cells of mammalian embryos and are capable of differentiating into any cell type and proliferating rapidly. ESCs are also believed to have a normal karyotype, retain high telomerase activity, and exhibit significant long-term proliferative potential, making these cells excellent candidates for use as universal donor cells.

Adult stem cells

The cells described herein may be Adult Stem Cells (ASC). ASCs are undifferentiated cells that can be found in mammals (e.g., humans). ASCs are defined by their ability to self-renew, for example, through several rounds of cell replication while maintaining their undifferentiated state, and to differentiate into several different cell types, such as glial cells. Adult stem cells are a broad class of stem cells and may include hematopoietic stem cells, breast stem cells, intestinal stem cells, mesenchymal stem cells, endothelial stem cells, neural stem cells, olfactory adult stem cells, neural crest stem cells, and testicular cells.

Induction of pluripotent stem cells

The cells described herein may be induced pluripotent stem cells (ipscs). ipscs can be produced directly from adult human cells by introducing genes encoding key transcription factors involved in pluripotency, such as OCT4, SOX2, cMYC, and KLF 4. ipscs may be derived from the same subject to which subsequent progenitor cells are to be administered. That is, somatic cells can be obtained from a subject, reprogrammed to induce pluripotent stem cells, and then re-differentiated into progenitor cells (e.g., autologous cells) to be administered to the subject. However, in the case of autologous cells, there is still a risk of post-implantation immune response and low viability. In some embodiments, the iPSC is derived from a commercial source. In some embodiments, ipscs are genetically edited prior to differentiation into lineage restricted progenitor cells or fully differentiated somatic cells.

Human hematopoietic stem cells and progenitor cells

The cells described herein may be human hematopoietic stem cells and progenitor cells (hspcs). This stem cell lineage produces all blood cell types including erythroid (erythrocyte) or Red Blood Cell (RBC), myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, megakaryocytes/platelets and dendritic cells) and lymphoid (T-cells, B-cells, NK-cells). Blood cells result from the proliferation and differentiation of a very small population of multipotent Hematopoietic Stem Cells (HSCs) that also have the ability to replenish themselves by self-renewal. During differentiation, the offspring of HSCs undergo various intermediate maturation stages before reaching maturity, producing pluripotent and lineage committed progenitor cells. Bone Marrow (BM) is the major site of human hematopoiesis and under normal conditions only small numbers of Hematopoietic Stem and Progenitor Cells (HSPCs) are found in the Peripheral Blood (PB). Treatment with cytokines, some myelosuppressive drugs for cancer treatment, and compounds that disrupt interactions between hematopoietic and BM stromal cells can rapidly mobilize large numbers of stem and progenitor cells into the circulation.

Differentiation of cells into other cell types

Another step of the methods of the present disclosure may include differentiating the cells into differentiated cells. The differentiation step may be performed according to any method known in the art. For example, human ipscs were differentiated into definitive endoderm using various treatments, including activin and B27 supplement (Life Technologies). Definitive endoderm is further differentiated into hepatocytes, and the treatment includes: FGF4, HGF, BMP2, BMP4, oncostatin M, dexamethasone, and the like (Duan et al, stem Cells,2010;28:674-686; ma et al, stem Cells Translational Medicine,2013; 2:409-419). In another embodiment, sci Rep.2015 may be according to Sawitza et al; 5:13320 differentiation steps were performed. The differentiated cell may be any somatic cell of a mammal, such as a human. In some embodiments, the somatic cells may be exocrine epithelial cells (e.g., salivary gland mucus cells, prostate cells), hormone secreting cells (e.g., pituitary anterior lobe cells, intestinal tract cells, islet cells), keratinocytes (e.g., epidermal keratinocytes), wet layered barrier epithelial cells, sensory transduction cells (e.g., photoreceptors), autonomic neuron cells, sensory organs, and peripheral neuron support cells (e.g., schwann cells), central nervous system neurons, glial cells (e.g., astrocytes, oligodendrocytes), lens cells, adipocytes, kidney cells, barrier function cells (e.g., ductal cells), extracellular matrix cells, contractile cells (e.g., skeletal muscle cells, cardiac muscle cells, smooth muscle cells), blood cells (e.g., erythrocytes), immune system cells (e.g., megakaryocytes, microglia, neutrophils, mast cells, T cells, B cells, natural killer cells), germ cells (e.g., germ cells), vegetative cells, or mesenchymal cells.

In general, the universal donor cell populations disclosed herein maintain expression of one or more inserted nucleotide sequences over time. For example, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the universal donor cells express the inserted one or more tolerogenic factors and/or survival factors. Furthermore, lineage restricted or fully differentiated cell populations derived from the universal donor cells disclosed herein maintain expression of the inserted one or more nucleotide sequences over time. For example, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the lineage restricted or fully differentiated cells express one or more tolerogenic factors and/or survival factors.

V. formulations and administration

Formulations and delivery for gene editing

The guide RNAs, polynucleotides described herein, e.g., polynucleotides encoding tolerogenic factors and/or survival factors, or polynucleotides encoding endonucleases, as well as endonucleases, can be formulated and delivered to cells in any manner known in the art.

Depending on the particular mode of administration and dosage form, the guide RNA and/or polynucleotide may be formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, and the like. The guide RNA and/or polynucleotide compositions may be formulated to achieve a physiologically compatible pH and, depending on the formulation and route of administration, range from about pH 3 to about pH 11, about pH 3 to about pH 7. In some cases, the pH may be adjusted to a range from about pH 5.0 to about pH 8. In some cases, a composition may comprise a therapeutically effective amount of at least one compound as described herein and one or more pharmaceutically acceptable excipients. Optionally, the composition may comprise a combination of compounds described herein, or may comprise a second active ingredient useful for treating or preventing bacterial growth (e.g., without limitation, an antibacterial or antimicrobial agent), or may comprise a combination of agents of the present disclosure.

Suitable excipients include, for example, carrier molecules, which include large, slowly metabolizing macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polyamino acids, amino acid copolymers and inactive virus particles. Other exemplary excipients may include antioxidants (e.g., without limitation, ascorbic acid), chelating agents (e.g., without limitation, EDTA), carbohydrates (e.g., without limitation, dextrin, hydroxyalkyl cellulose, and hydroxyalkyl methylcellulose), stearic acid, liquids (e.g., without limitation, oil, water, saline, glycerol, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

The guide RNA polynucleotide (RNA or DNA) and/or the endonuclease polynucleotide (RNA or DNA) may be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, the endonuclease polypeptide may be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In further alternative aspects, the DNA endonuclease may be delivered alone as one or more polypeptides, or precomplexed with one or more guide RNAs, or one or more crrnas with a tracrRNA.

Polynucleotides may be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, gene Therapy,2011,18:1127-1133 (which focuses on non-viral delivery vehicles that can also be used to deliver siRNA for other polynucleotides).

For the polynucleotides of the present disclosure, the formulation may be selected from, for example, any of the formulations taught in international application PCT/US 2012/069610.

Polynucleotides, such as guide RNAs, sgrnas, and mrnas encoding endonucleases, may be delivered to a cell or subject via Lipid Nanoparticles (LNPs).

LNP refers to any particle having a diameter of less than 1000nm, 500nm, 250nm, 200nm, 150nm, 100nm, 75nm, 50nm, or 25 nm. Alternatively, the size of the nanoparticles may range from 1-1000nm, 1-500nm, 1-250nm, 25-200nm, 25-100nm, 35-75nm, or 25-60nm.

LNP can be made from cationic, anionic or neutral lipids. Neutral lipids, such as fusogenic phospholipid DOPE or membrane fraction cholesterol, may be included as "helper lipids" in LNP to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy due to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses.

LNP may also consist of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

Any lipid or combination of lipids known in the art may be used to produce LNP. Examples of lipids for LNP production are: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORE-DPyPE and GL 67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC 2), DLin-MC3-DMA (MC 3), XTC, MD1 and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14 and PEG-CerC20.

Lipids can be combined in any number of molar ratios to produce LNP. In addition, polynucleotides can be combined with lipids in a wide range of molar ratios to produce LNP.

Recombinant adeno-associated virus (AAV) vectors may be used for delivery. Techniques for producing rAAV particles are standard in the art in which the packaged AAV genome (including the polynucleotide, rep and cap genes to be delivered, and helper virus functions) is provided to the cell. The production of rAAV typically requires the following components to be present in a single cell (denoted herein as packaging cells): rAAV genome, AAV rep and cap genes separated from (i.e., not in) the rAAV genome, and helper virus functions. AAV rep and cap genes may be from any AAV serotype from which recombinant viruses may be derived, and may be from AAV serotypes other than rAAV genome ITRs, including but not limited to AAV serotypes described herein. The production of pseudotyped rAAVs is disclosed, for example, in International patent application publication No. WO 01/83692.

Preparation and administration of cells, such as universal donor cells

The genetically modified cells described herein, e.g., universal donor cells, can be formulated and administered to a subject by any means known in the art.

The terms "administering", "introducing", "implanting" and "transplanting" are used interchangeably in the context of placing a cell (e.g., a progenitor cell) into a subject by a method or route that results in at least partial localization of the introduced cell at a desired site. The cells, e.g., progenitor cells, or their differentiated progeny, can be administered by any suitable route that results in delivery to the desired location in the subject, where at least a portion of the implanted cells or components of the cells remain viable. The survival of the cells after administration to a subject may be as short as several hours, for example 24 hours, to several days, to several years or even the lifetime of the subject, i.e. long-term implantation.

Genetically modified cells described herein, e.g., universal donor cells, can survive longer periods of time after administration to a subject than the unmodified cells.

In some embodiments, a composition comprising the cells described herein may be administered by a suitable route, which may include intravenous administration, for example, as a bolus or by continuous infusion over a period of time. In some embodiments, intravenous administration may be by intramuscular, intraperitoneal, intrathecal, subcutaneous, intra-articular, intrasynovial, or intrathecal routes. In some embodiments, the composition may be in solid form, aqueous form, or liquid form. In some embodiments, the aqueous or liquid form may be atomized or lyophilized. In some embodiments, the atomized or lyophilized form may be reconstituted with an aqueous or liquid solution.

The cell composition may also be emulsified or presented as a liposome composition, provided that the emulsification process does not adversely affect cell viability. The cells and any other active ingredients may be admixed with excipients that are pharmaceutically acceptable and compatible with the active ingredients in amounts suitable for use in the methods of treatment described herein.

Additional agents included in the cell composition may include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, tartaric, mandelic, and the like (acid addition salts formed with the free amino groups of the polypeptide). Salts with free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or iron hydroxides; and organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, and the like.

Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that do not contain any substance other than the active ingredient and water, or contain a buffer such as sodium phosphate at physiological pH, physiological saline, or both, such as phosphate buffered saline. In addition, the aqueous carrier may contain more than one buffer salt, as well as salts such as sodium and potassium chloride, dextrose, polyethylene glycol, and other solutes. The liquid composition may also contain a liquid phase in addition to water, and not contain water but a liquid phase. Examples of such additional liquid phases are glycerol, vegetable oils such as cottonseed oil and water-oil emulsions. The amount of active compound used in a cellular composition effective to treat a particular disorder or condition may depend on the nature of the disorder or condition and may be determined by standard clinical techniques.

In some embodiments, a composition comprising cells may be administered to a subject, e.g., a human subject, having, suspected of having, or at risk of having a disease or disorder. In some embodiments, the composition may be administered to a subject that is free of a disease or disorder, is not suspected of having a disease or disorder, or is at risk of a disease or disorder. In some embodiments, the subject is a healthy human. In some embodiments, the subject, e.g., a human subject, has or is at risk of having a heritable disease or disorder. In some embodiments, the subject is suffering from or at risk of developing a symptom indicative of a disease or disorder. In some embodiments, the disease is diabetes, such as type I diabetes or type II diabetes. In some embodiments, the disorder is a pancreatectomy.

Specific compositions and methods of the present disclosure

Accordingly, the present disclosure is particularly directed to the following non-limiting compositions and methods.

In a first composition, composition 1, the present disclosure provides a composition comprising genetically modified cells comprising: (a) A first insertion of a disrupted B2M gene and a first polynucleotide encoding a midbrain astrocyte-derived neurotrophic factor (MANF) in the disrupted B2M gene; (b) A second insertion of the disrupted TXNIP gene and a second polynucleotide encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) into the disrupted TXNIP gene; wherein the cells express MANF and TNFAIP3 and have disrupted expression of B2M and TXNIP.

In another composition, composition 2, the present disclosure provides the composition according to composition 1, wherein the first insertion further comprises a third polynucleotide encoding HLA class I histocompatibility antigen alpha chain E (HLA-E).

In another composition, composition 3, the present disclosure provides a composition according to composition 1 or 2, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another composition, composition 4, the present disclosure provides a composition according to any one of compositions 1 to 3, wherein the first polynucleotide encoding MANF is linked to the third polynucleotide encoding HLA-E by a polynucleotide encoding a P2A peptide such that the first insertion comprises a MANF-P2A-HLA-E construct.

In another composition, composition 5, the present disclosure provides a composition according to composition 4, wherein the MANF-P2A-HLA-E construct comprises a polynucleotide sequence consisting essentially of SEQ ID NO. 55.

In another composition, composition 6, the present disclosure provides a composition according to composition 4 or 5, wherein the MANF-P2A-HLA-E construct is operably linked to an exogenous promoter.

In another composition, composition 7, the present disclosure provides a composition according to any one of compositions 1 to 6, wherein the second insertion further comprises a fourth polynucleotide encoding programmed death ligand 1 (PD-L-1).

In another composition, composition 8, the present disclosure provides a composition according to any one of compositions 1 to 7, wherein the second nucleotide sequence encoding TNFAIP3 is linked to the fourth nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding a P2A peptide such that the second insertion comprises a TNFAIP3-P2A-PD-L-1 construct.

In another composition, composition 9, the present disclosure provides the composition according to composition 8, wherein the TNFAIP3-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO: 54.

In another composition, composition 10, the present disclosure provides a composition according to composition 8 or 9, wherein the TNFAIP3-P2A-PD-L-1 construct is operably linked to an exogenous promoter.

In another composition, composition 11, the present disclosure provides a composition according to any one of compositions 1 to 10, wherein disrupted expression of B2M and TXNIP comprises reduced or eliminated expression of B2M and/or TXNIP.

In another composition, composition 12, the present disclosure provides a composition according to any one of compositions 1 to 11, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell (comparable cell) without polynucleotide insertion and gene disruption.

In another composition, composition 13, the present disclosure provides a composition according to any one of compositions 1 to 12, wherein the cells are stem cells.

In another composition, composition 14, the present disclosure provides a composition according to composition 13, wherein the stem cells are embryonic stem cells, adult stem cells, induced pluripotent stem cells, or hematopoietic stem cells.

In another composition, composition 15, the present disclosure provides a composition according to any one of compositions 1 to 12, wherein the cell is a differentiated cell or a somatic cell.

In another composition, composition 16, the present disclosure provides a composition according to composition 15, wherein the cells differentiate into lineage restricted progenitor cells or fully differentiated somatic cells.

In another composition, composition 17, the present disclosure provides a composition according to composition 16, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or immature beta cells, and the fully differentiated somatic cells are beta cells.

In another composition, composition 18, the present disclosure provides a composition comprising more than one genetically modified cell according to any one of compositions 1 to 17.

In another composition, composition 19, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one genetically modified cell of composition 18.

In another composition, composition 20, the present disclosure provides a composition according to composition 19, wherein the population comprises definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells.

In another composition, composition 21, the present disclosure provides a composition comprising more than one cell of composition 18 or a population of cells of composition 19 and at least one pharmaceutically acceptable excipient.

In a first method, method 22, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, method 22, comprising: (a) Obtaining or having obtained the population of lineage restricted progenitor cells or fully differentiated somatic cells of claim 19, wherein the lineage restricted progenitor cells or fully differentiated somatic cells comprise pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or beta cells to the subject.

In another method, method 23, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, i.e., method 23, comprising (a) obtaining or having obtained more than one genetically modified cell of claim 18, wherein the more than one genetically modified cell comprises a stem cell; (b) Differentiating the genetically modified cells into pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells and/or pancreatic beta cells; and (c) administering pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 24, the present disclosure provides the method provided in method 22 or 23, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another composition, composition 25, the present disclosure provides a composition comprising a genetically modified cell comprising (a) a first exogenous polynucleotide insertion encoding a midbrain astrocyte-derived neurotrophic factor (MANF), a second exogenous polynucleotide insertion encoding a tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a third exogenous polynucleotide insertion encoding cluster of differentiation 39 (CD 39), and/or a fourth exogenous polynucleotide insertion encoding cluster of differentiation 73 (CD 73), wherein the genetically modified cell expresses CD39, MANF, TNFAIP3, and/or CD73; and/or (B) disrupted genes encoding transforming growth factor beta (tgfβ) proteins, beta-2-microglobulin (B2M) proteins, thioredoxin interaction protein (TXNIP) proteins, and/or class II transactivator (CIITA) proteins, wherein the genetically modified cell has disrupted expression of tgfβ proteins, B2M proteins, TXNIP proteins, and/or CIITA proteins.

In another composition, composition 26, the present disclosure provides a composition according to composition 25, wherein the genetically modified cell comprises a first exogenous polynucleotide encoding MANF and expresses MANF.

In another composition, composition 27, the present disclosure provides a composition according to composition 25 or 26, wherein the first exogenous polynucleotide is operably linked to an exogenous promoter.

In another composition, composition 28, the present disclosure provides a composition according to any one of compositions 25 to 27, wherein the first exogenous polynucleotide comprises a nucleotide sequence consisting essentially of SEQ ID No. 17.

In another composition, composition 29, the present disclosure provides a composition according to any one of compositions 25 to 28, wherein the genetically modified cell comprises a second exogenous polynucleotide encoding TNFAIP3 and expresses TNFAIP3.

In another composition, composition 30, the present disclosure provides a composition according to any one of compositions 25 to 29, wherein the second exogenous polynucleotide is operably linked to the exogenous promoter.

In another composition, composition 31, the present disclosure provides a composition according to any one of compositions 25 to 30, wherein the second exogenous polynucleotide comprises a nucleotide sequence consisting essentially of SEQ ID No. 19.

In another composition, composition 32, the present disclosure provides a composition according to any one of compositions 25 to 31, wherein the genetically modified cell comprises a third exogenous polynucleotide encoding CD39 and expresses CD39.

In another composition, composition 33, the present disclosure provides a composition according to any one of compositions 25 to 32, wherein the third exogenous polynucleotide is operably linked to the exogenous promoter.

In another composition, composition 34, the present disclosure provides a composition according to any one of compositions 25 to 33, wherein the third exogenous polynucleotide comprises a nucleotide sequence consisting essentially of SEQ ID No. 27.

In another composition, composition 35, the present disclosure provides a composition according to any one of compositions 25 to 34, wherein the genetically modified cell comprises a fourth exogenous polynucleotide encoding CD73 and expresses CD73.

In another composition, composition 36, the present disclosure provides a composition according to any one of compositions 25 to 35, wherein the fourth exogenous polynucleotide encoding CD73 is operably linked to an exogenous promoter.

In another composition, composition 37, the present disclosure provides a composition according to any one of compositions 25 to 36, wherein the fourth exogenous polynucleotide encoding CD73 comprises a nucleotide sequence consisting essentially of SEQ ID No. 46.

In another composition, composition 38, the present disclosure provides a composition according to any one of compositions 25 to 37, wherein the genetically modified cell comprises a third exogenous polynucleotide encoding CD39 and a fourth exogenous polynucleotide encoding CD73 and expresses CD39 and CD73, wherein the third exogenous polynucleotide encoding CD39 is linked to the fourth exogenous polynucleotide encoding CD73 by a polynucleotide encoding a P2A peptide such that the third exogenous polynucleotide encoding CD39, the polynucleotide encoding a P2A peptide, and the fourth exogenous polynucleotide encoding CD73 form a CD39-P2A-CD73 construct.

In another composition, composition 39, the present disclosure provides a composition according to composition 38, wherein the CD39-P2A-CD73 construct is operably linked to an exogenous promoter.

In another composition, composition 40, the present disclosure provides a composition according to composition 38 or 39, wherein the CD39-P2A-CD73 construct comprises a nucleotide sequence consisting essentially of SEQ ID No. 58.

In another composition, composition 41, the present disclosure provides a composition according to any one of compositions 25 to 40, further comprising a fifth exogenous polynucleotide encoding HLA class I histocompatibility antigen alpha chain E (HLA-E), wherein the genetically modified cell expresses HLA-E.

In another composition, composition 42, the present disclosure provides a composition according to composition 41, wherein the fifth exogenous polynucleotide encoding HLA-E comprises a polynucleotide encoding an HLA-E trimer comprising B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another composition, composition 43, the present disclosure provides a composition according to composition 41 or 42, wherein the fifth exogenous polynucleotide encoding HLA-E is operably linked to an exogenous promoter.

In another composition, composition 44, the present disclosure provides a composition according to any one of compositions 41 to 43, wherein the fifth exogenous polynucleotide encoding HLA-E comprises a nucleotide sequence consisting essentially of SEQ ID No. 43.

In another composition, composition 45, the present disclosure provides a composition according to any one of compositions 41 to 44, comprising a first exogenous polynucleotide encoding MANF and a fifth exogenous polynucleotide encoding HLA-E, wherein the first exogenous polynucleotide encoding MANF is linked to the fifth exogenous polynucleotide encoding HLA-E by a polynucleotide encoding a P2A peptide such that the first exogenous polynucleotide, the polynucleotide encoding P2A peptide, and the fifth exogenous polynucleotide form a MANF-P2A-HLA-E construct.

In another composition, composition 46, the present disclosure provides a composition according to composition 45, wherein the MANF-P2A-HLA-E construct is operably linked to an exogenous promoter.

In another composition, composition 47, the present disclosure provides a composition according to composition 45 or 46, wherein the MANF-P2A-HLA-E construct comprises a polynucleotide sequence consisting essentially of SEQ ID NO. 55.

In another composition, composition 48, the present disclosure provides a composition according to any one of compositions 25 to 47, further comprising a sixth exogenous polynucleotide encoding programmed death ligand 1 (PD-L-1), wherein the genetically modified cell expresses PD-L-1.

In another composition, composition 49, the present disclosure provides a composition according to composition 48, wherein the sixth exogenous polynucleotide encoding PD-L-1 is operably linked to an exogenous promoter.

In another composition, composition 50, the present disclosure provides a composition according to composition 48 or 49, wherein the sixth exogenous polynucleotide comprises a nucleotide sequence consisting essentially of SEQ ID No. 20.

In another composition, composition 51, the present disclosure provides a composition according to any one of compositions 48 to 50, comprising a second exogenous polynucleotide encoding TNFAIP3 and a sixth exogenous polynucleotide encoding PD-L-1, wherein the second exogenous polynucleotide encoding TNFAIP3 is linked to the sixth exogenous polynucleotide sequence encoding PD-L-1 by a polynucleotide encoding a P2A peptide such that the second exogenous polynucleotide, the polynucleotide encoding the P2A peptide, and the sixth exogenous polynucleotide form a TNFAIP3-P2A-PD-L-1 construct.

In another composition, composition 52, the present disclosure provides a composition according to composition 51, wherein the TNFAIP3-P2A-PD-L-1 construct is operably linked to an exogenous promoter.

In another composition, composition 53, the present disclosure provides a composition according to composition 51 or 52, wherein the TNFAIP3-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO: 54.

In another composition, composition 54, the present disclosure provides a composition according to any one of compositions 48 to 53, comprising a third exogenous polynucleotide encoding CD39 and a sixth exogenous polynucleotide encoding PD-L-1, wherein the third exogenous polynucleotide encoding CD39 is linked to the sixth exogenous polynucleotide encoding PD-L-1 by a polynucleotide encoding a P2A peptide such that the third exogenous polynucleotide, the polynucleotide encoding the P2A peptide, and the sixth exogenous polynucleotide form a CD39-P2A-PD-L-1 construct.

In another composition, composition 55, the present disclosure provides a composition according to composition 54, wherein the CD39-P2A-PD-L-1 construct is operably linked to an exogenous promoter.

In another composition, composition 56, the present disclosure provides a composition according to composition 54 or 55, wherein the CD39-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO: 53.

In another composition, composition 57, the present disclosure provides a composition according to any one of compositions 48 to 56, comprising a first exogenous polynucleotide encoding MANF, a second exogenous polynucleotide encoding TNFAIP3, and a sixth exogenous polynucleotide encoding PD-L-1, wherein the first exogenous polynucleotide is linked to the second exogenous polynucleotide by the first polynucleotide encoding a P2A peptide, and the second exogenous polynucleotide is linked to the sixth exogenous polynucleotide by the second polynucleotide encoding a P2A peptide, such that the first exogenous polynucleotide encoding MANF, the first polynucleotide encoding P2A peptide, the second exogenous polynucleotide encoding TNFAIP3, the second polynucleotide encoding P2A peptide, and the sixth exogenous polynucleotide encoding PD-L-1 form a MANF-P2A-TNFAIP3-P2A-PD-L-1 construct.

In another composition, composition 58, the present disclosure provides a composition according to composition 57, wherein MANF-P2A-TNFAIP3-P2A-PD-L-1 is operably linked to an exogenous promoter.

In another composition, composition 59, the present disclosure provides a composition according to composition 57 or 58, wherein the MANF-P2A-TNFAIP3-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO. 52.

In another composition, composition 60, the present disclosure provides a composition according to any one of compositions 48 to 59, comprising a third exogenous polynucleotide encoding CD39, a fourth exogenous polynucleotide encoding CD73, and a sixth exogenous polynucleotide encoding PD-L-1, wherein the third exogenous polynucleotide encoding CD39 is linked to the fourth exogenous polynucleotide encoding CD73 by a first polynucleotide encoding a P2A peptide, and the fourth exogenous polynucleotide is linked to the sixth exogenous polynucleotide by a second polynucleotide encoding a P2A peptide, such that the third exogenous polynucleotide encoding CD39, the first polynucleotide encoding a P2A peptide, the fourth exogenous polynucleotide encoding CD73, the second polynucleotide encoding a P2A peptide, and the sixth exogenous polynucleotide encoding PD-L-1 form a CD39-P2A-CD73-P2A-PD-L-1 construct.

In another composition, composition 61, the present disclosure provides a composition according to composition 60, wherein the CD39-P2A-CD73-P2A-PD-L-1 construct is operably linked to an exogenous promoter.

In another composition, composition 62, the present disclosure provides a composition according to composition 60 or 61, wherein the CD39-P2A-CD73-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO: 56.

In another composition, composition 63, the present disclosure provides a composition according to any one of compositions 25 to 62, wherein the genetically modified cell comprises a disrupted B2M gene, a disrupted TXNIP gene, a disrupted CIITA gene and/or a disrupted tgfβ gene, and the cell has disrupted expression of B2M protein, TXNIP protein, CIITA protein and/or tgfβ protein.

In another composition, composition 64, the present disclosure provides a composition according to any one of compositions 25 to 63, wherein the first exogenous polynucleotide encoding MANF, the second exogenous polynucleotide encoding TNFAIP3, the third exogenous polynucleotide encoding CD39, and/or the fourth exogenous polynucleotide encoding CD73 are each independently inserted into or near the B2M gene, the TXNIP gene, the CIITA gene, and/or the tgfp gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfp protein.

In another composition, composition 65, the present disclosure provides a composition according to any one of compositions 25 to 64, further comprising a fifth exogenous polynucleotide encoding HLA class I histocompatibility antigen alpha chain E (HLA-E), wherein the fifth exogenous polynucleotide encoding HLA-E is inserted into or near the B2M gene, TXNIP gene, CIITA gene, and/or tgfβ gene, thereby disrupting expression of the B2M protein, TXNIP protein, CIITA protein, and/or tgfβ protein, and wherein the universal donor cell further expresses HLA-E.

In another composition, composition 66, the present disclosure provides a composition according to any one of compositions 25 to 65, further comprising a sixth exogenous polynucleotide encoding a programmed death ligand 1 (PD-L-1), wherein the sixth exogenous polynucleotide encoding PD-L-1 is inserted into or near the B2M gene, the TXNIP gene, the CIITA gene, and/or the tgfβ gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfβ protein, and wherein the universal donor cell expresses PD-L-1.

In another composition, composition 67, the present disclosure provides a composition according to any one of compositions 64 to 66, wherein the first exogenous polynucleotide encoding MANF is inserted into or near the B2M gene, the TXNIP gene, or the CIITA gene, and/or the tgfβ gene.

In another composition, composition 68, the present disclosure provides a composition according to any one of compositions 64 to 67, wherein the first exogenous polynucleotide encoding MANF is inserted within or near the B2M gene and/or TXNIP gene, thereby disrupting expression of the B2M protein and/or TXNIP protein.

In another composition, composition 69, the present disclosure provides a composition according to compositions 64 to 68, wherein the second exogenous polynucleotide encoding TNFAIP3 is inserted into or near the B2M gene, the TXNIP gene, or the CIITA gene, and/or the tgfβ gene.

In another composition, composition 70, the present disclosure provides a composition according to compositions 64 to 69, wherein a second exogenous polynucleotide encoding TNFAIP3 is inserted within or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 71, the present disclosure provides a composition according to any one of compositions 64 to 70, wherein a third exogenous polynucleotide encoding CD39 is inserted into or near the B2M gene, the TXNIP gene, the CIITA gene, and/or the tgfβ gene.

In another composition, composition 72, the present disclosure provides a composition according to any one of compositions 64 to 71, wherein a third exogenous polynucleotide encoding CD39 is inserted within or near the CIITA gene and/or the B2M gene, thereby disrupting expression of the CIITA protein and/or the B2M protein.

In another composition, composition 73, the present disclosure provides a composition according to any one of compositions 64 to 72, wherein the fourth exogenous polynucleotide encoding CD73 is inserted into or near the B2M gene, the TXNIP gene, the CIITA gene, and/or the tgfβ gene.

In another composition, composition 74, the present disclosure provides a composition according to any one of compositions 64 to 73, wherein a fourth exogenous polynucleotide encoding CD73 is inserted within or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 75, the present disclosure provides a composition according to any one of compositions 64 to 74, comprising a MANF-P2A-HLA-E construct, wherein the MANF-P2A-HLA-E construct is inserted within or near a B2M gene, a TXNIP gene, a CIITA gene, or a tgfβ gene, thereby disrupting expression of B2M protein, TXNIP protein, CIITA protein, and/or tgfβ protein.

In another composition, composition 76, the present disclosure provides a composition according to any one of compositions 64 to 75, wherein the MANF-P2A-HLA-E construct is inserted within or near the TXNIP gene, thereby disrupting expression of the TXNIP protein.

In another composition, composition 77, the present disclosure provides a composition according to any one of compositions 64 to 76, comprising a TNFAIP3-P2A-PD-L-1 construct, wherein the TNFAIP3-P2A-PD-L-1 construct is inserted into or near a B2M gene, a TXNIP gene, a CIITA gene, and/or a tgfp gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfp protein.

In another composition, composition 78, the present disclosure provides a composition according to any one of compositions 64 to 77, wherein the TNFAIP3-P2A-PD-L-1 construct is inserted within or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 79, the present disclosure provides a composition according to any one of compositions 64 to 78, comprising a CD39-P2A-PD-L-1 construct, wherein the CD39-P2A-PD-L-1 construct is inserted into or near a B2M gene, a TXNIP gene, a CIITA gene, and/or a tgfβ gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfβ protein.

In another composition, composition 80, the present disclosure provides a composition according to any one of compositions 64 to 79, wherein the CD39-P2A-PD-L-1 construct is inserted within or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 81, the present disclosure provides a composition according to any one of compositions 64 to 80, comprising a MANF-P2A-TNFAIP3-P2A-PD-L-1 construct, wherein the MANF-P2A-TNFAIP3-P2A-PD-L-1 construct is inserted into or near a B2M gene, a TXNIP gene, a CIITA gene, and/or a tgfβ gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfβ protein.

In another composition, composition 82, the present disclosure provides a composition according to any one of compositions 64 to 81, wherein the MANF-P2A-TNFAIP3-P2A-PD-L-1 construct is inserted into or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 83, the present disclosure provides a composition according to any one of compositions 64 to 82, comprising a CD39-P2A-CD73 construct, wherein the CD39-P2A-CD73 construct is inserted into or near a B2M gene, a TXNIP gene, a CIITA gene, and/or a tgfβ gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfβ protein.

In another composition, composition 84, the present disclosure provides a composition according to any one of compositions 64 to 83, wherein the CD39-P2A-CD73 construct is inserted into or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 85, the present disclosure provides a composition according to any one of compositions 64 to 84, comprising a CD39-P2A-CD73-P2A-PD-L-1 construct, wherein the CD39-P2A-CD73-P2A-PD-L-1 construct is inserted into or near a B2M gene, a TXNIP gene, a CIITA gene, and/or a tgfβ gene, thereby disrupting expression of the B2M protein, the TXNIP protein, the CIITA protein, and/or the tgfβ protein.

In another composition, composition 86, the present disclosure provides a composition according to any one of compositions 64 to 85, wherein the CD39-P2A-CD73-P2A-PD-L-1 construct is inserted within or near the B2M gene, thereby disrupting expression of the B2M protein.

In another composition, composition 87, the present disclosure provides a composition according to any one of compositions 25 to 86, wherein disrupted expression of a B2M protein, a TXNIP protein, a CIITA protein, and/or a tgfβ protein includes reduced or eliminated expression of a B2M protein, a TXNIP protein, a CIITA protein, and/or a tgfβ protein.

In another composition, composition 88, the present disclosure provides a composition according to any one of compositions 25 to 87, wherein the tgfβ protein is tgfβ -2.

In another composition, composition 89, the present disclosure provides a composition according to any one of compositions 25 to 88, wherein the cell is a stem cell.

In another composition, composition 90, the present disclosure provides a composition according to composition 89, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another composition, composition 91, the present disclosure provides a composition according to any one of compositions 25 to 88, wherein the cell is a differentiated cell or a somatic cell.

In another composition, composition 92, the present disclosure provides a composition according to composition 91, wherein the cells are lineage restricted progenitor cells or fully differentiated somatic cells.

In another composition, composition 93, the present disclosure provides a composition according to composition 92, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine cells, or immature beta cells, and the fully differentiated somatic cells are pancreatic beta cells.

In another composition, composition 94, the present disclosure provides a composition comprising more than one genetically modified cell according to any one of claims 1 to 93.

In another composition, composition 95, the present disclosure provides a composition according to composition 94, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, CD39 and/or CD73.

In another composition, composition 96, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one genetically modified cell of composition 94 or 95.

In another composition, composition 97, the present disclosure provides a composition according to composition 96, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or immature beta cells, and the fully differentiated somatic cells are pancreatic beta cells.

In another composition, composition 98, the present disclosure provides a composition according to composition 96 or 97, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, CD39 and/or CD73.

In another composition, composition 99, the present disclosure provides a composition comprising more than one cell of composition 94 or 95 or a cell population of any one of compositions 96 to 98.

In another composition, composition 100, the present disclosure provides a composition according to composition 99, further comprising at least one pharmaceutically acceptable excipient.

In another composition, composition 101, the present disclosure provides a composition according to composition 99 or 100 for use in treating a pancreatic disease or disorder.

In another composition, composition 102, the present disclosure provides a composition according to composition 101, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another composition, composition 103, the present disclosure provides a composition according to composition 101 or 102, wherein the human comprises a pancreatic disease or disorder.

In another method, method 104, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained more than one genetically modified cell of claim 94 or 95 after differentiation into pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 105, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained a population of lineage restricted progenitor cells or fully differentiated somatic cells according to any one of claims 96 to 98, wherein the lineage restricted progenitor cells or fully differentiated somatic cells comprise pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or beta cells to the subject.

In another method, method 106, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained more than one genetically modified cell of claim 94 or 95, wherein said more than one genetically modified cell comprises a stem cell; (b) Differentiating the genetically modified cells into pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells and/or pancreatic beta cells; and (c) administering pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 107, the present disclosure provides the method provided in any one of methods 104 to 106, wherein administering comprises implanting a device comprising pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells into the subject.

In another method, method 108, the present disclosure provides the method provided in any one of methods 104 to 107, wherein the subject has, is suspected of having, or is at risk of a pancreatic disease or disorder.

In another method, method 109, the present disclosure provides the method provided in method 108, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 110, the present disclosure provides the method provided in any one of methods 104 to 109, wherein the subject is a human.

In another composition, composition 111, the present disclosure provides a composition comprising a genetically modified cell comprising: (a) A first polynucleotide encoding a brain astrocyte-derived neurotrophic factor (MANF) inserted within or near a gene encoding a thioredoxin interacting protein (TXNIP) and (B) a second polynucleotide encoding a tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) inserted within or near a gene encoding a beta-2-microglobulin (B2M), wherein the genetically modified cell expresses MANF and TNFAIP3 and has disrupted expression of TXNIP and B2M.

In another composition, composition 112, the present disclosure provides a composition according to composition 111, wherein disrupted expression of B2M and TXNIP comprises reduced or eliminated expression of B2M and/or TXNIP.

In another composition, composition 113, the present disclosure provides a composition according to composition 111 or 112, further comprising a third polynucleotide encoding HLA class I histocompatibility antigen alpha chain E (HLA-E) inserted within or near the TXNIP gene.

In another composition, composition 114, the present disclosure provides a composition according to composition 113, wherein the third polynucleotide encoding HLA-E comprises a polynucleotide encoding an HLA-E trimer comprising B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another composition, composition 115, the present disclosure provides a composition according to composition 113 or 114, wherein the first polynucleotide encoding MANF and the third polynucleotide encoding HLA-E are operably linked to an exogenous promoter.

In another composition, composition 116, the present disclosure provides a composition according to any one of compositions 113 to 115, wherein the first polynucleotide encoding MANF is linked to the third polynucleotide encoding HLA-E by a polynucleotide encoding a P2A peptide such that the first polynucleotide, the polynucleotide encoding the P2A peptide, and the third polynucleotide form a MANF-P2A-HLA-E construct.

In another composition, composition 117, the present disclosure provides a composition according to composition 116, wherein the MANF-P2A-HLA-E construct comprises a polynucleotide sequence consisting essentially of SEQ ID NO. 55.

In another composition, composition 118, the present disclosure provides a composition according to any one of compositions 111 to 117, further comprising a fourth polynucleotide encoding programmed death ligand 1 (PD-L-1) inserted within or near the B2M gene.

In another composition, composition 119, the present disclosure provides a composition according to composition 118, wherein the second polynucleotide encoding TNFAIP3 and the fourth polynucleotide encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 120, the present disclosure provides a composition according to composition 118 or 119, wherein the second polynucleotide encoding TNFAIP3 is linked to the fourth polynucleotide sequence encoding PD-L-1 by a polynucleotide encoding a P2A peptide such that the second polynucleotide, the polynucleotide encoding the P2A peptide, and the fourth polynucleotide form a TNFAIP3-P2A-PD-L-1 construct.

In another composition, composition 121, the present disclosure provides a composition according to composition 120, wherein the TNFAIP3-P2A-PD-L-1 construct comprises a nucleotide sequence consisting essentially of SEQ ID NO: 54.

In another composition, composition 122, the present disclosure provides a composition according to any one of compositions 111 to 121, wherein the cells are stem cells.

In another composition, composition 123, the present disclosure provides a composition according to composition 112, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another composition, composition 124, the present disclosure provides a composition according to any one of compositions 111 to 121, wherein the cell is a differentiated cell or a somatic cell.

In another composition, composition 125, the present disclosure provides a composition according to composition 124, wherein the cells are lineage restricted progenitor cells or fully differentiated somatic cells.

In another composition, composition 126, the present disclosure provides a composition according to composition 125, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine cells, or immature beta cells, and the fully differentiated somatic cells are pancreatic beta cells.

In another composition, composition 127, the present disclosure provides a composition comprising more than one genetically modified cell according to any one of claims 111 to 126.

In another composition, composition 128, the present disclosure provides a composition according to composition 127, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, and/or PD-L-1.

In another composition, composition 129, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one genetically modified cell of composition 127 or 128.

In another composition, composition 130, the present disclosure provides a composition according to composition 129, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or immature beta cells, and the fully differentiated somatic cells are pancreatic beta cells.

In another composition, composition 131, the present disclosure provides a composition according to composition 129 or 130, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, and/or PD-L-1.

In another composition, composition 132, the present disclosure provides a composition comprising more than one cell of composition 17 or 18 or a cell population of any of compositions 130 or 131.

In another composition, composition 133, the present disclosure provides a composition according to composition 132, further comprising at least one pharmaceutically acceptable excipient.

In another composition, composition 134, the present disclosure provides a composition according to composition 132 or 133 for use in treating a pancreatic disease or disorder.

In another composition, composition 135, the present disclosure provides a composition according to composition 134, wherein the human comprises a pancreatic disease or disorder.

In another composition, composition 136, the present disclosure provides a composition according to composition 134 or 135, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 137, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained more than one genetically modified cell of any one of claims 111 to 139 after differentiation into pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 138, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained a population of lineage restricted progenitor cells or fully differentiated somatic cells of claim 129, wherein the lineage restricted progenitor cells or fully differentiated somatic cells comprise pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or beta cells to the subject.

In another method, method 139, the present disclosure provides a method for treating a subject in need thereof, the method comprising: (a) Obtaining or having obtained more than one genetically modified cell of claim 127 or claim 128, wherein the more than one genetically modified cell comprises a stem cell; (b) Differentiating the genetically modified cells into pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells and/or pancreatic beta cells; and (c) administering pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 140, the present disclosure provides the method provided by any one of methods 137-139, wherein administering comprises implanting a device comprising pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells into the subject.

In another method, method 141, the present disclosure provides the method provided in any one of methods 137-140, wherein the subject has, is suspected of having, or is at risk of a pancreatic disease or disorder.

In another method, method 142, the present disclosure provides the method provided in method 141, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 143, the present disclosure provides the method provided in any one of methods 137-142, wherein the subject is a human.

In another method, method 144, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) A first RNA-guided nuclease and a first guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus; (b) a first vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in the B2M locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3 and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; and (c) a second RNA-guided nuclease and a second gRNA targeting a target site in a thioredoxin interaction protein (TXNIP) locus; and (d) a second vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in a TXNIP locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is disrupted at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene; wherein the universal donor cell expresses TNFAIP3, PD-L-1, MANF, and HLA-E and has disrupted expression of B2M and TXNIP.

In another method, method 145, the present disclosure provides the in vitro method provided in method 144, wherein disrupted expression of B2M and TXNIP comprises a reduction or elimination of expression of B2M and/or TXNIP.

In another method, method 146, the present disclosure provides the in vitro method provided in method 144 or 145, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding P2A, and the nucleotide sequence encoding P2A is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 147, the present disclosure provides the in vitro method provided by any one of methods 144 to 146, wherein the nucleotide sequence of (b) (i) comprises SEQ ID No. 54.

In another method, method 148, the present disclosure provides the in vitro method provided by any one of methods 144 to 147, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 149, the present disclosure provides the in vitro method provided in method 148, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 150, the present disclosure provides the in vitro method provided by any one of methods 144 to 149, wherein the nucleotide sequence of (b) (ii) comprises or consists essentially of SEQ ID No. 15.

In another method, method 151, the present disclosure provides the in vitro method provided by any one of methods 144 to 150, wherein the nucleotide sequence of (b) (iii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 152, the present disclosure provides the in vitro method provided by any one of methods 144 to 151, wherein the first RNA-guided nuclease and the first gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 153, the present disclosure provides the in vitro method provided by any one of methods 144 to 152, wherein the first RNA-guided nuclease is a first Cas9 nuclease.

In another method, method 154, the present disclosure provides the in vitro method provided in method 153, wherein the first Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 155, the present disclosure provides the in vitro method of any one of methods 144 to 154, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 156, the present disclosure provides the in vitro method of any one of methods 144 to 155, wherein the nucleotide sequence of (d) (i) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding P2A, and the nucleotide sequence encoding P2A linked to a nucleotide sequence encoding HLA-E.

In another method, method 157, the present disclosure provides the in vitro method provided by any one of methods 144 to 156, wherein the nucleotide sequence of (d) (i) comprises SEQ ID No. 55.

In another method, method 158, the present disclosure provides the in vitro method provided by any one of methods 144 to 157, wherein the nucleotide sequence of (d) (i) is operably linked to an exogenous promoter.

In another method, method 159, the present disclosure provides the in vitro method provided in method 158, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 160, the present disclosure provides the in vitro method provided by any one of methods 144 to 159, wherein the nucleotide sequence of (d) (ii) consists essentially of SEQ ID No. 42.

In another method, method 161, the present disclosure provides the in vitro method provided by any one of methods 144 to 160, wherein the nucleotide sequence of (d) (iii) consists essentially of SEQ ID No. 44.

In another method, method 162, the present disclosure provides the in vitro method provided by any one of methods 144 to 161, wherein the second RNA-guided nuclease and the second gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 163, the present disclosure provides the in vitro method provided by any one of methods 144 to 162, wherein the second RNA-guided nuclease is a second Cas9 nuclease.

In another method, method 164, the present disclosure provides the in vitro method provided in method 163, wherein the second Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 165, the present disclosure provides the in vitro method provided by any one of methods 144 to 164, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another method, method 166, the present disclosure provides the in vitro method provided by any one of methods 144 to 165, wherein the stem cells are human stem cells.

In another method, method 167, the present disclosure provides the in vitro method provided by any one of methods 144 to 166, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and gene disruption.

In another method, method 168, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a first target locus and a first nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a neurotrophic factor of midbrain astrocyte origin (MANF), cluster of differentiation 39 (CD 39) and/or cluster of differentiation 73 (CD 73), wherein the first target locus is cleaved at the target site and the first nucleic acid comprising a nucleotide sequence encoding TNFAIP3, MANF, CD39 and/or CD73 is inserted into the target locus, thereby disrupting the target gene; and/or (B) an RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus, wherein the B2M locus is cleaved at the target site, thereby disrupting the B2M gene; and/or (c) an RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a thioredoxin interaction protein (TXNIP) locus, wherein the TXNIP locus is cleaved at the target site, thereby disrupting the TXNIP gene; and/or (d) an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a class II transactivator (CIITA) locus, wherein the CIITA locus is cleaved at the target site, thereby disrupting the CIITA gene; and/or (e) an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a transforming growth factor beta (tgfβ) locus, wherein the tgfβ locus is cleaved at the target site, thereby disrupting the tgfβ gene.

In another method, method 169, the present disclosure provides the in vitro method provided in method 168, wherein the target locus of (a) is selected from the group consisting of a beta-2 microglobulin (B2M) locus, a thioredoxin interacting protein (TXNIP) locus, a class II transactivator (CIITA) locus, and/or a transforming growth factor beta (tgfβ) locus, and the universal donor cell has disrupted expression of B2M, TXNIP, CIITA and/or tgfβ.

In another method, method 170, the present disclosure provides the in vitro method provided in method 168 or 169, wherein disrupted expression of B2M, TXNIP, CIITA and/or tgfβ comprises reduced or eliminated expression of B2M, TXNIP, CIITA and/or tgfβ.

In another method, method 171, the present disclosure provides the in vitro method provided in method 169 or 170, wherein the target locus of (a) is a B2M locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39 and/or CD73 is flanked by (i) and (ii), and the universal donor cell has disrupted expression of B2M.

In another method, method 172, the present disclosure provides the in vitro method provided in method 171, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 15.

In another method, method 173, the present disclosure provides the in vitro method provided by any one of methods 171 or 172, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 174, the present disclosure provides the in vitro method provided in method 169, wherein the target locus of (a) is a TXNIP locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39 and/or CD73 is flanked by (i) and (ii), and the universal donor cell has disrupted expression of TXNIP.

In another method, method 175, the present disclosure provides the in vitro method provided in method 174, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 42.

In another method, method 176, the present disclosure provides the in vitro method provided in method 174 or 175, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 44.

In another method, method 177, the present disclosure provides the in vitro method provided in method 169, wherein the target locus of (a) is a CIITA locus and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39 and/or CD73 is flanked by (i) and (ii), and the universal donor cell has disrupted expression of CIITA.

In another method, method 178, the present disclosure provides the in vitro method provided in method 177, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 26.

In another method, method 179, the present disclosure provides the in vitro method provided in method 177 or 178, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 28.

In another method, method 180, the present disclosure provides the in vitro method provided in method 169, wherein the target locus of (a) is a tgfβ locus and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39 and/or CD73 is flanked by (i) and (ii), and the universal donor cell has disrupted expression of tgfβ.

In another method, method 181, the present disclosure provides the in vitro method provided by any one of methods 168 to 180, wherein the target site of (b) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 1 to 13.

In another method, method 182, the present disclosure provides the in vitro method provided by any one of methods 168 to 181, wherein the target site of (c) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 32-41.

In another method, method 183, the present disclosure provides the in vitro method provided by any one of methods 168 to 182, wherein the target site of (d) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 25 and 48-51.

In another method, method 184, the present disclosure provides the in vitro method provided by any one of methods 168 to 183, wherein the target site of (e) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 57.

In another method, method 185, the present disclosure provides an in vitro method as provided in any one of methods 168 to 184, the in vitro method further comprising delivering to the stem cells: (f) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a neurotrophic factor of midbrain astrocyte origin (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA class I histocompatibility antigen alpha chain E (HLA-E) and/or programmed death ligand 1 (PD-L-1), wherein the target locus is cleaved at the target site, and nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are inserted into the target locus, thereby disrupting the target gene.

In another method, method 186, the present disclosure provides the in vitro method provided in method 185, wherein the target locus of (f) is selected from the group consisting of a beta-2 microglobulin (B2M) locus, a thioredoxin interacting protein (TXNIP) locus, a class II transactivator (CIITA) locus, and/or a transforming growth factor beta (tgfβ) locus.

In another method, method 187, the present disclosure provides the in vitro method provided in method 186, wherein the target locus of (f) is a B2M locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 188, the present disclosure provides the in vitro method provided in method 187, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 15.

In another method, method 189, the present disclosure provides the in vitro method provided by any one of methods 187 or 188, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 190, the present disclosure provides the in vitro method provided in method 186, wherein the target locus of (f) is a TXNIP locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 191, the present disclosure provides the in vitro method provided by any one of methods 190, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 42.

In another method, method 192, the present disclosure provides the in vitro method provided in method 190 or 191, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 44.

In another method, method 193, the present disclosure provides the in vitro method provided in method 186, wherein the target locus of (f) is a CIITA locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 194, the present disclosure provides the in vitro method provided in method 193, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 26.

In another method, method 195, the present disclosure provides the in vitro method provided in method 193 or 195, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 28.

In another method, method 196, the present disclosure provides the in vitro method provided in method 186, wherein the target locus of (f) is a tgfβ locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 197, the present disclosure provides the in vitro method provided by any one of methods 185 to 196, wherein the target locus of (f) is the same as the target locus of (a).

In another method, method 198, the present disclosure provides the in vitro method provided by any one of methods 185 to 197, wherein the target locus of (f) is different from the target locus of (a).

In another method, method 199, the present disclosure provides an in vitro method provided by any one of methods 168 to 198, the in vitro method further comprising delivering to the stem cells: (f) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a glial cell-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E and/or PD-L-1, wherein the target locus is cleaved at the target site and nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are inserted into the target locus, thereby disrupting the target gene.

In another method, method 200, the present disclosure provides the in vitro method provided in method 199, wherein the target locus of (g) is selected from the group consisting of a beta-2 microglobulin (B2M) locus, a thioredoxin interacting protein (TXNIP) locus, a class II transactivator (CIITA) locus, and/or a transforming growth factor beta (tgfβ) locus.

In another method, method 201, the present disclosure provides the in vitro method provided in method 200, wherein the target locus of (g) is a B2M locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 202, the present disclosure provides the in vitro method provided in method 201, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 15.

In another method, method 203, the present disclosure provides the in vitro method provided in method 201 or 202, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 204, the present disclosure provides the in vitro method provided in method 200, wherein the target locus of (g) is a TXNIP locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 205, the present disclosure provides the in vitro method provided in method 204, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 42.

In another method, method 206, the present disclosure provides the in vitro method provided in method 204 or 205, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 44.

In another method, method 207, the present disclosure provides the in vitro method provided in method 200, wherein the target locus of (g) is a CIITA locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 208, the present disclosure provides the in vitro method provided in method 207, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 26.

In another method, method 209, the present disclosure provides the in vitro method provided in method 207 or 208, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 28.

In another method, method 210, the present disclosure provides the in vitro method provided in method 200, wherein the target locus of (g) is a tgfβ locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 211, the present disclosure provides the in vitro method provided by any one of methods 199 to 210, wherein the target locus of (g) is the same as the target locus of (a) and/or (f).

In another method, method 212, the present disclosure provides the in vitro method provided by any one of methods 199-211, wherein the target locus of (g) is different from the target locus of (a) and/or (f).

In another method, method 213, the present disclosure provides an in vitro method provided by any one of methods 168 to 212, the in vitro method further comprising delivering to a stem cell: (h) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a glial cell-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E and/or PD-L-1, wherein the target locus is cleaved at the target site and nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are inserted into the target locus, thereby disrupting the target gene.

In another method, method 214, the present disclosure provides the in vitro method provided in method 213, wherein the target locus of (h) is selected from the group consisting of a beta-2 microglobulin (B2M) locus, a thioredoxin interacting protein (TXNIP) locus, a class II transactivator (CIITA) locus, and/or a transforming growth factor beta (tgfβ) locus.

In another method, method 215, the present disclosure provides the in vitro method provided in method 214, wherein the target locus of (h) is a B2M locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 216, the present disclosure provides the in vitro method provided in method 215, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 15.

In another method, method 217, the present disclosure provides the in vitro method provided in method 215 or 216, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 218, the present disclosure provides the in vitro method provided in method 214, wherein the target locus of (h) is a TXNIP locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 219, the present disclosure provides the in vitro method provided in method 218, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 42.

In another method, method 220, the present disclosure provides the in vitro method provided in method 218 or 219, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 44.

In another method, method 221, the present disclosure provides the in vitro method provided in method 214, wherein the target locus of (h) is a CIITA locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 222, the present disclosure provides the in vitro method provided in method 221, wherein the nucleotide sequence of (i) comprises or consists essentially of SEQ ID No. 26.

In another method, method 223, the present disclosure provides the in vitro method provided in method 221 or 222, wherein the nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 28.

In another method, method 224, the present disclosure provides the in vitro method provided in method 214, wherein the target locus of (h) is a tgfβ locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L-1 are flanked by (i) and (ii).

In another method, method 225, the present disclosure provides the in vitro method provided by any one of methods 213 to 224, wherein the target locus of (h) is the same as the target locus of (a), (f) and/or (g).

In another method, method 226, the present disclosure provides the in vitro method provided by any one of methods 213 to 225, wherein the target locus of (h) is different from the target locus of (a), (f) and/or (g).

In another method, method 227, the present disclosure provides the in vitro method provided by any one of methods 168 to 226, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding MANF, and the universal donor cell expresses MANF.

In another method, method 228, the present disclosure provides the in vitro method provided in method 227, wherein the nucleotide sequence encoding MANF consists essentially of SEQ ID No. 17.

In another method, method 229, the present disclosure provides the in vitro method provided by any one of methods 168 to 228, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding TNFAIP3, and the universal donor cell expresses TNFAIP3.

In another method, method 230, the present disclosure provides the in vitro method provided in method 229, wherein the nucleotide sequence encoding TNFAIP3 consists essentially of SEQ ID No. 19.

In another method, method 231, the present disclosure provides the in vitro method provided by any one of methods 168 to 230, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding CD39, and the universal donor cell expresses CD39.

In another method, method 232, the present disclosure provides the in vitro method provided in method 231, wherein the nucleotide sequence encoding CD39 consists essentially of SEQ ID No. 27.

In another method, method 233, the present disclosure provides the in vitro method provided by any one of methods 168 to 232, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding CD73, and the universal donor cell expresses CD73.

In another method, method 234, the present disclosure provides the in vitro method provided in method 233, wherein the nucleotide sequence encoding CD73 consists essentially of SEQ ID No. 46.

In another method, method 235, the present disclosure provides the in vitro method provided by any one of methods 168 to 234, wherein the nucleic acid of (a) further comprises a nucleotide sequence encoding HLA class I histocompatibility antigen a chain E (HLA-E), and the universal donor cell further expresses HLA-E.

In another method, method 236, the present disclosure provides the in vitro method provided by any one of methods 168 to 235, wherein the nucleic acid of (f), (g) and/or (h) comprises a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E), and the universal donor cell expresses HLA-E.

In another method, method 237, the present disclosure provides the in vitro method provided in methods 168 to 236, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 238, the present disclosure provides the in vitro method provided by any one of methods 235 to 237, wherein the nucleotide sequence encoding HLA-E consists essentially of SEQ ID No. 43.

In another method, method 239, the present disclosure provides the in vitro method provided by any one of methods 235 to 238, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding MANF and a nucleotide sequence encoding HLA-E, and the universal donor cell expresses MANF and HLA-E.

In another method, method 240, the present disclosure provides the in vitro method provided in method 239, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding a P2A peptide linked to a nucleotide sequence encoding HLA-E.

In another method, method 241, the present disclosure provides the in vitro method provided in method 240, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence consisting of SEQ ID NO: 55.

In another method, method 242, the present disclosure provides the in vitro method provided by any one of methods 168 to 241, wherein the nucleic acid of (a) further comprises a nucleotide sequence encoding a programmed death ligand 1 (PD-L-1), and the universal donor cell further expresses PD-L-1.

In another method, method 243, the present disclosure provides the in vitro method provided by any one of methods 168 to 242, wherein the nucleic acid of (f), (g) and/or (h) comprises a nucleotide sequence encoding PD-L-1, and the universal donor cell expresses PD-L-1.

In another method, method 244, the present disclosure provides the in vitro method provided in method 242 or 243, wherein the nucleotide sequence encoding PD-L-1 consists essentially of SEQ ID NO. 20.

In another method, method 245, the present disclosure provides the in vitro method provided in methods 242 to 244, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding TNFAIP3 and a nucleotide sequence encoding PD-L-1, and the universal donor cell expresses TNFAIP3 and PD-L-1.

In another method, method 246, the present disclosure provides the in vitro method of any one of methods 242 to 245, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 247, the disclosure provides the in vitro method provided in method 246, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 54.

In another method, method 248, the present disclosure provides the in vitro method provided by any one of methods 242 to 247, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence of CD39 and a nucleotide sequence encoding PD-L-1, and the universal donor cell expresses CD39 and PD-L-1.

In another method, method 249, the present disclosure provides the in vitro method provided in method 248, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence of CD39, the nucleotide sequence of CD39 is linked to a nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 250, the present disclosure provides the in vitro method provided in method 249, wherein the nucleic acid of (a), (f), (g), and/or (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 53.

In another method, method 251, the present disclosure provides the in vitro method provided by any one of methods 185 to 250, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding MANF, a nucleotide sequence encoding TNFAIP3, and a nucleotide sequence encoding PD-L-1, and the universal donor cell expresses MANF, TNFAIP3, and PD-L-1.

In another method, method 252, the present disclosure provides the in vitro method provided in method 251, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding TNFAIP3 through a first nucleotide sequence encoding a P2A peptide and a nucleotide sequence encoding TNFAIP3 linked to a nucleotide sequence encoding PD-L-1 through a second nucleotide sequence encoding a P2A peptide.

In another method, method 253, the present disclosure provides the in vitro method provided in method 252, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 52.

In another method, method 254, the present disclosure provides the in vitro method of any one of methods 185 to 253, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding CD39, a nucleotide sequence encoding CD73 and a nucleotide sequence encoding PD-L-1, and the universal donor cell expresses CD39, CD73 and PD-L-1.

In another method, method 255, the present disclosure provides the in vitro method provided in method 254, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding CD73 by a first nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding CD73 is linked to the nucleotide sequence encoding PD-L-1 by a second nucleotide sequence encoding a P2A peptide.

In another method, method 256, the present disclosure provides the in vitro method provided in method 255, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 56.

In another method, method 257, the present disclosure provides the in vitro method provided by any one of methods 168 to 256, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence encoding CD39 and a nucleotide sequence encoding CD73, and the universal donor cell expresses CD39 and CD73.

In another method, method 258, the present disclosure provides the in vitro method provided in method 257, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding CD73 by a nucleotide sequence encoding a P2A peptide.

In another method, method 259, the present disclosure provides the in vitro method provided in method 258, wherein the nucleic acid of (a), (f), (g) and/or (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 58.

In another method, method 260, the present disclosure provides the in vitro method provided by any one of methods 168 to 259, wherein the nucleotide sequence of any one of the nucleic acids of (a), (f), (g) and/or (h) is operably linked to an exogenous promoter.

In another method, method 261, the present disclosure provides the in vitro method provided in method 260, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 262, the present disclosure provides the in vitro method provided by any one of methods 168 to 261, wherein the RNA-guided nuclease and the gRNA of (a), (b), (c), (d), (e), (f), (g), and/or (h) are present in a ratio of about 1:1 to about 1:10.

In another method, method 263, the present disclosure provides the in vitro method provided by any one of methods 168 to 262, wherein the RNA-guided nuclease and the gRNA of each of (a), (b), (c), (d), (e), (f), (g), and/or (h) are present in a ratio of about 1:1 to about 1:10.

In another method, method 264, the present disclosure provides the in vitro method provided by any one of methods 168 to 263, wherein the RNA-guided nuclease of each of (a), (b), (c), (d), (e), (f), (g), and/or (h) is a Cas9 nuclease.

In another method, method 265, the present disclosure provides the in vitro method provided in method 264, wherein the Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 266, the present disclosure provides the in vitro method provided by any one of methods 168 to 264, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another method, method 267, the present disclosure provides the in vitro method provided by any one of methods 168 to 266, wherein the stem cells are human stem cells.

In another method, method 268, the present disclosure provides the in vitro method provided by any one of methods 1 to 267, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and/or gene disruption.

In another method, method 269, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) A first RNA-guided nuclease and a first guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus; (b) a first vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in the B2M locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3 and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; wherein the universal donor cell expresses TNFAIP3 and PD-L-1 and has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and gene disruption.

In another method, method 270, the present disclosure provides the in vitro method provided in method 269, wherein disrupting the B2M gene comprises reducing or eliminating expression of B2M.

In another method, method 271, the disclosure provides the in vitro method provided in method 269 or 270, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 272, the present disclosure provides the in vitro method provided by any one of methods 269 to 271, wherein the nucleotide sequence of (b) (i) comprises SEQ ID No. 54.

In another method, method 273, the present disclosure provides the in vitro method provided by any one of methods 269-272, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 274, the present disclosure provides the in vitro method provided in method 273, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 275, the present disclosure provides the in vitro method provided by any one of methods 269 to 274, wherein the nucleotide sequence of (b) (ii) comprises or consists essentially of SEQ ID NO: 15.

In another method, method 276, the present disclosure provides the in vitro method provided by any one of methods 269 to 275, wherein the nucleotide sequence of (b) (iii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 277, the present disclosure provides the in vitro method provided by any one of methods 269 to 276, wherein the first RNA-guided nuclease and the first gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 278, the present disclosure provides the in vitro method provided by any one of methods 269-277, wherein the first RNA-guided nuclease is a first Cas9 nuclease.

In another method, method 279, the present disclosure provides the in vitro method provided in method 278, wherein the first Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 280, the present disclosure provides an in vitro method provided by any one of methods 269 to 279, the in vitro method further comprising: (c) A second RNA-guided nuclease and a second gRNA targeting a target site in a thioredoxin interaction protein (TXNIP) locus; and (d) a second vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in a TXNIP locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is disrupted at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene; wherein the universal donor cell also expresses MANF and HLA-E.

In another method, method 281, the present disclosure provides the in vitro method provided in method 280, wherein disrupting the TXNIP gene comprises reducing or eliminating expression of the TXNIP.

In another method, method 282, the present disclosure provides the in vitro method provided in method 280 or 281, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 283, the present disclosure provides the in vitro method of any one of methods 280-282, wherein the nucleotide sequence of (d) (i) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding a P2A peptide, and the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding HLA-E.

In another method, method 284, the present disclosure provides the in vitro method provided by any one of methods 280 to 283, wherein the nucleotide sequence of (d) (i) comprises SEQ ID No. 55.

In another method, method 285, the present disclosure provides the in vitro method provided by any one of methods 280 to 284, wherein the nucleotide sequence of (d) (i) is operably linked to an exogenous promoter.

In another method, method 286, the present disclosure provides the in vitro method provided in method 285, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 287, the present disclosure provides the in vitro method provided by any one of methods 280 to 286, wherein the nucleotide sequence of (d) (ii) consists essentially of SEQ ID No. 42.

In another method, method 288, the present disclosure provides the in vitro method provided by any one of methods 280 to 287, wherein the nucleotide sequence of (d) (iii) consists essentially of SEQ ID No. 44.

In another method, method 289, the present disclosure provides the in vitro method provided by any one of methods 280 to 288, wherein the second RNA-guided nuclease and the second gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 290, the present disclosure provides the in vitro method provided by any one of methods 280-289, wherein the second RNA-guided nuclease is a second Cas9 nuclease.

In another method, method 291, the disclosure provides the in vitro method provided in method 290, wherein the second Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 292, the present disclosure provides the in vitro method provided by any one of methods 269-291, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another method, method 293, the present disclosure provides the in vitro method provided by any one of methods 269-292, wherein the stem cells are human stem cells.

In another composition, composition 294, the present disclosure provides a composition comprising a genetically modified cell comprising a nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF), a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a nucleotide sequence encoding cluster 73 (Cd 73), and/or a nucleotide sequence encoding cluster 39 (Cd 39) inserted within or near a gene encoding a beta-2-microglobulin (B2M), a thioredoxin interacting protein (TXNIP), or a class II transactivator (CIITA), wherein the genetically modified cell expresses MANF, TNFAIP3, cd73, and/or Cd39 and has disrupted expression of B2M, TXNIP and/or CIITA.

In another composition, composition 295, the present disclosure provides a composition according to composition 294, wherein disrupted expression of B2M, TXNIP and/or CIITA includes reduced or eliminated expression of B2M, TXNIP and/or CIITA.

In another composition, composition 296, the present disclosure provides a composition according to composition 294 or 295, further comprising a nucleotide sequence encoding a programmed death ligand 1 (PD-L-1) and/or a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E) inserted within or near the B2M, TXNIP or CIITA gene.

In another composition, composition 297, the present disclosure provides a composition according to composition 296, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another composition, composition 298, the present disclosure provides a composition according to composition 296 or 297, wherein the genetically modified cell comprises a MANF-encoding nucleotide sequence and an HLA-E-encoding nucleotide sequence inserted within or near the TXNIP gene.

In another composition, composition 299, the present disclosure provides a composition according to composition 298, wherein the nucleotide sequence encoding MANF and the nucleotide sequence encoding HLA-E are operably linked to an exogenous promoter.

In another composition, composition 300, the present disclosure provides a composition according to either composition 298 or 299, wherein the nucleotide sequence encoding MANF is linked to the nucleotide sequence encoding HLA-E by a nucleotide sequence encoding ribosome skip.

In another composition, composition 301, the present disclosure provides a composition according to composition 300, wherein the ribosome jump is a 2A sequence family member.

In another composition, composition 302, the present disclosure provides a composition according to any one of compositions 294 to 301, wherein the genetically modified cell comprises a nucleotide sequence encoding TNFAIP3 and a nucleotide sequence encoding PD-L-1 inserted within or near the B2M gene.

In another composition, composition 303, the present disclosure provides a composition according to composition 302, wherein the nucleotide sequence encoding TNFAIP3 and the nucleotide sequence encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 304, the present disclosure provides a composition according to composition 302 or 303, wherein the nucleotide sequence encoding TNFAIP3 is linked to the nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding ribosome skip.

In another composition, composition 305, the present disclosure provides a composition according to composition 304, wherein the ribosome jump is a 2A sequence family member.

In another composition, composition 306, the present disclosure provides a composition according to composition 296 or 297, wherein the genetically modified cell comprises a nucleotide sequence encoding TNFAIP3, a nucleotide sequence encoding MANF, and a nucleotide sequence encoding PD-L-1 inserted within or near the B2M gene.

In another composition, composition 307, the present disclosure provides a composition according to composition 306, wherein the nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding MANF, and the nucleotide sequence encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 308, the present disclosure provides a composition according to composition 306 or 307, wherein the nucleotide sequence encoding TNFAIP3 is linked to the nucleotide sequence encoding MANF by the nucleotide sequence encoding ribosome skip, and the nucleotide sequence encoding MANF is linked to the nucleotide sequence encoding PD-L-1 by the nucleotide sequence encoding ribosome skip.

In another composition, composition 309, the present disclosure provides a composition according to composition 308, wherein the ribosome jump is a 2A sequence family member.

In another composition, composition 310, the present disclosure provides a composition according to any one of compositions 294 to 309, wherein the genetically modified cell comprises a nucleotide sequence encoding CD39 inserted within or near the CIITA gene.

In another composition, composition 311, the present disclosure provides a composition according to composition 310, wherein the nucleotide sequence encoding CD39 is operably linked to an exogenous promoter.

In another composition, composition 312, the present disclosure provides a composition according to composition 296 or 297, wherein the genetically modified cell comprises a nucleotide sequence encoding CD39 and a nucleotide sequence encoding PD-L-1 inserted within or near the B2M gene.

In another composition, composition 313, the present disclosure provides a composition according to composition 312, wherein the nucleotide sequence encoding CD39 and the nucleotide sequence encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 314, the present disclosure provides a composition according to composition 312 or 313, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding ribosome-skip.

In another composition, composition 315, the present disclosure provides a composition according to composition 314, wherein the ribosome jump is a 2A sequence family member.

In another composition, composition 316, the present disclosure provides a composition comprising a nucleotide sequence encoding PD-L-1 inserted in or near a B2M gene, a nucleotide sequence encoding HLA-E inserted in or near a TXNIP gene, and/or a nucleotide sequence encoding CD39 inserted in or near a CIITA gene or B2M gene, wherein the genetically modified cell expresses PD-L-1, HLA-E, and/or CD39 and has disrupted expression of B2M, TXNIP and/or CIITA.

In another composition, composition 317, the present disclosure provides a composition according to composition 316, wherein disrupted expression of B2M, TXNIP and/or CIITA includes reduced or eliminated expression of B2M, TXNIP and/or CIITA.

In another composition, composition 318, the present disclosure provides a composition according to any one of compositions 294 to 317, wherein the cells are stem cells.

In another composition, composition 319, the present disclosure provides a composition according to composition 318, wherein the stem cells are embryonic stem cells, adult stem cells, induced pluripotent stem cells, or hematopoietic stem cells.

In another composition, composition 320, the present disclosure provides a composition according to any one of compositions 294 to 319, wherein the cell is a differentiated cell or a somatic cell.

In another composition, composition 321, the present disclosure provides a composition according to composition 320, wherein the cells differentiate into lineage restricted progenitor cells or fully differentiated somatic cells.

In another composition, composition 322, the present disclosure provides a composition according to composition 321, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or pancreatic endocrine cells, and the fully differentiated somatic cells are immature beta cells or mature beta cells.

In another composition, composition 323, the present disclosure provides a composition comprising more than one genetically modified cell according to any one of claims 294 to 322.

In another composition, composition 324, the present disclosure provides a composition according to composition 323, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, and/or CD39.

In another composition, composition 325, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one genetically modified cell of composition 323 or 324.

In another composition, composition 326, the present disclosure provides a composition according to composition 325, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or pancreatic endocrine cells, and the fully differentiated somatic cells are immature beta cells or mature beta cells.

In another composition, composition 327, the present disclosure provides a composition according to composition 325 or 326, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, and/or CD39.

In another composition, composition 328, the present disclosure provides a composition comprising more than one cell of composition 323 or 324 or a cell population of any of compositions 325 to 327.

In another composition, composition 329, the present disclosure provides a composition according to composition 328, further comprising at least one pharmaceutically acceptable excipient.

In another composition, composition 330, the present disclosure provides a composition according to composition 328 or 329 for use in treating a subject in need thereof.

In another composition, composition 331, the present disclosure provides a composition according to composition 330, wherein the subject has or is at risk of having a disease or disorder.

In another composition, composition 332, the present disclosure provides a composition according to composition 330 or 331, wherein the disease or disorder is a genetically heritable disease, such as type I diabetes.

In another composition, composition 333, the present disclosure provides a composition according to composition 332, wherein the disease or disorder is type II diabetes or pancreatectomy.

In another composition, composition 334, the present disclosure provides a composition according to any one of compositions 328 to 333, wherein the subject is a human.

In another method, method 335, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, the method comprising: (a) The more than one genetically modified cell of any one of claims 294 to 322 after differentiation into a pancreatic endoderm cell, a pancreatic endocrine cell, an immature beta cell, or a mature beta cell has been obtained or has been obtained; and (b) administering to the subject pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells.

In another method, method 336, the present disclosure provides the method provided in method 335, wherein administering comprises implanting a device comprising pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells into the subject.

In another method, method 337, the present disclosure provides the method provided in method 335 or 336, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 338, the present disclosure provides the method provided by any one of methods 335 to 337, wherein the subject is a human.

In another method, method 339, the present disclosure provides an in vitro method for producing universal donor cells comprising delivering to stem cells: (a) A Ribonucleoprotein (RNP) complex comprising an RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus; (b) a vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 15 and having sequence homology to a genomic region located to the left of the target site in the B2M locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 22 and having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3 and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and gene disruption.

In another method, method 340, the present disclosure provides the in vitro method provided in method 339, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding ribosome skip, and the nucleotide sequence encoding ribosome skip is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 341, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) An RNP complex comprising an RNA-guided nuclease and a gRNA targeting a target site in a thioredoxin interaction protein (TXNIP) locus; and (b) a vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 42 and having sequence homology to a genomic region located to the left of the target site in the TXNIP locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO 44 and having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is disrupted at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene and producing a universal donor cell, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and gene disruption.

In another method, method 342, the present disclosure provides the in vitro method provided in method 341, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 343, the present disclosure provides the in vitro method provided in method 341 or 342, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding ribosome skip linked to a nucleotide sequence encoding HLA-E.

In another method, method 344, the present disclosure provides the in vitro method provided in method 340 or 343, wherein the ribosome jump of (b) (i) is a 2A sequence family member.

In another method, method 345, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) An RNP complex comprising an RNA-guided nuclease and a gRNA targeting a target site in a class II transactivator (CIITA) locus; and (b) a vector comprising a nucleic acid comprising: (i) a nucleotide sequence encoding cluster of differentiation 39 (CD 39); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 26 and having sequence homology to a genomic region located to the left of the target site in the CIITA locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 28 and having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein (i) is flanked by (ii) and (iii); wherein the CIITA locus is cleaved at the target site and a nucleic acid comprising a nucleotide sequence encoding CD39 is inserted into the CIITA locus thereby disrupting the CIITA gene and producing a universal donor cell, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without the nucleic acid insertion and gene disruption.

In another method, method 346, the present disclosure provides the in vitro method provided by any one of methods 339 to 345, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 347, the present disclosure provides the in vitro method provided in method 346, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 348, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) A first Ribonucleoprotein (RNP) complex comprising an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a beta-2 microglobulin (B2M) locus; (b) a first vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 15 and having sequence homology to a genomic region located to the left of the target site in the B2M locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 22 and having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3 and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; (c) A second RNP complex comprising an RNA-guided nuclease and a gRNA targeting a target site in a thioredoxin interaction protein (TXNIP) locus; and (d) a second vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 42 and having sequence homology to a genomic region located to the left of the target site in the TXNIP locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO 44 and having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene and producing a universal donor cell, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without the nucleic acid insertion and gene disruption.

In another method, method 349, the present disclosure provides an in vitro method provided in method 348, further comprising delivering to the stem cell: (e) A third RNP complex comprising an RNA-guided nuclease and a gRNA targeting a target site in a class II transactivator (CIITA) locus; and (f) a third vector comprising a nucleic acid comprising: (i) a nucleotide sequence encoding cluster of differentiation 39 (CD 39); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 26 and having sequence homology to a genomic region located to the left of the target site in the CIITA locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 28 and having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein (i) is flanked by (ii) and (iii); wherein the CIITA locus is cleaved at the target site and a nucleic acid comprising a nucleotide sequence encoding CD39 is inserted into the CIITA locus, thereby disrupting the CIITA gene.

In another method, method 350, the present disclosure provides the in vitro method provided in methods 294 to 349, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 351, the present disclosure provides the in vitro method provided by any one of methods 294 to 350, wherein the nucleotide sequence of (b) (i) comprises a sequence encoding TNFAIP3, the sequence encoding TNFAIP3 is linked to a sequence encoding a ribosome jump, the sequence encoding a ribosome jump is linked to a sequence encoding PD-L-1; and (d) (i) the nucleotide sequence comprises a sequence encoding MANF linked to a sequence encoding ribosome jump linked to a sequence encoding HLA-E.

In another method, method 352, the present disclosure provides the in vitro method provided in method 351, wherein the ribosome jump of each of (b) (i) and (d) (i) is a 2A sequence family member.

In another method, method 353, the disclosure provides the in vitro method provided by any one of methods 294-352, wherein the nucleotide sequence of each of (b) (i), (d) (i), and (f) (i) is operably linked to an exogenous promoter.

In another method, method 354, the present disclosure provides the in vitro method provided in method 353, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 355, the present disclosure provides an in vitro method for producing universal donor cells, the method comprising delivering to a stem cell: (a) A first Ribonucleoprotein (RNP) complex comprising an RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a beta-2 microglobulin (B2M) locus; (b) a first vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a nucleotide sequence encoding MANF and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 15 and having sequence homology to a genomic region located to the left of the target site in the B2M locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 22 and having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3, MANF and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; and producing a universal donor cell, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without the nucleic acid insertion and gene disruption.

In another method, method 356, the present disclosure provides the in vitro method provided in method 355, further comprising delivering to the stem cells: (c) A second RNP complex comprising an RNA-guided nuclease and a gRNA targeting a target site in a class II transactivator (CIITA) locus; and (d) a second vector comprising a nucleic acid comprising: (i) a nucleotide sequence encoding cluster of differentiation 39 (CD 39); (ii) A nucleotide sequence consisting essentially of SEQ ID NO. 26 and having sequence homology to a genomic region located to the left of the target site in the CIITA locus; and (iii) a nucleotide sequence consisting essentially of SEQ ID NO. 28 and having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein (i) is flanked by (ii) and (iii); wherein the CIITA locus is cleaved at the target site and a nucleic acid comprising a nucleotide sequence encoding CD39 is inserted into the CIITA locus, thereby disrupting the CIITA gene.

In another method, method 357, the disclosure provides the in vitro method provided in method 355 or 356, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding TNFAIP3 and a nucleotide sequence encoding MANF, the nucleotide sequence encoding TNFAIP3 being linked to the nucleotide sequence encoding MANF by a nucleotide sequence encoding ribosome skip, the nucleotide sequence encoding MANF being linked to the nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding ribosome skip.

In another method, method 358, the present disclosure provides the in vitro method provided in method 357, wherein the ribosome jump is a 2A sequence family member.

In another method, method 359, the present disclosure provides the in vitro method provided by any one of methods 357 to 358, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 360, the present disclosure provides the in vitro method provided by any one of methods 356 to 359, wherein the nucleotide sequence of (d) (i) is operably linked to an exogenous promoter.

In another method, method 361, the present disclosure provides the in vitro method provided in method 359 or 360, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG, or UBC promoter.

In another method, method 362, the present disclosure provides the in vitro method provided by any one of methods 339 to 361, wherein each RNP complex comprises a molar ratio of RNA-guided nuclease to gRNA of about 1:1 to about 1:10.

In another method, method 363, the present disclosure provides the in vitro method provided by any one of methods 339 to 362, wherein the RNA-guided nuclease of each RNP complex is a Cas9 nuclease.

In another method, method 364, the present disclosure provides the in vitro method provided in method 363, wherein the Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 365, the present disclosure provides the in vitro method provided by any one of methods 339 to 362, wherein the stem cells are embryonic stem cells, adult stem cells, induced pluripotent stem cells, or hematopoietic stem cells.

In another method, method 366, the present disclosure provides the in vitro method provided by any one of methods 339 to 365, wherein the stem cells are human stem cells.

In another composition, composition 367, the present disclosure provides a composition comprising more than one universal donor cell produced by any of methods 339 to 366.

In another composition, composition 368, the present disclosure provides a composition according to composition 367, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, and/or CD39.

In another composition, composition 369, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one universal donor cell of composition 367 or 368.

In another composition, composition 370, the present disclosure provides a composition according to composition 369, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine cells, immature beta cells, or mature beta cells, and the fully differentiated somatic cells are pancreatic beta cells.

In another composition, composition 371, the present disclosure provides compositions according to compositions 369-370, wherein at least about 50% of the cells express MANF, HLA-E, TNFAIP3, PD-L-1, and/or CD39.

In another composition, composition 372, the present disclosure provides a composition comprising more than one cell of any one of compositions 367 or 368 or a cell population of any one of compositions 369 to 371.

In another composition, composition 373, the present disclosure provides a composition according to composition 372, further comprising at least one pharmaceutically acceptable excipient.

In another composition, composition 374, the present disclosure provides compositions according to compositions 372 to 373 for use in treating a subject in need thereof.

In another composition, composition 375, the present disclosure provides a composition according to composition claim 374, wherein the subject has, is suspected of having, or is at risk of a disease or disorder.

In another composition, composition 376, the present disclosure provides a composition according to composition 375, wherein the disease or disorder is a genetically heritable disease, such as type I diabetes.

In another composition, composition 377, the present disclosure provides a composition according to composition 375, wherein the disease or disorder is type II diabetes or pancreatectomy.

In another composition, composition 378, the present disclosure provides compositions according to compositions 374-377, wherein the subject is a human.

In another method, method 379, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, the method comprising: (c) Obtaining or having obtained more than one universal donor cell of claim 367 or 368 after differentiation into pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells or mature beta cells; and (d) administering to the subject pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells.

In another method, method 380, the present disclosure provides the method provided in method 379, wherein administering comprises implanting a device comprising pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, or mature beta cells into the subject.

In another method, method 381, the present disclosure provides the methods provided in methods 379 to 380, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 382, the present disclosure provides the method provided by any one of methods 379 to 381, wherein the subject is a human.

In another composition, composition 383, the present disclosure provides the composition provided in any one of compositions 294 to 296, wherein the genetically modified cell comprises a nucleotide sequence encoding CD39 and a nucleotide sequence encoding PD-L-1 inserted within or near the B2M gene.

In another composition, composition 384, the present disclosure provides a composition according to composition 383, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding a 2A sequence family member.

In another composition, composition 385, the present disclosure provides a composition according to composition 383 or 384, wherein the nucleotide sequence encoding CD39 and the nucleotide sequence encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 386, the present disclosure provides the composition provided in any one of compositions 294-296, wherein the genetically modified cell comprises a nucleotide sequence encoding CD39, a nucleotide sequence encoding CD73, and a nucleotide sequence encoding PD-L-1 inserted within or near the B2M gene.

In another composition, composition 387, the present disclosure provides a composition according to composition 386, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding CD73 by a nucleotide sequence encoding a 2A sequence family member and the nucleotide sequence encoding CD73 is linked to the nucleotide sequence encoding PD-L-1 by a nucleotide sequence encoding a 2A sequence family member.

In another composition, composition 388, the present disclosure provides a composition according to either composition 386 or 387, wherein the nucleotide sequence encoding CD39, the nucleotide sequence encoding CD73, and the nucleotide sequence encoding PD-L-1 are operably linked to an exogenous promoter.

In another composition, composition 389, the disclosure provides a composition comprising a genetically modified cell comprising (a) a first polynucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a second polynucleotide encoding an HLA class I histocompatibility antigen alpha chain E (HLA-E) inserted within or near a gene encoding a thioredoxin interacting protein (TXNIP), and (B) a third polynucleotide sequence encoding a tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a fourth polynucleotide encoding a programmed death ligand 1 (PD-L-1) inserted within or near a gene encoding a beta-2-microglobulin (B2M), wherein the genetically modified cell expresses MANF, HLA-E, TNFAIP3 and PD-LL and has disrupted expression of TXNIP and B2M.

In another method, method 390, the present disclosure provides an in vitro method for preparing a universal donor cell, the method comprising delivering to a stem cell: (a) A first RNA-guided nuclease and a first guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus; (b) a first vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) and a nucleotide sequence encoding programmed death ligand 1 (PD-L-1); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in the B2M locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein (i) is flanked by (ii) and (iii); wherein the B2M locus is cleaved at the target site and a nucleic acid comprising nucleotide sequences encoding TNFAIP3 and PD-L-1 is inserted into the B2M locus, thereby disrupting the B2M gene; wherein the universal donor cell expresses TNFAIP3 and PD-L-1 and has increased immune evasion and/or survival after transplantation as compared to a comparable cell without nucleic acid insertion and gene disruption.

In another method, method 391, the present disclosure provides an in vitro method according to method 390, wherein disrupting the B2M gene comprises reducing or eliminating expression of B2M.

In another method, method 392, the present disclosure provides an in vitro method according to method 390 or 391, wherein the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding P2A, and the nucleotide sequence encoding P2A is linked to a nucleotide sequence encoding PD-L-1.

In another method, method 393, the present disclosure provides an in vitro method according to any of methods 390 to 392, wherein the nucleotide sequence of (b) (i) comprises SEQ ID No. 54.

In another method, method 394, the present disclosure provides an in vitro method according to any one of methods 390 to 393, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 395, the present disclosure provides an in vitro method according to any one of methods 390 to 394, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 396, the present disclosure provides an in vitro method according to any one of methods 390 to 395, wherein the nucleotide sequence of (b) (ii) comprises or consists essentially of SEQ ID No. 15.

In another method, method 397, the present disclosure provides an in vitro method according to any one of methods 390 to 396, wherein the nucleotide sequence of (b) (iii) comprises or consists essentially of SEQ ID No. 22.

In another method, method 398, the present disclosure provides an in vitro method according to any of methods 390 to 397, wherein the first RNA-guided nuclease and the first gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 399, the present disclosure provides an in vitro method according to any one of methods 390 to 398, wherein the first RNA-guided nuclease is a first Cas9 nuclease.

In another method, method 400, the present disclosure provides an in vitro method according to method 399, wherein the first Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 401, the present disclosure provides an in vitro method according to any one of methods 390 to 400, the in vitro method further comprising delivering to a stem cell: (c) A second RNA-guided nuclease and a second gRNA targeting a target site in a thioredoxin interaction protein (TXNIP) locus; and (d) a second vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in a TXNIP locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is disrupted at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene; wherein the universal donor cell also expresses MANF and HLA-E.

In another method, method 402, the present disclosure provides an in vitro method according to method 401, wherein disrupting the TXNIP gene comprises reducing or eliminating expression of the TXNIP.

In another method, method 403, the present disclosure provides an in vitro method according to method 401 or 402, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 404, the present disclosure provides the in vitro method according to any one of methods 401 to 403, wherein the nucleotide sequence of (d) (i) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding P2A, and the nucleotide sequence encoding P2A is linked to a nucleotide sequence encoding HLA-E.

In another method, method 405, the present disclosure provides an in vitro method according to any one of methods 401 to 404, wherein the nucleotide sequence of (d) (i) comprises SEQ ID No. 55.

In another method, method 406, the present disclosure provides an in vitro method according to any one of methods 401 to 405, wherein the nucleotide sequence of (d) (i) is operably linked to an exogenous promoter.

In another method, method 407, the present disclosure provides an in vitro method according to method 406, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 408, the present disclosure provides an in vitro method according to any one of methods 401 to 407, wherein the nucleotide sequence of (d) (ii) consists essentially of SEQ ID No. 42.

In another method, method 409, the present disclosure provides an in vitro method according to any one of methods 401 to 408, wherein the nucleotide sequence of (d) (iii) consists essentially of SEQ ID NO: 44.

In another method, method 410, the present disclosure provides an in vitro method according to any one of methods 401 to 409, wherein the second RNA-guided nuclease and the second gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 411, the present disclosure provides an in vitro method according to any one of methods 401 to 410, wherein the second RNA-guided nuclease is a second Cas9 nuclease.

In another method, method 412, the present disclosure provides an in vitro method according to method 411, wherein the second Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 413, the present disclosure provides an in vitro method according to any one of methods 401 to 412, further comprising delivering to the stem cells: (e) A third RNA-guided nuclease and a third gRNA targeting a target site in a class II transactivator (CIITA) locus; and (f) a second vector comprising a nucleic acid comprising: (i) a nucleotide sequence encoding CD 39; (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in the CIITA locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is cleaved at the target site and a nucleic acid comprising a nucleotide sequence encoding CD39 is inserted into the CIITA locus, thereby disrupting the CIITA gene; wherein the universal donor cell also expresses CD39.

In another method, method 414, the present disclosure provides an in vitro method according to method 413, wherein the nucleotide sequence of (e) (i) comprises SEQ ID No. 27.

In another method, method 415, the present disclosure provides an in vitro method according to method 413 or 414, wherein the nucleotide sequence of (f) (i) is operably linked to an exogenous promoter.

In another method, method 416, the present disclosure provides an in vitro method according to method 415, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 417, the present disclosure provides an in vitro method according to any of methods 413 to 416, wherein the nucleotide sequence of (f) (ii) consists essentially of SEQ ID No. 26.

In another method, method 418, the present disclosure provides an in vitro method according to any one of methods 413 to 417, wherein the nucleotide sequence of (f) (iii) consists essentially of SEQ ID No. 28.

In another method, method 419, the present disclosure provides an in vitro method according to any one of methods 413 to 418, wherein the third RNA guided nuclease and the third gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 420, the present disclosure provides the in vitro method according to any one of methods 413 to 419, wherein the third RNA-guided nuclease is a third Cas9 nuclease.

In another method, method 421, the present disclosure provides an in vitro method according to method 420, wherein the third Cas9 nuclease is linked to at least one nuclear localization signal.

In another method, method 422, the present disclosure provides an in vitro method according to any one of methods 390 to 421, the in vitro method further comprising delivering to the stem cells: (g) A fourth RNA-guided nuclease and a fourth gRNA targeting a target site in a tgfβ locus, thereby disrupting the tgfβ gene.

In another method, method 423, the present disclosure provides an in vitro method according to method 422, wherein the fourth gRNA targets a nucleotide sequence consisting essentially of SEQ ID No. 57.

In another method, method 424, the present disclosure provides an in vitro method according to any one of methods 390 to 423, wherein the stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

In another method, method 425, the present disclosure provides an in vitro method according to any one of methods 390 to 424, wherein the stem cells are human stem cells.

In another composition, composition 426, the present disclosure provides a composition comprising a genetically modified cell comprising: (a) A first insertion of a disrupted B2M gene and a first polynucleotide encoding a midbrain astrocyte-derived neurotrophic factor (MANF) in the disrupted B2M gene; (b) A second insertion of the disrupted TXNIP gene and a second polynucleotide encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3) into the disrupted TXNIP gene; (c) A third insertion of a disrupted CIITA gene and a third polynucleotide encoding CD39, wherein the cell expresses MANF, TNFAIP3 and CD39 and has disrupted expression of B2M, TXNIP and CIITA.

In another composition, composition 427, the present disclosure also provides a composition according to composition 426, wherein the third polynucleotide comprises a nucleotide sequence consisting essentially of SEQ ID No. 27.

In another composition, composition 428, the present disclosure provides a composition according to any one of compositions 426 to 427, wherein disrupted expression of B2M, TXNIP and/or CIITA includes reduced or eliminated expression of B2M protein, TXNIP protein, and/or CIITA protein.

In another composition, composition 429, the present disclosure also provides a composition according to any one of compositions 426-428, wherein the genetically modified cell further comprises (d) a disrupted tgfβ gene, and wherein the cell has disrupted expression of a tgfβ protein.

In another composition, composition 430, the present disclosure provides a composition according to composition 429, wherein disrupted expression of a tgfβ protein includes reduced or eliminated expression of the tgfβ protein.

In another composition, composition 431, the present disclosure provides a composition according to any of compositions 426 to 430, wherein the universal donor cell has increased immune evasion and/or survival after transplantation as compared to a comparable cell without polynucleotide insertion and gene disruption.

In another composition, composition 432, the present disclosure provides a composition according to any one of compositions 426 to 431, wherein the cell is a stem cell.

In another composition, composition 433, the present disclosure provides a composition according to composition 432, wherein the stem cells are embryonic stem cells, adult stem cells, induced pluripotent stem cells, or hematopoietic stem cells.

In another composition, composition 434, the present disclosure provides a composition according to any one of compositions 426 to 431, wherein the cell is a differentiated cell or a somatic cell.

In another composition, composition 435, the present disclosure provides a composition according to composition 434, wherein the cells differentiate into lineage restricted progenitor cells or fully differentiated somatic cells.

In another composition, composition 436, the present disclosure provides a composition according to composition 435, wherein the lineage restricted progenitor cells are definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm progenitor cells, pancreatic endocrine progenitor cells, or immature beta cells, and the fully differentiated somatic cells are beta cells.

In another composition, composition 437, the present disclosure provides a composition comprising more than one genetically modified cell according to any one of compositions 1 to 436.

In another composition, composition 438, the present disclosure provides a composition comprising a population of lineage restricted progenitor cells or fully differentiated somatic cells derived from more than one genetically modified cell of composition 437.

In another composition, composition 439, the present disclosure provides a composition according to composition 438, wherein the population comprises definitive endoderm cells, primordial gut tube cells, posterior foregut cells, pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells.

In another composition, composition 440, the present disclosure provides a composition comprising more than one cell of composition 437 or a cell population of composition 438 or 439 and at least one pharmaceutically acceptable excipient.

In another method, method 441, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, the method comprising: (a) Obtaining or having obtained the population of lineage restricted progenitor cells or fully differentiated somatic cells of claim 438, wherein the lineage restricted progenitor cells or fully differentiated somatic cells comprise pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells; and (b) administering pancreatic endoderm cells, pancreatic endocrine cells, immature beta cells, and/or beta cells to the subject.

In another method, method 442, the present disclosure provides a method for treating a pancreatic disease or disorder in a subject in need thereof, the method comprising (a) obtaining or having obtained more than one genetically modified cell of claim 436, wherein the more than one genetically modified cell comprises a stem cell; (b) Differentiating the genetically modified cells into pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells and/or pancreatic beta cells; and (c) administering pancreatic endoderm cells, pancreatic endocrine precursor cells, immature beta cells, and/or pancreatic beta cells to the subject.

In another method, method 443, the present disclosure provides the method provided in method 441 or 442, wherein the pancreatic disease or disorder is type I diabetes, type II diabetes, or pancreatectomy.

In another method, method 444, the present disclosure provides an in vitro method for preparing universal donor cells, the method comprising delivering to a stem cell: (a) RNA-guided nucleases and grnas targeting a target site in the thioredoxin interaction protein (TXNIP) locus; and (b) a vector comprising a nucleic acid comprising: (i) A nucleotide sequence encoding a midbrain astrocyte-derived neurotrophic factor (MANF) and a nucleotide sequence encoding HLA class I histocompatibility antigen alpha chain E (HLA-E); (ii) A nucleotide sequence having sequence homology to a genomic region located to the left of a target site in a TXNIP locus; and (iii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein (i) is flanked by (ii) and (iii); wherein the TXNIP locus is disrupted at the target site and a nucleic acid comprising nucleotide sequences encoding MANF and HLA-E is inserted into the TXNIP locus, thereby disrupting the TXNIP gene; wherein the universal donor cell expresses MANF and HLA-E.

In another method, method 445, the present disclosure provides an in vitro method according to method 444, wherein disrupting the TXNIP gene comprises reducing or eliminating expression of TXNIP.

In another method, method 446, the present disclosure provides an in vitro method according to method 444 or 445, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

In another method, method 447, the disclosure provides an in vitro method according to any of methods 444 to 446 in which the nucleotide sequence of (b) (i) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding P2A and the nucleotide sequence encoding P2A linked to a nucleotide sequence encoding HLA-E.

In another method, method 448, the present disclosure provides an in vitro method according to any one of methods 444 to 447, wherein the nucleotide sequence of (b) (i) comprises SEQ ID No. 55.

In another method, method 449, the disclosure provides an in vitro method according to any one of methods 444 to 448, wherein the nucleotide sequence of (b) (i) is operably linked to an exogenous promoter.

In another method, method 450, the present disclosure provides an in vitro method according to method 449, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

In another method, method 451, the present disclosure provides an in vitro method according to any one of methods 444 to 450, wherein the nucleotide sequence of (b) (ii) consists essentially of SEQ ID NO: 42.

In another method, method 452, the present disclosure provides an in vitro method according to any one of methods 444 to 451, wherein the nucleotide sequence of (b) (iii) consists essentially of SEQ ID NO: 44.

In another method, method 453, the present disclosure provides an in vitro method according to any one of methods 444 to 452, wherein the RNA-guided nuclease and gRNA are present in a ratio of about 1:1 to about 1:10.

In another method, method 454, the disclosure provides an in vitro method according to any one of methods 444 to 453, wherein the RNA-guided nuclease is a Cas9 nuclease.

In another method, method 455, the present disclosure provides an in vitro method according to method 454, wherein the Cas9 nuclease is linked to at least one nuclear localization signal.

Examples

The following examples describe the generation and characterization of specific universal donor cells according to the present disclosure.

Example 1: cell maintenance and expansion

Maintenance of hESC/hiPSC. Human embryonic stem cells (hescs) and human induced pluripotent stem cells (hipscs) were maintained on StemFlex Complete (Life Technologies, a 3349401) on BIOLAMININ 521CTG (BioLamina cat#ct 521) or on laminin 511 coated tissue culture plates. Cells were fed daily with StemFlex medium. To plate cells as single cells, cells were used in StemFlex at 1% RevitaCell ^TM Supplement (100X) (ThermoFisher Cat#A 2644501) was plated on BIOLAMININ or laminin 511 coated plates. For passaging, 1% of REVITACELL was added ^TM Supplement (100X).

Single cell cloning of hpscs. For single cell clones, stemFlex Complete (Life Technologies, A3349401) and 1% Revitacell were used ^TM Supplement (100X) (ThermoFisher Cat#A 2644501) was fed with hPSC (hESC or hiPSC). In useAfter dissociation, the cells were sorted into single cells in each well of the pre-coated plate. Use of 96-well plates inBIOLAMININ 521CTG (BioLamina Cat#CT521) diluted 1:10 or 1:20 in DPBS, calcium, magnesium (Life Technologies, 14040133) was pre-coated for 2 hours at 37 ℃. WOTF FACS-sorter (Nanocellect) was used to sort single cells into wells. Plates were prefilled with 100-200. Mu.L of RevitaCell ^TM And 4. Mu.L/mL of StemFlex Complete of recombinant laminin iMatrix-511 E8 (AMSBIO, AMS.892 011). 3 days after cell inoculation, cells were fed with fresh StemFlex and continued to be fed every other day with 100-200. Mu.L of medium. After 10 days of culture, cells were fed daily with StemFlex until day 12-14. At this time, use +.>The plates were dissociated and the collected cell suspensions were 1:2 separated, half into a new 96-well plate for maintenance, and the other half into the DNA extraction solution QuickExtract ^TM DNA extraction solution (Lucigen). Following DNA extraction, PCR is performed to assess the presence or absence of the desired gene edits at the targeted DNA locus. The required edits were verified using Sanger sequencing.

Amplification of single cell derived hPSC clones. For hescs, successfully targeted clones were passaged from 96-well plates to 24-well plates using StemFlex and BIOLAMININ 521 or recombinant laminin iMatrix-511 E8. After expansion in 24-well plates, cells were passaged onto 6-well plates and the transition to KSR A10H10 medium was started the following day after plating in StemFlex. On the first day after plating, cells were fed with a 50:50 KSR A10H10 and StemFlex mixture. The following day, cells were fed with 100% ksr a10h 10. After 2 days in 100% KSR A10H10, cells can be passaged using 10% XF in KSR A10H 10. If the cells did not experience 100% KSR A10H10 for 2 days, the cells received BIOLAMININ 521 or recombinant laminin iMatrix-511 E8 for attachment and survival, followed by additional culture in KSR A10H10 and complete transition to culture with laminin. After complete transition to KSR A10H10, hESC clones were passaged as described by Schulz et al (2012) PLoS ONE 7 (5): e 37004.

For hipscs, cells were maintained in StemFlex Complete on BIOLAMININ coated plates throughout cloning and routine maintenance, cells at passage stageIs maintained at the RevitaCell ^TM Is a kind of medium.

Example 2: human pluripotent stem cells producing B2M Knockouts (KO) and MANF-P2A-TNFAIP3-P2A-PD-L-1 Knockins (KI)

This example describes the generation and characterization of specific universal donor cells with additional edits to improve survival (MANF) and immune evasion (TNFAIP 3, also known as a 20) according to the present disclosure. A transgene encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 was generated and inserted into the B2M locus to knock out the B2M gene.

The B2M targeting gRNA is designed to target exon 1 of the B2M coding sequence. These grnas have a predicted low off-target score based on sequence homology predictions using gRNA design software. The target sequence of the gRNA is shown in Table 2. The gRNA comprises an RNA sequence corresponding to a target DNA sequence.

TABLE 2B 2M gRNA target sequences

Name of the name	Target sequence (5 '-3')	SEQ ID NO:	PAM
				B2M-1 gRNA (exon 1_T12)	GCTACTCTCTCTTTCTGGCC	1	TGG
B2M-2 gRNA (exon 1_T2)	GGCCGAGATGTCTCGCTCCG	2	TGG
				B2M-3 gRNA (exon 1_T8)	CGCGAGCACAGCTAAGGCCA	3	CGG
Exon 1_t1	TATAAGTGGAGGCGTCGCGC	4	TGG
				Exon 1_t3	GAGTAGCGCGAGCACAGCTA	5	AGG
Exon 1_t4	ACTGGACGCGTCGCGCTGGC	6	GGG
				Exon 1_t5	AAGTGGAGGCGTCGCGCTGG	7	CGG
Exon 1_t6	GGCCACGGAGCGAGACATCT	8	CGG
				Exon 1_t7	GCCCGAATGCTGTCAGCTTC	9	AGG
Exon 1_t9	CTCGCGCTACTCTCTCTTTC	10	TGG
				Exon 1_t10	TCCTGAAGCTGACAGCATTC	11	GGG
Exon 1_t11	TTCCTGAAGCTGACAGCATT	12	CGG
				Exon 1_t13	ACTCTCTCTTTCTGGCCTGG	13	AGG

Plasmid design was performed to insert the transgene encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 into the B2M locus such that the start codon of B2M was removed after undergoing Homology Directed Repair (HDR) to insert the transgene, eliminating any opportunity for partial B2M expression. Successful HDR resulted in the insertion of three genes, MANF, TNFAIP3, and PD-L-1 (CD 274) into the genome. These three coding sequences are linked by a P2A peptide coding sequence to allow expression of three separate proteins from a single transcript. The coding sequence of MANF-P2A-TNFAIP3-P2A-PD-L-1 comprises the nucleotide sequence of SEQ ID NO. 52. FIG. 1 shows a schematic representation of a B2M-CAGGS-MANF-P2A-TNFAIP3-P2A-PD-L-1 donor plasmid, and Table 3 identifies elements and positions therein. The donor plasmid contained the cDNA of MANF-P2A-TNFAIP3-P2A-PD-L-1 driven by the CAGGS promoter (i.e., including the CMV enhancer, chicken beta-actin promoter, and chimeric intron), flanked by 800 base pair homology arms, which have the same sequence as the B2M locus surrounding exon 1. The complete sequence of the plasmid comprises the nucleotide sequence of SEQ ID NO. 24.

TABLE 3 elements of B2M-CAGGS-MANF-P2A-TNFAIP3-P2A-PD-L-1 donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-B2M	145-944(800)	15
			CAGGS promoter	973-2639(1667)	16
MANF	2684-3229(546)	17
			P2A	3239-3295(57)	18
TNFAIP3	3296-5665(2370)	19
			P2A	5675-5731(57)	18
PD-L-1	5732-6604(873)	20
			bGH Multi (A) Signal	6622-6846(225)	21
RHA-B2M	6853-7652(800)	22
			Right ITR	7694-7834(141)	23
Complete plasmid	10,181bp	24

Human ESCs were electroporated with 4. Mu.g plasmid DNA per million hESCs using a Neon electroporation apparatus (Neon transfection System ThermoFisher Cat#MPK5000) with a Ribonucleoprotein (RNP) mixture of Cas9 protein and B2M-2gRNA (SEQ ID NO: 2). To form the RNP complex, gRNA and Cas9 were combined with R-buffer (Neon transfection system 100 μl kit ThermoFisher cat#mpk10096) in one vessel to a total volume of 25-50 μl and incubated at RT for 15 min. UsingCells were dissociated and then resuspended in DMEM/F12 medium (Gibco, cat# 11320033), counted using NC-200 (chememetec) and centrifuged. Resuspension with plasmid, RNP complex and R-buffer for a total of 1X10 ⁶ Individual cells. The mixture was then electroporated. After electroporation, cells were pipetted to be filled with cells with RevitaCell ^TM Eppendorf tubes or 6-well plate in StemFlex medium. The cell suspension was then spread in a pre-coated tissue culture dish. Cells were incubated in a normoxic incubator (37 ℃,8% CO) ₂ ) Is cultured.

7 to 10 days after electroporation, anti-mouse IgG Dynabeads (ThermoFisher, CELLection) ^TM Pan mouse IgG kit, 11531D) the cells expressing PD-L-1 were enriched for cells by Magnetic Assisted Cell Sorting (MACS). These enriched cells (L1V 008 cell line) represent a large KI population that is highly positive for PD-L-1. The enriched cells were then FACS sorted to PD-L-1 surface using a WOL FACS-sorter (nanocell) with StemFlex and RevitaCell ^TM Is coated in a BIOLAMININ 521CTG 96-well plate. To detect PD-L-1 surface expression, anti-PD-L-1 fluorescent antibodies were used (see Table 4). For FACS sorting, unedited cells were used as negative control. PD-L-1 positive cells were selected for sorting and single cell cloning.

TABLE 4 antibodies for flow cytometry

Antigens	Cloning	Fluorophores	Manufacturer (S)	Catalog #
					B2M	2M2	PE	Biolegend	316305
HLA-ABC	W6/32	Alexa 488	Biolegend	311415
					mIgG1κ	N/A	PE	BD Bioscience	555749
PD-L-1	B7-H1	Alexa-488	ThermoFisher	53-5983-42
					HLA-E	3D12	PE	ThermoFisher	12-9953-42

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. Using the sequence from insertion into the B2M locusPrimers amplified outside the plasmid homology arms of the sites allowed amplification of only KI-integrated DNA, identifying correctly targeted clones by PCR on MANF-TNFAIP3-PD-L-1KI insertion. The status of cloned B2M KO was confirmed by PCR and Sanger sequencing. The correct KI and KO clones were expanded in incremental tissue culture until a population size of 3000 ten thousand cells was reached.

Example 3: human pluripotent stem cells producing B2M KO and MANF-P2A-TNFAIP3-P2A-PD-L-1KI, CIITA KO and CD39KI

Cells in which the transgene encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 was inserted into the B2M locus and the transgene encoding CD39 was inserted into the CIITA locus, thereby knocking out the B2M and CIITA genes, were generated.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-MANF-P2A-TNFAIP3-P2A-PD-L-1 donor plasmid (SEQ ID NO:24, table 3) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above. Cells expressing PD-L-1 (positive) will be enriched by MACS using Miltenyi reagent or ThermoFisher reagent 7 to 10 days after electroporation. After amplification of the enriched PD-L-1 positive population, cells are electroporated with the CIITA-CAGGS-CD39 donor plasmid as detailed in table 5 below, and RNP comprising Cas9 and a gRNA for exon 3 of CIITA, e.g., CIITA Ex 3T 6 gRNA (target sequence 5'-GGTCCATCTGGTCATAGAAG-3'SEQ ID NO:25;PAM is TGG), substantially as described in example 2 above.

FIG. 2 shows a schematic representation of the CIITA-CAGGS-CD39 donor plasmid, and Table 5 identifies elements and positions therein. The CIITA-CAGGS-CD39 donor plasmid contains the CAGGS promoter (including CMV enhancer, chicken β -actin promoter and chimeric intron) to drive expression of the CD39 cDNA, flanked by 800 base pair homology arms with the same sequence as the CIITA locus around exon 3. The complete sequence of the plasmid comprises the nucleotide sequence of SEQ ID NO. 29.

TABLE 5 elements of CIITA-CAGGS-CD39 donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-CIITA	145-944(800)	26
			CAGGS promoter	973-2639(1667)	16
CD39	2684-4213(1530)	27
			bGH Multi (A) Signal	4240-4464(225)	21
RHA-CIITA	4471-5270(800)	28
			Right ITR	5312-5452(141)	23
Complete plasmid	7799	29

7 to 10 days after electroporation, miltenyi reagent (anti-mouse IgG microbead Cat #130-048-401, LS column Cat #130-042-401 and midi MACS separator Cat # 130-042-302) or ThermoFisher reagent (DynaMag) was used ^TM -15 magnet cat#12301D, CELLection ^TM Pan mouse IgG kit Cat#11531D, dynabeads ^TM Pan mouse IgG cat#11042) enriches cells for PD-L-1 and/or CD39 expressing cells by MACS. After enrichment of PD-L-1 and/or CD39, the enriched cells were FACS-sorted to carry StemFlex and RevitaCell for PD-L-1 and/or CD39 expression using a WOL FACS-sorter (nanocell) ^TM In a BIOLAMININ 521CTG coated 96-well plate, gating was set to PD-L-1 and CD39 biscationic cells. For FACS sorting, unedited cells were used as negative control. Positive cells will be selected for sorting and single cell cloning.

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples will be split for maintenance and genomic DNA extraction. Primers that amplify the region outside the plasmid homology arm at each insertion site will be used to enable amplification of only KI-integrated DNA, identifying the correctly targeted clone by PCR on PD-L-1KI insertion and CD39 KI insertion. Cloned B2M and CIITA KO status will be confirmed by PCR and Sanger sequencing.

Example 4: human pluripotent stem cells producing B2M KO and CD39-P2A-PD-L-1KI

Cells were generated in which the transgene encoding CD39-P2A-PD-L-1 was inserted into the B2M locus, thereby knocking out the B2M gene.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above as detailed in Table 6 below.

FIG. 3 shows a schematic representation of the B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid, and Table 6 identifies elements and positions therein. The B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid contains the CAGGS promoter (including CMV enhancer, chicken beta-actin promoter and chimeric intron) to drive the expression of the cDNA (SEQ ID NO: 53) of CD39-P2A-PD-L-1 flanked by homology arms of 800 base pairs with the same sequence as the B2M locus around exon 1. The complete sequence of the B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid comprises the nucleotide sequence of SEQ ID NO. 30.

TABLE 6 elements of B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-B2M	145-944(800)	15
			CAGGS promoter	973-2639(1667)	16
CD39	2684-4213(1530)	27
			P2A	4223-4279(57)	18
PD-L-1	4280-5152(873)	20
			bGH Multi (A) Signal	5170-5394(225)	21
RHA-B2M	5401-6200(800)	22
			Right ITR	6242-6382(141)	23
Complete plasmid	8729bp	30

7 to 10 days after electroporation, anti-mouse IgG Dynabeads (ThermoFisher, CELLection) ^TM Pan mouse IgG kit, 11531D) the cells expressing PD-L-1 were enriched for cells by Magnetic Assisted Cell Sorting (MACS). These enriched cells represent a large population of KIs that are highly positive for PD-L-1. Enriched cells were then FACS-sorted for PD-L-1 surface expression using a WOTF FACS-sorter (nanocell) to carry StemFlex and RevitaCell ^TM Is coated in a BIOLAMININ 521CTG 96-well plate. To detect PD-L-1 surface expression, anti-PD-L-1 fluorescent antibodies were used (see Table 4). For FACS sorting, unedited cells were used as negative control. PD-L-1 positive cells were selected for sorting and single cell cloning.

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. Primers amplified from outside the homology arm of the plasmid inserted into the site of the B2M locus were used to enable amplification of only KI-integrated DNA, identifying correctly targeted clones by PCR on CD39-PD-L-1KI insertion. The status of cloned B2M KO was confirmed by PCR and Sanger sequencing. The correct KI and KO clones (L1V 017 cell line) were expanded in incremental tissue culture until a population size of 3000 ten thousand cells was reached.

Example 5: human pluripotent stem cells producing B2M KO and MANF-P2A-TNFAIP3-P2A-PD-L-1KI and B2M KO and CD39-P2A-PD-L-1KI

Cells will be generated in which the transgene encoding MANF-P2A-TNFAIP3-P2A-PD-L-1 is inserted into a first target site at the B2M locus and the transgene encoding CD39-P2A-PD-L-1 is inserted into a second target site at another position at the B2M locus, thereby knocking out the B2M gene.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-MANF-P2A-TNFAIP3-P2A-PD-L-1 donor plasmid (SEQ ID NO:24, table 3) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 3) substantially as described in example 2 above. Following enrichment and amplification of PD-L-1, cells were electroporated with a B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid (SEQ ID NO:30, table 6) and RNP comprising Cas9 and a second B2M gRNA selected from SEQ ID NO:1 or 3-13 (see Table 2 above). Cells will be enriched, expanded, selected and characterized as described above.

Example 6: human pluripotent stem cells ("X1" cells) producing B2M KO and TNFAIP3-P2A-PD-L-1KI and TXNIP KO and MANF-P2A-HLA-E KI

Cells were generated in which the transgene encoding TNFAIP3-P2A-PD-L-1 was inserted into the B2M locus and the transgene encoding MANF-P2A-HLA-E was inserted into TXNIP, thereby knocking out the B2M and TXNIP genes.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (see below) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above. FIG. 4 shows a schematic representation of the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (also known as the X1-1 cassette) and Table 7 identifies the elements and positions therein. The B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid contains the CAGGS promoter (including CMV enhancer, chicken beta-actin promoter and chimeric intron) to drive expression of the cDNA of TNFAIP3-P2A-PD-L-1 (SEQ ID NO: 54), flanked by 800 base pair homology arms with the same sequence as the B2M locus around exon 1. The complete sequence of the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid comprises the nucleotide sequence of SEQ ID NO. 31.

TABLE 7 elements of B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-B2M	145-944(800)	15
			CAGGS promoter	973-2639(1667)	16
TNFAIP3	2684-5053(2370)	19
			P2A	5063-5119(57)	18
PD-L-1	5120-5992(873)	20
			bGH Multi (A) Signal	6010-6234(225)	21
RHA-B2M	6241-7040(800)	22
			Right ITR	7082-7222(141)	23
Complete plasmid	9569bp	31

Cells expressing PD-L-1 in cells were enriched by MACS substantially as described in example 2, 7 to 10 days post electroporation. After enrichment of PD-L-1, the enriched cells were electroporated with a TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid as detailed below and RNP comprising Cas9 and gRNA targeting exon 1 of the TXNIP gene (i.e., TXNIP_exon 1_T5 gRNA,SEQ ID NO:37). Table 8 shows the target sequences of additional gRNAs targeting exon 1 or exon 2 of the TXNIP gene. These grnas have a predicted low off-target score based on sequence homology predictions using gRNA design software.

TABLE 8 TXNIP gRNA target sequences

Name of the name	Target sequence (5 '-3')	SEQ ID NO:	PAM
				TXNIP_exon 1_T1	GAAGCGTGTCTTCATAGCGC	32	AGG
TXNIP_exon 1_T21	TTACTCGTGTCAAAGCCGTT	33	AGG
				TXNIP_exon 1_T22	TGTCAAAGCCGTTAGGATCC	34	TGG
TXNIP_exon 1_T23	GCCGTTAGGATCCTGGCTTG	35	CGG
				TXNIP_exon 1_T25	GCGGAGTGGCTAAAGTGCTT	36	TGG
TXNIP_exon 1_T5	TCCGCAAGCCAGGATCCTAA	37	CGG
				TXNIP_exon 2_T4	GTTCGGCTTTGAGCTTCCTC	38	AGG
TXNIP_exon 2_T2	GAGATGGTGATCATGAGACC	39	TGG
				TXNIP_exon 2_T1	TTGTACTCATATTTGTTTCC	40	AGG
TXNIP_exon 2_T3	AACAAATATGAGTACAAGTT	41	CGG

FIG. 5 shows a schematic representation of a TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid (also known as the X1-2 cassette), and Table 9 identifies elements and positions therein. The TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid contains the CAGGS promoter (including CMV enhancer, chicken beta-actin promoter and chimeric intron) to drive expression of the cDNA (SEQ ID NO: 55) of MANF-P2A-HLA-E, flanked by 800 base pair homology arms with the same sequence as the TXNIP locus around exon 1. The HLA-E sequence (SEQ ID NO: 43) encodes an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide, the HLA-G presenting peptide fused to a GS linker, the GS linker fused to a B2M membrane protein, the B2M membrane protein fused to a GS linker, and the GS linker fused to an HLA-E protein without its signal peptide. Such trimer designs have been previously published (Gornaguse et al 2017) Nat. Biotechnol.35 (8): 765-772). The complete sequence of the TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid comprises the nucleotide sequence of SEQ ID NO. 45.

TABLE 9 elements of TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-TXNIP	145-944(800)	42
			CAGGS promoter	973-2639(1667)	16
MANF	2684-3229(546)	17
			P2A	3239-3295(57)	18
HLA-E	3296-4795(1500)	43
			bGH Multi (A) Signal	4822-5046(225)	21
RHA-TXNIP	5053-5852(800)	44
			Right ITR	5894-6034(141)	23
Complete plasmid	8381bp	45

Cells expressing HLA-E in cells were enriched by MACS using Miltenyi reagent or ThermoFisher reagent 7 to 10 days after electroporation. These enriched cells were then FACS-sorted using a WOL FACS-sorter (nanocell) to carry StemFlex and RevitaCell ^TM In a BIOLAMININ 521CTG coated 96-well plate, gating was set to PD-L-1 and HLA-E biscationic cells. To detect PD-L-1 surface expression and HLA-E surface expression, anti-PD-L-1 and anti-HLA-E fluorescent antibodies were used (see Table 4). For FACS sorting, unedited cells were used as negative control. PD-L-1 and HLA-E biscationic cells (L1V 028 cell line) were selected for sorting and single cell cloning.

In a normoxic incubator (37 ℃,8% CO) ₂ ) Middle culture plateThe medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. Primers amplified from outside the plasmid homology arms at each insertion site were used to allow amplification of only KI-integrated DNA, and correctly targeted clones were identified by PCR on PD-L-1KI insertion and HLA-E KI insertion. Cloned B2M and TXNIP KO status was confirmed by PCR and Sanger sequencing. The correct KI and KO clones were expanded in incremental tissue culture until a population size of 3000 ten thousand cells was reached. These cells are hereinafter referred to as X1 cells.

Example 7: human pluripotent stem cells producing B2M KO and TNFAIP3-P2A-PD-L-1KI, TXNIP KO and MANF-P2A-HLA-E KI, CIITA KO and CD39 KI

Cells were generated in which the transgene encoding TNFAIP3-P2A-PD-L-1 was inserted into the B2M locus, the transgene encoding MANF-P2A-HLA-E was inserted into the TXNIP locus, and the transgene encoding CD39 was inserted into the CIITA locus, thereby knocking out the B2M, TXNIP and CIITA genes.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (SEQ ID NO:31, table 7) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above. Cells expressing PD-L-1 (positive) in cells were enriched by MACS substantially as described in example 2, 7 to 10 days post electroporation. After amplification of the enriched PD-L-1 positive population, cells were electroporated with TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid (SEQ ID NO:45, table 9) and RNP comprising Cas9 and TXNIP_exon 1_T5gRNA (SEQ ID NO: 37) substantially as described above in example 2. After enrichment of HLA-E positive cells and expansion of PD-L-1 and HLA-E cells, the biscationic cells were used for further insertion of CD39 into the CIITA locus.

The CIITA-CAGGS-CD39 donor plasmid (SEQ ID NO:29, table 5) was introduced with a Ribonucleoprotein (RNP) complex consisting of CIITA-targeted gRNA (CIITA Ex3_T6gRNA (SEQ ID NO: 25)) and Cas9 protein. Specifically, the X1 clone described in example 7 was transfected with the CIITA-CAGGS-CD39 donor plasmid together with RNP consisting of CIITA-targeted gRNA (CIITA Ex3_T6gRNA (SEQ ID NO: 25)) and Cas9 protein. Each of which In 200 ten thousand hESC cells, 4 μg of plasmid DNA was delivered with RNP by electroporation. Electroporation was performed in hESC cells using a neon electroporator with a 5:1 molar ratio (gRNA: cas9) of Cas9 protein (Biomay) and RNA (Biospring) -directed RNP mixture, absolute 125pmol of Cas9 and 625pmol of gRNA per 200 ten thousand cells. To form the RNP complex, gRNA and Cas9 are combined with R-buffer (Neon transfection kit) in one container to a total volume of 25-50 μl and incubated for 15min at Room Temperature (RT). UsingCells were dissociated and then resuspended in StemFlex medium, counted using NC-200 (chemetec) and centrifuged. Will total 2x10 ⁶ Individual cells were resuspended in RNP complex and R-buffer was added to a total volume of-115 μl. The mixture was then electroporated with 3 pulses at 1000V for 30ms. Two electroporation runs were performed. Following electroporation, cells were pipetted into wells of a 6-well plate filled with StemFlex medium containing RevitaCell and laminin 511. Plates were pre-coated with 1:10 dilution of BIOLAMININ 521 CTG. Cells were incubated in a normoxic incubator (37 ℃,8% CO) ₂ ) Is cultured.

Two days after electroporation, cells transfected with anti-CD 39 expressing cells were enriched by Fluorescence Assisted Cell Sorting (FACS) using anti-CD 39 antibodies. These enriched cells were then expanded and reclassified 7-10 days after electroporation to enrich for CD39 knockins. These enriched cells generated by the X1 clone represent a large transfected population of CD39 positive cells ("L3V 003B", also referred to as "X4"). Guide RNAs targeting the TGF- β2 gene were also used to edit X1 clones with CD39 KI to generate a large transfected population of CD39 positive cells and TGF- β2 negative cells ("L3V 004B", also known as "x4+ TGF- β2ko"). These populations were assessed for CD39 expression by flow cytometry, however the total percentage was lower than expected, thus a third enrichment of a large number of cells for CD39 expressing cells, and >90% CD39 expression was shown by flow cytometry (fig. 6).

Example 8: human pluripotent stem cells producing B2M KO and TNFAIP3-P2A-PD-L-1KI, TXNIP KO and MANF-P2A-HLA-E KI, and B2M KO and CD39-P2A-PD-L-1KI

Cells will be generated in which the transgene encoding TNFAIP3-P2A-PD-L-1 is inserted into a first target site in the B2M locus, the transgene encoding MANF-P2A-HLA-E is inserted into the TXNIP locus, and the transgene encoding CD39-P2A-PD-L-1 is inserted into another location in a second target site in the B2M locus, thereby knocking out the B2M and TXNIP genes.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (SEQ ID NO:31, table 7) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above. The cells will be enriched for PD-L-1 expressing (positive) cells by MACS using Miltenyi reagent or ThermoFisher reagent 7 to 10 days after electroporation. After amplification of the enriched PD-L-1 positive population, cells were electroporated with TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid (SEQ ID NO:45, table 9) and RNP comprising Cas9 and TXNIP_exon 1_T5gRNA (SEQ ID NO: 37) substantially as described above in example 2. After enriching HLA-E positive cells and amplifying PD-L-1 and HLA-E cells, the biscationic cells were electroporated with B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid (SEQ ID NO:30, table 6) and RNP comprising Cas9 and B2M gRNA selected from SEQ ID NO:1 or 3-13. CD39 positive cells in the enriched cells were expanded and PD-L-1, HLA-E and CD39 triple positive cells were selected, which were characterized as described above.

In some embodiments, in the B2M-CAGGS-CD39-P2A-PD-L-1 donor plasmid, the cDNA of CD39-P2A-PD-L-1 is flanked by 800 base pair homology arms, which have sequence identity to the genomic sequence flanking the second B2M target site.

Example 9: g-band karyotype analysis of edited clones

100 ten thousand edited ES cells (see examples 2 and 6) were passaged into T-25 flasks containing medium (DMEM/F12+10% Xeno-free KSR, 10ng/mL activin and 10ng/mL modulin). After overnight incubation, three T25 flasks were transported to cytogenetic laboratories (Cell Line Genetics, inc.) for karyotyping; FISH analysis of chromosome 1, 12, 17, 20; and array comparative genomic hybridization (aCGH) analysis using a standard 8x60K array. The G-banding results of selected B2M KO and MANF-TNFAIP3 (A20) -PD-L-1KI clones (L1V 008 cell line; example 2) and TXNIP KO and MANF-P2A-HLA-E KI/B2M KO and TNFAIP3 (A20) -P2A-PD-L-1KI clones (L1V 028 cell line; example 6) are shown in Table 10.

TABLE 10G with core analysis results

Example 10: differentiation of edited human embryonic stem cells into Pancreatic Endoderm Cells (PECs)

Maintenance of edited human embryonic stem cells (ES). Edited human pluripotent stem cells at different passages (P38-42) were maintained by: for 4 days passage, 33,000 cells/cm ² Inoculation, or passage at 50,000 cells/cm for 3 days ² Inoculation, this passage was performed with hESM medium (DMEM/F12+10% KSR+10ng/mL activin A and 10ng/mL modulin) and finally 10% human AB serum.

Aggregation-edited human embryonic stem cells are used for PEC differentiation. By usingThe edited cells were dissociated into single cells, then centrifuged and resuspended in DMEM/F12 medium at 100 tens of thousands of cells per ml in 2% StemPro (Cat#A 1000701, invitrogen, calif.), and a total of 3.5-4 hundred million cells were seeded in one 850cm ² In roller bottles (Cat#431198, corning, N.Y.), the differentiation was performed after a rotation of 8 RPM.+ -. 0.5RPM for 18-20 hours. Aggregates from edited human pluripotent stem cells were differentiated into pancreatic lineages using roller bottles as described by Schulz et al (2012) PLoS ONE 7 (5): e 37004. Aggregates from edited human pluripotent stem cells differentiate into pancreatic lineages as described in Rezania et al (2014) Nat. Biotechnol.32 (11): 1121-1133 and US 20200208116.

FIG. 7 shows similar morphology of TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI clones ("X1" or L1V028 cell lines) and clones differentiated from wild-type cells in PEC stage and stage 6 (S6).

Example 11: PEC stage and stage 6 gene expression

Targeting RNAseq for gene expression analysis was performed using Illumina TruSeq and a custom oligonucleotide set targeting 111 genes. The group mainly contains genes that are markers of developmental stages during pancreatic differentiation. At the end of PEC stage and stage 6, 10 μl APV (aggregate pellet volume) was collected and extracted using Qiagen RNeasy or RNeasy 96 spin column protocols (including on-column dnase treatment). Quantification and quality control was performed using the tape station in combination with Qubit or by using Qiagen QIAxcel. 50-200ng of RNA was processed according to the Illumina TruSeq library preparation protocol, which consisted of: cDNA synthesis, hybridization of custom oligonucleotide pools, washing, extension, ligation of bound oligonucleotides, PCR amplification of the library, and purification of the library, and then quantification and quality control of the resulting dsDNA library using TapeStation in combination with Qubit or by using Qiagen QIAxcel. The library was then diluted to a concentration of 4nM and pooled, then denatured, spiked into PhiX control, and further diluted to 10-12pM before loading into an Illumina Miseq sequencer. After the sequencing run, an initial data analysis is automatically performed by BaseSpace, generating an initial read count for each custom probe. For each gene, these read counts for all probes corresponding to that gene are then summed and 1 read count is added (to prevent downstream division by 0). Normalization was performed for gene SF3B2 and reads were typically shown as fold changes relative to phase 0. Normalization is performed using the DEseq method when processing data for principal component analysis.

The selected gene expression is shown in figure 8. In PEC stage and stage 6 (S6), the expression patterns of CHGA, FOXA2, NKX6.1, PDX1 and INS from the "X1" clones, namely TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI (X1), were similar to those of cells differentiated from wild-type cells.

Example 12: PEC stage and stage 6 flow cytometry for CHGA, PDX1 and NKX6.1

PEC stage and stage 6 aggregates were washed with PBS and then ACCUMAX was used ^TM (catalog #A7089, sigma, MO) was enzymatically dissociated into single cell suspensions at 37 ℃. MACS isolation buffer (cat#130-091-221,Miltenyi Biotec,North Rhine-Westphalia, germany) was added and the suspension was passed through a 40 μm filter and precipitated. For intracellular marker staining, cells were fixed in 4% (wt/v) paraformaldehyde for 30 min, washed in FACS buffer (PBS, 0.1% (wt/v) BSA,0.1% (wt/v) NaN 3), and then washed with Perm buffer (PBS, 0.2% (v/v) Triton X-100 (cat#a16046, alfa Aesar, MA), 5% (v/v) normal donkey serum, 0.1% (wt/v) NaN 3) permeabilized the cells on ice for 30 min, and then washed with wash buffer (PBS, 1% (wt/v) BSA,0.1% (wt/v) NaN 3). Cells were incubated overnight at 4℃with primary antibodies (Table 11) diluted with blocking buffer (PBS, 0.1% (v/v) Triton X-100,5% (v/v) normal donkey serum, 0.1% (wt/v) NaN 3). Cells were washed in IC buffer and then incubated with the appropriate secondary antibodies for 60 min at 4 ℃. Cells were washed in IC buffer and then FACS buffer. Flow cytometry data were collected using a NovoCyte flow cytometer (ACEA Biosciences, brussels). Data were analyzed using FlowJo software (Tree Star, inc.). Intact cells are identified based on forward (low angle) and lateral (orthogonal, 90 °) light scattering. Background was estimated using antibody controls and undifferentiated cells. In the figure, a representative flow cytometry pattern of a sub-population is shown. The numbers reported in the figures represent the percentage of total cells from the whole cell gate.

TABLE 11 antibodies for flow cytometry

Antigens	Fluorophores	Source	Dilution of
				PDX1	PE	BD Bioscience(Cat#562161)	1:2.5
NKX6.1	AF647	BD Bioscience(Cat#563338)	1:2.5
				CHGA	AF405	Novus(Cat#NBP2-33198AF405)	1:1000

FIG. 9 shows flow cytometry of CHGA, PDX1 and NKX6.1 in PEC cells differentiated from either wild-type cells or two L1V028 clones generated in example 6 (i.e., TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1 KI). FIGS. 10A and 10B show flow cytometry of CHGA, PDX1 and NKX6.1 in stage 6 (S6) cells differentiated from wild-type cells (FIG. 10A) or X1 cells (i.e., TXNIP KO/MANF-P2A-HLA-EKI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1 KI) (FIG. 10B).

Example 13: in vivo efficacy study of B2M KO/MANF-P2A-TNFAIP3-P2A-PD-L-1KI cells

Pancreatic endoderm cells were generated from the B2M KO/MANF-P2A-TNFAIP3 (A20) -P2A-PD-L-1KI (L1V 008) cell line described in example 2 above and a clonal unmodified cell line (clonal unmodified cell line) obtained by transfection with non-cutting guide-RNA (NCG).

Pancreatic endoderm aggregates from the clonal lines shown were loaded into a Punch Device (PD) to produce test or control articles. PD allows direct vascularization following subcutaneous transplantation, and encapsulated pancreatic progenitor cells mature in vivo into functional pancreatic endocrine cells, including glucose-responsive insulin-producing cells.

As summarized in table 12, L1V008 and control cells were tested in four groups of athymic nude rats, each of which was subcutaneously implanted with two articles, each article containing approximately 7 x 10 ⁶ Individual cells.

TABLE 12 study design

All surviving animals were evaluated for efficacy by a Glucose Stimulated Insulin Secretion (GSIS) test starting at 12 weeks. Blood samples were obtained from non-fasted animals before and after intraperitoneal administration of 3g/kg glucose. Serum concentrations of human C-peptide were determined by standard enzyme-linked immunosorbent assay. C-peptide readings of the control group (GRP 4) were taken 60 minutes after intraperitoneal administration of glucose, while readings of the experimental group were taken 90 minutes after administration.

Figure 11 shows C-peptide levels at weeks 12, 16, 20 and 24 for four groups. The results showed no substantial differences between the experimental groups. These results indicate that neither the introduced genetic modification nor the manipulation required to generate a clonal line affects the ability of the cell line in question to differentiate into pancreatic endoderm cells in vitro and subsequently produce functional beta cells in vivo.

Example 14: in vivo efficacy study of B2M KO/CD39-P2A-PD-L-1KI cells

The B2M KO/CD39-P2A-PD-L-1KI (L1V 017) cell line derived from the preparation of example 4 or pancreatic endoderm aggregates from control cells were loaded into a perforating device and implanted into animals for GSIS testing as described in example 13 above. Table 13 shows the study design.

TABLE 13 study design

As shown in fig. 12, the genetic modification and manipulation required to generate this cell line did not affect the ability of the cells to differentiate into pancreatic endoderm cells in vitro and subsequently produce functional beta cells in vivo.

Example 15: in vivo efficacy study of TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI cells

In vivo efficacy of PEC stage and stage 6 cells differentiated from control cells (NCG) or L1V028 clones generated in example 6 (i.e., TXNIP KO/MANF-P2A-HLA-EKI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI; X1) were tested. The test or control vesicles were transplanted into the left kidney of NSG mice (Jackson Laboratory Stock No: 005557). Table 14 shows the study design.

TABLE 14 study design

GSIS tests were performed at weeks 12, 16, 20 and 24. FIG. 13 shows C-peptide levels at weeks 12 and 16 for individual animals in the PEC control group, the PEC-X1 group, the S6 control group and the S6-X1 group. Figure 14 shows the time course of average C-peptide levels from week 12 to week 24 for PEC control and PEC-X1 groups. These results indicate that X1 cells are able to differentiate into pancreatic endoderm cells in vitro and subsequently produce functional beta cells in vivo.

At week 26, after GSIS testing, animals were euthanized and removed test articles (explanted test article) were fixed in neutral buffered formalin, processed into slides, stained with H & E, and insulin and glucagon were determined by immunohistochemistry.

Several seed-operated clones from the "X1" cell line (i.e., L1V 028) were also tested in vivo. Clones were selected based on whole genome sequencing. They have a Het/Hom in situ genotype (on-site genetype) and do not show accidental plasmid insertion nor any variants of oncogenes that may have altered function. Clone 6D09 had no putative off-target inserts, whereas clones 6H07 and 5C10 had at least one putative off-target insert. GSIS testing was performed at weeks 12 and 16. Figure 15 shows the C-peptide levels and group average levels at weeks 12, 16 and 20 for each animal. Clones 6D09, 6H07 and 5C10 showed good in vivo efficacy.

Example 16: human pluripotent stem cells producing B2M Knockdown (KO) and CD39-P2A-CD73-P2A-PD-L-1KI

Cells were generated in which the transgene encoding CD39-P2A-CD73-P2A-PD-L-1 was inserted into the B2M locus, thereby knocking out the B2M gene.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 donor plasmid and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above as detailed in Table 15 below.

FIG. 16 shows a schematic representation of the B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 plasmid, and Table 15 identifies the elements and positions therein. The B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 donor plasmid contains the CAGGS promoter driving the expression of the cDNA (SEQ ID NO: 56) of CD39-P2A-CD73-P2A-PD-L-1 flanked by homology arms of 800 base pairs, which have the same sequence as the B2M locus around exon 1. The complete sequence of the B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 donor plasmid comprises the nucleotide sequence of SEQ ID NO. 47.

Table 15: elements of the B2M-CAGGS-CD39-P2A-CD73-P2A-PD-L-1 donor plasmid

Element	Location (size in bp)	SEQ ID NO:
			Left ITR	1-130(130)	14
LHA-B2M	145-944(800)	15
			CAGGS promoter	973-2639(1667)	16
CD39	2684-4213(1530)	27
			P2A	4223-4279(57)	18
CD73	4280-6001(1722)	46
			P2A	6011-6067(57)	18
PD-L-1	6068-6940(873)	20
			bGH Multi (A) Signal	6958-7182(225)	21
RHA-B2M	7189-7988(800)	22
			Right ITR	8030-8170(141)	23
Complete plasmid	10,517bp	47

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. The correct targeted clone for CD39-P2A-CD73-P2A-PD-L-1KI insertion was identified by PCR using primers amplified from outside the homology arm of the plasmid inserted at the site of the B2M locus, enabling amplification of only the KI-integrated DNA. The status of cloned B2M KO was confirmed by PCR and Sanger sequencing. The correct KI and KO clones (L1V 018B cell line) were expanded in incremental tissue culture until a population size of 3000 tens of thousands of cells was reached.

Example 17: production of B2M KO and TNFAIP3 (A20) -P2A-PD-L-1KI human pluripotent stem cells

Human pluripotent stem cells were electroporated with a B2M-CAGGS-TNFAIP3 (A20) -P2A-PD-L-1 donor plasmid (SEQ ID NO:31, table 7) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above to generate the L1V019B cell line. FIG. 4 shows a schematic representation of the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (also known as the X1-1 cassette).

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. The correct targeted clone for a20-P2A-PD-L-1KI insertion was identified by PCR using primers amplified from outside the homology arm of the plasmid inserted at the site of the B2M locus, enabling the amplification of only KI-integrated DNA. The status of cloned B2M KO was confirmed by PCR and Sanger sequencing. The correct KI and KO clones (L1V 019B cell lines) were expanded in incremental tissue culture until a population size of 3000 tens of thousands of cells was reached.

Example 18: differentiation and characterization of additional edited cell lines

Cells from the L1V017B cell line prepared in example 4 above (i.e., CD39-P2A-PD-L-1KI and B2M KO), the L1V018B cell line prepared in example 16 above (i.e., CD39-P2A-CD73-P2A-PD-L-1KI and B2M KO), and the L1V019B cell line prepared in example 17 above (i.e., TNFAIP3 (A20) -P2A-PD-L-1KI and B2M KO) were differentiated essentially as described in example 10 above.

Gene expression was examined at various time points during the differentiation process essentially as described in examples 11 and 12 above. FIG. 17 shows the detection of SOX17 and FOXA2 expression by flow cytometry on day 18 to confirm the presence of DE (definitive endoderm) cells. The presence of differentiated Pancreatic Endoderm Cells (PECs) was further confirmed by flow cytometry to detect the presence of CHGA negative and PDX1 and NKX6.1 positive dominant populations (see figure 18). The time course from day 16 to islet cell expression of various markers (e.g., CHGA, FOXA2, NKX6.1, PDX1, SOX17, AFP, ALB, CDX2, HAND1, HAND2, NANOG) is shown in fig. 19.

Example 19: production of B2M KO and PD-L-1KI, TXNIP KO and HLA-E KI, CIITA KO and CD39KI human pluripotent stem cells

Cells were generated in which a polynucleotide encoding PD-L-1 was inserted into the B2M locus, a polynucleotide encoding HLA-E was inserted into the TXNIP locus, and a polynucleotide encoding CD39 was inserted into the CIITA locus, thereby knocking out the B2M, TXNIP and CIITA genes.

Human pluripotent stem cells will be electroporated essentially as described in example 2 above with a B2M-CAGGS-PD-L-1 donor plasmid flanked by 800bp homology arms (SEQ ID NOS: 15 and 22) with genomic sequences to the left and right of the target site of the B2M locus, respectively, and an RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) in the B2M-CAGGS-PD-L-1 donor plasmid. Cells expressing PD-L-1 (positive) in cells were enriched by MACS substantially as described in example 2, 7 to 10 days post electroporation. After amplification of the enriched PD-L-1 positive population, the cells were electroporated with a TXNIP-CAGGS-HLA-E donor plasmid flanked by 800bp arms (SEQ ID NOS: 42 and 44) with sequence homology to genomic sequences located to the left and right, respectively, of the target site of the TXNIP locus and an RNP comprising Cas9 and TXNIP_exon 1_T5gRNA (SEQ ID NO: 37) essentially as described in example 2 above. After enrichment of HLA-E positive cells and expansion of PD-L-1 and HLA-E cells, the biscationic cells were electroporated with CIITA-CAGGS-CD39 donor plasmid (Table 5) and RNP comprising Cas9 and CIITA Ex3_T6gRNA (SEQ ID NO: 25). Cells expressing CD39 in the enriched cells were expanded and PD-L-1, HLA-E and CD39 triple positive cells were selected, which will be characterized as described above.

Example 20: human pluripotent stem cells producing B2M KO and TNFAIP3-P2A-PD-L-1KI, TXNIP KO and MANF-P2A-HLA-E KI, and B2M KO and CD39-P2A-PD-L-1KI

Cells will be generated in which a polynucleotide encoding PD-L-1 is inserted into a first target site of the B2M locus, a polynucleotide encoding HLA-E is inserted into the TXNIP locus, and a polynucleotide encoding CD39 is inserted into another location of a second target site of the B2M locus, thereby knocking out the B2M and TXNIP genes.

Double positive cells expressing PD-L-1 and HLA-E will be produced substantially as described in example 16 above. Double positive cells will be electroporated with a B2M-CAGGS-CD39 donor plasmid flanked by 800bp homology arms of sequence identity to the genomic sequence surrounding the second B2M target site, and an RNP comprising Cas9 and B2M gRNA selected from SEQ ID NO:1 or 3-13, the CD39 sequence (SEQ ID NO: 27) in the B2M-CAGGS-CD39 donor plasmid. CD39 positive cells in the enriched cells were expanded and PD-L-1, HLA-E and CD39 triple positive cells were selected, which were characterized as described above.

Example 21: differentiation of edited human embryonic stem cells into Pancreatic Endoderm Cells (PECs)

Maintenance of edited human embryonic stem cells (ES). Edited human pluripotent stem cells ("X4"; see example 7) containing B2M KO and TNFAIP3-P2A-PD-L-1KI, TXNIP KO and MANF-P2A-HLA-E KI, CIITA KO and CD39 KI at different passages (P38-42) were maintained by: about 33,000 cells/cm for 4 days passage ² Inoculation, or passage at about 50,000 cells/cm for 3 days ² Inoculation, passaging was performed with hESM medium (DMEM/F12+10% KSR+10ng/mL activin A and 10ng/mL modulin) and finally 10% human AB serum.

Aggregation of edited human embryonic stem cells for PEC differentiation. By usingThe edited cells were dissociated into single cells, then centrifuged and resuspended in DMEM/F12 medium at 100 tens of thousands of cells per ml in 2% StemPro (Cat#A 1000701, invitrogen, calif.), and a total of 3.5-4 hundred million cells were seeded in one 850cm ² In roller bottles (Cat#431198, corning, N.Y.), the differentiation was performed after a rotation of 8 RPM.+ -. 0.5RPM for 18-20 hours. Aggregates from edited human pluripotent stem cells were differentiated into pancreatic lineages using roller bottles and displayed X1 cells as described by Schulz et al (2012) PLoS ONE 7 (5): e 37004. Aggregates from edited human pluripotent stem cells differentiate into pancreatic lineages as described in Rezania et al (2014) Nat. Biotechnol.32 (11): 1121-1133 and US 20200208116.

Expression patterns of CHGA, FOXA2, NKX6.1, PDX1 and INS from "X4" clones, namely TXNIP KO/MANF-P2A-HLA-E KI, B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI and CIITA KO/CD39 KI, at PEC stage and stage 6 (S6), were determined to confirm differentiation.

Example 22: in vivo efficacy study of TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI, CIITA KO/CD39 KI cells

PEC stage and stage 6 cells differentiated from control cells (NCG) or X4 (i.e., TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (a 20) -P2A-PD-L-1KI, CIITA KO/CD39 KI) will also be tested for in vivo efficacy. The test or control vesicles were transplanted into the left kidney of NSG mice (Jackson Laboratory Stock No: 005557).

GSIS testing will be performed at weeks 12, 16, 20 and 24, as described for X1 cells in example 15. At week 26, after GSIS testing, animals were euthanized and removed test articles were fixed in neutral buffered formalin, processed into slides, and stained with H & E, and insulin and glucagon were determined by immunohistochemistry.

Example 23: x1 human pluripotent stem cells with TGF-. Beta.2KO were generated.

Producing a cell in which the transgene encoding TNFAIP3-P2A-PD-L-1 is inserted into the B2M locus, the transgene encoding MANF-P2A-HLA-E is inserted into the TXNIP locus, the transgene encoding CD39 is inserted into the CIITA locus, and the TGF- β2 gene is knocked out, thereby giving the cell B2M, TXNIP, CIITA and TGF- β2 gene knocked out.

Human pluripotent stem cells were electroporated with the B2M-CAGGS-TNFAIP3-P2A-PD-L-1 donor plasmid (SEQ ID NO:31, table 7) and RNP comprising Cas9 and B2M-2gRNA (SEQ ID NO: 2) substantially as described in example 2 above. Cells expressing PD-L-1 (positive) in cells were enriched by MACS substantially as described in example 2, 7 to 10 days post electroporation. After amplification of the enriched PD-L-1 positive population, cells were electroporated with the TXNIP-CAGGS-MANF-P2A-HLA-E donor plasmid (SEQ ID NO:45, table 9) and RNP comprising Cas9 and TXNIP_exon 1_T5gRNA (SEQ ID NO: 37) substantially as described above in example 2. After enriching HLA-E positive cells and amplifying PD-L-1 and HLA-E cells, double positive cells were electroporated with CIITA-CAGGS-CD39 donor plasmid (SEQ ID NO:29, table 5) and RNP comprising Cas9 and CIITA Ex3_T6gRNA (SEQ ID NO: 25). Cells expressing CD39 in the cells were enriched, expanded, and PD-L-1, HLA-E, and CD39 triple positive cells were selected, which were characterized as described above.

Triple positive cells (also with B2M, TXNIP and CIITA gene knockouts) confirmed with RNP electroporation comprising Cas9 and TGF- β2gRNA to produce TGF- β2 knockouts. TGF-beta 2gRNA1 (5'-GTTCATGCGCAAGAGGATCG-3' (SEQ ID NO: 57), PAM is AGG) was used to knock out TGF-beta 2 protein in X1 clones and X4 lot cell lines by causing a frameshift mutation in exon 1 of the TGF-beta 2 gene. Electroporation was performed in these enriched hESC cells using a neon electroporator with a 5:1 molar ratio (gRNA: cas9) of Cas9 protein (Biomay) and guide RNA (IDT) RNP mixture, absolute 125pmol of Cas9 and 625pmol of gRNA per 100 thousand cells. To form the RNP complex, gRNA and Cas9 are combined with R-buffer (Neon transfection kit) in one container to a total volume of 25-50 μl and incubated for 15min at Room Temperature (RT). The mixture was then combined with cells using R-buffer to a total volume of-115 μl. The mixture was then electroporated with 1 pulse at 1500V for 20ms. After electroporation, cells were removed to be filled with cells having REVITACELL ^TM STEMFLEX for supplement (100X) and laminin 511 ^TM In 6-well plates of medium. Cells were incubated in a normoxic incubator (37 c,8％CO ₂ ) Is cultured. The L3V003B ("X4") population targeted with TGF-. Beta.2gRNA was designated L3V004B ("X4+ TGF-. Beta.2KO") and the X1 clone population targeted with TGF-. Beta.2gRNA was designated L3V002B ("X1+ TGF-. Beta.2KO"). This procedure was repeated once for the L3V004B population and twice for the L3V002B population to ensure high efficiency of TGF- β2ko.

In a normoxic incubator (37 ℃,8% CO) ₂ ) Medium was changed every other day until the colonies were large enough to be re-inoculated as single cells. When pooled, the samples were split for maintenance and genomic DNA extraction. Correctly targeted clones were confirmed by PCR and Sanger sequencing.

PCR was performed on the target TGF-. Beta.2 sequence, and the cleavage efficiency of the resulting amplified DNA was evaluated by TIDE analysis. The relevant region was subjected to PCR using Platinum Taq Supermix (Invitrogen, cat#125320176 and cat# 11495017). The sequences of the PCR primers are shown in table 16. FIGS. 20A and 20B show the TGF-. Beta.2KO editing efficiency of two bulk edited lines L3V002 ("TGFB 2-KO-F1") and L3V004 ("TGFB 2-KO-CD 39-F1"). Both populations had more than 80% KO above the desired threshold, +1 and-7 indels were the most prominent edits.

TABLE 16 TGF-. Beta.2KO primers

Name of the name	Type(s)	Sequence (5 '-3')	SEQ ID NO:
				TGF-β2F1	Forward direction	AGGATACGTTTTTCTGTTGGGC	59
TGF-β2R1	Reverse direction	GGAGAACGGGAAAAGAGCGA	60

Example 24: differentiation of edited human embryonic stem cells into Pancreatic Endoderm Cells (PECs)

Maintenance of edited human embryonic stem cells (ES). Edited human pluripotent stem cells containing B2M KO and TNFAIP3-P2A-PD-L-1KI, TXNIP KO and MANF-P2A-HLA-E KI, CIITA KO and CD39 KI, and TGF-beta 2KO ("X4+ TGF-beta 2 KO") of different passages (P38-42) were maintained by: about 33,000 cells/cm for 4 days passage ² Inoculation, or passage at about 50,000 cells/cm for 3 days ² Inoculation, inoculation with hESM medium (DMEM/F12+10% KSR+10ng/mL activin A and 10ng/mL modulin) and eventually 10% human AB serum.

In PEC stage and stage 6 (S6), expression patterns from "X4+ TGF-. Beta.2KO" clones, namely TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI (X1) CIITA KO/CD39KI and TGF-. Beta.2KO, CHGA, FOXA2, NKX6.1, PDX1 and INS were determined to confirm differentiation.

Example 25: immune evasion assay of B2M KO and X1 PEC cells

The ability of B2M KO and TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI ("X1") cells to evade immune responses with or without TGF-beta signaling in culture medium was tested using an immune evasion assay using Peripheral Blood Mononuclear Cell (PBMC) proliferation assays. According to the manufacturer CellTrace ^TM The CFSE cell proliferation kit provides instructions for performing the assay. Briefly, fluorescently labeled PBMC were added to X-VIVO-15 medium containing edited or non-cleaved control PEC cells, IL-2, and human serum with or without TGF-beta blocking antibodies. Antibodies against TGF-beta 1, TGF-beta 2 and TGF-beta 3 are used to block protein signaling in culture media and inhibit TGF-beta mediated immune evasion. PBMC cells were monitored for proliferation over a period of 5 days using a dye-diluted CFSE cell proliferation kit. PBMC activation data with or without TGF- β blockers are provided in figure 21. The results indicate that without TGF- β blocking, all PECs are "immune evading" in that none of the samples induced T cell activation. In the case of TGF-beta blocking, T cell activation is increased. NCG (non-cutting control with normal B2M) driven a higher T cell activation response than PBMC alone control, but both B2M KO and X1 (also with B2M KO) PECs were below baseline, indicating that X1 and B2M KO PECs were immune evading, while NCG PECs were slightly immunogenic to allogeneic PBMC.

Example 26: characterization of edited and differentiated PEC cells secreting TGF- β2.

The levels of TGF- β1 and TGF- β2 secretion in the edited and differentiated cells were detected in 72 hour conditioned medium using ELISA-based assays using anti-TGF- β1 and anti-TGF- β2 antibodies. The following table provides the antibodies used.

ELISA target	Suppliers (suppliers)	Cat#
			TGF-b1	ThermoFisher	BMS249
TGF-b2	R&D	DB250
			S100A 8/A9-calprotectin 9	FisherScientific	501656476
GDF9	LifeSpan	LS-526-1
			PDGF-AA	ThermoFisher	EHPDGFA
PDGF-BB	ThermoFisher	EHPDGFB

TGF- β2 and TGF- β1 secretion profiles were determined in TGF- β2KO cells and edited cells with HLA-E KI, TXNIP KO, PD-L-1KI and B2M KO ("V1B"). The results indicate that both V1B and TGF- β2ko cells showed undetectable TGF- β2 levels in conditioned medium (see fig. 22A). Interestingly, however, conditioned medium from TGF- β2ko cells exhibited higher levels of TGF- β1 secretion (see fig. 22B).

Example 27: characterization of chemoattractants secreted by TGF-beta 2KO cells

Migration of fibroblasts and resulting fibrosis is guided by chemoattractants secreted by the implanted cells. ELISA-based methods were used to examine whether TGF-. Beta.2KO cells had reduced chemoattractant secretion compared to V1B cells (HLA-E KI, TXNIP KO, PD-L-1KI, B2M KO) and X1 (antibodies provided in the table in example 26). The chemoattractants tested included TGF-. Beta.2 (see FIG. 23A), growth differentiation factor (GDF-9, see FIG. 23B), and platelet-derived growth factor-AA (PDGF-AA, see FIG. 23C).

The results indicate that both TGF- β2 and GDF-9 secretion by V1B and TGF- β2KO cells is significantly reduced. However, only TGF-. Beta.2KO cells showed reduced PDGF-AA secretion.

Example 28: in vitro fibroblast migration assay.

In vitro fibroblast migration assays were performed using the QCM chemotactic cell migration assay kit (catalog number ECM 509) from Millipore/Sigma, following manufacturer's instructions. Briefly, a cell suspension comprising MRC-5 (human lung fibroblasts) or HT1080 (human fibrosarcoma) cells was placed in the upper chamber of the assay unit, which was separated from the outer chamber comprising 72 hours conditioned medium from wild type, V1B, TGF- β2ko, X1, X4 and/or x4+ TGF- β2ko PEC cells by a polycarbonate membrane of 8 μm pore size. Cells were allowed to migrate through the polycarbonate membrane for 2-24 hours. The migrating cells attach to the bottom of the membrane. The migrated cells were dissociated from the membrane and lysed. Cells were quantified using CyQuant GR dye. FIGS. 24A-24B show the results of fibroblast migration assays performed using human lung fibroblast (MRC-5) cells and conditioned medium from WT, V1B and X1 cells (FIG. 24A) and WT and TGF-. Beta.2KO cells (FIG. 24B). FIGS. 25A-25C show fibroblast migration assay results using human fibrosarcoma (HT 1080) cells and conditioned medium from WT, V1B and X1 cells (FIG. 25A), WT and TGF-. Beta.2KO cells (FIG. 25B), and WT, X4 and X4+ TGF-. Beta.2KO cells (FIG. 25C). From the data presented, it can be seen that both TGF- β2ko edited PEC conditioned media support reduced migration of fibroblasts compared to the wild type.

Example 29: in vivo efficacy study of TXNIP KO/MANF-P2A-HLA-E KI and B2M KO/TNFAIP3 (A20) -P2A-PD-L-1KI, CIITA KO/CD39 KI and TGF-. Beta.2KO cells

In vivo efficacy of PEC stage and stage 6 cells differentiated from control cells (NCG) or the x4+ TGF- β2ko cell lines produced in example 24 (i.e., TXNIP KO/MANF-P2A-HLA-E KI, B2M KO/TNFAIP3 (a 20) -P2A-PD-L-1KI, CIITA KO/CD39 KI and TGF- β2ko) will be tested. The test or control vesicles were transplanted into the left kidney of NSG mice (Jackson Laboratory Stock No: 005557).

GSIS testing will be performed at weeks 12, 16, 20 and 24, as described for X1 cells in example 14. At week 26, after GSIS testing, animals were euthanized and removed test articles were fixed in neutral buffered formalin, processed into slides, and stained with H & E, and insulin and glucagon were determined by immunohistochemistry.

Sequence listing

<110> kriging medical Co., ltd

A Lei Zani subunit

Varentine-s Lu Ji

<120> Universal donor cells

<130> CT154-PCT2

<150> US 63/132,890

<151> 2020-12-31

<150> US 63/234,997

<151> 2021-08-19

<150> US 63/288,356

<151> 2021-12-10

<160> 60

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 1

gctactctct ctttctggcc 20

<210> 2

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 2

ggccgagatg tctcgctccg 20

<210> 3

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 3

cgcgagcaca gctaaggcca 20

<210> 4

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 4

tataagtgga ggcgtcgcgc 20

<210> 5

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 5

gagtagcgcg agcacagcta 20

<210> 6

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 6

actggacgcg tcgcgctggc 20

<210> 7

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 7

aagtggaggc gtcgcgctgg 20

<210> 8

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 8

ggccacggag cgagacatct 20

<210> 9

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 9

gcccgaatgc tgtcagcttc 20

<210> 10

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 10

ctcgcgctac tctctctttc 20

<210> 11

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 11

tcctgaagct gacagcattc 20

<210> 12

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 12

ttcctgaagc tgacagcatt 20

<210> 13

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 13

actctctctt tctggcctgg 20

<210> 14

<211> 130

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 14

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct 130

<210> 15

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 15

gttctagggt ggaaactaag agaatgatgt acctagaggg cgctggaagc tctaaagccc 60

tagcagttac tgcttttact attagtggtc gtttttttct cccccccgcc ccccgacaaa 120

tcaacagaac aaagaaaatt acctaaacag caaggacata gggaggaact tcttggcaca 180

gaactttcca aacacttttt cctgaaggga tacaagaagc aagaaaggta ctctttcact 240

aggaccttct ctgagctgtc ctcaggatgc ttttgggact atttttctta cccagagaat 300

ggagaaaccc tgcagggaat tcccaagctg tagttataaa cagaagttct ccttctgcta 360

ggtagcattc aaagatctta atcttctggg tttccgtttt ctcgaatgaa aaatgcaggt 420

ccgagcagtt aactggctgg ggcaccatta gcaagtcact tagcatctct ggggccagtc 480

tgcaaagcga gggggcagcc ttaatgtgcc tccagcctga agtcctagaa tgagcgcccg 540

gtgtcccaag ctggggcgcg caccccagat cggagggcgc cgatgtacag acagcaaact 600

cacccagtct agtgcatgcc ttcttaaaca tcacgagact ctaagaaaag gaaactgaaa 660

acgggaaagt ccctctctct aacctggcac tgcgtcgctg gcttggagac aggtgacggt 720

ccctgcgggc cttgtcctga ttggctgggc acgcgtttaa tataagtgga ggcgtcgcgc 780

tggcgggcat tcctgaagct 800

<210> 16

<211> 1667

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 16

gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60

catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120

acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180

ctttccattg acgtcaatgg gtggactatt tacggtaaac tgcccacttg gcagtacatc 240

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300

ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360

tagtcatcgc tattaccatg ggtcgaggtg agccccacgt tctgcttcac tctccccatc 420

tcccccccct ccccaccccc aattttgtat ttatttattt tttaattatt ttgtgcagcg 480

atgggggcgg gggggggggg ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg 540

cggggcgagg cggagaggtg cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc 600

ttttatggcg aggcggcggc ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcggg 660

agtcgctgcg ttgccttcgc cccgtgcccc gctccgcgcc gcctcgcgcc gcccgccccg 720

gctctgactg accgcgttac tcccacaggt gagcgggcgg gacggccctt ctcctccggg 780

ctgtaattag cgcttggttt aatgacggct cgtttctttt ctgtggctgc gtgaaagcct 840

taaagggctc cgggagggcc ctttgtgcgg gggggagcgg ctcggggggt gcgtgcgtgt 900

gtgtgtgcgt ggggagcgcc gcgtgcggcc cgcgctgccc ggcggctgtg agcgctgcgg 960

gcgcggcgcg gggctttgtg cgctccgcgt gtgcgcgagg ggagcgcggc cgggggcggt 1020

gccccgcggt gcgggggggc tgcgagggga acaaaggctg cgtgcggggt gtgtgcgtgg 1080

gggggtgagc agggggtgtg ggcgcggcgg tcgggctgta acccccccct gcacccccct 1140

ccccgagttg ctgagcacgg cccggcttcg ggtgcggggc tccgtgcggg gcgtggcgcg 1200

gggctcgccg tgccgggcgg ggggtggcgg caggtggggg tgccgggcgg ggcggggccg 1260

cctcgggccg gggagggctc gggggagggg cgcggcggcc ccggagcgcc ggcggctgtc 1320

gaggcgcggc gagccgcagc cattgccttt tatggtaatc gtgcgagagg gcgcagggac 1380

ttcctttgtc ccaaatctgg cggagccgaa atctgggagg cgccgccgca ccccctctag 1440

cgggcgcggg cgaagcggtg cggcgccggc aggaaggaaa tgggcgggga gggccttcgt 1500

gcgtcgccgc gccgccgtcc ccttctccat ctccagcctc ggggctgccg cagggggacg 1560

gctgccttcg ggggggacgg ggcagggcgg ggttcggctt ctggcgtgtg accggcggct 1620

ctagagcctc tgctaaccat gttcatgcct tcttcttttt cctacag 1667

<210> 17

<211> 546

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 17

atgaggagga tgtgggccac gcaggggctg gcggtggcgc tggctctgag cgtgctgccg 60

ggcagccggg cgctgcggcc gggcgactgc gaagtttgta tttcttatct gggaagattt 120

taccaggacc tcaaagacag agatgtcaca ttctcaccag ccactattga aaacgaactt 180

ataaagttct gccgggaagc aagaggcaaa gagaatcggt tgtgctacta tatcggggcc 240

acagatgatg cagccaccaa aatcatcaat gaggtatcaa agcctctggc ccaccacatc 300

cctgtggaga agatctgtga gaagcttaag aagaaggaca gccagatatg tgagcttaag 360

tatgacaagc agatcgacct gagcacagtg gacctgaaga agctccgagt taaagagctg 420

aagaagattc tggatgactg gggggagaca tgcaaaggct gtgcagaaaa gtctgactac 480

atccggaaga taaatgaact gatgcctaaa tatgccccca aggcagccag tgcacggacc 540

gatttg 546

<210> 18

<211> 57

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 18

gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacct 57

<210> 19

<211> 2370

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 19

atggctgaac aagtccttcc tcaggctttg tatttgagca atatgcggaa agctgtgaag 60

atacgggaga gaactccaga agacattttt aaacctacta atgggatcat tcatcatttt 120

aaaaccatgc accgatacac actggaaatg ttcagaactt gccagttttg tcctcagttt 180

cgggagatca tccacaaagc cctcatcgac agaaacatcc aggccaccct ggaaagccag 240

aagaaactca actggtgtcg agaagtccgg aagcttgtgg cgctgaaaac gaacggtgac 300

ggcaattgcc tcatgcatgc cacttctcag tacatgtggg gcgttcagga cacagacttg 360

gtactgagga aggcgctgtt cagcacgctc aaggaaacag acacacgcaa ctttaaattc 420

cgctggcaac tggagtctct caaatctcag gaatttgttg aaacggggct ttgctatgat 480

actcggaact ggaatgatga atgggacaat cttatcaaaa tggcttccac agacacaccc 540

atggcccgaa gtggacttca gtacaactca ctggaagaaa tacacatatt tgtcctttgc 600

aacatcctca gaaggccaat cattgtcatt tcagacaaaa tgctaagaag tttggaatca 660

ggttccaatt tcgccccttt gaaagtgggt ggaatttact tgcctctcca ctggcctgcc 720

caggaatgct acagataccc cattgttctc ggctatgaca gccatcattt tgtacccttg 780

gtgaccctga aggacagtgg gcctgaaatc cgagctgttc cacttgttaa cagagaccgg 840

ggaagatttg aagacttaaa agttcacttt ttgacagatc ctgaaaatga gatgaaggag 900

aagctcttaa aagagtactt aatggtgata gaaatccccg tccaaggctg ggaccatggc 960

acaactcatc tcatcaatgc cgcaaagttg gatgaagcta acttaccaaa agaaatcaat 1020

ctggtagatg attactttga acttgttcag catgagtaca agaaatggca ggaaaacagc 1080

gagcagggga ggagagaggg gcacgcccag aatcccatgg aaccttccgt gccccagctt 1140

tctctcatgg atgtaaaatg tgaaacgccc aactgcccct tcttcatgtc tgtgaacacc 1200

cagcctttat gccatgagtg ctcagagagg cggcaaaaga atcaaaacaa actcccaaag 1260

ctgaactcca agccgggccc tgaggggctc cctggcatgg cgctcggggc ctctcgggga 1320

gaagcctatg agcccttggc gtggaaccct gaggagtcca ctggggggcc tcattcggcc 1380

ccaccgacag cacccagccc ttttctgttc agtgagacca ctgccatgaa gtgcaggagc 1440

cccggctgcc ccttcacact gaatgtgcag cacaacggat tttgtgaacg ttgccacaac 1500

gcccggcaac ttcacgccag ccacgcccca gaccacacaa ggcacttgga tcccgggaag 1560

tgccaagcct gcctccagga tgttaccagg acatttaatg ggatctgcag tacttgcttc 1620

aaaaggacta cagcagaggc ctcctccagc ctcagcacca gcctccctcc ttcctgtcac 1680

cagcgttcca agtcagatcc ctcgcggctc gtccggagcc cctccccgca ttcttgccac 1740

agagctggaa acgacgcccc tgctggctgc ctgtctcaag ctgcacggac tcctggggac 1800

aggacgggga cgagcaagtg cagaaaagcc ggctgcgtgt attttgggac tccagaaaac 1860

aagggctttt gcacactgtg tttcatcgag tacagagaaa acaaacattt tgctgctgcc 1920

tcagggaaag tcagtcccac agcgtccagg ttccagaaca ccattccgtg cctggggagg 1980

gaatgcggca cccttggaag caccatgttt gaaggatact gccagaagtg tttcattgaa 2040

gctcagaatc agagatttca tgaggccaaa aggacagaag agcaactgag atcgagccag 2100

cgcagagatg tgcctcgaac cacacaaagc acctcaaggc ccaagtgcgc ccgggcctcc 2160

tgcaagaaca tcctggcctg ccgcagcgag gagctctgca tggagtgtca gcatcccaac 2220

cagaggatgg gccctggggc ccaccggggt gagcctgccc ccgaagaccc ccccaagcag 2280

cgttgccggg cccccgcctg tgatcatttt ggcaatgcca agtgcaacgg ctactgcaac 2340

gaatgctttc agttcaagca gatgtatggc 2370

<210> 20

<211> 873

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 20

atgaggatat ttgctgtctt tatattcatg acctactggc atttgctgaa cgcatttact 60

gtcacggttc ccaaggacct atatgtggta gagtatggta gcaatatgac aattgaatgc 120

aaattcccag tagaaaaaca attagacctg gctgcactaa ttgtctattg ggaaatggag 180

gataagaaca ttattcaatt tgtgcatgga gaggaagacc tgaaggttca gcatagtagc 240

tacagacaga gggcccggct gttgaaggac cagctctccc tgggaaatgc tgcacttcag 300

atcacagatg tgaaattgca ggatgcaggg gtgtaccgct gcatgatcag ctatggtggt 360

gccgactaca agcgaattac tgtgaaagtc aatgccccat acaacaaaat caaccaaaga 420

attttggttg tggatccagt cacctctgaa catgaactga catgtcaggc tgagggctac 480

cccaaggccg aagtcatctg gacaagcagt gaccatcaag tcctgagtgg taagaccacc 540

accaccaatt ccaagagaga ggagaaactt ttcaatgtga ccagcacact gagaatcaac 600

acaacaacta atgagatttt ctactgcact tttaggagat tagatcctga ggaaaaccat 660

acagctgaat tggtcatccc agaactacct ctggcacatc ctccaaatga aaggactcac 720

ttggtaattc tgggagccat cttattatgc cttggtgtag cactgacatt catcttccgt 780

ttaagaaaag ggagaatgat ggatgtgaaa aaatgtggca tccaagatac aaactcaaag 840

aagcaaagtg atacacattt ggaggagacg taa 873

<210> 21

<211> 225

<212> DNA

<213> cattle (Bos taurus)

<400> 21

gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg 60

gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg 120

agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg 180

gaagacaata gcaggcatgc tggggatgcg gtgggctcta tgggt 225

<210> 22

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 22

ccagcgtgag tctctcctac cctcccgctc tggtccttcc tctcccgctc tgcaccctct 60

gtggccctcg ctgtgctctc tcgctccgtg acttcccttc tccaagttct ccttggtggc 120

ccgccgtggg gctagtccag ggctggatct cggggaagcg gcggggtggc ctgggagtgg 180

ggaagggggt gcgcacccgg gacgcgcgct acttgcccct ttcggcgggg agcaggggag 240

acctttggcc tacggcgacg ggagggtcgg gacaaagttt agggcgtcga taagcgtcag 300

agcgccgagg ttgggggagg gtttctcttc cgctctttcg cggggcctct ggctccccca 360

gcgcagctgg agtgggggac gggtaggctc gtcccaaagg cgcggcgctg aggtttgtga 420

acgcgtggag gggcgcttgg ggtctggggg aggcgtcgcc cgggtaagcc tgtctgctgc 480

ggctctgctt cccttagact ggagagctgt ggacttcgtc taggcgcccg ctaagttcgc 540

atgtcctagc acctctgggt ctatgtgggg ccacaccgtg gggaggaaac agcacgcgac 600

gtttgtagaa tgcttggctg tgatacaaag cggtttcgaa taattaactt atttgttccc 660

atcacatgtc acttttaaaa aattataaga actacccgtt attgacatct ttctgtgtgc 720

caaggacttt atgtgctttg cgtcatttaa ttttgaaaac agttatcttc cgccatagat 780

aactactatg gttatcttct 800

<210> 23

<211> 141

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 23

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120

gagcgcgcag ctgcctgcag g 141

<210> 24

<211> 10181

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 24

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtgttcta gggtggaaac taagagaatg atgtacctag 180

agggcgctgg aagctctaaa gccctagcag ttactgcttt tactattagt ggtcgttttt 240

ttctcccccc cgccccccga caaatcaaca gaacaaagaa aattacctaa acagcaagga 300

catagggagg aacttcttgg cacagaactt tccaaacact ttttcctgaa gggatacaag 360

aagcaagaaa ggtactcttt cactaggacc ttctctgagc tgtcctcagg atgcttttgg 420

gactattttt cttacccaga gaatggagaa accctgcagg gaattcccaa gctgtagtta 480

taaacagaag ttctccttct gctaggtagc attcaaagat cttaatcttc tgggtttccg 540

ttttctcgaa tgaaaaatgc aggtccgagc agttaactgg ctggggcacc attagcaagt 600

cacttagcat ctctggggcc agtctgcaaa gcgagggggc agccttaatg tgcctccagc 660

ctgaagtcct agaatgagcg cccggtgtcc caagctgggg cgcgcacccc agatcggagg 720

gcgccgatgt acagacagca aactcaccca gtctagtgca tgccttctta aacatcacga 780

gactctaaga aaaggaaact gaaaacggga aagtccctct ctctaacctg gcactgcgtc 840

gctggcttgg agacaggtga cggtccctgc gggccttgtc ctgattggct gggcacgcgt 900

ttaatataag tggaggcgtc gcgctggcgg gcattcctga agctaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatgagga ggatgtgggc 2700

cacgcagggg ctggcggtgg cgctggctct gagcgtgctg ccgggcagcc gggcgctgcg 2760

gccgggcgac tgcgaagttt gtatttctta tctgggaaga ttttaccagg acctcaaaga 2820

cagagatgtc acattctcac cagccactat tgaaaacgaa cttataaagt tctgccggga 2880

agcaagaggc aaagagaatc ggttgtgcta ctatatcggg gccacagatg atgcagccac 2940

caaaatcatc aatgaggtat caaagcctct ggcccaccac atccctgtgg agaagatctg 3000

tgagaagctt aagaagaagg acagccagat atgtgagctt aagtatgaca agcagatcga 3060

cctgagcaca gtggacctga agaagctccg agttaaagag ctgaagaaga ttctggatga 3120

ctggggggag acatgcaaag gctgtgcaga aaagtctgac tacatccgga agataaatga 3180

actgatgcct aaatatgccc ccaaggcagc cagtgcacgg accgatttgg gaagcggagc 3240

tactaacttc agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatggc 3300

tgaacaagtc cttcctcagg ctttgtattt gagcaatatg cggaaagctg tgaagatacg 3360

ggagagaact ccagaagaca tttttaaacc tactaatggg atcattcatc attttaaaac 3420

catgcaccga tacacactgg aaatgttcag aacttgccag ttttgtcctc agtttcggga 3480

gatcatccac aaagccctca tcgacagaaa catccaggcc accctggaaa gccagaagaa 3540

actcaactgg tgtcgagaag tccggaagct tgtggcgctg aaaacgaacg gtgacggcaa 3600

ttgcctcatg catgccactt ctcagtacat gtggggcgtt caggacacag acttggtact 3660

gaggaaggcg ctgttcagca cgctcaagga aacagacaca cgcaacttta aattccgctg 3720

gcaactggag tctctcaaat ctcaggaatt tgttgaaacg gggctttgct atgatactcg 3780

gaactggaat gatgaatggg acaatcttat caaaatggct tccacagaca cacccatggc 3840

ccgaagtgga cttcagtaca actcactgga agaaatacac atatttgtcc tttgcaacat 3900

cctcagaagg ccaatcattg tcatttcaga caaaatgcta agaagtttgg aatcaggttc 3960

caatttcgcc cctttgaaag tgggtggaat ttacttgcct ctccactggc ctgcccagga 4020

atgctacaga taccccattg ttctcggcta tgacagccat cattttgtac ccttggtgac 4080

cctgaaggac agtgggcctg aaatccgagc tgttccactt gttaacagag accggggaag 4140

atttgaagac ttaaaagttc actttttgac agatcctgaa aatgagatga aggagaagct 4200

cttaaaagag tacttaatgg tgatagaaat ccccgtccaa ggctgggacc atggcacaac 4260

tcatctcatc aatgccgcaa agttggatga agctaactta ccaaaagaaa tcaatctggt 4320

agatgattac tttgaacttg ttcagcatga gtacaagaaa tggcaggaaa acagcgagca 4380

ggggaggaga gaggggcacg cccagaatcc catggaacct tccgtgcccc agctttctct 4440

catggatgta aaatgtgaaa cgcccaactg ccccttcttc atgtctgtga acacccagcc 4500

tttatgccat gagtgctcag agaggcggca aaagaatcaa aacaaactcc caaagctgaa 4560

ctccaagccg ggccctgagg ggctccctgg catggcgctc ggggcctctc ggggagaagc 4620

ctatgagccc ttggcgtgga accctgagga gtccactggg gggcctcatt cggccccacc 4680

gacagcaccc agcccttttc tgttcagtga gaccactgcc atgaagtgca ggagccccgg 4740

ctgccccttc acactgaatg tgcagcacaa cggattttgt gaacgttgcc acaacgcccg 4800

gcaacttcac gccagccacg ccccagacca cacaaggcac ttggatcccg ggaagtgcca 4860

agcctgcctc caggatgtta ccaggacatt taatgggatc tgcagtactt gcttcaaaag 4920

gactacagca gaggcctcct ccagcctcag caccagcctc cctccttcct gtcaccagcg 4980

ttccaagtca gatccctcgc ggctcgtccg gagcccctcc ccgcattctt gccacagagc 5040

tggaaacgac gcccctgctg gctgcctgtc tcaagctgca cggactcctg gggacaggac 5100

ggggacgagc aagtgcagaa aagccggctg cgtgtatttt gggactccag aaaacaaggg 5160

cttttgcaca ctgtgtttca tcgagtacag agaaaacaaa cattttgctg ctgcctcagg 5220

gaaagtcagt cccacagcgt ccaggttcca gaacaccatt ccgtgcctgg ggagggaatg 5280

cggcaccctt ggaagcacca tgtttgaagg atactgccag aagtgtttca ttgaagctca 5340

gaatcagaga tttcatgagg ccaaaaggac agaagagcaa ctgagatcga gccagcgcag 5400

agatgtgcct cgaaccacac aaagcacctc aaggcccaag tgcgcccggg cctcctgcaa 5460

gaacatcctg gcctgccgca gcgaggagct ctgcatggag tgtcagcatc ccaaccagag 5520

gatgggccct ggggcccacc ggggtgagcc tgcccccgaa gaccccccca agcagcgttg 5580

ccgggccccc gcctgtgatc attttggcaa tgccaagtgc aacggctact gcaacgaatg 5640

ctttcagttc aagcagatgt atggcggaag cggagctact aacttcagcc tgctgaagca 5700

ggctggagac gtggaggaga accctggacc tatgaggata tttgctgtct ttatattcat 5760

gacctactgg catttgctga acgcatttac tgtcacggtt cccaaggacc tatatgtggt 5820

agagtatggt agcaatatga caattgaatg caaattccca gtagaaaaac aattagacct 5880

ggctgcacta attgtctatt gggaaatgga ggataagaac attattcaat ttgtgcatgg 5940

agaggaagac ctgaaggttc agcatagtag ctacagacag agggcccggc tgttgaagga 6000

ccagctctcc ctgggaaatg ctgcacttca gatcacagat gtgaaattgc aggatgcagg 6060

ggtgtaccgc tgcatgatca gctatggtgg tgccgactac aagcgaatta ctgtgaaagt 6120

caatgcccca tacaacaaaa tcaaccaaag aattttggtt gtggatccag tcacctctga 6180

acatgaactg acatgtcagg ctgagggcta ccccaaggcc gaagtcatct ggacaagcag 6240

tgaccatcaa gtcctgagtg gtaagaccac caccaccaat tccaagagag aggagaaact 6300

tttcaatgtg accagcacac tgagaatcaa cacaacaact aatgagattt tctactgcac 6360

ttttaggaga ttagatcctg aggaaaacca tacagctgaa ttggtcatcc cagaactacc 6420

tctggcacat cctccaaatg aaaggactca cttggtaatt ctgggagcca tcttattatg 6480

ccttggtgta gcactgacat tcatcttccg tttaagaaaa gggagaatga tggatgtgaa 6540

aaaatgtggc atccaagata caaactcaaa gaagcaaagt gatacacatt tggaggagac 6600

gtaaccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct 6660

cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 6720

aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc 6780

aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 6840

ctatgggtcg acccagcgtg agtctctcct accctcccgc tctggtcctt cctctcccgc 6900

tctgcaccct ctgtggccct cgctgtgctc tctcgctccg tgacttccct tctccaagtt 6960

ctccttggtg gcccgccgtg gggctagtcc agggctggat ctcggggaag cggcggggtg 7020

gcctgggagt ggggaagggg gtgcgcaccc gggacgcgcg ctacttgccc ctttcggcgg 7080

ggagcagggg agacctttgg cctacggcga cgggagggtc gggacaaagt ttagggcgtc 7140

gataagcgtc agagcgccga ggttggggga gggtttctct tccgctcttt cgcggggcct 7200

ctggctcccc cagcgcagct ggagtggggg acgggtaggc tcgtcccaaa ggcgcggcgc 7260

tgaggtttgt gaacgcgtgg aggggcgctt ggggtctggg ggaggcgtcg cccgggtaag 7320

cctgtctgct gcggctctgc ttcccttaga ctggagagct gtggacttcg tctaggcgcc 7380

cgctaagttc gcatgtccta gcacctctgg gtctatgtgg ggccacaccg tggggaggaa 7440

acagcacgcg acgtttgtag aatgcttggc tgtgatacaa agcggtttcg aataattaac 7500

ttatttgttc ccatcacatg tcacttttaa aaaattataa gaactacccg ttattgacat 7560

ctttctgtgt gccaaggact ttatgtgctt tgcgtcattt aattttgaaa acagttatct 7620

tccgccatag ataactacta tggttatctt ctggtaacca cgtgcggacc gaggctgcag 7680

cgtcgtcctc cctaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc 7740

tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc 7800

tcagtgagcg agcgagcgcg cagctgcctg caggggcgcc tgatgcggta ttttctcctt 7860

acgcatctgt gcggtatttc acaccgcata cgtcaaagca accatagtac gcgccctgta 7920

gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 7980

gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 8040

ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 8100

acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca tcgccctgat 8160

agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 8220

aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc 8280

cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta 8340

acaaaatatt aacgtttaca attttatggt gcactctcag tacaatctgc tctgatgccg 8400

catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 8460

tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 8520

ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt 8580

tataggttaa tgtcatgaac aataaaactg tctgcttaca taaacagtaa tacaaggggt 8640

gttatgagcc atattcaacg ggaaacgtcg aggccgcgat taaattccaa catggatgct 8700

gatttatatg ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat 8760

cgcttgtatg ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt 8820

gccaatgatg ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt 8880

ccgaccatca agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc 8940

cccggaaaaa cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt 9000

gatgcgctgg cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt 9060

aacagcgatc gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt 9120

gatgcgagtg attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa 9180

atgcataaac ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt 9240

gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga 9300

atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct 9360

tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg 9420

cagtttcatt tgatgctcga tgagtttttc taatctcatg accaaaatcc cttaacgtga 9480

gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 9540

tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt 9600

ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 9660

gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc 9720

tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 9780

cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 9840

gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 9900

actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 9960

ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 10020

gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 10080

atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 10140

tttacggttc ctggcctttt gctggccttt tgctcacatg t 10181

<210> 25

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 25

ggtccatctg gtcatagaag 20

<210> 26

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 26

catatttatg gggtatatgt gaatatttat tacatgcata gaaggtataa tgatcatgtc 60

aggatatttg aggtatccac atttgggatt gtttaaagat taaatgaaat agtgttaaaa 120

gtatttaata tgcccttcaa caaatgatga ggaaatctta gaatctgctc agactccttc 180

agtttacata ttaggaaact gaggcacaga aaggagcaga gacttgctca agtccaccca 240

aagcagtaga gcattgtggt taaatgcagg acttcagtca gactgtctgg gttcaaatcc 300

tggttccact tggacatggg tttccttaca taaatcactt cacctctctg agcctcagtt 360

ttctcatatg caaagtgagg ataataataa taccttcctt acatggttac tgatatgagt 420

attaaatgtg ccagctcatg tgcctggcgt ataggaggtg ctttataaac cttagctgtt 480

accactcatg gcattgccaa atgtgggacg ggtctcctga ctctctggtg tgagattgat 540

ggaatccaca ctttccagtt cccttttcta cctcctgggt atcttctcat atggttgtaa 600

gttccttgga ggaagggaat gtggcttgct ctctccacca cgctgagcat ataagaggtg 660

ctgaatgagc gcttttattc actcctctca tccccagccc tcaccagctg ggagttgttg 720

taggtgtcaa ttttctgcct ctttccaaca ccctgtgagg tgactgagca ttgtcttccc 780

tcccaggcag ctcacagtgt 800

<210> 27

<211> 1530

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 27

atggaagata caaaggagtc taacgtgaag acattttgct ccaagaatat cctagccatc 60

cttggcttct cctctatcat agctgtgata gctttgcttg ctgtggggtt gacccagaac 120

aaagcattgc cagaaaacgt taagtatggg attgtgctgg atgcgggttc ttctcacaca 180

agtttataca tctataagtg gccagcagaa aaggagaatg acacaggcgt ggtgcatcaa 240

gtagaagaat gcagggttaa aggtcctgga atctcaaaat ttgttcagaa agtaaatgaa 300

ataggcattt acctgactga ttgcatggaa agagctaggg aagtgattcc aaggtcccag 360

caccaagaga cacccgttta cctgggagcc acggcaggca tgcggttgct caggatggaa 420

agtgaagagt tggcagacag ggttctggat gtggtggaga ggagcctcag caactacccc 480

tttgacttcc agggtgccag gatcattact ggccaagagg aaggtgccta tggctggatt 540

actatcaact atctgctggg caaattcagt cagaaaacaa ggtggttcag catagtccca 600

tatgaaacca ataatcagga aacctttgga gctttggacc ttgggggagc ctctacacaa 660

gtcacttttg taccccaaaa ccagactatc gagtccccag ataatgctct gcaatttcgc 720

ctctatggca aggactacaa tgtctacaca catagcttct tgtgctatgg gaaggatcag 780

gcactctggc agaaactggc caaggacatt caggttgcaa gtaatgaaat tctcagggac 840

ccatgctttc atcctggata taagaaggta gtgaacgtaa gtgaccttta caagaccccc 900

tgcaccaaga gatttgagat gactcttcca ttccagcagt ttgaaatcca gggtattgga 960

aactatcaac aatgccatca aagcatcctg gagctcttca acaccagtta ctgcccttac 1020

tcccagtgtg ccttcaatgg gattttcttg ccaccactcc agggggattt tggggcattt 1080

tcagcttttt actttgtgat gaagttttta aacttgacat cagagaaagt ctctcaggaa 1140

aaggtgactg agatgatgaa aaagttctgt gctcagcctt gggaggagat aaaaacatct 1200

tacgctggag taaaggagaa gtacctgagt gaatactgct tttctggtac ctacattctc 1260

tccctccttc tgcaaggcta tcatttcaca gctgattcct gggagcacat ccatttcatt 1320

ggcaagatcc agggcagcga cgccggctgg actttgggct acatgctgaa cctgaccaac 1380

atgatcccag ctgagcaacc attgtccaca cctctctccc actccaccta tgtcttcctc 1440

atggttctat tctccctggt ccttttcaca gtggccatca taggcttgct tatctttcac 1500

aagccttcat atttctggaa agatatggta 1530

<210> 28

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 28

tgaccagatg gacctggctg gagaagaaga gattgagctc tactcaggtg ggccctcctc 60

cctctggtct cttccggtat cccccacccc tcagcttgct gtagagacgg caatcagggg 120

aaattctggt ccctgccctc ccgtcagcac cacggacagc tcccacgtct gtgggacgct 180

ctctgcagat ggggatgatc tcccagccct gccccgcctc tccctcgttc cccaccagcc 240

ctctttccag aaatttcctt cttcatccaa gggacttttc ctcccagaac ccgacacaga 300

caccatcaac tgcgaccagt tcagcaggct gttgtgtgac atggaaggtg atgaagagac 360

cagggaggct tatgccaata tcggtgagga agcacctgag cccagaaaag gacaatcaag 420

ggcaagagtt ctttgctgcc acttgtcaat atcacccatt catcatgagc cacgtcagtc 480

ccctcccaca gaaatcattg caagggggat gcggagcaat ggctggagga acggagactc 540

cagggaagag aggggagatg gaggccagtg ggggaaatag gccccttcac taatgaccac 600

caagaaaaca aaatctcatg tttacatcct ccacctccat ttctatacgc atttctgctt 660

cttgctcttc tgtccatcct ttctacaaag cccataccat acaccccttt cccttttcct 720

cccagctcct tagccaagct actctagtat ttgtaataac tagcatttac tggatactca 780

tagtatgctc attgctgtcc 800

<210> 29

<211> 7799

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 29

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtcatatt tatggggtat atgtgaatat ttattacatg 180

catagaaggt ataatgatca tgtcaggata tttgaggtat ccacatttgg gattgtttaa 240

agattaaatg aaatagtgtt aaaagtattt aatatgccct tcaacaaatg atgaggaaat 300

cttagaatct gctcagactc cttcagttta catattagga aactgaggca cagaaaggag 360

cagagacttg ctcaagtcca cccaaagcag tagagcattg tggttaaatg caggacttca 420

gtcagactgt ctgggttcaa atcctggttc cacttggaca tgggtttcct tacataaatc 480

acttcacctc tctgagcctc agttttctca tatgcaaagt gaggataata ataatacctt 540

ccttacatgg ttactgatat gagtattaaa tgtgccagct catgtgcctg gcgtatagga 600

ggtgctttat aaaccttagc tgttaccact catggcattg ccaaatgtgg gacgggtctc 660

ctgactctct ggtgtgagat tgatggaatc cacactttcc agttcccttt tctacctcct 720

gggtatcttc tcatatggtt gtaagttcct tggaggaagg gaatgtggct tgctctctcc 780

accacgctga gcatataaga ggtgctgaat gagcgctttt attcactcct ctcatcccca 840

gccctcacca gctgggagtt gttgtaggtg tcaattttct gcctctttcc aacaccctgt 900

gaggtgactg agcattgtct tccctcccag gcagctcaca gtgtaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatggaag atacaaagga 2700

gtctaacgtg aagacatttt gctccaagaa tatcctagcc atccttggct tctcctctat 2760

catagctgtg atagctttgc ttgctgtggg gttgacccag aacaaagcat tgccagaaaa 2820

cgttaagtat gggattgtgc tggatgcggg ttcttctcac acaagtttat acatctataa 2880

gtggccagca gaaaaggaga atgacacagg cgtggtgcat caagtagaag aatgcagggt 2940

taaaggtcct ggaatctcaa aatttgttca gaaagtaaat gaaataggca tttacctgac 3000

tgattgcatg gaaagagcta gggaagtgat tccaaggtcc cagcaccaag agacacccgt 3060

ttacctggga gccacggcag gcatgcggtt gctcaggatg gaaagtgaag agttggcaga 3120

cagggttctg gatgtggtgg agaggagcct cagcaactac ccctttgact tccagggtgc 3180

caggatcatt actggccaag aggaaggtgc ctatggctgg attactatca actatctgct 3240

gggcaaattc agtcagaaaa caaggtggtt cagcatagtc ccatatgaaa ccaataatca 3300

ggaaaccttt ggagctttgg accttggggg agcctctaca caagtcactt ttgtacccca 3360

aaaccagact atcgagtccc cagataatgc tctgcaattt cgcctctatg gcaaggacta 3420

caatgtctac acacatagct tcttgtgcta tgggaaggat caggcactct ggcagaaact 3480

ggccaaggac attcaggttg caagtaatga aattctcagg gacccatgct ttcatcctgg 3540

atataagaag gtagtgaacg taagtgacct ttacaagacc ccctgcacca agagatttga 3600

gatgactctt ccattccagc agtttgaaat ccagggtatt ggaaactatc aacaatgcca 3660

tcaaagcatc ctggagctct tcaacaccag ttactgccct tactcccagt gtgccttcaa 3720

tgggattttc ttgccaccac tccaggggga ttttggggca ttttcagctt tttactttgt 3780

gatgaagttt ttaaacttga catcagagaa agtctctcag gaaaaggtga ctgagatgat 3840

gaaaaagttc tgtgctcagc cttgggagga gataaaaaca tcttacgctg gagtaaagga 3900

gaagtacctg agtgaatact gcttttctgg tacctacatt ctctccctcc ttctgcaagg 3960

ctatcatttc acagctgatt cctgggagca catccatttc attggcaaga tccagggcag 4020

cgacgccggc tggactttgg gctacatgct gaacctgacc aacatgatcc cagctgagca 4080

accattgtcc acacctctct cccactccac ctatgtcttc ctcatggttc tattctccct 4140

ggtccttttc acagtggcca tcataggctt gcttatcttt cacaagcctt catatttctg 4200

gaaagatatg gtataatgat agccgctgat cagcctcgac tgtgccttct agttgccagc 4260

catctgttgt ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg 4320

tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc 4380

tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat agcaggcatg 4440

ctggggatgc ggtgggctct atgggtcgac tgaccagatg gacctggctg gagaagaaga 4500

gattgagctc tactcaggtg ggccctcctc cctctggtct cttccggtat cccccacccc 4560

tcagcttgct gtagagacgg caatcagggg aaattctggt ccctgccctc ccgtcagcac 4620

cacggacagc tcccacgtct gtgggacgct ctctgcagat ggggatgatc tcccagccct 4680

gccccgcctc tccctcgttc cccaccagcc ctctttccag aaatttcctt cttcatccaa 4740

gggacttttc ctcccagaac ccgacacaga caccatcaac tgcgaccagt tcagcaggct 4800

gttgtgtgac atggaaggtg atgaagagac cagggaggct tatgccaata tcggtgagga 4860

agcacctgag cccagaaaag gacaatcaag ggcaagagtt ctttgctgcc acttgtcaat 4920

atcacccatt catcatgagc cacgtcagtc ccctcccaca gaaatcattg caagggggat 4980

gcggagcaat ggctggagga acggagactc cagggaagag aggggagatg gaggccagtg 5040

ggggaaatag gccccttcac taatgaccac caagaaaaca aaatctcatg tttacatcct 5100

ccacctccat ttctatacgc atttctgctt cttgctcttc tgtccatcct ttctacaaag 5160

cccataccat acaccccttt cccttttcct cccagctcct tagccaagct actctagtat 5220

ttgtaataac tagcatttac tggatactca tagtatgctc attgctgtcc ggtaaccacg 5280

tgcggaccga ggctgcagcg tcgtcctccc taggaacccc tagtgatgga gttggccact 5340

ccctctctgc gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg 5400

ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca ggggcgcctg 5460

atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatacg tcaaagcaac 5520

catagtacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 5580

tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 5640

tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 5700

gatttagtgc tttacggcac ctcgacccca aaaaacttga tttgggtgat ggttcacgta 5760

gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 5820

atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc tattcttttg 5880

atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 5940

aatttaacgc gaattttaac aaaatattaa cgtttacaat tttatggtgc actctcagta 6000

caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 6060

cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 6120

ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc 6180

tcgtgatacg cctattttta taggttaatg tcatgaacaa taaaactgtc tgcttacata 6240

aacagtaata caaggggtgt tatgagccat attcaacggg aaacgtcgag gccgcgatta 6300

aattccaaca tggatgctga tttatatggg tataaatggg ctcgcgataa tgtcgggcaa 6360

tcaggtgcga caatctatcg cttgtatggg aagcccgatg cgccagagtt gtttctgaaa 6420

catggcaaag gtagcgttgc caatgatgtt acagatgaga tggtcagact aaactggctg 6480

acggaattta tgcctcttcc gaccatcaag cattttatcc gtactcctga tgatgcatgg 6540

ttactcacca ctgcgatccc cggaaaaaca gcattccagg tattagaaga atatcctgat 6600

tcaggtgaaa atattgttga tgcgctggca gtgttcctgc gccggttgca ttcgattcct 6660

gtttgtaatt gtccttttaa cagcgatcgc gtatttcgtc tcgctcaggc gcaatcacga 6720

atgaataacg gtttggttga tgcgagtgat tttgatgacg agcgtaatgg ctggcctgtt 6780

gaacaagtct ggaaagaaat gcataaactt ttgccattct caccggattc agtcgtcact 6840

catggtgatt tctcacttga taaccttatt tttgacgagg ggaaattaat aggttgtatt 6900

gatgttggac gagtcggaat cgcagaccga taccaggatc ttgccatcct atggaactgc 6960

ctcggtgagt tttctccttc attacagaaa cggctttttc aaaaatatgg tattgataat 7020

cctgatatga ataaattgca gtttcatttg atgctcgatg agtttttcta atctcatgac 7080

caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 7140

aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 7200

accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 7260

aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 7320

ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 7380

agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 7440

accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 7500

gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 7560

tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 7620

cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 7680

cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 7740

cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgt 7799

<210> 30

<211> 8729

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 30

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtgttcta gggtggaaac taagagaatg atgtacctag 180

agggcgctgg aagctctaaa gccctagcag ttactgcttt tactattagt ggtcgttttt 240

ttctcccccc cgccccccga caaatcaaca gaacaaagaa aattacctaa acagcaagga 300

catagggagg aacttcttgg cacagaactt tccaaacact ttttcctgaa gggatacaag 360

aagcaagaaa ggtactcttt cactaggacc ttctctgagc tgtcctcagg atgcttttgg 420

gactattttt cttacccaga gaatggagaa accctgcagg gaattcccaa gctgtagtta 480

taaacagaag ttctccttct gctaggtagc attcaaagat cttaatcttc tgggtttccg 540

ttttctcgaa tgaaaaatgc aggtccgagc agttaactgg ctggggcacc attagcaagt 600

cacttagcat ctctggggcc agtctgcaaa gcgagggggc agccttaatg tgcctccagc 660

ctgaagtcct agaatgagcg cccggtgtcc caagctgggg cgcgcacccc agatcggagg 720

gcgccgatgt acagacagca aactcaccca gtctagtgca tgccttctta aacatcacga 780

gactctaaga aaaggaaact gaaaacggga aagtccctct ctctaacctg gcactgcgtc 840

gctggcttgg agacaggtga cggtccctgc gggccttgtc ctgattggct gggcacgcgt 900

ttaatataag tggaggcgtc gcgctggcgg gcattcctga agctaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatggaag atacaaagga 2700

gtctaacgtg aagacatttt gctccaagaa tatcctagcc atccttggct tctcctctat 2760

catagctgtg atagctttgc ttgctgtggg gttgacccag aacaaagcat tgccagaaaa 2820

cgttaagtat gggattgtgc tggatgcggg ttcttctcac acaagtttat acatctataa 2880

gtggccagca gaaaaggaga atgacacagg cgtggtgcat caagtagaag aatgcagggt 2940

taaaggtcct ggaatctcaa aatttgttca gaaagtaaat gaaataggca tttacctgac 3000

tgattgcatg gaaagagcta gggaagtgat tccaaggtcc cagcaccaag agacacccgt 3060

ttacctggga gccacggcag gcatgcggtt gctcaggatg gaaagtgaag agttggcaga 3120

cagggttctg gatgtggtgg agaggagcct cagcaactac ccctttgact tccagggtgc 3180

caggatcatt actggccaag aggaaggtgc ctatggctgg attactatca actatctgct 3240

gggcaaattc agtcagaaaa caaggtggtt cagcatagtc ccatatgaaa ccaataatca 3300

ggaaaccttt ggagctttgg accttggggg agcctctaca caagtcactt ttgtacccca 3360

aaaccagact atcgagtccc cagataatgc tctgcaattt cgcctctatg gcaaggacta 3420

caatgtctac acacatagct tcttgtgcta tgggaaggat caggcactct ggcagaaact 3480

ggccaaggac attcaggttg caagtaatga aattctcagg gacccatgct ttcatcctgg 3540

atataagaag gtagtgaacg taagtgacct ttacaagacc ccctgcacca agagatttga 3600

gatgactctt ccattccagc agtttgaaat ccagggtatt ggaaactatc aacaatgcca 3660

tcaaagcatc ctggagctct tcaacaccag ttactgccct tactcccagt gtgccttcaa 3720

tgggattttc ttgccaccac tccaggggga ttttggggca ttttcagctt tttactttgt 3780

gatgaagttt ttaaacttga catcagagaa agtctctcag gaaaaggtga ctgagatgat 3840

gaaaaagttc tgtgctcagc cttgggagga gataaaaaca tcttacgctg gagtaaagga 3900

gaagtacctg agtgaatact gcttttctgg tacctacatt ctctccctcc ttctgcaagg 3960

ctatcatttc acagctgatt cctgggagca catccatttc attggcaaga tccagggcag 4020

cgacgccggc tggactttgg gctacatgct gaacctgacc aacatgatcc cagctgagca 4080

accattgtcc acacctctct cccactccac ctatgtcttc ctcatggttc tattctccct 4140

ggtccttttc acagtggcca tcataggctt gcttatcttt cacaagcctt catatttctg 4200

gaaagatatg gtaggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagacgt 4260

ggaggagaac cctggaccta tgaggatatt tgctgtcttt atattcatga cctactggca 4320

tttgctgaac gcatttactg tcacggttcc caaggaccta tatgtggtag agtatggtag 4380

caatatgaca attgaatgca aattcccagt agaaaaacaa ttagacctgg ctgcactaat 4440

tgtctattgg gaaatggagg ataagaacat tattcaattt gtgcatggag aggaagacct 4500

gaaggttcag catagtagct acagacagag ggcccggctg ttgaaggacc agctctccct 4560

gggaaatgct gcacttcaga tcacagatgt gaaattgcag gatgcagggg tgtaccgctg 4620

catgatcagc tatggtggtg ccgactacaa gcgaattact gtgaaagtca atgccccata 4680

caacaaaatc aaccaaagaa ttttggttgt ggatccagtc acctctgaac atgaactgac 4740

atgtcaggct gagggctacc ccaaggccga agtcatctgg acaagcagtg accatcaagt 4800

cctgagtggt aagaccacca ccaccaattc caagagagag gagaaacttt tcaatgtgac 4860

cagcacactg agaatcaaca caacaactaa tgagattttc tactgcactt ttaggagatt 4920

agatcctgag gaaaaccata cagctgaatt ggtcatccca gaactacctc tggcacatcc 4980

tccaaatgaa aggactcact tggtaattct gggagccatc ttattatgcc ttggtgtagc 5040

actgacattc atcttccgtt taagaaaagg gagaatgatg gatgtgaaaa aatgtggcat 5100

ccaagataca aactcaaaga agcaaagtga tacacatttg gaggagacgt aaccgctgat 5160

cagcctcgac tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 5220

ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 5280

cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 5340

gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atgggtcgac 5400

ccagcgtgag tctctcctac cctcccgctc tggtccttcc tctcccgctc tgcaccctct 5460

gtggccctcg ctgtgctctc tcgctccgtg acttcccttc tccaagttct ccttggtggc 5520

ccgccgtggg gctagtccag ggctggatct cggggaagcg gcggggtggc ctgggagtgg 5580

ggaagggggt gcgcacccgg gacgcgcgct acttgcccct ttcggcgggg agcaggggag 5640

acctttggcc tacggcgacg ggagggtcgg gacaaagttt agggcgtcga taagcgtcag 5700

agcgccgagg ttgggggagg gtttctcttc cgctctttcg cggggcctct ggctccccca 5760

gcgcagctgg agtgggggac gggtaggctc gtcccaaagg cgcggcgctg aggtttgtga 5820

acgcgtggag gggcgcttgg ggtctggggg aggcgtcgcc cgggtaagcc tgtctgctgc 5880

ggctctgctt cccttagact ggagagctgt ggacttcgtc taggcgcccg ctaagttcgc 5940

atgtcctagc acctctgggt ctatgtgggg ccacaccgtg gggaggaaac agcacgcgac 6000

gtttgtagaa tgcttggctg tgatacaaag cggtttcgaa taattaactt atttgttccc 6060

atcacatgtc acttttaaaa aattataaga actacccgtt attgacatct ttctgtgtgc 6120

caaggacttt atgtgctttg cgtcatttaa ttttgaaaac agttatcttc cgccatagat 6180

aactactatg gttatcttct ggtaaccacg tgcggaccga ggctgcagcg tcgtcctccc 6240

taggaacccc tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag 6300

gccgggcgac caaaggtcgc ccgacgcccg ggctttgccc gggcggcctc agtgagcgag 6360

cgagcgcgca gctgcctgca ggggcgcctg atgcggtatt ttctccttac gcatctgtgc 6420

ggtatttcac accgcatacg tcaaagcaac catagtacgc gccctgtagc ggcgcattaa 6480

gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc 6540

ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag 6600

ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca 6660

aaaaacttga tttgggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc 6720

gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa 6780

cactcaaccc tatctcgggc tattcttttg atttataagg gattttgccg atttcggcct 6840

attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa 6900

cgtttacaat tttatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc 6960

agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat 7020

ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg ttttcaccgt 7080

catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta taggttaatg 7140

tcatgaacaa taaaactgtc tgcttacata aacagtaata caaggggtgt tatgagccat 7200

attcaacggg aaacgtcgag gccgcgatta aattccaaca tggatgctga tttatatggg 7260

tataaatggg ctcgcgataa tgtcgggcaa tcaggtgcga caatctatcg cttgtatggg 7320

aagcccgatg cgccagagtt gtttctgaaa catggcaaag gtagcgttgc caatgatgtt 7380

acagatgaga tggtcagact aaactggctg acggaattta tgcctcttcc gaccatcaag 7440

cattttatcc gtactcctga tgatgcatgg ttactcacca ctgcgatccc cggaaaaaca 7500

gcattccagg tattagaaga atatcctgat tcaggtgaaa atattgttga tgcgctggca 7560

gtgttcctgc gccggttgca ttcgattcct gtttgtaatt gtccttttaa cagcgatcgc 7620

gtatttcgtc tcgctcaggc gcaatcacga atgaataacg gtttggttga tgcgagtgat 7680

tttgatgacg agcgtaatgg ctggcctgtt gaacaagtct ggaaagaaat gcataaactt 7740

ttgccattct caccggattc agtcgtcact catggtgatt tctcacttga taaccttatt 7800

tttgacgagg ggaaattaat aggttgtatt gatgttggac gagtcggaat cgcagaccga 7860

taccaggatc ttgccatcct atggaactgc ctcggtgagt tttctccttc attacagaaa 7920

cggctttttc aaaaatatgg tattgataat cctgatatga ataaattgca gtttcatttg 7980

atgctcgatg agtttttcta atctcatgac caaaatccct taacgtgagt tttcgttcca 8040

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 8100

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 8160

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 8220

tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 8280

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 8340

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 8400

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 8460

acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 8520

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 8580

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 8640

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 8700

ggccttttgc tggccttttg ctcacatgt 8729

<210> 31

<211> 9569

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 31

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtgttcta gggtggaaac taagagaatg atgtacctag 180

agggcgctgg aagctctaaa gccctagcag ttactgcttt tactattagt ggtcgttttt 240

ttctcccccc cgccccccga caaatcaaca gaacaaagaa aattacctaa acagcaagga 300

catagggagg aacttcttgg cacagaactt tccaaacact ttttcctgaa gggatacaag 360

aagcaagaaa ggtactcttt cactaggacc ttctctgagc tgtcctcagg atgcttttgg 420

gactattttt cttacccaga gaatggagaa accctgcagg gaattcccaa gctgtagtta 480

taaacagaag ttctccttct gctaggtagc attcaaagat cttaatcttc tgggtttccg 540

ttttctcgaa tgaaaaatgc aggtccgagc agttaactgg ctggggcacc attagcaagt 600

cacttagcat ctctggggcc agtctgcaaa gcgagggggc agccttaatg tgcctccagc 660

ctgaagtcct agaatgagcg cccggtgtcc caagctgggg cgcgcacccc agatcggagg 720

gcgccgatgt acagacagca aactcaccca gtctagtgca tgccttctta aacatcacga 780

gactctaaga aaaggaaact gaaaacggga aagtccctct ctctaacctg gcactgcgtc 840

gctggcttgg agacaggtga cggtccctgc gggccttgtc ctgattggct gggcacgcgt 900

ttaatataag tggaggcgtc gcgctggcgg gcattcctga agctaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatggctg aacaagtcct 2700

tcctcaggct ttgtatttga gcaatatgcg gaaagctgtg aagatacggg agagaactcc 2760

agaagacatt tttaaaccta ctaatgggat cattcatcat tttaaaacca tgcaccgata 2820

cacactggaa atgttcagaa cttgccagtt ttgtcctcag tttcgggaga tcatccacaa 2880

agccctcatc gacagaaaca tccaggccac cctggaaagc cagaagaaac tcaactggtg 2940

tcgagaagtc cggaagcttg tggcgctgaa aacgaacggt gacggcaatt gcctcatgca 3000

tgccacttct cagtacatgt ggggcgttca ggacacagac ttggtactga ggaaggcgct 3060

gttcagcacg ctcaaggaaa cagacacacg caactttaaa ttccgctggc aactggagtc 3120

tctcaaatct caggaatttg ttgaaacggg gctttgctat gatactcgga actggaatga 3180

tgaatgggac aatcttatca aaatggcttc cacagacaca cccatggccc gaagtggact 3240

tcagtacaac tcactggaag aaatacacat atttgtcctt tgcaacatcc tcagaaggcc 3300

aatcattgtc atttcagaca aaatgctaag aagtttggaa tcaggttcca atttcgcccc 3360

tttgaaagtg ggtggaattt acttgcctct ccactggcct gcccaggaat gctacagata 3420

ccccattgtt ctcggctatg acagccatca ttttgtaccc ttggtgaccc tgaaggacag 3480

tgggcctgaa atccgagctg ttccacttgt taacagagac cggggaagat ttgaagactt 3540

aaaagttcac tttttgacag atcctgaaaa tgagatgaag gagaagctct taaaagagta 3600

cttaatggtg atagaaatcc ccgtccaagg ctgggaccat ggcacaactc atctcatcaa 3660

tgccgcaaag ttggatgaag ctaacttacc aaaagaaatc aatctggtag atgattactt 3720

tgaacttgtt cagcatgagt acaagaaatg gcaggaaaac agcgagcagg ggaggagaga 3780

ggggcacgcc cagaatccca tggaaccttc cgtgccccag ctttctctca tggatgtaaa 3840

atgtgaaacg cccaactgcc ccttcttcat gtctgtgaac acccagcctt tatgccatga 3900

gtgctcagag aggcggcaaa agaatcaaaa caaactccca aagctgaact ccaagccggg 3960

ccctgagggg ctccctggca tggcgctcgg ggcctctcgg ggagaagcct atgagccctt 4020

ggcgtggaac cctgaggagt ccactggggg gcctcattcg gccccaccga cagcacccag 4080

cccttttctg ttcagtgaga ccactgccat gaagtgcagg agccccggct gccccttcac 4140

actgaatgtg cagcacaacg gattttgtga acgttgccac aacgcccggc aacttcacgc 4200

cagccacgcc ccagaccaca caaggcactt ggatcccggg aagtgccaag cctgcctcca 4260

ggatgttacc aggacattta atgggatctg cagtacttgc ttcaaaagga ctacagcaga 4320

ggcctcctcc agcctcagca ccagcctccc tccttcctgt caccagcgtt ccaagtcaga 4380

tccctcgcgg ctcgtccgga gcccctcccc gcattcttgc cacagagctg gaaacgacgc 4440

ccctgctggc tgcctgtctc aagctgcacg gactcctggg gacaggacgg ggacgagcaa 4500

gtgcagaaaa gccggctgcg tgtattttgg gactccagaa aacaagggct tttgcacact 4560

gtgtttcatc gagtacagag aaaacaaaca ttttgctgct gcctcaggga aagtcagtcc 4620

cacagcgtcc aggttccaga acaccattcc gtgcctgggg agggaatgcg gcacccttgg 4680

aagcaccatg tttgaaggat actgccagaa gtgtttcatt gaagctcaga atcagagatt 4740

tcatgaggcc aaaaggacag aagagcaact gagatcgagc cagcgcagag atgtgcctcg 4800

aaccacacaa agcacctcaa ggcccaagtg cgcccgggcc tcctgcaaga acatcctggc 4860

ctgccgcagc gaggagctct gcatggagtg tcagcatccc aaccagagga tgggccctgg 4920

ggcccaccgg ggtgagcctg cccccgaaga cccccccaag cagcgttgcc gggcccccgc 4980

ctgtgatcat tttggcaatg ccaagtgcaa cggctactgc aacgaatgct ttcagttcaa 5040

gcagatgtat ggcggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagacgt 5100

ggaggagaac cctggaccta tgaggatatt tgctgtcttt atattcatga cctactggca 5160

tttgctgaac gcatttactg tcacggttcc caaggaccta tatgtggtag agtatggtag 5220

caatatgaca attgaatgca aattcccagt agaaaaacaa ttagacctgg ctgcactaat 5280

tgtctattgg gaaatggagg ataagaacat tattcaattt gtgcatggag aggaagacct 5340

gaaggttcag catagtagct acagacagag ggcccggctg ttgaaggacc agctctccct 5400

gggaaatgct gcacttcaga tcacagatgt gaaattgcag gatgcagggg tgtaccgctg 5460

catgatcagc tatggtggtg ccgactacaa gcgaattact gtgaaagtca atgccccata 5520

caacaaaatc aaccaaagaa ttttggttgt ggatccagtc acctctgaac atgaacttac 5580

atgtcaggct gagggctacc ccaaggccga agtcatctgg acaagcagtg accatcaagt 5640

cctgagtggt aagaccacca ccaccaattc caagagagag gagaaacttt tcaatgtgac 5700

cagcacactg agaatcaaca caacaactaa tgagattttc tactgcactt ttaggagatt 5760

agatcctgag gaaaaccata cagctgaatt ggtcatccca gaactacctc tggcacatcc 5820

tccaaatgaa aggactcact tggtaattct gggagccatc ttattatgcc ttggtgtagc 5880

actgacattc atcttccgtt taagaaaagg gagaatgatg gatgtgaaaa aatgtggcat 5940

ccaagataca aactcaaaga agcaaagtga tacacatttg gaggagacgt aaccgctgat 6000

cagcctcgac tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 6060

ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 6120

cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 6180

gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atgggtcgac 6240

ccagcgtgag tctctcctac cctcccgctc tggtccttcc tctcccgctc tgcaccctct 6300

gtggccctcg ctgtgctctc tcgctccgtg acttcccttc tccaagttct ccttggtggc 6360

ccgccgtggg gctagtccag ggctggatct cggggaagcg gcggggtggc ctgggagtgg 6420

ggaagggggt gcgcacccgg gacgcgcgct acttgcccct ttcggcgggg agcaggggag 6480

acctttggcc tacggcgacg ggagggtcgg gacaaagttt agggcgtcga taagcgtcag 6540

agcgccgagg ttgggggagg gtttctcttc cgctctttcg cggggcctct ggctccccca 6600

gcgcagctgg agtgggggac gggtaggctc gtcccaaagg cgcggcgctg aggtttgtga 6660

acgcgtggag gggcgcttgg ggtctggggg aggcgtcgcc cgggtaagcc tgtctgctgc 6720

ggctctgctt cccttagact ggagagctgt ggacttcgtc taggcgcccg ctaagttcgc 6780

atgtcctagc acctctgggt ctatgtgggg ccacaccgtg gggaggaaac agcacgcgac 6840

gtttgtagaa tgcttggctg tgatacaaag cggtttcgaa taattaactt atttgttccc 6900

atcacatgtc acttttaaaa aattataaga actacccgtt attgacatct ttctgtgtgc 6960

caaggacttt atgtgctttg cgtcatttaa ttttgaaaac agttatcttc cgccatagat 7020

aactactatg gttatcttct ggtaaccacg tgcggaccga ggctgcagcg tcgtcctccc 7080

taggaacccc tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag 7140

gccgggcgac caaaggtcgc ccgacgcccg ggctttgccc gggcggcctc agtgagcgag 7200

cgagcgcgca gctgcctgca ggggcgcctg atgcggtatt ttctccttac gcatctgtgc 7260

ggtatttcac accgcatacg tcaaagcaac catagtacgc gccctgtagc ggcgcattaa 7320

gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc 7380

ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag 7440

ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca 7500

aaaaacttga tttgggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc 7560

gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa 7620

cactcaaccc tatctcgggc tattcttttg atttataagg gattttgccg atttcggcct 7680

attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa 7740

cgtttacaat tttatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc 7800

agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat 7860

ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg ttttcaccgt 7920

catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta taggttaatg 7980

tcatgaacaa taaaactgtc tgcttacata aacagtaata caaggggtgt tatgagccat 8040

attcaacggg aaacgtcgag gccgcgatta aattccaaca tggatgctga tttatatggg 8100

tataaatggg ctcgcgataa tgtcgggcaa tcaggtgcga caatctatcg cttgtatggg 8160

aagcccgatg cgccagagtt gtttctgaaa catggcaaag gtagcgttgc caatgatgtt 8220

acagatgaga tggtcagact aaactggctg acggaattta tgcctcttcc gaccatcaag 8280

cattttatcc gtactcctga tgatgcatgg ttactcacca ctgcgatccc cggaaaaaca 8340

gcattccagg tattagaaga atatcctgat tcaggtgaaa atattgttga tgcgctggca 8400

gtgttcctgc gccggttgca ttcgattcct gtttgtaatt gtccttttaa cagcgatcgc 8460

gtatttcgtc tcgctcaggc gcaatcacga atgaataacg gtttggttga tgcgagtgat 8520

tttgatgacg agcgtaatgg ctggcctgtt gaacaagtct ggaaagaaat gcataaactt 8580

ttgccattct caccggattc agtcgtcact catggtgatt tctcacttga taaccttatt 8640

tttgacgagg ggaaattaat aggttgtatt gatgttggac gagtcggaat cgcagaccga 8700

taccaggatc ttgccatcct atggaactgc ctcggtgagt tttctccttc attacagaaa 8760

cggctttttc aaaaatatgg tattgataat cctgatatga ataaattgca gtttcatttg 8820

atgctcgatg agtttttcta atctcatgac caaaatccct taacgtgagt tttcgttcca 8880

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 8940

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 9000

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 9060

tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 9120

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 9180

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 9240

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 9300

acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 9360

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 9420

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 9480

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 9540

ggccttttgc tggccttttg ctcacatgt 9569

<210> 32

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 32

gaagcgtgtc ttcatagcgc 20

<210> 33

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 33

ttactcgtgt caaagccgtt 20

<210> 34

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 34

tgtcaaagcc gttaggatcc 20

<210> 35

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 35

gccgttagga tcctggcttg 20

<210> 36

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 36

gcggagtggc taaagtgctt 20

<210> 37

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 37

tccgcaagcc aggatcctaa 20

<210> 38

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 38

gttcggcttt gagcttcctc 20

<210> 39

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 39

gagatggtga tcatgagacc 20

<210> 40

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 40

ttgtactcat atttgtttcc 20

<210> 41

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 41

aacaaatatg agtacaagtt 20

<210> 42

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 42

accgctctca gaccagaaac gtccacaccc gccctccgat ggcctgtcgc cctggctagg 60

ttttagggtc agtgggatcc tccttccact ggacccggga gaagacgctc aacagccccc 120

tccttcccct ccttcctctc cttcctctcc ttcccccctc cctgcgccgc tccagagcgc 180

aacaaccatt ttcccagcca ggagcacacc gtgtccacgc gccacagcga tctcactgat 240

tggtcgggct cctggtaaac aaggaccggg cagccaatgg gagggatgtg cacgagggca 300

gcacgagcct ccgggccagc gctcgcgtgg ctcttctggc ccgggctact atatagagac 360

gtttccgcct cctgcttgaa actaacccct ctttttctcc aaaggagtgc ttgtggagat 420

cggatctttt ctccagcaat tgggggaaag aaggcttttt ctctgaatta gcttagtgta 480

accagcggcg tatatttttt aggcgccttt tcgaaaacct agtagttaat attcatttgt 540

ttaaatctta ttttattttt aagctcaaac tgcttaagaa taccttaatt ccttaaagtg 600

aaataatttt ttgcaaaggg gtttcctcga tttggagctt tttttttctt ccaccgtcat 660

ttctaactct taaaaccaac tcagttccat catggtgatg ttcaagaaga tcaagtcttt 720

tgaggtggtc tttaacgacc ctgaaaaggt gtacggcagt ggcgagaagg tggctggccg 780

ggtgatagtg gaggtgtgtg 800

<210> 43

<211> 1500

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 43

atgtctcgct ccgttgcctt agctgtgctc gcgctactct ctctttctgg attagaggct 60

gtcatggcgc cccgaaccct cttcctgggt ggaggcggtt caggcggagg tggctctggc 120

ggtggcggat cgatccagcg tactccaaag attcaggttt actcacgtca tccagcagag 180

aatggaaagt caaatttcct gaattgctat gtgtctgggt ttcatccatc cgacattgaa 240

gttgacttac tgaagaatgg agagagaatt gaaaaagtgg agcattcaga cttgtctttc 300

agcaaggact ggtctttcta tctcttgtac tacactgaat tcacccccac tgaaaaagat 360

gagtatgcct gccgtgtgaa ccatgtgact ttgtcacagc ccaagatagt taagtgggat 420

cgagacatgg gtggtggtgg ttctggtggt ggtggttctg gcggcggcgg ctccggtggt 480

ggtggatccg gctcccactc cttgaagtat ttccacactt ccgtgtcccg gcccggccgc 540

ggggagcccc gcttcatctc tgtgggctac gtggacgaca cccagttcgt gcgcttcgac 600

aacgacgccg cgagtccgag gatggtgccg cgggcgccgt ggatggagca ggaggggtca 660

gagtattggg accgggagac acggagcgcc agggacaccg cacagatttt ccgagtgaat 720

ctgcggacgc tgcgcggcta ctacaatcag agcgaggccg ggtctcacac cctgcagtgg 780

atgcatggct gcgagctggg gcccgacggg cgcttcctcc gcgggtatga acagttcgcc 840

tacgacggca aggattatct caccctgaat gaggacctgc gctcctggac cgcggtggac 900

acggcggctc agatctccga gcaaaagtca aatgatgcct ctgaggcgga gcaccagaga 960

gcctacctgg aagacacatg cgtggagtgg ctccacaaat acctggagaa ggggaaggag 1020

acgctgcttc acctggagcc cccaaagaca cacgtgactc accaccccat ctctgaccat 1080

gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac actgacctgg 1140

cagcaggatg gggagggcca tacccaggac acggagctcg tggagaccag gcctgcaggg 1200

gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagagga gcagagatac 1260

acgtgccatg tgcagcatga ggggctaccc gagcccgtca ccctgagatg gaagccggct 1320

tcccagccca ccatccccat cgtgggcatc attgctggcc tggttctcct tggatctgtg 1380

gtctctggag ctgtggttgc tgctgtgata tggaggaaga agagctcagg tggaaaagga 1440

gggagctact ctaaggctga gtggagcgac agtgcccagg ggtctgagtc tcacagcttg 1500

<210> 44

<211> 800

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 44

cagggatccc agcagtgcaa acagacttcg gagtacctgc gctatgaaga cacgcttctt 60

ctggaagacc agccaacagg taagcggccc aattcattgt tggagggtga aagctgatta 120

gagaagagaa ttgaatacac aaaacctgta cgaaatgttt taagttgctc agtttgagtg 180

gtttgaatta cgtgttgttg cttccttttt tctgttttaa tttgcagaca ttctcctccc 240

cccccaaaaa aaagggtgat ttgtacaatt ttttatggtg ctgtgtccta aaggggatcc 300

tgaggggcgt tgcctcgggt agttaaagtc ttatgtgtgc ataagttgct tattctttgt 360

ctacttccta tttgagatgt tagtagagaa ctgtcctggg tgaatctttc agtattgcag 420

ggcttggcaa cttgctgccc gacaaaatac atcagaattt ctctttaaga acaatatggg 480

atggattaaa aaatatatat atgggatgaa attgggggta cttcaatacc ttgcatgcca 540

cccaagcatt ccttatcaca cagatgcatt ttaagtgtaa cagcaagcct aatggctact 600

cgattttctt tcccttcagg tgagaatgag atggtgatca tgagacctgg aaacaaatat 660

gagtacaagt tcggctttga gcttcctcag gggtaaatat cagctaaatg catctttgaa 720

cttttctgtc taaaatatct tgccctcctt tgatcactta ctgttcttgg agagcgtttt 780

aaaattttca ttttcttgac 800

<210> 45

<211> 8381

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 45

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtaccgct ctcagaccag aaacgtccac acccgccctc 180

cgatggcctg tcgccctggc taggttttag ggtcagtggg atcctccttc cactggaccc 240

gggagaagac gctcaacagc cccctccttc ccctccttcc tctccttcct ctccttcccc 300

cctccctgcg ccgctccaga gcgcaacaac cattttccca gccaggagca caccgtgtcc 360

acgcgccaca gcgatctcac tgattggtcg ggctcctggt aaacaaggac cgggcagcca 420

atgggaggga tgtgcacgag ggcagcacga gcctccgggc cagcgctcgc gtggctcttc 480

tggcccgggc tactatatag agacgtttcc gcctcctgct tgaaactaac ccctcttttt 540

ctccaaagga gtgcttgtgg agatcggatc ttttctccag caattggggg aaagaaggct 600

ttttctctga attagcttag tgtaaccagc ggcgtatatt ttttaggcgc cttttcgaaa 660

acctagtagt taatattcat ttgtttaaat cttattttat ttttaagctc aaactgctta 720

agaatacctt aattccttaa agtgaaataa ttttttgcaa aggggtttcc tcgatttgga 780

gctttttttt tcttccaccg tcatttctaa ctcttaaaac caactcagtt ccatcatggt 840

gatgttcaag aagatcaagt cttttgaggt ggtctttaac gaccctgaaa aggtgtacgg 900

cagtggcgag aaggtggctg gccgggtgat agtggaggtg tgtgaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatgagga ggatgtgggc 2700

cacgcagggg ctggcggtgg cgctggctct gagcgtgctg ccgggcagcc gggcgctgcg 2760

gccgggcgac tgcgaagttt gtatttctta tctgggaaga ttttaccagg acctcaaaga 2820

cagagatgtc acattctcac cagccactat tgaaaacgaa cttataaagt tctgccggga 2880

agcaagaggc aaagagaatc ggttgtgcta ctatatcggg gccacagatg atgcagccac 2940

caaaatcatc aatgaggtat caaagcctct ggcccaccac atccctgtgg agaagatctg 3000

tgagaagctt aagaagaagg acagccagat atgtgagctt aagtatgaca agcagatcga 3060

cctgagcaca gtggacctga agaagctccg agttaaagag ctgaagaaga ttctggatga 3120

ctggggggag acatgcaaag gctgtgcaga aaagtctgac tacatccgga agataaatga 3180

actgatgcct aaatatgccc ccaaggcagc cagtgcacgg accgatttgg gaagcggagc 3240

tactaacttc agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatgtc 3300

tcgctccgtt gccttagctg tgctcgcgct actctctctt tctggattag aggctgtcat 3360

ggcgccccga accctcttcc tgggtggagg cggttcaggc ggaggtggct ctggcggtgg 3420

cggatcgatc cagcgtactc caaagattca ggtttactca cgtcatccag cagagaatgg 3480

aaagtcaaat ttcctgaatt gctatgtgtc tgggtttcat ccatccgaca ttgaagttga 3540

cttactgaag aatggagaga gaattgaaaa agtggagcat tcagacttgt ctttcagcaa 3600

ggactggtct ttctatctct tgtactacac tgaattcacc cccactgaaa aagatgagta 3660

tgcctgccgt gtgaaccatg tgactttgtc acagcccaag atagttaagt gggatcgaga 3720

catgggtggt ggtggttctg gtggtggtgg ttctggcggc ggcggctccg gtggtggtgg 3780

atccggctcc cactccttga agtatttcca cacttccgtg tcccggcccg gccgcgggga 3840

gccccgcttc atctctgtgg gctacgtgga cgacacccag ttcgtgcgct tcgacaacga 3900

cgccgcgagt ccgaggatgg tgccgcgggc gccgtggatg gagcaggagg ggtcagagta 3960

ttgggaccgg gagacacgga gcgccaggga caccgcacag attttccgag tgaatctgcg 4020

gacgctgcgc ggctactaca atcagagcga ggccgggtct cacaccctgc agtggatgca 4080

tggctgcgag ctggggcccg acgggcgctt cctccgcggg tatgaacagt tcgcctacga 4140

cggcaaggat tatctcaccc tgaatgagga cctgcgctcc tggaccgcgg tggacacggc 4200

ggctcagatc tccgagcaaa agtcaaatga tgcctctgag gcggagcacc agagagccta 4260

cctggaagac acatgcgtgg agtggctcca caaatacctg gagaagggga aggagacgct 4320

gcttcacctg gagcccccaa agacacacgt gactcaccac cccatctctg accatgaggc 4380

caccctgagg tgctgggccc tgggcttcta ccctgcggag atcacactga cctggcagca 4440

ggatggggag ggccataccc aggacacgga gctcgtggag accaggcctg caggggatgg 4500

aaccttccag aagtgggcag ctgtggtggt gccttctgga gaggagcaga gatacacgtg 4560

ccatgtgcag catgaggggc tacccgagcc cgtcaccctg agatggaagc cggcttccca 4620

gcccaccatc cccatcgtgg gcatcattgc tggcctggtt ctccttggat ctgtggtctc 4680

tggagctgtg gttgctgctg tgatatggag gaagaagagc tcaggtggaa aaggagggag 4740

ctactctaag gctgagtgga gcgacagtgc ccaggggtct gagtctcaca gcttgtaatg 4800

atagccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct 4860

cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 4920

aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc 4980

aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 5040

ctatgggtcg accagggatc ccagcagtgc aaacagactt cggagtacct gcgctatgaa 5100

gacacgcttc ttctggaaga ccagccaaca ggtaagcggc ccaattcatt gttggagggt 5160

gaaagctgat tagagaagag aattgaatac acaaaacctg tacgaaatgt tttaagttgc 5220

tcagtttgag tggtttgaat tacgtgttgt tgcttccttt tttctgtttt aatttgcaga 5280

cattctcctc cccccccaaa aaaaagggtg atttgtacaa ttttttatgg tgctgtgtcc 5340

taaaggggat cctgaggggc gttgcctcgg gtagttaaag tcttatgtgt gcataagttg 5400

cttattcttt gtctacttcc tatttgagat gttagtagag aactgtcctg ggtgaatctt 5460

tcagtattgc agggcttggc aacttgctgc ccgacaaaat acatcagaat ttctctttaa 5520

gaacaatatg ggatggatta aaaaatatat atatgggatg aaattggggg tacttcaata 5580

ccttgcatgc cacccaagca ttccttatca cacagatgca ttttaagtgt aacagcaagc 5640

ctaatggcta ctcgattttc tttcccttca ggtgagaatg agatggtgat catgagacct 5700

ggaaacaaat atgagtacaa gttcggcttt gagcttcctc aggggtaaat atcagctaaa 5760

tgcatctttg aacttttctg tctaaaatat cttgccctcc tttgatcact tactgttctt 5820

ggagagcgtt ttaaaatttt cattttcttg acggtaacca cgtgcggacc gaggctgcag 5880

cgtcgtcctc cctaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc 5940

tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc 6000

tcagtgagcg agcgagcgcg cagctgcctg caggggcgcc tgatgcggta ttttctcctt 6060

acgcatctgt gcggtatttc acaccgcata cgtcaaagca accatagtac gcgccctgta 6120

gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 6180

gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 6240

ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 6300

acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca tcgccctgat 6360

agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 6420

aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc 6480

cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta 6540

acaaaatatt aacgtttaca attttatggt gcactctcag tacaatctgc tctgatgccg 6600

catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 6660

tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 6720

ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt 6780

tataggttaa tgtcatgaac aataaaactg tctgcttaca taaacagtaa tacaaggggt 6840

gttatgagcc atattcaacg ggaaacgtcg aggccgcgat taaattccaa catggatgct 6900

gatttatatg ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat 6960

cgcttgtatg ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt 7020

gccaatgatg ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt 7080

ccgaccatca agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc 7140

cccggaaaaa cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt 7200

gatgcgctgg cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt 7260

aacagcgatc gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt 7320

gatgcgagtg attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa 7380

atgcataaac ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt 7440

gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga 7500

atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct 7560

tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg 7620

cagtttcatt tgatgctcga tgagtttttc taatctcatg accaaaatcc cttaacgtga 7680

gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 7740

tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt 7800

ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 7860

gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc 7920

tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 7980

cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 8040

gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 8100

actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 8160

ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 8220

gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 8280

atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 8340

tttacggttc ctggcctttt gctggccttt tgctcacatg t 8381

<210> 46

<211> 1722

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 46

atgtgtcccc gagccgcgcg ggcgcccgcg acgctactcc tcgccctggg cgcggtgctg 60

tggcctgcgg ctggcgcctg ggagcttacg attttgcaca ccaacgacgt gcacagccgg 120

ctggagcaga ccagcgagga ctccagcaag tgcgtcaacg ccagccgctg catgggtggc 180

gtggctcggc tcttcaccaa ggttcagcag atccgccgcg ccgaacccaa cgtgctgctg 240

ctggacgccg gcgaccagta ccagggcact atctggttca ccgtgtacaa gggcgccgag 300

gtggcgcact tcatgaacgc cctgcgctac gatgccatgg cactgggaaa tcatgaattt 360

gataatggtg tggaaggact gatcgagcca ctcctcaaag aggccaaatt tccaattctg 420

agtgcaaaca ttaaagcaaa ggggccacta gcatctcaaa tatcaggact ttatttgcca 480

tataaagttc ttcctgttgg tgatgaagtt gtgggaatcg ttggatacac ttccaaagaa 540

accccttttc tctcaaatcc agggacaaat ttagtgtttg aagatgaaat cactgcatta 600

caacctgaag tagataagtt aaaaactcta aatgtgaaca aaattattgc actgggacat 660

tcgggttttg aaatggataa actcatcgct cagaaagtga ggggtgtgga cgtcgtggtg 720

ggaggacact ccaacacatt tctttacaca ggcaatccac cttccaaaga ggtgcctgct 780

gggaagtacc cattcatagt cacttctgat gatgggcgga aggttcctgt agtccaggcc 840

tatgcttttg gcaaatacct aggctatctg aagatcgagt ttgatgaaag aggaaacgtc 900

atctcttccc atggaaatcc cattcttcta aacagcagca ttcctgaaga tccaagcata 960

aaagcagaca ttaacaaatg gaggataaaa ttggataatt attctaccca ggaattaggg 1020

aaaacaattg tctatctgga tggctcctct caatcatgcc gctttagaga atgcaacatg 1080

ggcaacctga tttgtgatgc aatgattaac aacaacctga gacacacgga tgaaatgttc 1140

tggaaccacg tatccatgtg cattttaaat ggaggtggta tccggtcgcc cattgatgaa 1200

cgcaacaatg gcacaattac ctgggagaac ctggctgctg tattgccctt tggaggcaca 1260

tttgacctag tccagttaaa aggttccacc ctgaagaagg cctttgagca tagcgtgcac 1320

cgctacggcc agtccactgg agagttcctg caggtgggcg gaatccatgt ggtgtatgat 1380

ctttcccgaa aacctggaga cagagtagtc aaattagatg ttctttgcac caagtgtcga 1440

gtgcccagtt atgaccctct caaaatggac gaggtatata aggtgatcct cccaaacttc 1500

ctggccaatg gtggagatgg gttccagatg ataaaagatg aattattaag acatgactct 1560

ggtgaccaag atatcaacgt ggtttctaca tatatctcca aaatgaaagt aatttatcca 1620

gcagttgaag gtcggatcaa gttttccaca ggaagtcact gccatggaag cttttcttta 1680

atatttcttt cactttgggc agtgatcttt gttttatacc aa 1722

<210> 47

<211> 10517

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 47

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtgttcta gggtggaaac taagagaatg atgtacctag 180

agggcgctgg aagctctaaa gccctagcag ttactgcttt tactattagt ggtcgttttt 240

ttctcccccc cgccccccga caaatcaaca gaacaaagaa aattacctaa acagcaagga 300

catagggagg aacttcttgg cacagaactt tccaaacact ttttcctgaa gggatacaag 360

aagcaagaaa ggtactcttt cactaggacc ttctctgagc tgtcctcagg atgcttttgg 420

gactattttt cttacccaga gaatggagaa accctgcagg gaattcccaa gctgtagtta 480

taaacagaag ttctccttct gctaggtagc attcaaagat cttaatcttc tgggtttccg 540

ttttctcgaa tgaaaaatgc aggtccgagc agttaactgg ctggggcacc attagcaagt 600

cacttagcat ctctggggcc agtctgcaaa gcgagggggc agccttaatg tgcctccagc 660

ctgaagtcct agaatgagcg cccggtgtcc caagctgggg cgcgcacccc agatcggagg 720

gcgccgatgt acagacagca aactcaccca gtctagtgca tgccttctta aacatcacga 780

gactctaaga aaaggaaact gaaaacggga aagtccctct ctctaacctg gcactgcgtc 840

gctggcttgg agacaggtga cggtccctgc gggccttgtc ctgattggct gggcacgcgt 900

ttaatataag tggaggcgtc gcgctggcgg gcattcctga agctaagctt gtggacgata 960

tcgaattcgc acgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 1020

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 1080

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 1140

cgccaatagg gactttccat tgacgtcaat gggtggacta tttacggtaa actgcccact 1200

tggcagtaca tcaagtgtat catatgccaa gtacgccccc tattgacgtc aatgacggta 1260

aatggcccgc ctggcattat gcccagtaca tgaccttatg ggactttcct acttggcagt 1320

acatctacgt attagtcatc gctattacca tgggtcgagg tgagccccac gttctgcttc 1380

actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta 1440

ttttgtgcag cgatgggggc gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg 1500

cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct 1560

ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc 1620

gcggcgggcg ggagtcgctg cgttgccttc gccccgtgcc ccgctccgcg ccgcctcgcg 1680

ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc gggacggccc 1740

ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg ctcgtttctt ttctgtggct 1800

gcgtgaaagc cttaaagggc tccgggaggg ccctttgtgc gggggggagc ggctcggggg 1860

gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc ccggcggctg 1920

tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc gtgtgcgcga ggggagcgcg 1980

gccgggggcg gtgccccgcg gtgcgggggg gctgcgaggg gaacaaaggc tgcgtgcggg 2040

gtgtgtgcgt gggggggtga gcagggggtg tgggcgcggc ggtcgggctg taaccccccc 2100

ctgcaccccc ctccccgagt tgctgagcac ggcccggctt cgggtgcggg gctccgtgcg 2160

gggcgtggcg cggggctcgc cgtgccgggc ggggggtggc ggcaggtggg ggtgccgggc 2220

ggggcggggc cgcctcgggc cggggagggc tcgggggagg ggcgcggcgg ccccggagcg 2280

ccggcggctg tcgaggcgcg gcgagccgca gccattgcct tttatggtaa tcgtgcgaga 2340

gggcgcaggg acttcctttg tcccaaatct ggcggagccg aaatctggga ggcgccgccg 2400

caccccctct agcgggcgcg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg 2460

gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc atctccagcc tcggggctgc 2520

cgcaggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 2580

tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagg 2640

ggggatccgt ttatctgcag aattcgccct tgacgtcgcc accatggaag atacaaagga 2700

gtctaacgtg aagacatttt gctccaagaa tatcctagcc atccttggct tctcctctat 2760

catagctgtg atagctttgc ttgctgtggg gttgacccag aacaaagcat tgccagaaaa 2820

cgttaagtat gggattgtgc tggatgcggg ttcttctcac acaagtttat acatctataa 2880

gtggccagca gaaaaggaga atgacacagg cgtggtgcat caagtagaag aatgcagggt 2940

taaaggtcct ggaatctcaa aatttgttca gaaagtaaat gaaataggca tttacctgac 3000

tgattgcatg gaaagagcta gggaagtgat tccaaggtcc cagcaccaag agacacccgt 3060

ttacctggga gccacggcag gcatgcggtt gctcaggatg gaaagtgaag agttggcaga 3120

cagggttctg gatgtggtgg agaggagcct cagcaactac ccctttgact tccagggtgc 3180

caggatcatt actggccaag aggaaggtgc ctatggctgg attactatca actatctgct 3240

gggcaaattc agtcagaaaa caaggtggtt cagcatagtc ccatatgaaa ccaataatca 3300

ggaaaccttt ggagctttgg accttggggg agcctctaca caagtcactt ttgtacccca 3360

aaaccagact atcgagtccc cagataatgc tctgcaattt cgcctctatg gcaaggacta 3420

caatgtctac acacatagct tcttgtgcta tgggaaggat caggcactct ggcagaaact 3480

ggccaaggac attcaggttg caagtaatga aattctcagg gacccatgct ttcatcctgg 3540

atataagaag gtagtgaacg taagtgacct ttacaagacc ccctgcacca agagatttga 3600

gatgactctt ccattccagc agtttgaaat ccagggtatt ggaaactatc aacaatgcca 3660

tcaaagcatc ctggagctct tcaacaccag ttactgccct tactcccagt gtgccttcaa 3720

tgggattttc ttgccaccac tccaggggga ttttggggca ttttcagctt tttactttgt 3780

gatgaagttt ttaaacttga catcagagaa agtctctcag gaaaaggtga ctgagatgat 3840

gaaaaagttc tgtgctcagc cttgggagga gataaaaaca tcttacgctg gagtaaagga 3900

gaagtacctg agtgaatact gcttttctgg tacctacatt ctctccctcc ttctgcaagg 3960

ctatcatttc acagctgatt cctgggagca catccatttc attggcaaga tccagggcag 4020

cgacgccggc tggactttgg gctacatgct gaacctgacc aacatgatcc cagctgagca 4080

accattgtcc acacctctct cccactccac ctatgtcttc ctcatggttc tattctccct 4140

ggtccttttc acagtggcca tcataggctt gcttatcttt cacaagcctt catatttctg 4200

gaaagatatg gtaggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagacgt 4260

ggaggagaac cctggaccta tgtgtccccg agccgcgcgg gcgcccgcga cgctactcct 4320

cgccctgggc gcggtgctgt ggcctgcggc tggcgcctgg gagcttacga ttttgcacac 4380

caacgacgtg cacagccggc tggagcagac cagcgaggac tccagcaagt gcgtcaacgc 4440

cagccgctgc atgggtggcg tggctcggct cttcaccaag gttcagcaga tccgccgcgc 4500

cgaacccaac gtgctgctgc tggacgccgg cgaccagtac cagggcacta tctggttcac 4560

cgtgtacaag ggcgccgagg tggcgcactt catgaacgcc ctgcgctacg atgccatggc 4620

actgggaaat catgaatttg ataatggtgt ggaaggactg atcgagccac tcctcaaaga 4680

ggccaaattt ccaattctga gtgcaaacat taaagcaaag gggccactag catctcaaat 4740

atcaggactt tatttgccat ataaagttct tcctgttggt gatgaagttg tgggaatcgt 4800

tggatacact tccaaagaaa ccccttttct ctcaaatcca gggacaaatt tagtgtttga 4860

agatgaaatc actgcattac aacctgaagt agataagtta aaaactctaa atgtgaacaa 4920

aattattgca ctgggacatt cgggttttga aatggataaa ctcatcgctc agaaagtgag 4980

gggtgtggac gtcgtggtgg gaggacactc caacacattt ctttacacag gcaatccacc 5040

ttccaaagag gtgcctgctg ggaagtaccc attcatagtc acttctgatg atgggcggaa 5100

ggttcctgta gtccaggcct atgcttttgg caaataccta ggctatctga agatcgagtt 5160

tgatgaaaga ggaaacgtca tctcttccca tggaaatccc attcttctaa acagcagcat 5220

tcctgaagat ccaagcataa aagcagacat taacaaatgg aggataaaat tggataatta 5280

ttctacccag gaattaggga aaacaattgt ctatctggat ggctcctctc aatcatgccg 5340

ctttagagaa tgcaacatgg gcaacctgat ttgtgatgca atgattaaca acaacctgag 5400

acacacggat gaaatgttct ggaaccacgt atccatgtgc attttaaatg gaggtggtat 5460

ccggtcgccc attgatgaac gcaacaatgg cacaattacc tgggagaacc tggctgctgt 5520

attgcccttt ggaggcacat ttgacctagt ccagttaaaa ggttccaccc tgaagaaggc 5580

ctttgagcat agcgtgcacc gctacggcca gtccactgga gagttcctgc aggtgggcgg 5640

aatccatgtg gtgtatgatc tttcccgaaa acctggagac agagtagtca aattagatgt 5700

tctttgcacc aagtgtcgag tgcccagtta tgaccctctc aaaatggacg aggtatataa 5760

ggtgatcctc ccaaacttcc tggccaatgg tggagatggg ttccagatga taaaagatga 5820

attattaaga catgactctg gtgaccaaga tatcaacgtg gtttctacat atatctccaa 5880

aatgaaagta atttatccag cagttgaagg tcggatcaag ttttccacag gaagtcactg 5940

ccatggaagc ttttctttaa tatttctttc actttgggca gtgatctttg ttttatacca 6000

aggaagcgga gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc 6060

tggacctatg aggatatttg ctgtctttat attcatgacc tactggcatt tgctgaacgc 6120

atttactgtc acggttccca aggacctata tgtggtagag tatggtagca atatgacaat 6180

tgaatgcaaa ttcccagtag aaaaacaatt agacctggct gcactaattg tctattggga 6240

aatggaggat aagaacatta ttcaatttgt gcatggagag gaagacctga aggttcagca 6300

tagtagctac agacagaggg cccggctgtt gaaggaccag ctctccctgg gaaatgctgc 6360

acttcagatc acagatgtga aattgcagga tgcaggggtg taccgctgca tgatcagcta 6420

tggtggtgcc gactacaagc gaattactgt gaaagtcaat gccccataca acaaaatcaa 6480

ccaaagaatt ttggttgtgg atccagtcac ctctgaacat gaactgacat gtcaggctga 6540

gggctacccc aaggccgaag tcatctggac aagcagtgac catcaagtcc tgagtggtaa 6600

gaccaccacc accaattcca agagagagga gaaacttttc aatgtgacca gcacactgag 6660

aatcaacaca acaactaatg agattttcta ctgcactttt aggagattag atcctgagga 6720

aaaccataca gctgaattgg tcatcccaga actacctctg gcacatcctc caaatgaaag 6780

gactcacttg gtaattctgg gagccatctt attatgcctt ggtgtagcac tgacattcat 6840

cttccgttta agaaaaggga gaatgatgga tgtgaaaaaa tgtggcatcc aagatacaaa 6900

ctcaaagaag caaagtgata cacatttgga ggagacgtaa ccgctgatca gcctcgactg 6960

tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 7020

aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 7080

gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg 7140

aagacaatag caggcatgct ggggatgcgg tgggctctat gggtcgaccc agcgtgagtc 7200

tctcctaccc tcccgctctg gtccttcctc tcccgctctg caccctctgt ggccctcgct 7260

gtgctctctc gctccgtgac ttcccttctc caagttctcc ttggtggccc gccgtggggc 7320

tagtccaggg ctggatctcg gggaagcggc ggggtggcct gggagtgggg aagggggtgc 7380

gcacccggga cgcgcgctac ttgccccttt cggcggggag caggggagac ctttggccta 7440

cggcgacggg agggtcggga caaagtttag ggcgtcgata agcgtcagag cgccgaggtt 7500

gggggagggt ttctcttccg ctctttcgcg gggcctctgg ctcccccagc gcagctggag 7560

tgggggacgg gtaggctcgt cccaaaggcg cggcgctgag gtttgtgaac gcgtggaggg 7620

gcgcttgggg tctgggggag gcgtcgcccg ggtaagcctg tctgctgcgg ctctgcttcc 7680

cttagactgg agagctgtgg acttcgtcta ggcgcccgct aagttcgcat gtcctagcac 7740

ctctgggtct atgtggggcc acaccgtggg gaggaaacag cacgcgacgt ttgtagaatg 7800

cttggctgtg atacaaagcg gtttcgaata attaacttat ttgttcccat cacatgtcac 7860

ttttaaaaaa ttataagaac tacccgttat tgacatcttt ctgtgtgcca aggactttat 7920

gtgctttgcg tcatttaatt ttgaaaacag ttatcttccg ccatagataa ctactatggt 7980

tatcttctgg taaccacgtg cggaccgagg ctgcagcgtc gtcctcccta ggaaccccta 8040

gtgatggagt tggccactcc ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca 8100

aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagc 8160

tgcctgcagg ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac 8220

cgcatacgtc aaagcaacca tagtacgcgc cctgtagcgg cgcattaagc gcggcgggtg 8280

tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg 8340

ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 8400

ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 8460

tgggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 8520

tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta 8580

tctcgggcta ttcttttgat ttataaggga ttttgccgat ttcggcctat tggttaaaaa 8640

atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg tttacaattt 8700

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 8760

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 8820

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac 8880

gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgaacaata 8940

aaactgtctg cttacataaa cagtaataca aggggtgtta tgagccatat tcaacgggaa 9000

acgtcgaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 9060

cgcgataatg tcgggcaatc aggtgcgaca atctatcgct tgtatgggaa gcccgatgcg 9120

ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 9180

gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 9240

actcctgatg atgcatggtt actcaccact gcgatccccg gaaaaacagc attccaggta 9300

ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 9360

cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 9420

gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 9480

cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataaactttt gccattctca 9540

ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 9600

aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 9660

gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 9720

aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 9780

tttttctaat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 9840

ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 9900

cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 9960

aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct 10020

agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 10080

tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 10140

ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 10200

cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 10260

atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 10320

ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 10380

tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 10440

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 10500

gccttttgct cacatgt 10517

<210> 48

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 48

gctccaggta gccaccttct 20

<210> 49

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 49

taggggcccc aactccatgg 20

<210> 50

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 50

ggcttatgcc aatatcggtg 20

<210> 51

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 51

aggtgatgaa gagaccaggg 20

<210> 52

<211> 3921

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 52

atgaggagga tgtgggccac gcaggggctg gcggtggcgc tggctctgag cgtgctgccg 60

ggcagccggg cgctgcggcc gggcgactgc gaagtttgta tttcttatct gggaagattt 120

taccaggacc tcaaagacag agatgtcaca ttctcaccag ccactattga aaacgaactt 180

ataaagttct gccgggaagc aagaggcaaa gagaatcggt tgtgctacta tatcggggcc 240

acagatgatg cagccaccaa aatcatcaat gaggtatcaa agcctctggc ccaccacatc 300

cctgtggaga agatctgtga gaagcttaag aagaaggaca gccagatatg tgagcttaag 360

tatgacaagc agatcgacct gagcacagtg gacctgaaga agctccgagt taaagagctg 420

aagaagattc tggatgactg gggggagaca tgcaaaggct gtgcagaaaa gtctgactac 480

atccggaaga taaatgaact gatgcctaaa tatgccccca aggcagccag tgcacggacc 540

gatttgggaa gcggagctac taacttcagc ctgctgaagc aggctggaga cgtggaggag 600

aaccctggac ctatggctga acaagtcctt cctcaggctt tgtatttgag caatatgcgg 660

aaagctgtga agatacggga gagaactcca gaagacattt ttaaacctac taatgggatc 720

attcatcatt ttaaaaccat gcaccgatac acactggaaa tgttcagaac ttgccagttt 780

tgtcctcagt ttcgggagat catccacaaa gccctcatcg acagaaacat ccaggccacc 840

ctggaaagcc agaagaaact caactggtgt cgagaagtcc ggaagcttgt ggcgctgaaa 900

acgaacggtg acggcaattg cctcatgcat gccacttctc agtacatgtg gggcgttcag 960

gacacagact tggtactgag gaaggcgctg ttcagcacgc tcaaggaaac agacacacgc 1020

aactttaaat tccgctggca actggagtct ctcaaatctc aggaatttgt tgaaacgggg 1080

ctttgctatg atactcggaa ctggaatgat gaatgggaca atcttatcaa aatggcttcc 1140

acagacacac ccatggcccg aagtggactt cagtacaact cactggaaga aatacacata 1200

tttgtccttt gcaacatcct cagaaggcca atcattgtca tttcagacaa aatgctaaga 1260

agtttggaat caggttccaa tttcgcccct ttgaaagtgg gtggaattta cttgcctctc 1320

cactggcctg cccaggaatg ctacagatac cccattgttc tcggctatga cagccatcat 1380

tttgtaccct tggtgaccct gaaggacagt gggcctgaaa tccgagctgt tccacttgtt 1440

aacagagacc ggggaagatt tgaagactta aaagttcact ttttgacaga tcctgaaaat 1500

gagatgaagg agaagctctt aaaagagtac ttaatggtga tagaaatccc cgtccaaggc 1560

tgggaccatg gcacaactca tctcatcaat gccgcaaagt tggatgaagc taacttacca 1620

aaagaaatca atctggtaga tgattacttt gaacttgttc agcatgagta caagaaatgg 1680

caggaaaaca gcgagcaggg gaggagagag gggcacgccc agaatcccat ggaaccttcc 1740

gtgccccagc tttctctcat ggatgtaaaa tgtgaaacgc ccaactgccc cttcttcatg 1800

tctgtgaaca cccagccttt atgccatgag tgctcagaga ggcggcaaaa gaatcaaaac 1860

aaactcccaa agctgaactc caagccgggc cctgaggggc tccctggcat ggcgctcggg 1920

gcctctcggg gagaagccta tgagcccttg gcgtggaacc ctgaggagtc cactgggggg 1980

cctcattcgg ccccaccgac agcacccagc ccttttctgt tcagtgagac cactgccatg 2040

aagtgcagga gccccggctg ccccttcaca ctgaatgtgc agcacaacgg attttgtgaa 2100

cgttgccaca acgcccggca acttcacgcc agccacgccc cagaccacac aaggcacttg 2160

gatcccggga agtgccaagc ctgcctccag gatgttacca ggacatttaa tgggatctgc 2220

agtacttgct tcaaaaggac tacagcagag gcctcctcca gcctcagcac cagcctccct 2280

ccttcctgtc accagcgttc caagtcagat ccctcgcggc tcgtccggag cccctccccg 2340

cattcttgcc acagagctgg aaacgacgcc cctgctggct gcctgtctca agctgcacgg 2400

actcctgggg acaggacggg gacgagcaag tgcagaaaag ccggctgcgt gtattttggg 2460

actccagaaa acaagggctt ttgcacactg tgtttcatcg agtacagaga aaacaaacat 2520

tttgctgctg cctcagggaa agtcagtccc acagcgtcca ggttccagaa caccattccg 2580

tgcctgggga gggaatgcgg cacccttgga agcaccatgt ttgaaggata ctgccagaag 2640

tgtttcattg aagctcagaa tcagagattt catgaggcca aaaggacaga agagcaactg 2700

agatcgagcc agcgcagaga tgtgcctcga accacacaaa gcacctcaag gcccaagtgc 2760

gcccgggcct cctgcaagaa catcctggcc tgccgcagcg aggagctctg catggagtgt 2820

cagcatccca accagaggat gggccctggg gcccaccggg gtgagcctgc ccccgaagac 2880

ccccccaagc agcgttgccg ggcccccgcc tgtgatcatt ttggcaatgc caagtgcaac 2940

ggctactgca acgaatgctt tcagttcaag cagatgtatg gcggaagcgg agctactaac 3000

ttcagcctgc tgaagcaggc tggagacgtg gaggagaacc ctggacctat gaggatattt 3060

gctgtcttta tattcatgac ctactggcat ttgctgaacg catttactgt cacggttccc 3120

aaggacctat atgtggtaga gtatggtagc aatatgacaa ttgaatgcaa attcccagta 3180

gaaaaacaat tagacctggc tgcactaatt gtctattggg aaatggagga taagaacatt 3240

attcaatttg tgcatggaga ggaagacctg aaggttcagc atagtagcta cagacagagg 3300

gcccggctgt tgaaggacca gctctccctg ggaaatgctg cacttcagat cacagatgtg 3360

aaattgcagg atgcaggggt gtaccgctgc atgatcagct atggtggtgc cgactacaag 3420

cgaattactg tgaaagtcaa tgccccatac aacaaaatca accaaagaat tttggttgtg 3480

gatccagtca cctctgaaca tgaactgaca tgtcaggctg agggctaccc caaggccgaa 3540

gtcatctgga caagcagtga ccatcaagtc ctgagtggta agaccaccac caccaattcc 3600

aagagagagg agaaactttt caatgtgacc agcacactga gaatcaacac aacaactaat 3660

gagattttct actgcacttt taggagatta gatcctgagg aaaaccatac agctgaattg 3720

gtcatcccag aactacctct ggcacatcct ccaaatgaaa ggactcactt ggtaattctg 3780

ggagccatct tattatgcct tggtgtagca ctgacattca tcttccgttt aagaaaaggg 3840

agaatgatgg atgtgaaaaa atgtggcatc caagatacaa actcaaagaa gcaaagtgat 3900

acacatttgg aggagacgta a 3921

<210> 53

<211> 2469

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 53

atggaagata caaaggagtc taacgtgaag acattttgct ccaagaatat cctagccatc 60

cttggcttct cctctatcat agctgtgata gctttgcttg ctgtggggtt gacccagaac 120

aaagcattgc cagaaaacgt taagtatggg attgtgctgg atgcgggttc ttctcacaca 180

agtttataca tctataagtg gccagcagaa aaggagaatg acacaggcgt ggtgcatcaa 240

gtagaagaat gcagggttaa aggtcctgga atctcaaaat ttgttcagaa agtaaatgaa 300

ataggcattt acctgactga ttgcatggaa agagctaggg aagtgattcc aaggtcccag 360

caccaagaga cacccgttta cctgggagcc acggcaggca tgcggttgct caggatggaa 420

agtgaagagt tggcagacag ggttctggat gtggtggaga ggagcctcag caactacccc 480

tttgacttcc agggtgccag gatcattact ggccaagagg aaggtgccta tggctggatt 540

actatcaact atctgctggg caaattcagt cagaaaacaa ggtggttcag catagtccca 600

tatgaaacca ataatcagga aacctttgga gctttggacc ttgggggagc ctctacacaa 660

gtcacttttg taccccaaaa ccagactatc gagtccccag ataatgctct gcaatttcgc 720

ctctatggca aggactacaa tgtctacaca catagcttct tgtgctatgg gaaggatcag 780

gcactctggc agaaactggc caaggacatt caggttgcaa gtaatgaaat tctcagggac 840

ccatgctttc atcctggata taagaaggta gtgaacgtaa gtgaccttta caagaccccc 900

tgcaccaaga gatttgagat gactcttcca ttccagcagt ttgaaatcca gggtattgga 960

aactatcaac aatgccatca aagcatcctg gagctcttca acaccagtta ctgcccttac 1020

tcccagtgtg ccttcaatgg gattttcttg ccaccactcc agggggattt tggggcattt 1080

tcagcttttt actttgtgat gaagttttta aacttgacat cagagaaagt ctctcaggaa 1140

aaggtgactg agatgatgaa aaagttctgt gctcagcctt gggaggagat aaaaacatct 1200

tacgctggag taaaggagaa gtacctgagt gaatactgct tttctggtac ctacattctc 1260

tccctccttc tgcaaggcta tcatttcaca gctgattcct gggagcacat ccatttcatt 1320

ggcaagatcc agggcagcga cgccggctgg actttgggct acatgctgaa cctgaccaac 1380

atgatcccag ctgagcaacc attgtccaca cctctctccc actccaccta tgtcttcctc 1440

atggttctat tctccctggt ccttttcaca gtggccatca taggcttgct tatctttcac 1500

aagccttcat atttctggaa agatatggta ggaagcggag ctactaactt cagcctgctg 1560

aagcaggctg gagacgtgga ggagaaccct ggacctatga ggatatttgc tgtctttata 1620

ttcatgacct actggcattt gctgaacgca tttactgtca cggttcccaa ggacctatat 1680

gtggtagagt atggtagcaa tatgacaatt gaatgcaaat tcccagtaga aaaacaatta 1740

gacctggctg cactaattgt ctattgggaa atggaggata agaacattat tcaatttgtg 1800

catggagagg aagacctgaa ggttcagcat agtagctaca gacagagggc ccggctgttg 1860

aaggaccagc tctccctggg aaatgctgca cttcagatca cagatgtgaa attgcaggat 1920

gcaggggtgt accgctgcat gatcagctat ggtggtgccg actacaagcg aattactgtg 1980

aaagtcaatg ccccatacaa caaaatcaac caaagaattt tggttgtgga tccagtcacc 2040

tctgaacatg aactgacatg tcaggctgag ggctacccca aggccgaagt catctggaca 2100

agcagtgacc atcaagtcct gagtggtaag accaccacca ccaattccaa gagagaggag 2160

aaacttttca atgtgaccag cacactgaga atcaacacaa caactaatga gattttctac 2220

tgcactttta ggagattaga tcctgaggaa aaccatacag ctgaattggt catcccagaa 2280

ctacctctgg cacatcctcc aaatgaaagg actcacttgg taattctggg agccatctta 2340

ttatgccttg gtgtagcact gacattcatc ttccgtttaa gaaaagggag aatgatggat 2400

gtgaaaaaat gtggcatcca agatacaaac tcaaagaagc aaagtgatac acatttggag 2460

gagacgtaa 2469

<210> 54

<211> 3309

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 54

atggctgaac aagtccttcc tcaggctttg tatttgagca atatgcggaa agctgtgaag 60

atacgggaga gaactccaga agacattttt aaacctacta atgggatcat tcatcatttt 120

aaaaccatgc accgatacac actggaaatg ttcagaactt gccagttttg tcctcagttt 180

cgggagatca tccacaaagc cctcatcgac agaaacatcc aggccaccct ggaaagccag 240

aagaaactca actggtgtcg agaagtccgg aagcttgtgg cgctgaaaac gaacggtgac 300

ggcaattgcc tcatgcatgc cacttctcag tacatgtggg gcgttcagga cacagacttg 360

gtactgagga aggcgctgtt cagcacgctc aaggaaacag acacacgcaa ctttaaattc 420

cgctggcaac tggagtctct caaatctcag gaatttgttg aaacggggct ttgctatgat 480

actcggaact ggaatgatga atgggacaat cttatcaaaa tggcttccac agacacaccc 540

atggcccgaa gtggacttca gtacaactca ctggaagaaa tacacatatt tgtcctttgc 600

aacatcctca gaaggccaat cattgtcatt tcagacaaaa tgctaagaag tttggaatca 660

ggttccaatt tcgccccttt gaaagtgggt ggaatttact tgcctctcca ctggcctgcc 720

caggaatgct acagataccc cattgttctc ggctatgaca gccatcattt tgtacccttg 780

gtgaccctga aggacagtgg gcctgaaatc cgagctgttc cacttgttaa cagagaccgg 840

ggaagatttg aagacttaaa agttcacttt ttgacagatc ctgaaaatga gatgaaggag 900

aagctcttaa aagagtactt aatggtgata gaaatccccg tccaaggctg ggaccatggc 960

acaactcatc tcatcaatgc cgcaaagttg gatgaagcta acttaccaaa agaaatcaat 1020

ctggtagatg attactttga acttgttcag catgagtaca agaaatggca ggaaaacagc 1080

gagcagggga ggagagaggg gcacgcccag aatcccatgg aaccttccgt gccccagctt 1140

tctctcatgg atgtaaaatg tgaaacgccc aactgcccct tcttcatgtc tgtgaacacc 1200

cagcctttat gccatgagtg ctcagagagg cggcaaaaga atcaaaacaa actcccaaag 1260

ctgaactcca agccgggccc tgaggggctc cctggcatgg cgctcggggc ctctcgggga 1320

gaagcctatg agcccttggc gtggaaccct gaggagtcca ctggggggcc tcattcggcc 1380

ccaccgacag cacccagccc ttttctgttc agtgagacca ctgccatgaa gtgcaggagc 1440

cccggctgcc ccttcacact gaatgtgcag cacaacggat tttgtgaacg ttgccacaac 1500

gcccggcaac ttcacgccag ccacgcccca gaccacacaa ggcacttgga tcccgggaag 1560

tgccaagcct gcctccagga tgttaccagg acatttaatg ggatctgcag tacttgcttc 1620

aaaaggacta cagcagaggc ctcctccagc ctcagcacca gcctccctcc ttcctgtcac 1680

cagcgttcca agtcagatcc ctcgcggctc gtccggagcc cctccccgca ttcttgccac 1740

agagctggaa acgacgcccc tgctggctgc ctgtctcaag ctgcacggac tcctggggac 1800

aggacgggga cgagcaagtg cagaaaagcc ggctgcgtgt attttgggac tccagaaaac 1860

aagggctttt gcacactgtg tttcatcgag tacagagaaa acaaacattt tgctgctgcc 1920

tcagggaaag tcagtcccac agcgtccagg ttccagaaca ccattccgtg cctggggagg 1980

gaatgcggca cccttggaag caccatgttt gaaggatact gccagaagtg tttcattgaa 2040

gctcagaatc agagatttca tgaggccaaa aggacagaag agcaactgag atcgagccag 2100

cgcagagatg tgcctcgaac cacacaaagc acctcaaggc ccaagtgcgc ccgggcctcc 2160

tgcaagaaca tcctggcctg ccgcagcgag gagctctgca tggagtgtca gcatcccaac 2220

cagaggatgg gccctggggc ccaccggggt gagcctgccc ccgaagaccc ccccaagcag 2280

cgttgccggg cccccgcctg tgatcatttt ggcaatgcca agtgcaacgg ctactgcaac 2340

gaatgctttc agttcaagca gatgtatggc ggaagcggag ctactaactt cagcctgctg 2400

aagcaggctg gagacgtgga ggagaaccct ggacctatga ggatatttgc tgtctttata 2460

ttcatgacct actggcattt gctgaacgca tttactgtca cggttcccaa ggacctatat 2520

gtggtagagt atggtagcaa tatgacaatt gaatgcaaat tcccagtaga aaaacaatta 2580

gacctggctg cactaattgt ctattgggaa atggaggata agaacattat tcaatttgtg 2640

catggagagg aagacctgaa ggttcagcat agtagctaca gacagagggc ccggctgttg 2700

aaggaccagc tctccctggg aaatgctgca cttcagatca cagatgtgaa attgcaggat 2760

gcaggggtgt accgctgcat gatcagctat ggtggtgccg actacaagcg aattactgtg 2820

aaagtcaatg ccccatacaa caaaatcaac caaagaattt tggttgtgga tccagtcacc 2880

tctgaacatg aacttacatg tcaggctgag ggctacccca aggccgaagt catctggaca 2940

agcagtgacc atcaagtcct gagtggtaag accaccacca ccaattccaa gagagaggag 3000

aaacttttca atgtgaccag cacactgaga atcaacacaa caactaatga gattttctac 3060

tgcactttta ggagattaga tcctgaggaa aaccatacag ctgaattggt catcccagaa 3120

ctacctctgg cacatcctcc aaatgaaagg actcacttgg taattctggg agccatctta 3180

ttatgccttg gtgtagcact gacattcatc ttccgtttaa gaaaagggag aatgatggat 3240

gtgaaaaaat gtggcatcca agatacaaac tcaaagaagc aaagtgatac acatttggag 3300

gagacgtaa 3309

<210> 55

<211> 2112

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 55

atgaggagga tgtgggccac gcaggggctg gcggtggcgc tggctctgag cgtgctgccg 60

ggcagccggg cgctgcggcc gggcgactgc gaagtttgta tttcttatct gggaagattt 120

taccaggacc tcaaagacag agatgtcaca ttctcaccag ccactattga aaacgaactt 180

ataaagttct gccgggaagc aagaggcaaa gagaatcggt tgtgctacta tatcggggcc 240

acagatgatg cagccaccaa aatcatcaat gaggtatcaa agcctctggc ccaccacatc 300

cctgtggaga agatctgtga gaagcttaag aagaaggaca gccagatatg tgagcttaag 360

tatgacaagc agatcgacct gagcacagtg gacctgaaga agctccgagt taaagagctg 420

aagaagattc tggatgactg gggggagaca tgcaaaggct gtgcagaaaa gtctgactac 480

atccggaaga taaatgaact gatgcctaaa tatgccccca aggcagccag tgcacggacc 540

gatttgggaa gcggagctac taacttcagc ctgctgaagc aggctggaga cgtggaggag 600

aaccctggac ctatgtctcg ctccgttgcc ttagctgtgc tcgcgctact ctctctttct 660

ggattagagg ctgtcatggc gccccgaacc ctcttcctgg gtggaggcgg ttcaggcgga 720

ggtggctctg gcggtggcgg atcgatccag cgtactccaa agattcaggt ttactcacgt 780

catccagcag agaatggaaa gtcaaatttc ctgaattgct atgtgtctgg gtttcatcca 840

tccgacattg aagttgactt actgaagaat ggagagagaa ttgaaaaagt ggagcattca 900

gacttgtctt tcagcaagga ctggtctttc tatctcttgt actacactga attcaccccc 960

actgaaaaag atgagtatgc ctgccgtgtg aaccatgtga ctttgtcaca gcccaagata 1020

gttaagtggg atcgagacat gggtggtggt ggttctggtg gtggtggttc tggcggcggc 1080

ggctccggtg gtggtggatc cggctcccac tccttgaagt atttccacac ttccgtgtcc 1140

cggcccggcc gcggggagcc ccgcttcatc tctgtgggct acgtggacga cacccagttc 1200

gtgcgcttcg acaacgacgc cgcgagtccg aggatggtgc cgcgggcgcc gtggatggag 1260

caggaggggt cagagtattg ggaccgggag acacggagcg ccagggacac cgcacagatt 1320

ttccgagtga atctgcggac gctgcgcggc tactacaatc agagcgaggc cgggtctcac 1380

accctgcagt ggatgcatgg ctgcgagctg gggcccgacg ggcgcttcct ccgcgggtat 1440

gaacagttcg cctacgacgg caaggattat ctcaccctga atgaggacct gcgctcctgg 1500

accgcggtgg acacggcggc tcagatctcc gagcaaaagt caaatgatgc ctctgaggcg 1560

gagcaccaga gagcctacct ggaagacaca tgcgtggagt ggctccacaa atacctggag 1620

aaggggaagg agacgctgct tcacctggag cccccaaaga cacacgtgac tcaccacccc 1680

atctctgacc atgaggccac cctgaggtgc tgggccctgg gcttctaccc tgcggagatc 1740

acactgacct ggcagcagga tggggagggc catacccagg acacggagct cgtggagacc 1800

aggcctgcag gggatggaac cttccagaag tgggcagctg tggtggtgcc ttctggagag 1860

gagcagagat acacgtgcca tgtgcagcat gaggggctac ccgagcccgt caccctgaga 1920

tggaagccgg cttcccagcc caccatcccc atcgtgggca tcattgctgg cctggttctc 1980

cttggatctg tggtctctgg agctgtggtt gctgctgtga tatggaggaa gaagagctca 2040

ggtggaaaag gagggagcta ctctaaggct gagtggagcg acagtgccca ggggtctgag 2100

tctcacagct tg 2112

<210> 56

<211> 4257

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 56

atggaagata caaaggagtc taacgtgaag acattttgct ccaagaatat cctagccatc 60

cttggcttct cctctatcat agctgtgata gctttgcttg ctgtggggtt gacccagaac 120

aaagcattgc cagaaaacgt taagtatggg attgtgctgg atgcgggttc ttctcacaca 180

agtttataca tctataagtg gccagcagaa aaggagaatg acacaggcgt ggtgcatcaa 240

gtagaagaat gcagggttaa aggtcctgga atctcaaaat ttgttcagaa agtaaatgaa 300

ataggcattt acctgactga ttgcatggaa agagctaggg aagtgattcc aaggtcccag 360

caccaagaga cacccgttta cctgggagcc acggcaggca tgcggttgct caggatggaa 420

agtgaagagt tggcagacag ggttctggat gtggtggaga ggagcctcag caactacccc 480

tttgacttcc agggtgccag gatcattact ggccaagagg aaggtgccta tggctggatt 540

actatcaact atctgctggg caaattcagt cagaaaacaa ggtggttcag catagtccca 600

tatgaaacca ataatcagga aacctttgga gctttggacc ttgggggagc ctctacacaa 660

gtcacttttg taccccaaaa ccagactatc gagtccccag ataatgctct gcaatttcgc 720

ctctatggca aggactacaa tgtctacaca catagcttct tgtgctatgg gaaggatcag 780

gcactctggc agaaactggc caaggacatt caggttgcaa gtaatgaaat tctcagggac 840

ccatgctttc atcctggata taagaaggta gtgaacgtaa gtgaccttta caagaccccc 900

tgcaccaaga gatttgagat gactcttcca ttccagcagt ttgaaatcca gggtattgga 960

aactatcaac aatgccatca aagcatcctg gagctcttca acaccagtta ctgcccttac 1020

tcccagtgtg ccttcaatgg gattttcttg ccaccactcc agggggattt tggggcattt 1080

tcagcttttt actttgtgat gaagttttta aacttgacat cagagaaagt ctctcaggaa 1140

aaggtgactg agatgatgaa aaagttctgt gctcagcctt gggaggagat aaaaacatct 1200

tacgctggag taaaggagaa gtacctgagt gaatactgct tttctggtac ctacattctc 1260

tccctccttc tgcaaggcta tcatttcaca gctgattcct gggagcacat ccatttcatt 1320

ggcaagatcc agggcagcga cgccggctgg actttgggct acatgctgaa cctgaccaac 1380

atgatcccag ctgagcaacc attgtccaca cctctctccc actccaccta tgtcttcctc 1440

atggttctat tctccctggt ccttttcaca gtggccatca taggcttgct tatctttcac 1500

aagccttcat atttctggaa agatatggta ggaagcggag ctactaactt cagcctgctg 1560

aagcaggctg gagacgtgga ggagaaccct ggacctatgt gtccccgagc cgcgcgggcg 1620

cccgcgacgc tactcctcgc cctgggcgcg gtgctgtggc ctgcggctgg cgcctgggag 1680

cttacgattt tgcacaccaa cgacgtgcac agccggctgg agcagaccag cgaggactcc 1740

agcaagtgcg tcaacgccag ccgctgcatg ggtggcgtgg ctcggctctt caccaaggtt 1800

cagcagatcc gccgcgccga acccaacgtg ctgctgctgg acgccggcga ccagtaccag 1860

ggcactatct ggttcaccgt gtacaagggc gccgaggtgg cgcacttcat gaacgccctg 1920

cgctacgatg ccatggcact gggaaatcat gaatttgata atggtgtgga aggactgatc 1980

gagccactcc tcaaagaggc caaatttcca attctgagtg caaacattaa agcaaagggg 2040

ccactagcat ctcaaatatc aggactttat ttgccatata aagttcttcc tgttggtgat 2100

gaagttgtgg gaatcgttgg atacacttcc aaagaaaccc cttttctctc aaatccaggg 2160

acaaatttag tgtttgaaga tgaaatcact gcattacaac ctgaagtaga taagttaaaa 2220

actctaaatg tgaacaaaat tattgcactg ggacattcgg gttttgaaat ggataaactc 2280

atcgctcaga aagtgagggg tgtggacgtc gtggtgggag gacactccaa cacatttctt 2340

tacacaggca atccaccttc caaagaggtg cctgctggga agtacccatt catagtcact 2400

tctgatgatg ggcggaaggt tcctgtagtc caggcctatg cttttggcaa atacctaggc 2460

tatctgaaga tcgagtttga tgaaagagga aacgtcatct cttcccatgg aaatcccatt 2520

cttctaaaca gcagcattcc tgaagatcca agcataaaag cagacattaa caaatggagg 2580

ataaaattgg ataattattc tacccaggaa ttagggaaaa caattgtcta tctggatggc 2640

tcctctcaat catgccgctt tagagaatgc aacatgggca acctgatttg tgatgcaatg 2700

attaacaaca acctgagaca cacggatgaa atgttctgga accacgtatc catgtgcatt 2760

ttaaatggag gtggtatccg gtcgcccatt gatgaacgca acaatggcac aattacctgg 2820

gagaacctgg ctgctgtatt gccctttgga ggcacatttg acctagtcca gttaaaaggt 2880

tccaccctga agaaggcctt tgagcatagc gtgcaccgct acggccagtc cactggagag 2940

ttcctgcagg tgggcggaat ccatgtggtg tatgatcttt cccgaaaacc tggagacaga 3000

gtagtcaaat tagatgttct ttgcaccaag tgtcgagtgc ccagttatga ccctctcaaa 3060

atggacgagg tatataaggt gatcctccca aacttcctgg ccaatggtgg agatgggttc 3120

cagatgataa aagatgaatt attaagacat gactctggtg accaagatat caacgtggtt 3180

tctacatata tctccaaaat gaaagtaatt tatccagcag ttgaaggtcg gatcaagttt 3240

tccacaggaa gtcactgcca tggaagcttt tctttaatat ttctttcact ttgggcagtg 3300

atctttgttt tataccaagg aagcggagct actaacttca gcctgctgaa gcaggctgga 3360

gacgtggagg agaaccctgg acctatgagg atatttgctg tctttatatt catgacctac 3420

tggcatttgc tgaacgcatt tactgtcacg gttcccaagg acctatatgt ggtagagtat 3480

ggtagcaata tgacaattga atgcaaattc ccagtagaaa aacaattaga cctggctgca 3540

ctaattgtct attgggaaat ggaggataag aacattattc aatttgtgca tggagaggaa 3600

gacctgaagg ttcagcatag tagctacaga cagagggccc ggctgttgaa ggaccagctc 3660

tccctgggaa atgctgcact tcagatcaca gatgtgaaat tgcaggatgc aggggtgtac 3720

cgctgcatga tcagctatgg tggtgccgac tacaagcgaa ttactgtgaa agtcaatgcc 3780

ccatacaaca aaatcaacca aagaattttg gttgtggatc cagtcacctc tgaacatgaa 3840

ctgacatgtc aggctgaggg ctaccccaag gccgaagtca tctggacaag cagtgaccat 3900

caagtcctga gtggtaagac caccaccacc aattccaaga gagaggagaa acttttcaat 3960

gtgaccagca cactgagaat caacacaaca actaatgaga ttttctactg cacttttagg 4020

agattagatc ctgaggaaaa ccatacagct gaattggtca tcccagaact acctctggca 4080

catcctccaa atgaaaggac tcacttggta attctgggag ccatcttatt atgccttggt 4140

gtagcactga cattcatctt ccgtttaaga aaagggagaa tgatggatgt gaaaaaatgt 4200

ggcatccaag atacaaactc aaagaagcaa agtgatacac atttggagga gacgtaa 4257

<210> 57

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 57

gttcatgcgc aagaggatcg 20

<210> 58

<211> 3318

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> synthetic

<400> 58

atggaagata caaaggagtc taacgtgaag acattttgct ccaagaatat cctagccatc 60

cttggcttct cctctatcat agctgtgata gctttgcttg ctgtggggtt gacccagaac 120

aaagcattgc cagaaaacgt taagtatggg attgtgctgg atgcgggttc ttctcacaca 180

agtttataca tctataagtg gccagcagaa aaggagaatg acacaggcgt ggtgcatcaa 240

gtagaagaat gcagggttaa aggtcctgga atctcaaaat ttgttcagaa agtaaatgaa 300

ataggcattt acctgactga ttgcatggaa agagctaggg aagtgattcc aaggtcccag 360

caccaagaga cacccgttta cctgggagcc acggcaggca tgcggttgct caggatggaa 420

agtgaagagt tggcagacag ggttctggat gtggtggaga ggagcctcag caactacccc 480

tttgacttcc agggtgccag gatcattact ggccaagagg aaggtgccta tggctggatt 540

actatcaact atctgctggg caaattcagt cagaaaacaa ggtggttcag catagtccca 600

tatgaaacca ataatcagga aacctttgga gctttggacc ttgggggagc ctctacacaa 660

gtcacttttg taccccaaaa ccagactatc gagtccccag ataatgctct gcaatttcgc 720

ctctatggca aggactacaa tgtctacaca catagcttct tgtgctatgg gaaggatcag 780

gcactctggc agaaactggc caaggacatt caggttgcaa gtaatgaaat tctcagggac 840

ccatgctttc atcctggata taagaaggta gtgaacgtaa gtgaccttta caagaccccc 900

tgcaccaaga gatttgagat gactcttcca ttccagcagt ttgaaatcca gggtattgga 960

aactatcaac aatgccatca aagcatcctg gagctcttca acaccagtta ctgcccttac 1020

tcccagtgtg ccttcaatgg gattttcttg ccaccactcc agggggattt tggggcattt 1080

tcagcttttt actttgtgat gaagttttta aacttgacat cagagaaagt ctctcaggaa 1140

aaggtgactg agatgatgaa aaagttctgt gctcagcctt gggaggagat aaaaacatct 1200

tacgctggag taaaggagaa gtacctgagt gaatactgct tttctggtac ctacattctc 1260

tccctccttc tgcaaggcta tcatttcaca gctgattcct gggagcacat ccatttcatt 1320

ggcaagatcc agggcagcga cgccggctgg actttgggct acatgctgaa cctgaccaac 1380

atgatcccag ctgagcaacc attgtccaca cctctctccc actccaccta tgtcttcctc 1440

atggttctat tctccctggt ccttttcaca gtggccatca taggcttgct tatctttcac 1500

aagccttcat atttctggaa agatatggta ggaagcggag ctactaactt cagcctgctg 1560

aagcaggctg gagacgtgga ggagaaccct ggacctatgt gtccccgagc cgcgcgggcg 1620

cccgcgacgc tactcctcgc cctgggcgcg gtgctgtggc ctgcggctgg cgcctgggag 1680

cttacgattt tgcacaccaa cgacgtgcac agccggctgg agcagaccag cgaggactcc 1740

agcaagtgcg tcaacgccag ccgctgcatg ggtggcgtgg ctcggctctt caccaaggtt 1800

cagcagatcc gccgcgccga acccaacgtg ctgctgctgg acgccggcga ccagtaccag 1860

ggcactatct ggttcaccgt gtacaagggc gccgaggtgg cgcacttcat gaacgccctg 1920

cgctacgatg ccatggcact gggaaatcat gaatttgata atggtgtgga aggactgatc 1980

gagccactcc tcaaagaggc caaatttcca attctgagtg caaacattaa agcaaagggg 2040

ccactagcat ctcaaatatc aggactttat ttgccatata aagttcttcc tgttggtgat 2100

gaagttgtgg gaatcgttgg atacacttcc aaagaaaccc cttttctctc aaatccaggg 2160

acaaatttag tgtttgaaga tgaaatcact gcattacaac ctgaagtaga taagttaaaa 2220

actctaaatg tgaacaaaat tattgcactg ggacattcgg gttttgaaat ggataaactc 2280

atcgctcaga aagtgagggg tgtggacgtc gtggtgggag gacactccaa cacatttctt 2340

tacacaggca atccaccttc caaagaggtg cctgctggga agtacccatt catagtcact 2400

tctgatgatg ggcggaaggt tcctgtagtc caggcctatg cttttggcaa atacctaggc 2460

tatctgaaga tcgagtttga tgaaagagga aacgtcatct cttcccatgg aaatcccatt 2520

cttctaaaca gcagcattcc tgaagatcca agcataaaag cagacattaa caaatggagg 2580

ataaaattgg ataattattc tacccaggaa ttagggaaaa caattgtcta tctggatggc 2640

tcctctcaat catgccgctt tagagaatgc aacatgggca acctgatttg tgatgcaatg 2700

attaacaaca acctgagaca cacggatgaa atgttctgga accacgtatc catgtgcatt 2760

ttaaatggag gtggtatccg gtcgcccatt gatgaacgca acaatggcac aattacctgg 2820

gagaacctgg ctgctgtatt gccctttgga ggcacatttg acctagtcca gttaaaaggt 2880

tccaccctga agaaggcctt tgagcatagc gtgcaccgct acggccagtc cactggagag 2940

ttcctgcagg tgggcggaat ccatgtggtg tatgatcttt cccgaaaacc tggagacaga 3000

gtagtcaaat tagatgttct ttgcaccaag tgtcgagtgc ccagttatga ccctctcaaa 3060

atggacgagg tatataaggt gatcctccca aacttcctgg ccaatggtgg agatgggttc 3120

cagatgataa aagatgaatt attaagacat gactctggtg accaagatat caacgtggtt 3180

tctacatata tctccaaaat gaaagtaatt tatccagcag ttgaaggtcg gatcaagttt 3240

tccacaggaa gtcactgcca tggaagcttt tctttaatat ttctttcact ttgggcagtg 3300

atctttgttt tataccaa 3318

<210> 59

<211> 22

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 59

aggatacgtt tttctgttgg gc 22

<210> 60

<211> 20

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 60

ggagaacggg aaaagagcga 20

Claims

1. An in vitro method for producing universal donor cells, the method comprising delivering to a stem cell:

(a) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a first target locus, a first nucleic acid comprising a nucleotide sequence encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a midbrain astrocyte-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39) and/or cluster of differentiation 73 (CD 73), wherein the first target locus is cleaved at the target site and the first nucleic acid is inserted into the target locus, thereby disrupting the target gene; and/or

(b) An RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a beta-2 microglobulin (B2M) locus, wherein the B2M locus is cleaved at the target site, thereby disrupting the B2M gene; and/or

(c) An RNA-guided nuclease and a guide RNA (gRNA) targeting a target site in a thioredoxin interacting protein (TXNIP) locus, wherein the TXNIP locus is cleaved at the target site, thereby disrupting the TXNIP gene; and/or

(d) An RNA-guided nuclease and a guide RNA (gRNA) that targets a target site in a class II transactivator (CIITA) locus, wherein the CIITA locus is cleaved at the target site, thereby disrupting the CIITA gene; and/or

(e) RNA-guided nucleases and guide RNAs (grnas) that target a target site in a transforming growth factor β (tgfβ) locus, wherein the tgfβ locus is cleaved at the target site, thereby disrupting the tgfβ gene.

2. The in vitro method of claim 1, wherein the target locus of (a) is selected from the group consisting of a B2M locus or a β -2 microglobulin (B2M) locus of (B), a TXNIP locus or a thioredoxin interacting protein (TXNIP) locus of (c), a CIITA locus or a class II transactivator (CIITA) locus of (d), and a tgfp locus or transforming growth factor β (tgfp) locus of (e), wherein the universal donor cell has disrupted expression of B2M, TXNIP, CIITA and/or tgfp.

3. The in vitro method of claim 1 or 2, wherein the disrupted expression of B2M, TXNIP, CIITA and/or tgfβ comprises a reduction or elimination of expression of B2M, TXNIP, CIITA and/or tgfβ.

4. The in vitro method of any one of claims 1-3, wherein the target locus of (a) is the B2M locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (i) and (ii); and/or the target locus of (a) is the B2M locus of (B), and the first nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus of (B); and (iv) a nucleotide sequence having sequence homology to a genomic region located right to the target site in the B2M locus of (B), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of B2M.

5. The in vitro method of claim 4, wherein the nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 15.

6. The in vitro method of claim 4 or 5, wherein the nucleotide sequence of (ii) or (iv) comprises or consists essentially of SEQ ID No. 22.

7. The in vitro method of any one of claims 1-3, wherein the target locus of (a) is the TXNIP locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (i) and (ii); and/or the target locus of (a) is the TXNIP locus of (c), and the first nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus of (c); and (iv) a nucleotide sequence having sequence homology to a genomic region located right to the target site in the TXNIP locus of (c), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of TXNIP.

8. The in vitro method of claim 7, wherein the nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 42.

9. The in vitro method according to claim 7 or 8, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 44.

10. The in vitro method of any one of claims 1-3, wherein the target locus of (a) is the CIITA locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (i) and (ii); and/or the target locus of (a) is the CIITA locus of (d), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus of (d); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus of (d), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of CIITA.

11. The in vitro method according to claim 10, wherein said nucleotide sequence of (i) or (iii) comprises or essentially consists of SEQ ID No. 26.

12. The in vitro method according to claim 10 or 11, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 28.

13. The in vitro method of any one of claims 1-3, wherein the target locus of (a) is the tgfβ locus, and the nucleic acid further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (i) and (ii); and/or the target locus of (a) is the tgfβ locus of (e), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus of (e); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfp locus of (e), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39 and/or CD73 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of tgfβ.

14. The in vitro method according to any one of claims 1 to 13, wherein said target site of (b) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 1 to 13.

15. The in vitro method according to any one of claims 1 to 14, wherein said target site of (c) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 32-41.

16. The in vitro method according to any one of claims 1 to 15, wherein said target site of (d) comprises a nucleotide sequence consisting essentially of any one of SEQ ID NOs 25 and 48-51.

17. The in vitro method according to any one of claims 1 to 16, wherein said target site of (e) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 57.

18. The in vitro method of any one of claims 1 to 17, further comprising delivering to the stem cells:

(f) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a neurotrophic factor of midbrain astrocyte origin (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA class I histocompatibility antigen alpha chain E (HLA-E) and/or programmed death ligand 1 (PD-L1), wherein the target locus is cleaved at the target locus and the nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are inserted into the target locus, thereby disrupting the target gene.

19. The in vitro method of claim 18, wherein the target locus of (f) is selected from the group consisting of a beta-2 microglobulin (B2M) locus or a B2M locus, (c) a thioredoxin interacting protein (TXNIP) locus or a TXNIP locus, (d) a class II transactivator (CIITA) locus or a CIITA locus and/or a transforming growth factor beta (tgfβ) locus or tgfβ locus of (e), and wherein the universal donor cell has disrupted expression of B2M, TXNIP, CIITA and/or tgfβ.

20. The in vitro method of claim 18 or 19, wherein the target locus of (f) is the B2M locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (f) is the B2M locus of (B), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus of (B); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus of (B), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of B2M.

21. The in vitro method according to claim 20, wherein said nucleotide sequence of (i) or (iii) comprises or essentially consists of SEQ ID No. 15.

22. The in vitro method according to claim 20 or 21, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 22.

23. The in vitro method of claim 19, wherein the target locus of (f) is the TXNIP locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (f) is the TXNIP locus of (c), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus of (c); and (iv) a nucleotide sequence having sequence homology to a genomic region located right to the target site in the TXNIP locus of (c), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of TXNIP.

24. The in vitro method of claim 23, wherein said nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 42.

25. The in vitro method according to claim 23 or 24, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 44.

26. The in vitro method of claim 18 or 19, wherein the target locus of (f) is the CIITA locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (f) is the CIITA locus of (d), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus of (d); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus of (d), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of CIITA.

27. The in vitro method of claim 26, wherein the nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 26.

28. The in vitro method according to claim 26 or 27, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 28.

29. The in vitro method of claim 19, wherein the target locus of (f) is the tgfβ locus, and the nucleic acid of (f) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (f) is the tgfβ locus of (e), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus of (e); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfp locus of (E), wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 is flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of tgfβ.

30. The in vitro method according to any one of claims 18 to 29, wherein said target locus of (f) is identical to said target locus of (a).

31. The in vitro method of any one of claims 18 to 29, wherein the target locus of (f) is different from the target locus of (a).

32. The in vitro method according to any one of claims 18 to 31, further comprising delivering to the stem cells:

(g) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a glial cell-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E and/or PD-L1, wherein the target locus is cleaved at the target locus and the nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are inserted into the target locus, thereby disrupting the target gene.

33. The in vitro method of claim 18, wherein the target locus of (g) is selected from the group consisting of a beta-2 microglobulin (B2M) locus or a B2M locus, (c) a thioredoxin interacting protein (TXNIP) locus or a TXNIP locus, (d) a class II transactivator (CIITA) locus or a CIITA locus and/or a transforming growth factor beta (tgfβ) locus or tgfβ locus of (e), and wherein the universal donor cell has disrupted expression of B2M, TXNIP, CIITA and/or tgfβ.

34. The in vitro method of claim 32 or 33, wherein the target locus of (g) is the B2M locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (g) is the B2M locus of (B), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus of (B); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus of (B), wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 is flanked by (iii) and B (iv); and wherein the universal donor cell has disrupted expression of B2M.

35. The in vitro method of claim 34, wherein the nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 15.

36. The in vitro method according to any one of claims 34 or 35, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 22.

37. The in vitro method of claim 32 or 33, wherein the target locus of (g) is the TXNIP locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the sequences encoding the d nucleotide sequences of TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (g) is the TXNIP locus of (c), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus of (c); and (iv) a nucleotide sequence having sequence homology to a genomic region located right to the target site in the TXNIP locus of (c), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of TXNIP.

38. The in vitro method of claim 37, wherein the nucleotide sequence of (i) or (iii) comprises or consists essentially of SEQ ID No. 42.

39. The in vitro method according to claim 37 or 38, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 44.

40. The in vitro method of claim 32 or 33, wherein the target locus of (g) is the CIITA locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the sequences encoding the d nucleotide sequences of TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (g) is the CIITA locus of (d), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus of (d); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of CIITA.

41. The in vitro method according to claim 40, wherein said nucleotide sequence of (i) or (iii) comprises or essentially consists of SEQ ID NO. 26.

42. The in vitro method according to claim 40 or 41, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID NO. 28.

43. The in vitro method of claim 32 or 33, wherein the target locus of (g) is the tgfβ locus, and the nucleic acid of (g) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (g) is the tgfβ locus of (e), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus of (e); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfp locus of (E), wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 is flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of tgfβ.

44. The in vitro method according to any one of claims 32 to 43, wherein said target locus of (g) is identical to said target locus of (a) and/or (f).

45. The in vitro method according to any one of claims 32 to 43, wherein said target locus of (g) is different from said target locus of (a) and/or (f).

46. The in vitro method of any one of claims 32-45, further comprising delivering to the stem cells:

(h) RNA-guided nucleases and guide RNAs (grnas) targeting a target site in a target locus, and nucleic acids comprising nucleotide sequences encoding tumor necrosis factor alpha-inducing protein 3 (TNFAIP 3), a glial cell-derived neurotrophic factor (MANF), cluster of differentiation 39 (CD 39), cluster of differentiation 73 (CD 73), HLA-E and/or PD-L1, wherein the target locus is cleaved at the target locus and the nucleic acids comprising nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are inserted into the target locus, thereby disrupting the target gene.

47. The in vitro method of claim 18, wherein the target locus of (h) is selected from the group consisting of a beta-2 microglobulin (B2M) locus or a B2M locus, (c) a thioredoxin interacting protein (TXNIP) locus or a TXNIP locus, (d) a class II transactivator (CIITA) locus or a CIITA locus and/or a transforming growth factor beta (tgfβ) locus or tgfβ locus of (e), and wherein the universal donor cell has disrupted expression of B2M, TXNIP, CIITA and/or tgfβ.

48. The in vitro method of claim 46 or 47, wherein the target locus of (h) is the B2M locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (h) is the B2M locus of (B), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the B2M locus of (B); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the B2M locus of (B), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and wherein the universal donor cell has disrupted expression of B2M.

49. The in vitro method according to claim 48, wherein said nucleotide sequence of (i) or (iii) comprises or essentially consists of SEQ ID NO. 15.

50. The in vitro method according to any one of claims 48 or 49, wherein said nucleotide sequence of (ii) or (iv) comprises or essentially consists of SEQ ID No. 22.

51. The in vitro method of claim 46 or 47, wherein the target locus of (h) is the TXNIP locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the TXNIP locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (h) is the TXNIP locus of (c), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the TXNIP locus of (c); and (iv) a nucleotide sequence having sequence homology to a genomic region located right to the target site in the TXNIP locus of (c), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and the universal donor cell has disrupted expression of TXNIP.

52. The in vitro method according to claim 51, wherein the nucleotide sequence of (i) comprises or essentially consists of SEQ ID NO. 42.

53. The in vitro method according to claim 51 or 52, wherein the nucleotide sequence of (ii) comprises or essentially consists of SEQ ID NO 44.

54. The in vitro method of claim 46 or 47, wherein the target locus of (h) is the CIITA locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (h) is the CIITA locus of (d), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the CIITA locus of (d); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the CIITA locus of (d), wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (iii) and (iv); and the universal donor cell has disrupted expression of CIITA.

55. The in vitro method according to claim 54, wherein said nucleotide sequence of (i) comprises or consists essentially of SEQ ID NO. 26.

56. The in vitro method of claim 54 or 55, wherein said nucleotide sequence of (ii) comprises or consists essentially of SEQ ID No. 28.

57. The in vitro method of claim 46 or 47, wherein the target locus of (h) is the tgfβ locus, and the nucleic acid of (h) further comprises (i) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus; and (ii) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfβ locus, wherein the nucleotide sequences encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 are flanked by (i) and (ii); and/or the target locus of (h) is the tgfβ locus of (e), and the nucleic acid further comprises (iii) a nucleotide sequence having sequence homology to a genomic region located to the left of the target locus in the tgfβ locus of (e); and (iv) a nucleotide sequence having sequence homology to a genomic region located to the right of the target site in the tgfp locus of (E), wherein the nucleotide sequence encoding TNFAIP3, MANF, CD39, CD73, HLA-E and/or PD-L1 is flanked by (iii) and (iv); and the universal donor cell has disrupted expression of tgfβ.

58. The in vitro method of any one of claims 46 to 57, wherein the target locus of (h) is the same as the target locus of (a), (f) and/or (g).

59. The in vitro method of any one of claims 46 to 57, wherein the target locus of (h) is different from the target locus of (a), (f) and/or (g).

60. The in vitro method of any one of claims 1 to 59, wherein said nucleic acid of (a), said nucleic acid of (f), said nucleic acid of (g) and/or said nucleic acid of (h) comprises a nucleotide sequence encoding MANF, and said universal donor cell expresses MANF.

61. The in vitro method of claim 60, wherein said nucleotide sequence encoding MANF consists essentially of SEQ ID No. 17.

62. The in vitro method of any one of claims 1 to 61, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding TNFAIP3, and the universal donor cell expresses TNFAIP3.

63. The in vitro method according to claim 62, wherein said nucleotide sequence encoding TNFAIP3 consists essentially of SEQ ID NO. 19.

64. The in vitro method of any one of claims 1 to 63, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD39, and the universal donor cell expresses CD39.

65. The in vitro method according to claim 64, wherein said nucleotide sequence encoding CD39 consists essentially of SEQ ID NO. 27.

66. The in vitro method of any one of claims 1 to 65, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD73, and the universal donor cell expresses CD73.

67. The in vitro method according to claim 66, wherein said nucleotide sequence encoding CD73 consists essentially of SEQ ID No. 46.

68. The in vitro method of any one of claims 1 to 67, wherein the nucleic acid of (a) further comprises a nucleotide sequence encoding HLA class I histocompatibility antigen a chain E (HLA-E), and the universal donor cell further expresses HLA-E.

69. The in vitro method of any one of claims 18-68, wherein the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding an HLA class I histocompatibility antigen a chain E (HLA-E), and the universal donor cell expresses HLA-E.

70. The in vitro method of claim 68 or 69, wherein the nucleotide sequence encoding HLA-E comprises a sequence encoding an HLA-E trimer comprising a B2M signal peptide fused to an HLA-G presenting peptide fused to a B2M membrane protein fused to HLA-E without its signal peptide.

71. The in vitro method of any one of claims 68 to 70, wherein said nucleotide sequence encoding HLA-E consists essentially of SEQ ID No. 43.

72. The in vitro method of any one of claims 68 to 71, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding MANF and a nucleotide sequence encoding HLA-E, and the universal donor cell expresses MANF and HLA-E.

73. The in vitro method of claim 72, wherein said nucleic acid of (a), said nucleic acid of (f), said nucleic acid of (g) and/or said nucleic acid of (h) comprises a nucleotide sequence encoding MANF linked to a nucleotide sequence encoding a P2A peptide linked to a nucleotide sequence encoding HLA-E.

74. The in vitro method of claim 73, wherein said nucleic acid of (a), said nucleic acid of (f), said nucleic acid of (g) and/or said nucleic acid of (h) comprises a nucleotide sequence consisting of SEQ ID No. 55.

75. The in vitro method of any one of claims 1 to 74, wherein the nucleic acid of (a) further comprises a nucleotide sequence encoding a programmed death ligand 1 (PD-L1), and the universal donor cell further expresses PD-L1.

76. The in vitro method of any one of claims 18 to 75, wherein the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding PD-L1, and the universal donor cell expresses PD-L1.

77. The in vitro method of claim 75 or 76, wherein said nucleotide sequence encoding PD-L1 consists essentially of SEQ ID No. 20.

78. The in vitro method of claims 75-77, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding TNFAIP3 and a nucleotide sequence encoding PD-L1, and the universal donor cell expresses TNFAIP3 and PD-L1.

79. The in vitro method of claim 78, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding TNFAIP3, the nucleotide sequence encoding TNFAIP3 is linked to a nucleotide sequence encoding a P2A peptide, the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding PD-L1.

80. The in vitro method of claim 79, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence consisting essentially of SEQ ID No. 54.

81. The in vitro method of any one of claims 75 to 80, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD39 and a nucleotide sequence encoding PD-L1, and the universal donor cell expresses CD39 and PD-L1.

82. The in vitro method of claim 81, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD39, the nucleotide sequence encoding CD39 is linked to a nucleotide sequence encoding a P2A peptide, the nucleotide sequence encoding a P2A peptide is linked to a nucleotide sequence encoding PD-L1.

83. The in vitro method of claim 82, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 53.

84. The in vitro method of any one of claims 75-83, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding MANF, a nucleotide sequence encoding TNFAIP3, and a nucleotide sequence encoding PD-L1, and the universal donor cell expresses MANF, TNFAIP3, and PD-L1.

85. The in vitro method of claim 84, wherein said nucleic acid of (a), said nucleic acid of (f), said nucleic acid of (g) and/or said nucleic acid of (h) comprises a nucleotide sequence encoding MANF and a nucleotide sequence encoding TNFAIP3, said nucleotide sequence encoding MANF being linked to a nucleotide sequence encoding TNFAIP3 by a first nucleotide sequence encoding a P2A peptide, said nucleotide sequence encoding TNFAIP3 being linked to a nucleotide sequence encoding PD-L1 by a second nucleotide sequence encoding a P2A peptide.

86. The in vitro method of claim 85, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 52.

87. The in vitro method of any one of claims 75 to 86, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD39, a nucleotide sequence encoding CD73 and a nucleotide sequence encoding PD-L1, and the universal donor cell expresses CD39, CD73 and PD-L1.

88. The in vitro method of claim 87, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding CD73 by the first nucleotide sequence encoding a P2A peptide and the nucleotide sequence encoding CD73 is linked to the nucleotide sequence encoding PD-L1 by the second nucleotide sequence encoding a P2A peptide.

89. The in vitro method of claim 88, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 56.

90. The in vitro method of any one of claims 1-89, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g), and/or the nucleic acid of (h) comprises a nucleotide sequence encoding CD39 and a nucleotide sequence encoding CD73, and the universal donor cell expresses CD39 and CD73.

91. The in vitro method of claim 90, wherein the nucleotide sequence encoding CD39 is linked to the nucleotide sequence encoding CD73 by a nucleotide sequence encoding a P2A peptide.

92. The in vitro method of claim 91, wherein the nucleic acid of (a), the nucleic acid of (f), the nucleic acid of (g) and/or the nucleic acid of (h) comprises a nucleotide sequence consisting essentially of SEQ ID NO: 58.

93. The in vitro method according to any one of claims 1 to 92, wherein the nucleotide sequence of any one of said nucleic acids of (a), (f), (g) and/or (h) is operably linked to an exogenous promoter.

94. The in vitro method of claim 93, wherein the exogenous promoter is a CMV, EF1 a, PGK, CAG or UBC promoter.

95. The in vitro method of any one of claims 1 to 94, wherein said RNA guided nuclease is present in a ratio of about 1:1 to about 1:10 to said gRNA of (a), (b), (c), (d), (e), (f), (g) and/or (h).

96. The in vitro method of any one of claims 1 to 95, wherein the RNA guided nuclease is present in a ratio of about 1:1 to about 1:10 to the gRNA of each of (a), (b), (c), (d), (e), (f), (g) and/or (h).

97. The in vitro method of any one of claims 1 to 96, wherein the RNA-guided nuclease of each of (a), (b), (c), (d), (e), (f), (g), and/or (h) is a Cas9 nuclease.

98. The in vitro method of claim 97, wherein the Cas9 nuclease is linked to at least one nuclear localization signal.

99. The in vitro method of any one of claims 1-98, wherein said stem cell is an embryonic stem cell, an adult stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.

100. The in vitro method of any one of claims 1 to 99, wherein the stem cells are human stem cells.

101. The in vitro method of any one of claims 1 to 100, wherein said universal donor cell has increased immune evasion and/or survival after transplantation compared to a comparable cell without nucleic acid insertion and/or gene disruption.