CN116926099A - Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances - Google Patents

Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances Download PDF

Info

Publication number
CN116926099A
CN116926099A CN202210378766.8A CN202210378766A CN116926099A CN 116926099 A CN116926099 A CN 116926099A CN 202210378766 A CN202210378766 A CN 202210378766A CN 116926099 A CN116926099 A CN 116926099A
Authority
CN
China
Prior art keywords
plasmid
bacterial
physical
lysis
bacterial cellulose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210378766.8A
Other languages
Chinese (zh)
Inventor
高艳梅
金帆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Institute of Advanced Technology of CAS
Original Assignee
Shenzhen Institute of Advanced Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Institute of Advanced Technology of CAS filed Critical Shenzhen Institute of Advanced Technology of CAS
Priority to CN202210378766.8A priority Critical patent/CN116926099A/en
Publication of CN116926099A publication Critical patent/CN116926099A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/78—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a preparation method and application of physical stimulus control for producing bacterial cellulose engineering bacteria for pyrolysis, in particular discloses a plasmid for physical control for bacterial pyrolysis, wherein the plasmid is provided with a physical activation promoter and a coding gene of a pyrolysis protein amplified under the control of the physical activation promoter, the upstream of the coding gene of the pyrolysis protein is also provided with a Ribosome Binding Site (RBS), and the Ribosome Binding Site (RBS) has a sequence as shown in SEQ ID NO.3 or a sequence with 1,2,3 or 4 base mutation on SEQ ID NO. 3; the invention also discloses a bacterial cellulose engineering bacterium which contains the plasmid and can be generated. According to the invention, the problems of self-cleaning and intracellular substance release are realized by constructing a cracking system in host bacteria, the conditions are controllable, the accuracy is high, and the accurate regulation and control on engineering bacteria cracking are realized by regulating RBS sites of cracking proteins.

Description

Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a blue light controlled acetobacter xylinum cracking death and intracellular material release system capable of generating a cellulose film.
Background
Bacteria grow fast and are convenient for large-scale culture, so that the bacteria have been used by researchers for producing various medicines. With the development of synthetic biology, the use of engineered bacteria as drug delivery systems has the incomparable advantage of traditional methods of administration [1] . For example, bacteria can protect the activity of the drug, increasing the half-life of the drug; more importantly, bacteria can deliver drugs to body parts that are difficult to reach by injection or oral administration.
Microorganisms such as Acetobacter xylinum can produce a strong and ultrapure natural Bacterial Cellulose (BC) as compared to other bacteria. The BC has good biocompatibility, can provide optimal three-dimensional matrix for cell attachment, is nontoxic to various cells, can provide flexibility, high water retention capacity and gas exchange [2][3] . Although BC membranes have been widely used in the fields of food, medical treatment, etc., there are few modifications to the Acetobacter xylinum strain itself, making its function more single. In recent years, researchers have attempted to express some foreign proteins using acetobacter xylinum, but the problem of controlled release of intracellular expressed proteins and the like has not been solved yet [4] 。
[1]Kang M,Choe D,Kim K,et al.Synthetic Biology Approaches in The Development of Engineered Therapeutic Microbes[J].Int J Mol Sci,2020,21(22):
[2]Picheth GF,Pirich CL,Sierakowski MR,et al.Bacterial cellulose in biomedical applications:A review[J].Int.J.Biol.Macromol,2017,104(Pt A):97-106.
[3]Barja F.Bacterial nanocellulose production and biomedical applications[J].J Biomed Res,2021,35(4):310-317.
[4]Florea M,Hagemann H,Santosa G,et al.Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain[J].Proc.Natl.Acad.Sci.U.S.A,2016,113(24):E3431-3440.
Disclosure of Invention
To solve the above problems, the present invention constructs a physically activated lysis system to control the self-elimination of bacteria that can produce bacterial cellulose membranes and the release of intracellular material. According to the invention, a set of cracking system regulated and controlled by physical stimulus is constructed in bacteria capable of generating bacterial cellulose by a synthetic biological method to remotely control bacterial cracking and intracellular substance release capable of generating bacterial cellulose. The engineered bacteria that produce bacterial cellulose can normally grow and produce BC films in dark conditions, but when physically stimulated, the bacteria that produce bacterial cellulose lyse and release intracellular produced material.
In one aspect, the invention provides a plasmid for physically controlling bacterial lysis, wherein the plasmid has a physically activated promoter and a gene encoding a lysate amplified under the control of the physically activated promoter, the encoding gene of the lysate further has a ribosome binding site upstream of the gene encoding the lysate, and the ribosome binding site (ribosome binding site, RBS) has a sequence as set forth in SEQ ID NO. 3.
Further, the physically activated promoter is a promoter capable of initiating a start due to a change in light, temperature, pressure, osmotic pressure.
Further, the light is preferably blue light.
Further, the physically activated promoter is selected from the blue light promoter pDawn, preferably, the sequence of which is shown in SEQ ID NO. 1.
Further, the lytic protein is selected from the group consisting of proteins capable of causing bacterial lysis, preferably bacteriophage E, LKD phage lytic protein of phage phi 174, lambda phage lytic protein.
Further, the coding sequence of the cleavage protein E of the phage phi 174 is shown as SEQ ID NO. 2.
Further, the plasmid is selected from any plasmid replicable in bacteria that can produce bacterial cellulose, for example, pSEVA331 as a vector plasmid.
In another aspect, the present invention provides a bacterial cellulose membrane (BC) producing engineering bacterium having the above plasmid for physical control lysis of the present invention, which is capable of being activated by physical stimulation for lysis.
Further, the host bacteria for producing the bacterial cellulose membrane engineering bacteria are at least one selected from acetobacter xylinum, acetobacter pasteurii, acetobacter xylosoxidans, acetobacter hansenii, acetobacter aceti, acetobacter aerogenes, rhizobium, achromobacter, agrobacterium, pseudomonas, alcaligenes, sarcina, and zoogloea.
Further, the genome or plasmid of the engineering bacterium capable of producing bacterial cellulose membrane can express the coding gene of the exogenous active substance.
Further, the active substance is selected from the group consisting of proteins, RNAs, polypeptides.
In a further aspect, the invention provides a construction method for engineering bacteria capable of generating bacterial cellulose membranes, which comprises the following steps:
s11) constructing a plasmid for physically controlling bacterial lysis, wherein the plasmid is provided with a physically activated promoter and a coding gene of a lysate amplified under the control of the physically activated promoter, the upstream of the coding gene of the lysate is also provided with a ribosome binding site, and the ribosome binding site has a sequence shown in SEQ ID NO. 3;
s12) transferring the plasmid for physical control bacterial lysis into wild bacteria capable of generating bacterial cellulose membrane to obtain bacterial cellulose membrane producing engineering bacteria capable of controlling lysis under physical conditions.
In a further aspect, the invention provides the use of a plasmid for physical control lysis according to the invention for the preparation of bacteria capable of being lysed by physical stimulation.
In yet another aspect, the invention provides a method of modulating bacterial lysis and release of intracellular material produced by bacteria, the method comprising:
s01) constructing the engineering bacteria capable of generating bacterial cellulose films;
s02) activating the bacterial cellulose membrane engineering bacteria to be generated by physical stimulation for cracking.
In a further aspect, the invention provides a method for constructing an engineering bacterium capable of inducing lysis by physical stimulation, the method comprising the steps of:
s1) selecting a corresponding promoter according to the physical stimulus type, and selecting a lysate according to the bacterial type;
s2) constructing a mixed plasmid connection liquid by adopting a random primer method, wherein the mixed plasmid connection liquid comprises the promoter selected in the step S1), a series of different ribosome binding sites designed and obtained by the random primer method and the coding gene sequence of the cracking protein selected in the step S1);
s3) transferring the mixed plasmid connection liquid obtained in the step S2) into escherichia coli to obtain escherichia coli engineering bacteria to be screened;
s4) respectively culturing the engineering bacteria of the escherichia coli to be screened under the physical stimulation in the step S1) and under the condition of non-physical stimulation, and screening to obtain escherichia coli strains which can normally grow under the condition of non-physical stimulation and are completely lysed under the condition of physical stimulation;
s5) extracting corresponding recombinant plasmids from the escherichia coli engineering bacteria obtained through screening in the step S4), sequencing to obtain corresponding ribosome binding site sequences, and respectively introducing the recombinant plasmids into the wild type bacteria in the step S1) to obtain engineering bacteria capable of being induced to crack by physical stimulation.
Further, the bacterium is a cellulose membrane-forming bacterium capable of forming a foreign protein or a target component
Further, the physical stimulus is a change in light, temperature, pressure, osmotic pressure.
Advantageous effects
1. The invention provides a method for controlling the cracking of engineering bacteria by using a non-invasive induction mode, which avoids the problems of invasion of chemical inducer and diffusion in bacterial cellulose membrane, and the regulation mode is not limited by time and space.
2. According to the invention, the problem of missing expression of the cracking protein is solved by a special method, so that engineering bacteria cannot be cracked due to missing expression of the cracking protein when the engineering bacteria are not subjected to physical stimulation, and further, enough cellulose membranes or expected proteins cannot be obtained, or the effect of cracking host bacteria is not realized in the time of hope of cracking. Meanwhile, the invention also solves the problem that the cracking protein can not reach the lowest cracking threshold level after being started by physical stimulus, and can not realize the cracking of host bacteria.
3. The bacterial cellulose membrane can be prepared by the method, and bacteria for producing the bacterial cellulose membrane can realize self-cleaning through pyrolysis without adding additional reagents, so that the obtained bacterial cellulose is cleaner, has no pollution, has no residues of organic matters and the like, and is expected to realize more purposes.
4. According to the invention, the problems of self-cleaning and release of produced intracellular substances are realized by constructing a cracking system in host bacteria, the conditions are controllable, the accuracy is high, and more accurate regulation and control of cracking proteins are realized by regulating RBS sites.
Drawings
FIG. 1 is a schematic diagram showing the intracellular material release of Acetobacter xylinum and detailed gene loops in engineering bacteria under blue light control: under the dark condition, the promoter pDawn is not started, and engineering bacteria normally grow and generate BC films. After using blue light illumination, the pDAWN promoter starts high expression of the cracking protein X174E, and after the concentration reaches a certain threshold value, the acetobacter xylinum is cracked to release intracellular substances produced by the acetobacter xylinum.
FIG. 2 is a graph showing the results of E.coli screening, wherein: 1,2,3,4 represent four different monoclonal spots of LB agar plates, respectively. Only monoclonal spot 4 was able to respond to blue light cleavage while growing normally in the dark (which corresponds to RBS designated RBS 4).
Fig. 3 is a graph of experimental results of acetobacter xylinum with blue light control: the engineering bacteria can grow normally under the light-shielding condition, but the illumination condition is completely cracked.
Detailed Description
The following detailed description of the present invention will be made in detail to make the above objects, features and advantages of the present invention more apparent, but should not be construed to limit the scope of the present invention.
EXAMPLE 1 construction of Acetobacter xylinum that can be lysed under blue light control
As illustrated in FIG. 1, acetobacter xylinum ATCC58532 is selected as a host bacterium, the lysate is expressed by a plasmid, pSEVA331 is selected as the vector plasmid, and the expression of the lysate E (X174E, the sequence of which is shown as SEQ ID NO. 2) of phage phi 174 is controlled by using a blue light promoter pDAWN (the sequence of which is shown as SEQ ID NO. 1) in the plasmid, so that the pDAWN-X174E-pSEVA331 plasmid is obtained. Finally, under the dark condition, the pDawn promoter in the engineering bacteria is not started, the engineering bacteria normally grow and can generate cellulose films; however, when blue light (470 nm) is used for illumination, pDawn in the engineering bacteria starts high expression of the cracking protein X174E, and the engineering bacteria crack and die and can release intracellular substances.
However, under dark conditions there is inevitably a lack of expression of the promoter pDawn, which also results in low levels of production of the cleavage protein X174E. If the X174E protein is excessively high in leakage expression, the engineering bacteria cannot grow normally under the dark condition, so that the engineering bacteria containing plasmids cannot be obtained, or the engineering bacteria can grow normally under the dark condition, but cannot respond to blue light splitting. Therefore, the background expression quantity of the X174E protein is the key of controllable engineering bacteria cracking.
As described above, in order to ensure that the engineering bacteria can grow and produce membranes normally in dark conditions, the concentration of the leaked expressed cleavage protein X174E must be lower than the threshold concentration required for cleavage and reach the cleavage threshold after the pDAWN promoter is turned on. In order to obtain an engineering bacterium suitable for X174E protein expression, the inventors of the present invention adjusted the expression level of X174E protein by adjusting the sequence of the pre-ribosome binding site of the cleavage protein. Meanwhile, in order to improve the screening efficiency, the primary screening is performed in the escherichia coli which is mature in molecular biology operation, and then the plasmid obtained by the primary screening is electrically transferred into acetobacter xylinum for further screening. Specifically, the method of random primer mutation is adopted first to screen in batch in the escherichia coli TOP 10.
The method for constructing pDawn-RBSNNN-X174E-pSEVA331 series plasmid by a random primer method comprises the following steps: all fragments and vector ligation in the experiment were obtained by the Gibson ligation method (Gibson assembly), and primers designed by the random primer method were synthesized by Shanghai Biotechnology Co. The plasmid mixture of pDAWN-RBSNNN-X174E-pSEVA331 series obtained by ligation using the random primer method was transferred into E.coli TOP10 super-competence by chemical transformation, and finally plated on LB agar plates containing resistance overnight for culture.
From overnight cultured agar plates, the monoclonal spots were randomly selected and dissolved in 20. Mu.L of sterile water, and 5. Mu.L of each of the two corresponding agar plates was pipetted. After air-drying at room temperature, one of the plates was subjected to light-shielding treatment (wrapped with tin foil) and the other plate was subjected to blue light (50. Mu.W/cm) 2 ) Culturing for 16-24 hr.
The experimental results are shown in fig. 2, and the experimental results show that different plasmids show different results, and the escherichia coli which can normally grow under the light-shielding condition and can be completely lysed under the blue light condition is screened.
Then, the proper plasmid screened from colibacillus is subjected to second generation sequencing, and RBS sequence is confirmed, and the RBS sequence obtained by screening is shown as SEQ ID NO.3 and named RBS4. The screened proper plasmid, namely pDAWN-RBS4-X174E-pSEVA331, is transferred into acetobacter xylinum ATCC58532 by a method of electric shock transformation (3 KV,2 ms), and is coated on a HS agar plate containing resistance to be cultured for 4 days, and finally engineering bacteria pDAWN-RBS4-X174E-pSEVA331-ATCC58532 is obtained.
The experimental results are shown in FIG. 3, and further experimental results show that pDAWN-RBS4-X174E-pSEVA331-ATCC58532 can realize normal growth under the light-shielding condition and complete cleavage under the blue light condition.
In all experiments, E.coli was used as growth medium with LB broth and Acetobacter xylinum ATCC58532 was used as growth medium with hetrin-Schram (HS) medium. If antibiotics were added, chloramphenicol (chl) was used at concentrations of 37. Mu.g/mL and 148. Mu.g/mL for E.coli and Acetobacter xylinum, respectively. In all experiments, the culture temperatures of E.coli and Acetobacter xylinum were 37℃and 30℃respectively, unless otherwise specified.
Element used and corresponding sequence thereof
pDawn SEQ ID NO.1
tcaatcgttgagcatgccggcgcgcatcgcgaggcgaaccagctccgaaaggctgttggcctgcatcttggtcatgacgttggcccgatacacctcgatggtgcgcgggctgatgtcgtactcgcgggcgatcagcttgttggaaaggccggcgatcagcccttccatgacctggcgctccctggggctcaacgaggcgacgcgggcggcgatatcctgcgcgacggcctcgctcttggcggccggctcggcctggcggatcgccgattcgatcatggcggtgaggcggtcgtcctcgaaaggcttttccagaaagtccaccgcccctaacttcatcgcctcgaccgcgagcggcacgtcgccgtgaccggtcatgatgaggatcggaaaggggctttgctgcgccttcatccgcttcaacagctcgatgccgtcaaggcccggcatgcgcacgtcggagacgacgcagccgaaggagagacccggcagggcgtcgagaaaggcttgcgcgtcgtcaaacagcgtgacgccgaagccggcagaatccagcaggaaattcagcgaatcccgcatcgccgcgtcgtcgtcgatgacgtagatatgtcccttggtcgtcatgctagacctcctatcatctcgtcggctgccgggagggtgaagcggaaggtcgccccgcccgatgcgttgctctcggcccacatgcgcccgccgtgagcttcgatgatcgagcggctgatggacagtcccacgcccatgccggtgtccttggtggtgaagaaagtctgaaacaggttcggaatgacgtcgtcctggaaaccgctgccggtgtcggacacttcgacctcgatcatgtcgtcggcggcgggggtgttggtgacgacgagctcgcgtcgctgcgactgagccatcgcttccagcgcgttgcggaacaggttgaccaggacctgctggatctgcacccggtcggcgagaacgagatcggcgcccggatcgagactgaagcggagctgcacgttctgctcgcgcgcgccggcaagcccgagcgcgccggcctcctcgatcagcttggagagactctcgacccgcttctccgattcgccgcgggcaacgaagtcgcgcaggcgccggatgatctggccggcgcgcagcgcctgctcggcggcgcggtccagggcgctttcgaccttcggtgtgttcggatcactgctgccggcaagcagccgccgcgagcccttcatgtagttgctgatcgccgccagcggctggttgagctcgtgcgcgagcgcggacgccatttcgcccatggcgctcagcctggagacgtggacgagctcggattgcagttcctggaggcgcgcctgggtctgctggtgctcggtgatatcattctgaataccgacaaaatacgttttatcctctatttccattggatcaatatttaattcattccagaacatcgttccgtcttttttgtagttttggatctgaacggtgaccggttctttattttgtaaagcggttctgatgttgtccacttctgcaggatctgtgtgtttcccctgtaagaagcgacagttctttcctaaaatttcctcggtctcgtagccggtcatttgaacaaagccttgatttacgtagacaataggattatcttcaagtgcgggatctgtaattaccacaccgactcgcacgtgatcaagtgcttttttgatgacttccagctgtcctggtatcccaaatgattgaaaactagccacattcaccaccctcaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcaccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctacgcccgtgatcctgatcaccggctatccggacgaaaacatctcgacccgggccgccgaggccggcgtaaaagacgtggttttgaagccgcttctcgacgaaaacctgctcaagcgtatccgccgcgccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcatcacaacggagtctagaaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccgagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc
X174E SEQ ID NO.2
atggtacgctggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaacattattaatggcgtcgagcgtccggttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcaggaaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtgcggaaggagtga
RBS4 SEQ ID NO.3
tactagtgaacgatggcaaatactag。
SEQUENCE LISTING
<110> Shenzhen advanced technology research institute of China academy of sciences
<120> A method for producing bacterial cellulose by physical stimulus control and releasing intracellular substances
Application of
<130> CP122010191C、PCT2201007
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 3369
<212> DNA
<213> artificial sequence
<400> 1
tcaatcgttg agcatgccgg cgcgcatcgc gaggcgaacc agctccgaaa ggctgttggc 60
ctgcatcttg gtcatgacgt tggcccgata cacctcgatg gtgcgcgggc tgatgtcgta 120
ctcgcgggcg atcagcttgt tggaaaggcc ggcgatcagc ccttccatga cctggcgctc 180
cctggggctc aacgaggcga cgcgggcggc gatatcctgc gcgacggcct cgctcttggc 240
ggccggctcg gcctggcgga tcgccgattc gatcatggcg gtgaggcggt cgtcctcgaa 300
aggcttttcc agaaagtcca ccgcccctaa cttcatcgcc tcgaccgcga gcggcacgtc 360
gccgtgaccg gtcatgatga ggatcggaaa ggggctttgc tgcgccttca tccgcttcaa 420
cagctcgatg ccgtcaaggc ccggcatgcg cacgtcggag acgacgcagc cgaaggagag 480
acccggcagg gcgtcgagaa aggcttgcgc gtcgtcaaac agcgtgacgc cgaagccggc 540
agaatccagc aggaaattca gcgaatcccg catcgccgcg tcgtcgtcga tgacgtagat 600
atgtcccttg gtcgtcatgc tagacctcct atcatctcgt cggctgccgg gagggtgaag 660
cggaaggtcg ccccgcccga tgcgttgctc tcggcccaca tgcgcccgcc gtgagcttcg 720
atgatcgagc ggctgatgga cagtcccacg cccatgccgg tgtccttggt ggtgaagaaa 780
gtctgaaaca ggttcggaat gacgtcgtcc tggaaaccgc tgccggtgtc ggacacttcg 840
acctcgatca tgtcgtcggc ggcgggggtg ttggtgacga cgagctcgcg tcgctgcgac 900
tgagccatcg cttccagcgc gttgcggaac aggttgacca ggacctgctg gatctgcacc 960
cggtcggcga gaacgagatc ggcgcccgga tcgagactga agcggagctg cacgttctgc 1020
tcgcgcgcgc cggcaagccc gagcgcgccg gcctcctcga tcagcttgga gagactctcg 1080
acccgcttct ccgattcgcc gcgggcaacg aagtcgcgca ggcgccggat gatctggccg 1140
gcgcgcagcg cctgctcggc ggcgcggtcc agggcgcttt cgaccttcgg tgtgttcgga 1200
tcactgctgc cggcaagcag ccgccgcgag cccttcatgt agttgctgat cgccgccagc 1260
ggctggttga gctcgtgcgc gagcgcggac gccatttcgc ccatggcgct cagcctggag 1320
acgtggacga gctcggattg cagttcctgg aggcgcgcct gggtctgctg gtgctcggtg 1380
atatcattct gaataccgac aaaatacgtt ttatcctcta tttccattgg atcaatattt 1440
aattcattcc agaacatcgt tccgtctttt ttgtagtttt ggatctgaac ggtgaccggt 1500
tctttatttt gtaaagcggt tctgatgttg tccacttctg caggatctgt gtgtttcccc 1560
tgtaagaagc gacagttctt tcctaaaatt tcctcggtct cgtagccggt catttgaaca 1620
aagccttgat ttacgtagac aataggatta tcttcaagtg cgggatctgt aattaccaca 1680
ccgactcgca cgtgatcaag tgcttttttg atgacttcca gctgtcctgg tatcccaaat 1740
gattgaaaac tagccacatt caccaccctc aattgactct cttccgggcg ctatcatgcc 1800
ataccgcgaa aggttttgca ccattcgatg gtgtccggga tctcgacgct ctcccttatg 1860
cgactcctgc attaggaagc agcccagtag taggttgagg ccgttgagca ccgccgccgc 1920
aaggaatggt gcatgcaagg agatggcgcc caacagtccc ccggccacgg ggcctgccac 1980
catacccacg ccgaaacaag cgctcatgag cccgaagtgg cgagcccgat cttccccatc 2040
ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg gcgccggtga tgccggccac 2100
gatgcgtccg gcgtagagga tcgagatcta cgcccgtgat cctgatcacc ggctatccgg 2160
acgaaaacat ctcgacccgg gccgccgagg ccggcgtaaa agacgtggtt ttgaagccgc 2220
ttctcgacga aaacctgctc aagcgtatcc gccgcgccat ccaggaccgg cctcgggcat 2280
gacctacggg gttctacgta aggcaccccc cttaagatat cgctcgaaat tttcgaacct 2340
cccgataccg cgtaccaatg cgtcatcaca acggagtcta gaaaagagga gaaatactag 2400
atgagcacaa aaaagaaacc attaacacaa gagcagcttg aggacgcacg tcgccttaaa 2460
gcaatttatg aaaaaaagaa aaatgaactt ggcttatccc aggaatctgt cgcagacaag 2520
atggggatgg ggcagtcagg cgttggtgct ttatttaatg gcatcaatgc attaaatgct 2580
tataacgccg cattgcttgc aaaaattctc aaagttagcg ttgaagaatt tagcccttca 2640
atcgccagag aaatctacga gatgtatgaa gcggttagta tgcagccgtc acttagaagt 2700
gagtatgagt accctgtttt ttctcatgtt caggcaggga tgttctcacc tgagcttaga 2760
acctttacca aaggtgatgc ggagagatgg gtaagcacaa ccaaaaaagc cagtgattct 2820
gcattctggc ttgaggttga aggtaattcc atgaccgcac caacaggctc caagccgagc 2880
tttcctgacg gaatgttaat tctcgttgac cctgagcagg ctgttgagcc aggtgatttc 2940
tgcatagcca gacttggggg tgatgagttt accttcaaga aactgatcag ggatagcggt 3000
caggtgtttt tacaaccact aaacccacag tacccaatga tcccatgcaa tgagagttgt 3060
tccgttgtgg ggaaagttat cgctagtcag tggcctgaag agacgtttgg cgctgcaaac 3120
gacgaaaact acgctttagt agcttaataa cgctgatagt gctagtgtag atcgctacta 3180
gagccaggca tcaaataaaa cgaaaggctc agtcgaaaga ctgggccttt cgttttatct 3240
gttgtttgtc ggtgaacgct ctctactaga gtcacactgg ctcaccttcg ggtgggcctt 3300
tctgcgttta tatactagag taacaccgtg cgtgttgact attttacctc tggcggtgat 3360
aatggttgc 3369
<210> 2
<211> 276
<212> DNA
<213> artificial sequence
<400> 2
atggtacgct ggactttgtg ggataccctc gctttcctgc tcctgttgag tttattgctg 60
ccgtcattgc ttattatgtt catcccgtca acattcaaac ggcctgtctc atcatggaag 120
gcgctgaatt tacggaaaac attattaatg gcgtcgagcg tccggttaaa gccgctgaat 180
tgttcgcgtt taccttgcgt gtacgcgcag gaaacactga cgttcttact gacgcagaag 240
aaaacgtgcg tcaaaaatta cgtgcggaag gagtga 276
<210> 3
<211> 26
<212> DNA
<213> artificial sequence
<400> 3
tactagtgaa cgatggcaaa tactag 26

Claims (10)

1. A plasmid for physically controlling bacterial lysis, characterized in that the plasmid has a physically activated promoter and a gene encoding a lytic protein amplified under the control of the physically activated promoter, the gene encoding the lytic protein further has a ribosome binding site upstream, and the Ribosome Binding Site (RBS) has a sequence as set forth in SEQ ID No.3, or a sequence having a mutation of 1,2,3 or 4 bases in SEQ ID No. 3.
2. The plasmid for physical control bacterial lysis according to claim 1, wherein the physically activated promoter is a promoter capable of initiating initiation due to changes in light, temperature, pressure, osmotic pressure;
preferably, the light is preferably blue light;
preferably, the physically activated promoter is selected from the blue light promoter pDawn, more preferably, the sequence of which is shown in SEQ ID No. 1.
3. The plasmid for physically controlling bacterial lysis according to claim 1, characterized in that the lytic protein is selected from the group consisting of proteins capable of causing bacterial lysis, preferably the lytic protein E, LKD phage lytic protein of phage phi 174, lambda phage lytic protein;
more preferably, the coding sequence of the cleavage protein E of the phage phi 174 is shown in SEQ ID NO. 2.
4. A bacterial cellulose membrane-producing engineering bacterium having the plasmid for physical control lysis according to any one of claims 1 to 3, which is capable of being activated by physical stimulation to lyse.
5. The bacterial cellulose membrane-producing engineering bacterium according to claim 4, wherein the host bacterium for producing the bacterial cellulose membrane-producing engineering bacterium is at least one selected from the group consisting of Acetobacter xylinum, acetobacter pastoris, acetobacter xylosojae, gluconobacter hankii, acetobacter aceti, aerobacter, rhizobium, achromobacter, agrobacterium, pseudomonas, alcaligenes, sarcina, and Acetobacter.
6. The bacterial cellulose membrane-producing engineering bacterium according to claim 4 or 5, wherein the genome or plasmid of the bacterial cellulose membrane-producing engineering bacterium expresses a gene encoding an active substance;
preferably, the active substance is selected from the group consisting of proteins, RNAs, polypeptides.
7. The method for constructing a bacterial cellulose membrane-producing engineering bacterium according to any one of claims 4 to 6, comprising:
s11) constructing a plasmid for physically controlling bacterial lysis, wherein the plasmid is provided with a physically activated promoter and a coding gene of a lysate amplified under the control of the physically activated promoter, the coding gene of the lysate is provided with a Ribosome Binding Site (RBS) at the upstream of the coding gene of the lysate, and the Ribosome Binding Site (RBS) has a sequence shown in SEQ ID NO. 3;
s12) transferring the plasmid for physical control bacterial lysis into wild bacteria capable of generating bacterial cellulose membrane to obtain engineering bacteria capable of generating bacterial cellulose membrane capable of controlling lysis under physical conditions.
8. Use of a plasmid for physical control lysis according to any of claims 1-3 for the preparation of an engineered bacterium capable of being lysed by physical stimulation.
9. A method of modulating bacterial lysis and release of bacterial intracellular material, the method comprising:
s01) constructing the engineering bacteria capable of generating bacterial cellulose membrane according to any one of claims 4-6;
s02) activating physical stimulus to crack the bacterial cellulose membrane-forming engineering bacteria and release intracellular substances.
10. A method of constructing an engineered bacterium capable of inducing lysis by physical stimulation, the method comprising the steps of:
s1) selecting a corresponding promoter according to the physical stimulus type, and selecting a lysate according to the bacterial type;
s2) constructing a mixed plasmid connection liquid by adopting a random primer method, wherein the mixed plasmid connection liquid comprises the promoter selected in the step S1), a series of different ribosome binding sites designed and obtained by the random primer method and the coding gene sequence of the cracking protein selected in the step S1);
s3) transferring the mixed plasmid connection liquid obtained in the step S2) into escherichia coli to obtain escherichia coli engineering bacteria to be screened;
s4) respectively culturing the engineering bacteria of the escherichia coli to be screened under the physical stimulation in the step S1) and under the condition of non-physical stimulation, and screening to obtain escherichia coli strains which can normally grow under the condition of non-physical stimulation and are completely lysed under the condition of physical stimulation;
s5) extracting corresponding recombinant plasmids from the escherichia coli engineering bacteria obtained by screening in the step S4) and sequencing to obtain corresponding ribosome binding site sequences, and respectively introducing the recombinant plasmids into the wild bacteria in the step S1) to obtain engineering bacteria capable of being induced to crack by physical stimulation;
preferably, the bacteria are cellulose membrane-forming bacteria that can produce a foreign protein or target component;
preferably, the physical stimulus is a change in light, temperature, pressure, osmotic pressure.
CN202210378766.8A 2022-04-11 2022-04-11 Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances Pending CN116926099A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210378766.8A CN116926099A (en) 2022-04-11 2022-04-11 Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210378766.8A CN116926099A (en) 2022-04-11 2022-04-11 Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances

Publications (1)

Publication Number Publication Date
CN116926099A true CN116926099A (en) 2023-10-24

Family

ID=88393092

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210378766.8A Pending CN116926099A (en) 2022-04-11 2022-04-11 Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances

Country Status (1)

Country Link
CN (1) CN116926099A (en)

Similar Documents

Publication Publication Date Title
US6610529B1 (en) Recombinant bacterial system with environmentally limited viability
ES2369859T3 (en) PROCEDURE FOR CHROMOSOMIC INTEGRATION AND REPLACEMENT OF DNA SEQUENCE IN CLOSTRIDIA.
US11149279B2 (en) Gene therapy DNA vector VTvaf17, method of production; Escherichia coli strain SCS110-AF, method of production; Escherichia coli strain SCS110-AF/VTvaf17 bearing gene therapy DNA vector VTvaf17, method of production
CN102703424B (en) A kind of method of genome of E.coli point mutation of recombined engineering mediation
CN1225125A (en) Stable recombinant yeasts for fermenting xylose to ethanol
CN108277231B (en) CRISPR system for corynebacterium genome editing
JP2022524043A (en) Repeated genome editing of microorganisms
CN101475954B (en) Preparation of recombinant spore with surface for displaying lipase having catalytic activity
WO2023045682A1 (en) Method for increasing soluble expression quantity of polypeptide
Rowe et al. The quiescent-cell expression system for protein synthesis in Escherichia coli
CN105176899B (en) Method for constructing recombinant bacteria for producing or highly producing target gene products, constructed recombinant bacteria and application
JP2022524044A (en) Pool-type genome editing of microorganisms
CN116926099A (en) Preparation method and application of physical stimulus control capable of generating bacterial cellulose and bacterial lysis and release of intracellular substances
CN1133342A (en) Antikanamycin gene originated from microbe
WO2023197093A1 (en) Preparation method and use of physical stimulation to control lysis and intracellular substance release of bacteria capable of producing bacterial cellulose
US9562249B2 (en) Actinomycete integrative and conjugative element from Actinoplanes sp. SE50/110 as plasmid for genetic transformation of related actinobacteria
US20150056168A1 (en) Bacterial expression system
EP1404847A2 (en) Method of plasmid stabilisation by in vivo deleting the antibiotic resistence and selecting with an essential gene
Hall et al. Transformation of Acetobacter xylinum with plasmid DNA by electroporation
US11203760B2 (en) Gene therapy DNA vector GDTT1.8NAS12 and the method for obtaining thereof
CN113957072A (en) Short terminator suitable for bacillus licheniformis and application thereof in high-efficiency expression of target product
Deng et al. The ilvGMEDA operon is regulated by transcription attenuation in Vibrio alginolyticus ZJ-T
CN111893130A (en) PCCI-2U plasmid and construction method and application thereof
CN117187147A (en) Bacterial cellulose engineering bacteria capable of generating targeted therapeutic active ingredients and preparation method thereof
WO2023085429A1 (en) Transformed cell and method for producing target protein

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination