CN116926021A

CN116926021A - Construction method of pseudovirus of feline panleukopenia virus

Info

Publication number: CN116926021A
Application number: CN202310837922.7A
Authority: CN
Inventors: 高巍; 袁宝; 任文陟; 陈健; 杜崇涛; 高飞; 马一然; 罗婷婷; 尚熙龙; 胡进平; 张金玉
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2023-07-10
Filing date: 2023-07-10
Publication date: 2023-10-24

Abstract

The invention discloses a construction method of pseudovirus of feline panleukopenia, which comprises the steps of firstly extracting DNA of a strain ATCCVR-648 of the feline panleukopenia, carrying out PCR amplification to obtain VP2 gene, connecting the VP2 gene to a pDONR221 vector to obtain an intermediate vector pDOWn- { FPV-VP2, carrying out recombination with a pUp-EF1A vector carrying a promoter and a skeleton vector pLV.Des2d.C/EGFP: T2A: puro to obtain recombinant expression plasmid, and carrying out slow virus packaging to obtain the pseudovirus. Compared with the prior art, the feline panleukopenia virus pseudovirus constructed by the invention has no replication activity, high biological safety and good stability, can be used as a positive control standard and an internal control standard when detecting nucleic acid of the feline panleukopenia virus, and can be applied to research of the feline panleukopenia virus, screening of antiviral preparations and research and development of vaccines.

Description

Construction method of pseudovirus of feline panleukopenia virus

Technical Field

The invention relates to a construction method of pseudovirus of feline panleukopenia virus, belonging to the technical field of genetic engineering.

Background

Feline panleukopenia virus (feline panleukopenia virus, FPV), also known as feline infectious enteritis or cat pestilence, is an acute, highly contagious, lethal infectious disease of cats caused by feline parvovirus, mainly occurs in young cats within one year of age, clinically manifested as sudden hyperthermia, vomiting, diarrhea, high dehydration and obvious reduction in white blood cell count, has a high degree of infectivity, wherein morbidity and mortality of young susceptible animals are as high as 25-90%, immune responses often occur after adult cat infection, no typical clinical symptoms, can spread to embryos through blood circulation after pregnant female cat infection, cause infection and cause abortion. The animals with the disease and rehabilitation are main infectious sources, the secretion and the excrement of the animals with the disease and rehabilitation contain a large amount of viruses, the environment is polluted, and the natural infection of the wild animals is mainly caused by direct or indirect contact. In the scientific research and drug screening of feline panleukopenia virus, it is necessary to directly use FPV virus, but because of its strong infectivity, it is urgently required to develop a safe and effective means of FPV research.

Pseudoviruses are viruses in which a retrovirus is able to integrate the envelope glycoprotein of another different virus species, forming an envelope with an exogenous virus, while the genome retains the genomic properties of the retrovirus itself. The pseudovirus has high biological safety due to the defect of nucleic acid molecules and only one cell infection period, is widely applied to the aspects of virus research, antiviral preparation screening, vaccine research and the like, and can be used as a positive control standard and an internal control standard during virus nucleic acid detection. At present, no report on construction of pseudoviruses of feline panleukopenia virus exists.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provides a construction method of pseudoviruses of feline panleukopenia viruses.

The inventor firstly extracts cat leukopenia virus ATCC VR-648 strain virus DNA, designs a primer for PCR amplification to obtain VP2 gene, then adopts BP reaction to construct an entry clone carrier pDOWn- { FPV-VP2} containing a target sequence, and adopts LR reaction to construct a recombinant expression carrier containing the target sequence, and recombines a pUp-EF1A carrier carrying a promoter, pDOWn- { FPV-VP2} and pLV.Des2d.C/EGFP: T2A: puro to construct a final recombinant expression plasmid pLV [ Exp ] -EGFP: T2A: puro-EF1A > { FPV-VP2}. The specific scheme is as follows:

a construction method of pseudovirus of feline panleukopenia virus comprises the following steps:

step one, extracting cat leukopenia virus ATCC VR-648 strain virus DNA, carrying out PCR amplification to obtain VP2 gene, and connecting the VP2 gene to a pDONR221 vector to obtain an intermediate vector pDOWN- { FPV-VP2};

step two, mixing a pUp-EF1A vector carrying a promoter, an intermediate vector pDOWn- { FPV-VP2} and a skeleton vector pLV.Des2d.C/EGFP: T2A: puro, and recombining to obtain a recombinant expression plasmid;

and thirdly, mixing the recombinant expression plasmid, the plasmid pMD2.G and the psPAX2, co-transfecting HEK293T cells, collecting supernatant after 48h transfection, centrifuging for 30min at 2000g, collecting supernatant, filtering with a 0.45 mu M filter membrane to obtain filtrate, centrifuging the filtrate, and discarding the supernatant to obtain the pseudovirus particles of the feline panleukopenia virus.

Further, in the first step, the nucleotide sequence of the VP2 gene is shown as SEQ ID NO. 1.

atgagtgatggagcagttcaaccagacggtggtcagcctgctgtcagaaatgaaagagctacaggatctgggaacgggtctggaggcgggggtggtggtggttctgggggtgtggggatttctacgggtactttcaataatcagacggaatttaaatttttggaaaacggatgggtggaaatcacagcaaactcaagcagacttgtacatttaaatatgccagaaagtgaaaattataaaagagtagttgtaaataatatggataaaactgcagttaaaggaaacatggctttagatgatactcatgtacaaattgtaacaccttggtcattggttgatgcaaatgcttggggagtttggtttaatccaggagattggcaactaattgttaatactatgagtgagttgcatttagttagttttgaacaagaaatttttaatgttgttttaaagactgtttcagaatctgctactcagccaccaactaaagtttataataatgatttaactgcatcattgatggttgcattagatagtaataatactatgccatttactccagcagctatgagatctgaaacattgggtttttatccatggaaaccaaccataccaactccatggagatattattttcaatgggatagaacattaataccatctcatactggaactagtggcacaccaacaaatgtatatcatggtacagatccagatgatgttcaattttatactattgaaaattctgtgccagtacacttactaagaacaggtgatgaatttgctacaggaacatttttttttgattgtaaaccatgtagactaacacatacatggcaaacaaatagagcattgggcttaccaccatttctaaattctttgcctcaatctgaaggagctactaactttggtgatataggagttcaacaagataaaagacgaggtgtaactcaaatgggaaatacagactatattactgaagctactattatgagaccagctgaggttggttatagtgcaccatattattcttttgaggcgtctacacaagggccatttaaaacacctattgcagcaggacgggggggagcgcaaacagatgaaaatcaagcagcagatggtgatccaagatatgcatttggtagacaacatggtcaaaaaactaccacaacaggagaaacacctgagagatttacatatatagcacatcaagatacaggaagatatccagaaggagattggattcaaaatattaactttaaccttcctgtaacagatgataatgtattgctaccaacagatccagttggaggtaaagcaggaattaactatactaatatatttaatacttatggtcctttaactgcattaaataatgtaccaccagtttatccaaatggtcaaatttgggataaagaatttgatactgacttaaaaccaagacttcatgtaaatgcaccatttgtttgtcaaaataattgtcctggtcaattatttgtaaaagttgcgcctaatttaacaaatgaatatgatcctgatgcatctgctaatatgtcaagaattgtaacttactcagatttttggtggaaaggtaaattagtatttaaagctaaactaagagcctctcatacttggaatccaattcaacaaatgagtattaatgtagataaccaatttaactatgtaccaagtaatattggaggtatgaaaattgtatatgaaaaatctcaactagcacctagaaaattatattaa(SEQ ID NO.1)。

Further, in the first step, the PCR amplified primers comprise pD-220916-1016qjg-PF1 and pD-220916-1016qjg-PR1, and the sequences are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3.

pD-220916-1016qjg-PF1：

GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGAGTGATGGAGCAGTTCAAC CAG(SEQ ID NO.2)；

pD-220916-1016qjg-PR1：

GGGGACCACTTTGTACAAGAAAGCTGGGTTTAATATAATTTTCTAGGTGCTAGTTGAG ATTTTTC(SEQ ID NO.3)。

In the first step, the VP2 gene is linked to the pDONR221 vector by BP reaction under the following reaction conditions: incubate at 25℃for 1h.

Further, in the second step, the mass ratio of the pUp-EF1A vector carrying the promoter, the intermediate vector pDOWn- { FPV-VP2} and the skeleton vector pLV.Des2d.C/EGFP: T2A: puro is (1-2): (1-2): (5-10).

In the second step, the recombination adopts an LR reaction, and the reaction conditions are as follows: incubate at 25℃for 3h.

Further, in step three, the mass ratio of the plasmids pMD2.G, psPAX2 and recombinant expression plasmid is 1:1:2.

Further, in the third step, the centrifugation conditions are: 4 ℃,50000g,2h.

The invention has the beneficial effects that:

the invention provides a construction method of pseudovirus of feline panleukopenia, which comprises the steps of firstly extracting DNA of a strain of cat panleukopenia ATCC VR-648, designing a primer for PCR amplification to obtain VP2 gene, connecting the VP2 gene to a pDONR221 vector to obtain an intermediate vector pDOWn- { FPV-VP2, recombining the intermediate vector with a pUp-EF1A vector carrying a promoter and a skeleton vector pLV.Des2d.C/EGFP: T2A: puro, constructing a final recombinant expression plasmid, and finally carrying out slow virus packaging to obtain the pseudovirus of cat panleukopenia. Compared with the prior art, the feline panleukopenia virus pseudovirus constructed by the invention has no replication activity, high biological safety and good stability, can be used as a positive control standard and an internal control standard when detecting nucleic acid of the feline panleukopenia virus, and can be applied to research of the feline panleukopenia virus, screening of antiviral preparations and research and development of vaccines.

Drawings

FIG. 1 is a map of a recombinant expression plasmid;

FIG. 2 is an agarose gel electrophoresis of the enzyme digestion assay;

FIG. 3 shows the results of virus packaging assays;

FIG. 4 shows the results of detection of feline panleukopenia virus pseudovirus fluid infectivity.

Detailed Description

The technical scheme of the invention is clearly and completely described below with reference to the accompanying drawings and the specific embodiments.

In the following examples, lipofectamine 2000 andculture broth, available from Invitrogen; HEK293T cells were purchased from ATCC; the pDONR221 vector was purchased from Shanghai-associated biological engineering Co., ltd; dNTP mix (10. Mu.M), DNA Polymerase from Kumei Biotechnology Co., ltd; pUp-EF1A vector, pLV. Des2d.C/EGFP: T2A: puro backbone vector, available from the King boat Biotechnology (Guangzhou) Co., ltd; plasmid pMD2.G, psPAX2 was purchased from the cloud navicular Biotechnology (Guangzhou) Co., ltd; the remaining materials, reagents, etc., unless otherwise specified, are commercially available.

In the following examples, the experimental methods used, unless otherwise specified, are all conventional in the art.

Example 1

step one, extracting cat leukopenia virus ATCC VR-648 strain virus DNA, designing a primer for PCR amplification to obtain VP2 gene (the nucleotide sequence of the VP2 gene is shown as SEQ ID NO. 1), and connecting the VP2 gene to a pDONR221 vector to obtain an intermediate vector pDOWn- { FPV-VP2};

1. designing primer for PCR amplification to obtain VP2 gene fragment

The PCR amplified primers comprise pD-220916-1016qjg-PF1 and pD-220916-1016qjg-PR1, and the primer sequences are as follows:

pD-220916-1016qjg-PF1：

GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGAGTGATGGAGCAGTTCAAC CAG(SEQ ID NO.2)；

pD-220916-1016qjg-PR1：

reaction system for PCR amplification: 5 x Primer STAR ^TM Buffer 10. Mu.L, dNTP mix (10. Mu.M) 4. Mu.L, primer-F (10. Mu.M) 1. Mu.L, primer-R (10. Mu.M) 1. Mu.L, template DNA 1. Mu.L, primer STAR ^TM HS DNA Polymerase 0.5μL，ddH ₂ O makes up 50. Mu.L.

PCR procedure: 3min at 98℃and 10s at 98 ℃;60 ℃ for 10s;60 s at 72 ℃;72℃for 5min,30 cycles.

After the PCR reaction system is finished, 10 mu L of 6×loading buffer is added into the reaction system to terminate the reaction, agarose gel electrophoresis is carried out on the PCR reaction product, a gel block containing a target fragment is cut off and recovered, and the DNA is put at-20 ℃ for standby after the concentration of the Nanodrop8000 is measured.

Construction of intermediate vector pDOWN- { FPV-VP2} by BP reaction

(1) pDONR221 backbone plasmid extraction

The method is used for preparing various skeleton vector DNA used in the vector construction process by adopting a small extraction kit of the Tiangen plasmid and referring to the instruction book of the small extraction kit of the Tiangen plasmid.

(2) BP reaction

BP reaction system: attB-PCR product 75ng, pDONR221 backbone vector 75ng, BP close ^TM II Enzyme Mix 1. Mu.L, TE Buffer, pH8.0, added to 4. Mu.L.

BP reaction conditions: incubating at 25 ℃ for 1h; after the reaction, 1. Mu.L of proteinase K was added and the reaction was incubated at 37℃for 15min to terminate the BP reaction.

(3) Transformation of competent E.coli cells

a. Removing competent cells from-80deg.C, and thawing on ice;

b. in a super clean bench, 5. Mu.L BP reaction product was added to 100. Mu.L competent cells, light

Spring mixing;

c. ice bath for 30min;

d, heat shock at 42 ℃ for 90s;

e. ice bath for 2-3min;

f. 250. Mu.L of LB medium or SOC medium is added;

g.250rpm,37 ℃, and culturing (resuscitating) the strain for about 1h;

h. the resuscitated bacterial solution was plated onto Kana antibiotic-containing plates and incubated overnight at 37℃with inversion.

4. Positive clone selection and identification

3-6 single colonies are randomly picked up, thalli are rinsed in a sterile 0.2mL sterile EP tube, 1 mu L of the thalli is taken as a template for colony PCR, and the rest is used as a strain for inoculating and culturing bacteria to extract plasmid DNA.

Colony PCR reaction system: 1. Mu.L of template, 0.8. Mu.L of dNTP mix (2.5 mM), 0.5. Mu.L of sequencing primer-F1 (10. Mu.M), 0.5. Mu.L of sequencing primer-R (10. Mu.M), 10 XBuffer 1. Mu.L, taq DNA Polymerase 0.5.5. Mu.L, ddH ₂ O makes up 10. Mu.L.

5' sequencing primer and sequence M13-F (-20): GTAAAACGACGGCCAG;

3' sequencing primer and its sequence M13-R CAGGAAACAGCTATGAC.

Colony PCR reaction procedure: 94℃for 3min,94℃for 30s;60 ℃ for 30s;72 ℃,1min/1-2Kb;25 cycles, at 72℃for 5-10min.

After colony PCR is finished, adding 6×loadingbuffer, then electrophoresis, selecting clone capable of amplifying target length by referring to DNA Ladder, inoculating to LB culture medium at 37 ℃ for culture at 250rpm overnight, then extracting small-extracted plasmid DNA, carrying out sequencing, comparing returned sequencing result with standard sequence by adopting sequencer software, and obtaining a carrier with correct sequencing as pDOWN- { FPV-VP2}.

Step two, mixing a pUp-EF1A vector carrying a promoter, an intermediate vector pDOWN- { FPV-VP2} and a skeleton vector pLV.Des2d.C/EGFP: T2A: puro in a mass ratio of 1:1:5, and then recombining to obtain a recombinant expression plasmid. The map of the recombinant expression plasmid prepared is shown in FIG. 1.

(1) The recombination adopts an LR reaction system: pUp-EF1A 20ng, pDOWN- { FPV-VP2}20ng, backbone vector pLV. Des2d.C/EGFP: T2A: puro 50ng, LR classase1. Mu.L, TE buffer make up to 5. Mu.L. The reaction conditions are as follows: incubate at 25℃for 3h. After the reaction, 1. Mu.L of proteinase K was added thereto and incubated at 37℃for 15 minutes to terminate the reaction.

(2) LR reaction products transformed competent cells

2 mu L of LR reaction products are transformed into competent cells, and resuscitated bacterial liquid is finally coated on LB plates containing Amp antibiotics, and the culture is carried out at 37 ℃ in an inverted manner for overnight.

(3) Colony PCR

Randomly picking 3-6 single colonies, performing PCR reaction with reference to the colonies in the first step, performing agarose gel electrophoresis, picking colonies capable of amplifying the DNA bands with the target band length according to the DNA Ladder, inoculating cultured bacteria, and extracting plasmid DNA.

(4) Enzyme digestion identification

The vector map is opened by using SnapGene software (see figure 1), a digestion scheme is determined, then restriction enzyme of NEB is adopted to carry out digestion on plasmid DNA of a final vector, agarose gel electrophoresis is carried out after the digestion reaction is finished and analysis is carried out by referring to DNALader, figure 2 is an agarose gel electrophoresis map of digestion identification, wherein a lane M is a Marker, a lane p31 is an undigested original plasmid, a lane 31 is a double digestion result of a recombinant expression vector, and corresponding 5 bands (2146,991,3985,1246,2761) are consistent with expectations, so that DNA bands with expected sizes can be cut out, and digestion is correct.

And thirdly, mixing the recombinant expression plasmid, the plasmid pMD2.G and the psPAX2, and then co-transfecting HEK293T cells to prepare the pseudovirus particles of the feline panleukopenia virus. The detailed steps are as follows:

(1) And inoculating glycerol bacteria of the target gene plasmid into liquid LB for overnight culture, extracting plasmid DNA by using a large extraction kit for removing endotoxin, and measuring the concentration by using Nanodrop8000 for later use.

(2) Day before transfection HEK293T cells were seeded and cultured at 100mmAdding DMEM medium (ThermoFisher company) containing 10% FBS, 37deg.C, 5% CO into culture dish ₂ Culturing for 24h, and the cell fusion rate before transfection is about 80-90%.

(3) Liquid change 1h before transfection, addThe culture solution is continuously cultured.

(4) A, B solutions were mixed separately. Wherein the solution A is 1.5mLMixing with 4 μg DNA (packaging plasmid pMD2.G, psPAX2 and target gene plasmid, respectively, with the mass ratio of 1:1:2) by gently blowing and beating. Solution B1.5 mL->Mixing with 40 μl Lipofectamine 2000, gently stirring, standing at room temperature, and incubating for 5min. And adding the solution A into the solution B, lightly blowing and uniformly mixing, standing at room temperature, and incubating for 20min.

(5) Slowly dropwise adding the incubated transfection complex into the cells with the changed liquid, slightly shaking to uniformly distribute the transfection complex, and adding 5% CO at 37 DEG C ₂ Culturing. After 6h of transfection, the medium was replaced with DMEM containing 10% FBS and the mixture was kept at 37℃with 5% CO ₂ Culturing.

(6) After 48h of transfection, the culture supernatant was collected and concentrated, centrifuged at 2000g for 30min at 4℃to obtain the supernatant, which was filtered at 0.45. Mu.M to remove cell debris.

(7) The filtrate was added to a centrifuge tube, centrifuged at 4℃and 50000g for 2 hours, the supernatant was discarded, lentiviral particles were collected, each pellet was resuspended in 200. Mu.L of HBSS buffer, and the pellet was stored at-80℃after packaging.

1. Virus packaging result detection

The detection method comprises the following steps: and observing the obtained feline panleukopenia virus pseudovirus under a fluorescence microscope, and carrying out virus packaging detection.

The result of the virus package test is shown in fig. 3, and it can be seen that the clear green fluorescence is positive under the fluorescence microscope after the feline panleukopenia virus pseudovirus is infected for 48 hours, which indicates that the pseudovirus is successfully constructed.

2. Feline panleukopenia virus pseudovirus titer assay

200. Mu.L of the virus concentrate was added to a centrifuge tube, 1.5mL of 20% sucrose solution was added to the lower layer, centrifuged for 2 hours at 50000g after equilibration, the supernatant was removed by centrifugation, precipitated virus particles were collected, and each tube of precipitate was resuspended with 200. Mu.L of HBSS buffer, and the virus titer was determined. Viral titers were measured using the p24 ELISA method. The HIV-1p24 antigen was captured by anti-p 24 coated microtiter wells and bound to biotinylated secondary anti-p 24 antibody. Subsequently, streptavidin-HRP conjugate and substrate were added and developed in solution. The color intensity was spectrophotometrically measured to indicate the level of p24 in the sample and then accurately quantified using a p24 standard curve.

Test results: the titer of feline panleukopenia virus is 3.68X10 ⁸ TU/mL。

3. Transduction test

And (3) infecting HEK293 cells by adopting the constructed feline panleukopenia virus pseudovirus liquid, and carrying out pseudovirus infectivity detection: HEK293 cells were individually plated at 5X 10 per well ⁵ The number of individual cells was inoculated into 96-well plates in advance, and when the cells grew to a monolayer, the cell culture medium was aspirated and washed with DMEM to remove any residual fetal bovine serum. The pseudoviruses were diluted 10-fold with DMEM to 10-fold gradient ^-8 The diluted pseudo virus liquid is respectively inoculated into 96-well plates with cell monolayers, placed in a 37 ℃ incubator for standing and incubation for 1h, the pseudo virus liquid in the culture plates is sucked, 200 mu l of complete culture liquid is added into each well, and the cells are continuously cultured for 48h. Cells were observed under a fluorescence microscope for GFP expression at 12h intervals.

The results of the feline panleukopenia pseudovirus infectivity assay are shown in fig. 4, and it can be seen that GFP positive cells are present in HEK293 cells, indicating that the prepared feline panleukopenia pseudovirus can infect HEK293 cells.

Claims

1. A construction method of pseudovirus of feline panleukopenia virus, which is characterized by comprising the following steps:

step one, extracting the DNA of a feline panleukopenia virus ATCCVR-648 strain, carrying out PCR amplification to obtain a VP2 gene, and connecting the VP2 gene to a pDONR221 vector to obtain an intermediate vector pDOWN- { FPV-VP2};

2. The method for constructing pseudoviruses of feline panleukopenia virus according to claim 1, wherein in the first step, the nucleotide sequence of the VP2 gene is shown in SEQ ID No. 1.

3. The method for constructing pseudoviruses of feline panleukopenia according to claim 1, wherein in the first step, the PCR amplified primers comprise pD-220916-1016qjg-PF1 and pD-220916-1016qjg-PR1, the sequences of which are shown in SEQ ID No.2 and SEQ ID No.3, respectively.

4. The method of claim 1, wherein in the first step, the VP2 gene is linked to the pDONR221 vector by BP reaction under the following conditions: incubate at 25℃for 1h.

5. The method for constructing pseudoviruses of feline panleukopenia according to claim 1, wherein in the second step, the mass ratio of pUp-EF1A vector carrying promoter, intermediate vector pDOWN- { FPV-VP2} and skeleton vector pLV.Des2d.C/EGFP: T2A: puro is (1-2): (1-2): (5-10).

6. The method of claim 1, wherein in step two, the recombination is performed by LR reaction under the following reaction conditions: incubate at 25℃for 3h.

7. The method of claim 1, wherein in step three, the mass ratio of the plasmid pmd2.G, psPAX2 and recombinant expression plasmid is 1:1:2.

8. The method of constructing feline panleukopenia virus pseudovirus according to any one of claims 1 to 7 wherein in step three, the centrifugation conditions are: 4 ℃,50000g,2h.