CN116917498A

CN116917498A - Method for polynucleotide detection

Info

Publication number: CN116917498A
Application number: CN202280015379.6A
Authority: CN
Inventors: 马格达莱纳·斯托拉雷克-雅努什凯维奇; 巴纳比·威廉·巴姆福思
Original assignee: Bio Fidelity Ltd
Current assignee: Bio Fidelity Ltd
Priority date: 2021-02-16
Filing date: 2022-02-16
Publication date: 2023-10-20
Also published as: GB202102178D0

Abstract

The present invention relates to simplified polynucleotide sequence detection methods suitable for detecting the presence of a number of diagnostic markers, including those used to identify cancer, infectious diseases, and transplant organ rejection. The method is also useful for companion diagnostic tests (companion diagnostic testing) in which a set of markers must be identified reliably and at low cost.

Description

Method for polynucleotide detection

Technical Field

Polymerase Chain Reaction (PCR) is a well known powerful technique for amplifying DNA or RNA present in laboratory and diagnostic samples to a degree that can be reliably detected and/or quantified. However, it suffers from a number of limitations when used to study analyte samples containing low levels of such molecules. First, while this technique can detect as few as a single target molecule, it is prone to false positive results due to unwanted amplification of other nucleic acid sequences present in the sample. This makes the selection of oligonucleotide primers for initiating the reaction critical; this in turn makes designing primers with the required level of specificity relatively complex. Thus, many PCR-based tests currently on the market have limited specificity.

A second disadvantage is that multiplexing of PCR-based methods is limited in practice to a maximum of several tens of target sequences (typically not more than 10) to avoid primer-primer interactions, resulting in the need for relatively narrow operating windows.

Another problem is that quantification of the target is difficult because the PCR reaction is cycled exponentially; small changes in reaction efficiency have a large impact on the amount of detectable species produced. Therefore, even with proper control and proper calibration, quantification is typically limited to about 3 times accuracy.

Finally, mutations in the target region studied by PCR amplification methods may have unwanted side effects. For example, there are examples in which FDA-approved tests have to be withdrawn because the target organism is mutated in the genetic region targeted by the test primer, resulting in a large number of false negatives. In contrast, PCR methods often produce false positives when wild-type variants are present if a particular Single Nucleotide Polymorphism (SNP) is the target of amplification. Avoiding this requires very careful primer design and further limits the effectiveness of multiplexing. This is particularly important when searching for a panel of SNPs, as this is a common requirement for cancer testing/screening or concomitant diagnosis.

WO2020/016590 describes a method for detecting a target nucleic acid sequence in which a sample is contacted with a single stranded probe, if the probe is complementary to the target, the probe is digested by pyrophosphorolysis enzyme and the digested probe is detected. The method is performed in solution and uses more than one step of pyrophosphorolysis and ligation to detect target sequences. The following invention is a simplified version of the assay disclosed therein using less enzyme.

Ingram et al ("PAP-LMPCR for improved, ole-specific footprinting and automated chromatin fine structure analysis", NUCLEIC ACIDS RESEARCH, vol.36, n.3, month 1, 21, 2008) teach a method in which the ligation reaction is very inefficient in the presence of pyrophosphorolysis-inducing buffer. The inventors have surprisingly found an improvement to the process of WO2020/016590, including a combined pyrophosphorolysis and ligation step, which can be effectively performed, but the Ingram et al publication does not teach this.

SUMMARY

We have now developed an improved process based on our use in our previous patent (WO 20016590 a ₁ The experience of pyrophosphorolysis reactions employed in PCT/GB2020/053361, PCT/GB2020/053362, PCT/GB2020/053363, GB2020539.9 and GB 2101176.2). In combination with blocking oligonucleotides, many of these limitations are overcome. To this end, it exploits (1) the double-strand specificity of pyrophosphorolysis (a reaction that will not proceed efficiently on single-stranded oligonucleotide substrates or double-stranded substrates containing blocking groups or nucleotide mismatches), and (2) the ability of blocking oligonucleotides to increase the specificity of the method of the invention by reducing non-specific binding. Thus, according to the present invention there is provided a method of detecting a target polynucleotide sequence in a given nucleic acid analyte, the method comprising the steps of:

(a) Introducing a blocking oligonucleotide into a first reaction mixture comprising one or more nucleic acid analytes, wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences;

(b) Introducing the mixture produced in (a) into a second reaction comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Pyrophosphorolytic enzyme; and

ligase;

wherein the target analyte and the single-stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ ；

(c) Detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of a polynucleotide target sequence in the analyte.

In one aspect of the invention, there is provided a method for detecting a polynucleotide target sequence in a given nucleic acid analyte in a sample, the method comprising the steps of:

(a) Generating amplicons of the analytes by performing PCR on a biological sample comprising the analytes and optionally background genomic DNA, deriving one or more analytes from the biological sample, wherein the one or more primers have non-complementary 5' tails;

(b) Introducing one or more single stranded nucleic acid analytes into a first reaction mixture comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Pyrophosphorolytic enzyme; and

ligase;

wherein the analyte and the single-stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Experience connectivityTo form A ₂ ；

In some embodiments, step (a) comprises generating amplicons of the analyte by performing PCR on a biological sample comprising the analyte and optionally background genomic DNA, deriving one or more analytes from the biological sample, wherein the one or more primers have non-complementary 5' tails.

In some embodiments, step (a) comprises generating amplicons of the analyte by performing PCR on a biological sample comprising the analyte and optionally background genomic DNA, deriving one or more single stranded analytes from the biological sample, wherein one or more primers have non-complementary 5' tails and one primer is introduced in excess relative to the other primer.

In some embodiments, step (a) comprises generating amplicons of the analyte by performing PCR on a biological sample comprising the analyte and optionally background genomic DNA, deriving one or more single stranded analytes from the biological sample, wherein the one or more primers have non-complementary 5 'tails, the one or more primers are 5' protected, and the PCR product is treated with a 5'-3' exonuclease.

Analytes to which the methods of the invention can be applied are those nucleic acids comprising the target polynucleotide sequence sought, such as naturally occurring or synthetic DNA or RNA molecules. In one embodiment, the analyte is typically present in an aqueous solution containing the analyte and other biological material, and in one embodiment the analyte will be present with other background nucleic acid molecules that are not of interest for testing purposes. In some embodiments, the analyte will be present in a low amount relative to these other nucleic acid components. Preferably, for example, when the analyte originates from a biological sample containing cellular material, some or all of these other nucleic acids and foreign biological material will be removed using sample preparation techniques such as filtration, centrifugation, chromatography or electrophoresis, prior to performing step (a) of the method. Suitably, the analyte is derived from a biological sample, such as blood, plasma, sputum, urine, skin or biopsy, taken from a mammalian subject (particularly a human patient). In one embodiment, the biological sample will be lysed to release the analyte by disrupting any cells present. In other embodiments, the analyte may already be present in the sample itself in free form; such as cell-free DNA circulating in blood or plasma.

Brief Description of Drawings

Fig. 1: the results of example 1, EGFR exon 19cosm12384 mutations were detected using different concentrations of blocking oligonucleotide in the initial PCR amplification. The results show that the higher the concentration of blocking oligonucleotide used, the greater the difference between the Cq values for 0% and 0.1% af.

Fig. 2: the results of example 2, after initial PCR amplification, were introduced blocking oligonucleotides followed by a combined pyrophosphorolysis and ligation step, and detection of 0.1% af t790m. The results show that the use of blocking oligonucleotides resulted in a greater difference between the Cq values of 0% and 0.1% af.

Fig. 3: the results of example 3, using different concentrations of blocking oligonucleotides fully complementary to the target sequence, were used in the method of detecting 0.1% af t790m. The results show that the presence of blocking oligonucleotides increases the difference between the Cq values for 0% and 0.1% af, with an optimal blocking oligonucleotide concentration of about 80nM.

Fig. 4: an illustrative example of an embodiment of the invention, wherein a blocking oligonucleotide may be present during initial PCR amplification. The blocking oligonucleotides anneal to the wild-type strand present, preventing them from being amplified by PCR. This only allows preferential amplification of the mutant chains.

Fig. 5: an illustrative example of an embodiment of the invention, wherein the blocking oligonucleotide is present in a combined pyrophosphorolysis and ligation step. Blocking oligonucleotides completely annealed to wild type molecules preventing probe A ₀ Is performed by annealing. Mismatch between the blocking oligonucleotide and the target mutant molecule results in a lower melting temperature, leading toBlocking oligonucleotides that anneal to mutant molecules dissociate (melt-off) at high temperatures (elevated temperature) for pyrophosphorolysis or are probed A ₀ Substitutions, while those blocking oligonucleotides that hybridize to wild-type molecules remain annealed. This results in a significant increase in the proportion of probes that successfully anneal to the mutant chains and thus in a significant increase in the level of fluorescence signal detected as a result of this method.

Fig. 6: an illustrative example of an embodiment of the invention, wherein a blocking oligonucleotide (perfectly complementary to the target sequence present in the mutant strand, but mismatched to the corresponding sequence in the wild-type strand) is present in the combined pyrophosphorolysis and ligation steps. Due to the presence of one or more mismatches, the blocking oligonucleotide does not anneal perfectly to any wild type strand present, which prevents any pyrophosphorolysis of the blocking oligonucleotide, preventing any subsequent probe A ₀ Mismatch annealing to the wild-type strand. The blocking oligonucleotide is fully annealed to any mutant strand present and is fully pyrophosphorolyzed, allowing any probe A present to occur ₀ Annealing to the mutant chain allows for subsequent pyrophosphorolysis and ligation.

Fig. 7: a is that ₁ Cyclization to form A against analyte target sequence ₂ Is a schematic diagram of (a). A is that ₀ From A ₀ Is gradually digested in the 3'-5' direction opposite to the target (againstthe target) to form a partially digested chain A ₁ This is shown in step (a) and step (B). This stepwise digestion results in a reaction with A ₀ /A ₁ Is revealed by the 5' -end complementary target region of (A) ₁ Then hybridizes to this region, as shown in step (C). A is that ₁ And then joined together to form cyclized A ₂ Step (D).

Fig. 8: single-stranded Probe oligonucleotide A ₀ Annealing to the target polynucleotide sequence to produce a first intermediate product that is at least partially double-stranded, and wherein A ₀ Forms a double-stranded complex with the target polynucleotide sequence at the 3' end of (2). In this simplified embodiment of the invention, there are two A ₀ Molecules and a target polynucleotide sequence to illustrate A that is not annealed to the target ₀ How not to participate inAdditional steps of the method. In this illustrative example, A ₀ Annealing to the target polynucleotide sequence at the 3' end of (A) ₀ Is not annealed to the target polynucleotide sequence. A is that ₀ Comprising a 5' chemical blocking group, a co-priming sequence, and a barcode region.

The partially double-stranded first intermediate product is prepared from A in the presence of pyrophosphorolysis enzyme ₀ Undergo pyrophosphorolysis in the 3' -5' direction starting from the 3' -end of (C) to produce partially digested strand A ₁ Analyte and undigested A not annealed to target ₀ A molecule.

Fig. 9: a is that ₁ Annealing to Single-stranded trigger oligonucleotide B, and A ₁ Strand-directed B extends in the 5'-3' direction to produce oligonucleotide A ₂ . In this illustrative example, trigger oligonucleotide B has a 5' chemical blocking. Any undigested A ₀ Annealing to trigger oligonucleotide B, however undigested A ₀ It is not possible to extend in the 5'-3' direction against B to produce a sequence of targets that are a subsequent part of the method. In this example, A ₂ Priming with at least one single stranded primer oligonucleotide and generating A ₂ Or A ₂ More than one copy of the region of (c).

Fig. 10: a is that ₁ Anneals to splint oligonucleotide D and then circularizes by ligating its 3 'and 5' ends. Now cyclized A ₂ Priming with at least one single stranded primer oligonucleotide and generating A ₂ Or A ₂ More than one copy of the region of (c). In this illustrative example, the modification is due to 3 '-modification (in this example chemical modification) or through the 3' end of D and A ₂ Nucleotide mismatches between the corresponding regions of (a) so that splint oligonucleotide D cannot be directed against a ₁ Extending.

Fig. 11: annealing of the 3' region of splint oligonucleotide D to A ₁ While the 5 'region of splint oligonucleotide D anneals to the 5' region of ligation probe C. Thus, a second intermediate product A is formed ₂ It comprises A ₁ C and optionally A ₁ An intermediate region extending in the 5' -3' direction so as to meet the 5' -end of C. In this descriptionIn the illustrative example, ligation probe C has a 3' chemical blocking group, so that a 3' -5' exonuclease can be used to digest any unconnected A ₁ 。

A ₂ Priming with at least one single stranded primer oligonucleotide and generating A ₂ Or A ₂ More than one copy of the region of (c).

Fig. 12: when Blocking Oligonucleotides (BO) were added before or during the PPL step, 0.1% af t790m mutation was detected. The results show the difference between the Cq values of 0% and 0.1% af, the presence of blocking oligonucleotides increased the difference between 0 and 0.1% af under both conditions.

Fig. 13: the figure shows the detection of EGFR receptor mutations A) Cosm6225 and B) Cosm6218 for 0.1% AF when two different sets of primers are used. When primers containing non-complementary tails were used for the initial PCR, a significant increase in fluorescence levels could be observed in both figures.

Description of the embodiments

(b) Introducing the mixture produced in (a) into a second reaction comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Pyrophosphorolytic enzyme; and

ligase;

(c) Inspection and detectionMeasuring the signal of the product from the previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of a polynucleotide target sequence in the analyte.

i. single-stranded Probe oligonucleotide A ₀ ；

Pyrophosphorolytic enzyme; and

ligase;

wherein the analyte and the single-stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ ；

In some embodiments, one or more primers that are not 5 'protected may have a 5' phosphate group.

In some embodiments, the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dntps), and an amplification enzyme, and during step (a), the nucleic acid analyte present in the sample undergoes amplification, and wherein after amplification of a given nucleic acid analyte and before (b), the sample is further treated with a protease.

In some embodiments, prior to step (a), the nucleic acid analyte present in the sample is amplified, and after amplifying the given nucleic acid analyte, the sample is further treated with a protease.

In some embodiments, the sample is treated with a protease prior to step (a). In some embodiments, the sample is treated with a protease during step (a). In some embodiments, the sample is treated with a protease after step (a).

In some embodiments, the first and second reaction mixtures are combined such that the method comprises the steps of:

(a) Introducing one or more nucleic acid analytes into a combined reaction mixture comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Blocking the oligonucleotide;

pyrophosphorolysis enzyme; and

ligase;

wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences, and wherein the target analyte is hybridized to single stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ ；

(b) Detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of a polynucleotide target sequence in the analyte.

In some embodiments, the reaction mixture comprising pyrophosphorolysis enzyme further comprises a source of pyrophosphate ions.

In some embodiments, the targeted region of RNA present in the biological sample is reverse transcribed into DNA by a reverse transcriptase prior to introduction into a reaction mixture comprising pyrophosphorolysis enzyme.

In some embodiments, this is accomplished by using a reverse transcriptase and appropriate nucleotides.

In some embodiments, RNA present in the sample is transcribed into DNA while any pre-amplification of nucleic acids present in the sample is performed via PCR.

In some embodiments, transcription of any RNA present in the sample to DNA and any pre-amplification of nucleic acids present in the sample via PCR occur in separate steps.

In some embodiments of any of the methods described previously or subsequently, the RNA present in the sample is not transcribed into DNA.

In such embodiments, A ₀ Undergo pyrophosphorolysis against RNA sequences to form partially digested strand A ₁ And the method is then carried out as previously or subsequently described。

In some embodiments of the method, the blocking oligonucleotide is fully complementary to the target nucleic acid analyte and mismatched to the non-target nucleic acid analyte such that:

incompletely annealing the non-target nucleic acid analyte to the blocking oligonucleotide to form an intermediate that cannot be pyrophosphorolysis digested to the extent necessary for the blocking oligonucleotide to melt with the non-target molecule;

the target nucleic acid analyte is fully annealed to the blocking oligonucleotide to form an intermediate that is at least partially double-stranded at the 3' end of the blocking oligonucleotide, and the blocking oligonucleotide is pyrophosphorolyzed in the 3' -5' direction, releasing the target nucleic acid analyte;

target nucleic acid analyte and Single-stranded Probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ The method comprises the steps of carrying out a first treatment on the surface of the And

detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of a polynucleotide target sequence in the analyte.

An illustrative example of an embodiment of the invention can be seen in FIG. 4, where a blocking oligonucleotide may be present during initial PCR amplification. The blocking oligonucleotides anneal to the wild-type strand present, preventing them from being amplified by PCR. This only allows preferential amplification of the mutant chains.

An illustrative example of an embodiment of the invention can be seen in FIG. 5, wherein a blocking oligonucleotide is present in a combined pyrophosphorolysis and ligation step. Blocking oligonucleotides completely anneal to the existing wild-type strand preventing probe A ₀ Is a mismatch anneal of (a). The blocking oligonucleotide does not anneal completely to the existing mutant chain and breaks off or is cleaved by probe A due to the temperature used in the combined pyrophosphorolysis ₀ And (3) replacement. This results inThe proportion of probes that successfully anneal to the mutant chains increases significantly, and thus the level of fluorescence signal detected as a result of this method increases significantly.

An illustrative example of an embodiment of the invention can be seen in FIG. 6, in which a blocking oligonucleotide (perfectly complementary to the target sequence present in the mutant strand, but mismatched to the corresponding sequence in the wild-type strand) is present in the combined pyrophosphorolysis and ligation step. Due to the presence of one or more mismatches, the blocking oligonucleotide does not anneal perfectly to any wild type strand present, which prevents any pyrophosphorolysis of the blocking oligonucleotide, preventing any subsequent probe A ₀ Mismatch annealing to the wild-type strand. The blocking oligonucleotide is fully annealed to any mutant strand present and is fully pyrophosphorolyzed, allowing any probe A present to occur ₀ Annealing to the mutant chain allows for subsequent pyrophosphorolysis and ligation.

In some embodiments, the blocking oligonucleotide comprises a modification to confer resistance to digestion by hydrolysis or pyrophosphorolysis of an external nucleic acid.

In some embodiments, the blocking oligonucleotide comprises a 3' modification to confer resistance to digestion by exonucleic acid hydrolysis or pyrophosphorolysis.

In some embodiments, the blocking oligonucleotide comprises a 5' modification to confer resistance to digestion by exonucleic acid cleavage.

In some embodiments, the second reaction mixture or combined reaction mixture further comprises at least one of the compounds with A ₀ Single stranded primer oligonucleotides that are substantially complementary, and deoxyribonucleotide triphosphates (dNTPs).

In some embodiments, the second reaction mixture or the combined reaction mixture further comprises an amplification/polymerase.

In some embodiments, the product of the pyrophosphorolysis reaction is introduced into a third reaction mixture comprising at least one single stranded primer oligonucleotide and dntps prior to the detection step.

In some embodiments, the third reaction mixture further comprises an amplification/polymerase.

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises:

-at least one single stranded primer oligonucleotide, deoxynucleotide triphosphate (dNTP) and an amplifying enzyme; or (b)

-reagents suitable for the Hybridization Chain Reaction (HCR); or (b)

-reagents suitable for Ligation Chain Reaction (LCR);

wherein the pyrophosphorolysis enzyme is optionally the same as the enzyme that performs the amplification.

In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot start dNTP.

A hot-start deoxynucleotide triphosphate (dNTP) is a dNTP modified at the 3' end with a thermolabile protecting group. The presence of such modifications prevents DNA polymerase nucleotide incorporation until the nucleotide protecting group is removed using a thermal activation step.

In one embodiment, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a component for a Hybridization Chain Reaction (HCR).

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a ligation probe oligonucleotide C having a 5' phosphate, and A ₁ Splint oligonucleotide D, which is complementary to the 3 'end of C and the 5' end of C, and partially digested strand A ₁ Ligating at the 3 'end to the 5' end of C to form oligonucleotide A ₂ 。

In this embodiment, the reaction mixture further comprises hairpin oligonucleotide 1 (HO 1) and hairpin oligonucleotide 2 (HO 2), each of which comprises a fluorophore and a quencher, such that the fluorophore and the quencher are in contact with each other when each oligonucleotide is maintained in the hairpin configuration. HO1 is designed such that A ₂ To which the "hairpin" structure is opened and the fluorophore is separated from the quencher. Now "open"HO1 is now able to anneal to HO2, opening the" hairpin "structure and separating the fluorophore from the quencher.

In this embodiment, more than one hairpin oligonucleotide is present such that one A ₂ The presence of a chain reaction that causes the hairpin oligonucleotide to open, resulting in a detectable fluorescent signal. This method is known in the literature as Hybridization Chain Reaction (HCR).

In some embodiments, the fluorophore of the fluorophore-quencher pair is selected from, but not limited to, a dye of the fluorescein family, the carboxyrhodamine family, the cyanine family, and the rhodamine family. Other dye families that may be used include, for example, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine (squaraine) family dyes, chelate lanthanide dyes, dye families available from Molecular Probes under the trade name Alexa Fluor J, dye families available from ATTO-TEC (Siegen, germany) under the trade name ATTO, and dye families available from Invitrogen (Carlsbad, calif.) under the trade name Bodipy J. Dyes of the fluorescein family include, for example, 6-carboxyfluorescein (FAM), 2',4',1, 4-tetrachlorofluorescein (TET), 2',4',5',7',1, 4-Hexachlorofluorescein (HEX), 2',7' -dimethoxy-4 ',5' -dichloro-6-carboxyrhodamine (JOE), 2 '-chloro-5' -fluoro-7 ',8' -fused phenyl-1, 4-dichloro-6-carboxyfluorescein (NED), 2 '-chloro-7' -phenyl-1, 4-dichloro-6-carboxyfluorescein (VIC), 6-carboxy-X-Rhodamine (ROX), and 2',4',5',7' -tetrachloro-5-carboxy-fluorescein (zo). Dyes of the carboxyrhodamine family include tetramethyl-6-carboxyrhodamine (TAMRA), tetrapropanol) -6-carboxyrhodamine (ROX), texas Red, R110 and R6G. Dyes of the cyanine family include Cy2, cy3, cy3.5, cy5, cy5.5 and Cy7. Fluorophores are readily commercially available from, for example, perkin-Elmer (Foster City, calif.), molecular Probes, inc (Eugene, oreg.), and Amersham GE Healthcare (Piscataway, n.j.).

In some embodiments, the quencher of the fluorophore-quencher pair may be a fluorescent quencher or a non-fluorescent quencher. Fluorescence quenchers include, but are not limited to TAMRA, ROX, DABCYL, DABSYL, cyanine dyes (including nitrothiazole blue (NTB)), anthraquinones, malachite green, nitrothiazoles, and nitroimidazoles. Exemplary non-fluorescent quenchers that dissipate energy absorbed from fluorophores include those available under the trade name Black Hole from Biosearch Technologies, inc (Novato, calif.) ^TM Those under the trade name Eclipse ^TM Is a non-fluorescent quencher. Those available under the trade names Qx1J from Dark from Epoch Biosciences (matthel, wash), inc (San Jose, calif), those available under the trade names ZEN and TAO from Integrated DNA Technologies (Coralville, iowa), and those available under the trade names Iowa Black from Integrated DNA Technologies (Coralville, iowa) ^TM Those of (3).

In some embodiments, the fluorophore of the fluorophore-quencher pair can be fluorescein, lucifer Yellow, B-phycoerythrin, 9-acridinium isothiocyanate, lucifer Yellow VS, 4-acetamido-4 ' -isothiocyanatophenyl-2, 2' -disulfonic acid, 7-diethylamino-3- (4 ' -isothiocyanatophenyl) -4-methylcoumarin, 1-pyrene butyrate succinimidyl ester, and 4-acetamido-4 ' -isothiocyanatophenyl-2, 2' -disulfonic acid derivatives.

In some embodiments, the fluorophore of the fluorophore-quencher pair may be LC-Red 640, LC-Red 705, cy5, cy5.5, lissamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriamine pentaacetate, or other lanthanide ion (e.g., europium or terbium) chelate.

In some embodiments, the invention uses a double quenched fluorescent-labeled oligonucleotide. The inclusion of the second internal quencher shortens the distance between the dye and the quencher, and in conjunction with the first quencher provides greater overall dye quenching, reduces background and increases signal detection. The second quencher and the first quencher may be any of the quenchers previously described.

In an alternative embodiment, a second reaction mixture or a combined reaction mixture or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection stepThe reaction mixture contains a ligation probe oligonucleotide C with 5' phosphate, and A ₁ Splint oligonucleotide D, which is complementary to the 3 'end of C and the 5' end of C, and partially digested strand A ₁ Ligating at the 3 'end to the 5' end of C to form oligonucleotide A ₂ 。

In some embodiments, a ₁ Is linked together at the 5 'and 3' ends to form a cyclized A ₂ 。

In some embodiments, a ₁ Oligonucleotide C is circularized against the ligation probe to form A ₂ 。

In some embodiments, a ₀ Circularization of oligonucleotide D against splint to form A ₂ 。

In some embodiments, a ₁ Cyclizing to form A against the target sequence ₂ . In this embodiment, the catalyst is prepared by A ₀ From A ₀ Gradually digested from the 3' -end in the 3' -5' direction to form A ₁ And exposed target region and A ₀ /A ₁ Is complementary to the 5' end of (C). In such an embodiment, a ligase may be used to ligate A ₁ 3 'and 5' ends of (A) to form circularized oligonucleotide A ₂ . This is shown for example in fig. 7. In one embodiment, A ₀ /A ₁ Is complementary to the target across a region of 5-50 nucleotides in length. In one embodiment, the region is 5-25 nucleotides in length. In one embodiment, the region is 5-20 nucleotides in length. In one embodiment, the region is 5-15 nucleotides in length. In one embodiment, the region is 5-12 nucleotides in length. In one embodiment, the region is 5-10 nucleotides in length.

In some embodiments, a ₁ Is cyclized to form A ₂ As previously or subsequently described.

In some embodiments, a ₂ Chain A by partial digestion ₁ Formed as previously or subsequently described.

In embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises:

-an oligonucleotide a comprising a substrate arm, a part of a catalytic core and a sensor arm;

-an oligonucleotide B comprising a substrate arm, a part of a catalytic core and a sensor arm; and

-a substrate comprising a fluorophore-quencher pair;

wherein the sensor arms of oligonucleotide A and oligonucleotide B are identical to A ₂ Is complementary to the flanking regions of (a) such that in the presence of a ₂ In the presence of a catalytic, multicomponent nuclease (MNAzyme) is formed by combining oligonucleotide a and oligonucleotide B. In this embodiment, MNAzyme is present only in the presence of A ₂ And cleaving the substrate comprising the fluorophore-quencher pair, thereby producing a detectable fluorescent signal.

In some embodiments, the fluorophore-quencher pair can be as previously described.

In some embodiments, the reaction mixtures of the present invention are combined such that pyrophosphorolysis, ligation, and detectable fluorescence signal generation occurs without the addition of additional reagents.

In an alternative embodiment, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a partially double stranded nucleic acid construct, wherein:

one strand comprising at least one RNA base, at least one fluorophore, and wherein the region of the strand is identical to A ₂ And wherein the strand may be referred to as a 'substrate' strand;

the other strand comprises at least one quencher, and wherein the region of the strand is complementary to A ₂ Is complementary to a region adjacent to the region complementary to the substrate strand such that in the presence of A ₂ In the above, the partially double-stranded nucleic acid construct becomes substantially more double-stranded;

wherein the substrate strand of the double-stranded nucleic acid construct is cleaved at the RNA bases during the process of becoming substantially more double-stranded, since the at least one quencher of the "further" strand is no longer sufficiently close to the at least one fluorophore of the substrate strand to generate fluorescence.

In other words, in the presence of A ₂ In the case of a partially double-stranded nucleic acid construct having a double-stranded portion of larger size.

In some embodiments, additional reagents, such as suitable buffers and/or ions, are present in the second reaction mixture or the combined reaction mixture or third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step.

In some embodiments, the reaction mixture further comprises Mg ²⁺ Ions.

In some embodiments, the reaction mixture further comprises Zn ²⁺ Ions.

In some embodiments, the reaction mixture further comprises X ²⁺ Ions, wherein X is a metal.

In some embodiments, the reaction mixture further comprises one or more X ²⁺ Ions, wherein X is a metal.

In an alternative embodiment, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises reagents for Ligase Chain Reaction (LCR).

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step comprises

a. One or more ligases; and

b. and A is a ₂ Two or more LCR probe oligonucleotides complementary to the upper adjacent sequences, wherein when the probe successfully anneals to A ₂ When the 5 'phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe.

In some embodiments, in the presence of A ₂ In the case of (a), both LCR probes will successfully anneal to a ₂ And are linked together to form an oligonucleotide molecule, which is then The oligonucleotide molecule acts as a new target for the second round of covalent attachment, resulting in a target of interest (in this case a ₂ ) Is a geometric amplification of (a). Ligation of product or amplicon with A ₂ Complementary, and serve as targets in the next amplification cycle. Thus, exponential amplification of a particular target DNA sequence is achieved by repeated cycles of denaturation, hybridization, and ligation in the presence of excess LCR probes. From this, infer A ₂ And thus infer the presence of the target polynucleotide sequence.

In some embodiments, in the presence of A ₂ In the case of (2), both PCR probes will successfully anneal to A ₂ And are linked together to form an oligonucleotide molecule which then serves as a second round of covalently linked new target, resulting in a target of interest (in this case a ₂ ) Is then amplified by the geometry of the target of interest (in this case a ₂ ) Is detected.

In some embodiments, the attached oligonucleotide molecules are detected in real-time using intercalating dyes.

In some embodiments, the attached oligonucleotide molecules are detected using gel electrophoresis.

Those skilled in the art will recognize that there are many techniques that allow detection of linked oligonucleotide molecules.

In some embodiments, one or more of the ligases is thermostable.

In some embodiments, the one or more ligases are naturally occurring.

In another embodiment, one or more ligases are engineered.

In some embodiments, the one or more ligases are selected from any of the ligases previously or subsequently disclosed.

In some embodiments, the one or more polymerases are thermostable.

In some embodiments, the one or more polymerases are selected from any of the polymerases previously or subsequently disclosed.

In some embodiments, the one or more polymerases are naturally occurring.

In another embodiment, one or more polymerases are engineered.

In some embodiments, the one or more polymerases are the same as the polymerase used for pyrophosphorolysis.

In some embodiments, one or more enzymes of the invention are hot start enzymes.

In some embodiments, one or more enzymes of the invention are thermostable.

In an alternative embodiment, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step comprises:

a. Splint oligonucleotide comprising a fluorophore-quencher pair, the splint oligonucleotide A ₂ Complementation;

b. double-strand specific DNA digestive enzymes;

wherein in the presence of A ₂ In the case of (a), the splint oligonucleotide is digested such that the fluorophore-quencher pair is separated and the fluorescent signal, and thus a ₂ Is detectable.

In some embodiments, the fluorophore-quencher pair can be as previously described. In some embodiments, the double-strand specific DNA-digesting enzyme is an exonuclease. In another embodiment, it is a polymerase with proofreading activity. In another embodiment, the reaction mixture comprises a mixture of one or more of the following: exonuclease or polymerase with proofreading activity.

In some embodiments, the double-strand specific DNA-digesting enzyme is a hot start enzyme.

In some embodiments, the double-strand specific DNA digestive enzyme has reduced activity at a temperature at which pyrophosphorolysis reactions of the method occur.

In some embodiments, the double-strand specific DNA digestive enzyme is inactive at a temperature at which pyrophosphorolysis reactions of the method occur.

In some embodiments, a ₀ Is fully complementary to the target polynucleotide sequence at the 3' end.

In some embodiments, the ligase substantially lacks single-stranded ligation activity.

In some embodiments, comprising partially digested strand A ₁ Is introduced into the inorganic pyrophosphatase prior to or during the detection step.

In chemical science, methylation refers to the addition of a methyl group to a substrate or the substitution of an atom or group with a methyl group. Methylation is a form of alkylation, particularly where a methyl group is substituted for a hydrogen atom rather than a larger carbon chain. These terms are commonly used in chemistry, biochemistry, soil science and bioscience.

In biological systems, methylation is catalyzed by enzymes: such methylation may be involved in the modification of heavy metals, regulation of gene expression, regulation of protein function, and RNA metabolism. Methylation of heavy metals can also occur outside of biological systems. Chemical methylation of tissue samples is also a method for reducing certain histological staining artifacts.

Abnormal DNA methylation profiles are associated with many different complex disease states. In oncology, hypermethylation of tumor suppressor genes in serum DNA can be used as a diagnostic marker for small cell lung cancer. Abnormal DNA methylation of cells of the immune system is found in patients with immune diseases such as diabetes, rheumatoid Arthritis (RA) and Systemic Lupus Erythematosus (SLE). Differential DNA methylation (a measure of global DNA methylation) in Peripheral Blood Leukocyte (PBL) repeat elements ALU, LINE-1 and Satellite 2 has been found to be associated with ischemic heart disease.

DNA methylation in vertebrates typically occurs at CpG sites (cytosine-phosphate-guanine sites; i.e., cytosine is followed by guanine in the DNA sequence); this methylation results in the conversion of cytosine to 5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA methyltransferase. Most mammalian DNA is methylated at about 40% of CpG sites, but there are some regions called CpG islands that are GC-rich (consisting of about 65% CG residues) where there is no methylation. These CpG islands are associated with 56% of promoters of mammalian genes, including all commonly expressed genes. Between 1% and 2% of the human genome are CpG clusters, and there is an inverse relationship between CpG methylation and transcriptional activity.

DNA methylation involves the addition of a methyl group to the nitrogen at the 5-position of the cytosine loop or the 6-position of the adenine loop. Such modifications may be inherited by cell division. DNA methylation is typically removed during fertilized egg formation and reestablished during development by continued cell division. DNA methylation is an important part of the normal biological development and cellular differentiation of higher organisms. DNA methylation stably alters gene expression patterns in cells, enabling cells to "remember where they have been removed"; in other words, cells programmed to islets during embryonic development remain islets throughout the life cycle of the organism without a continuous signal telling them that they need to remain islets. In addition, DNA methylation inhibits the expression of viral genes and other deleterious elements that have been integrated into the host's genome over time. DNA methylation also forms the basis of chromatin structure, enabling cells to form various features from a single, immutable DNA sequence that are required for multicellular life. DNA methylation also plays a critical role in the development of almost all types of cancer.

Bisulfite sequencing is the use of bisulfite to treat DNA to determine its methylation pattern. DNA methylation is the first epigenetic marker discovered and is still the most studied. It is also associated with repression of transcriptional activity.

Among many mRNA modifications, N6-methyl adenosine (m 6A) modification is the most common type in eukaryotes and in nuclear replication viruses. m6A has an important role in many cancer types, including leukemia, brain tumor, liver cancer, breast cancer and lung cancer.

Although 5-methylcytosine (5 mC) is the most studied epigenetic modification, 5mC oxidizes to 5-hydroxymethylcytosine (5 hmC) under the catalysis of TET (ten-eleven translocation) enzyme. Studies have shown that the distribution of 5hmC is tissue specific and that there is a difference in the distribution of 5hmC in different organs and tissues. The reduction of 5hmC expression in malignant tissues has been shown to be consistent in a wide range of different cancers, including melanoma. By evaluating a total of 15 pairs of normal and cancerous samples in human breast tissue, studies have shown that the level of 5hmC is significantly reduced in the cancerous group compared to healthy breast tissue.

Treatment of DNA with bisulfite converts cytosine residues to uracil, but 5-methylcytosine residues are unaffected. Thus, bisulfite treatment introduces specific changes in the DNA sequence that depend on the methylation state of individual cytosine residues, thereby generating single nucleotide resolution information about the methylation state of DNA segments. Various analyses can be performed on the changed sequence to retrieve this information. Thus, objective analysis is simplified to distinguish single nucleotide polymorphisms (cytosine and thymine) caused by bisulfite conversion. 5hmC is converted to 5mC at bisulfite treatment, then 5mC is read out as C at sequencing, and thus 5hmC and 5mC cannot be distinguished. The output from bisulfite sequencing cannot be defined as DNA methylation only anymore, because it is a complex of 5mC and 5 hmC. The development of Tet-assisted bisulfite sequencing is now able to distinguish between these two modifications with single base resolution.

5hmC can be detected using TET assisted bisulfite sequencing (TAB-seq). The fragmented DNA was enzymatically modified using the T4 bacteriophage β glucosyltransferase (T4-BGT) followed by ten-eleven translocation (TET) dioxygenase treatment in sequence prior to sodium bisulfite addition. T4-BGT glycosylates 5hmC to form beta-glycosyl-5-hydroxymethylcytosine (5 ghmC), and TET is then used to oxidize 5mC to 5caC. Only 5ghmC is protected from subsequent deamination of sodium bisulphite and this enables 5hmC to be distinguished from 5mC by sequencing.

Oxidative bisulfite sequencing (oxBS) provides another method of distinguishing between 5mC and 5hmC. The oxidizing reagent potassium homoruthenate converts 5hmC to 5-formyl cytosine (5 fC), and subsequent sodium bisulfite treatment deaminates 5fC to uracil. 5mC remains unchanged and can therefore be identified using this method.

Apodec coupled epigenetic sequencing (ACE-seq) completely precludes bisulfite conversion and relies on enzymatic conversion to detect 5hmC. In this way, T4-BGT glycosylates 5hmC to 5ghmC and protects it from deamination of apolipoprotein B mRNA editing enzyme subunit 3A (APOBEC 3A). Cytosine and 5mC were deaminated by apodec 3A and sequenced as thymine.

TET assisted 5-methylcytosine sequencing (TAmC-seq) enriches the 5mC locus and utilizes two sequential enzymatic reactions followed by affinity pulldown. The fragmented DNA was treated with T4-BGT and 5hmC was protected by glycosylation. The enzyme mET 1 is then used to oxidize 5mC to 5hmC, and the T4-BGT marks the newly formed 5hmC with a modified glucose moiety (6-N3-glucose). Click chemistry was used to introduce biotin tags that enabled enrichment of 5 mC-containing DNA fragments for detection and whole genome profiling.

Methylation set analysis methods are broadly divided into 3 groups: based on restriction enzymes, on chromatin immunoprecipitation (ChIP) or on affinity and bisulphite conversion (gene based). The restriction enzyme-based method is a methylation sensitive restriction enzyme for small/large scale DNA methylation analysis, global methylation analysis is performed by the use of a combination of methylation sensitive restriction enzyme assay methods (RLGS, DMH, etc.), applied to any genome without knowledge of the DNA sequence. However, large amounts of genomic DNA are required, making this method unsuitable for sample analysis when small amounts of DNA are recovered. In another aspect, chIP-based methods may be used to identify regions of differential methylation in tumors by precipitating protein antigens from solution using antibodies to the proteins. These methods are protein-based and are widely used in cancer research.

Affinity enrichment is a technique commonly used to isolate methylated DNA from the remaining DNA population. This is typically accomplished by antibody immunoprecipitation methods or with methyl-CpG binding domain (MBD) proteins.

Methylated DNA immunoprecipitation (MeDIP) is an antibody immunoprecipitation method that uses 5-methylcytidine antibodies to specifically recognize methylated cytosines. The media kit requires that the input DNA sample be single-stranded for 5-methylcytidine (5-mC) antibody binding.

Another method for enriching methylated DNA fragments uses recombinant methyl binding protein MBD2b or MBD2b/MBD3L1 complex. One advantage of the methyl-CpG binding protein enrichment strategy is that the input DNA sample need not be denatured; the protein recognizes methylated DNA in a naturally double stranded form. Another advantage is that MBD proteins bind only to methylated DNA in CpG background to ensure enrichment of methylated CpG DNA, making this technology an ideal technique for studying CpG islands.

In some embodiments, one or more nucleic acid analytes are selectively modified prior to or during step (a) of the methods of the invention.

In some embodiments, the unmethylated cytosine base in the one or more nucleic acid analytes is chemically or enzymatically converted prior to or during step (a).

In one embodiment, the unmodified cytosine base is converted to uracil by a methyltransferase.

In one embodiment, the enzyme is m.sssl.

In one embodiment, the unmodified cytosine base is converted to uracil by a deaminase.

Enzymatic methyl sequencing workflow relies on the ability of apodec to deaminate cytosines to uracils. Apodec also deaminates 5mC and 5hmC making it impossible to distinguish between cytosine and its modified forms. To detect 5mC and 5hmC, the method also utilizes TET2 and oxidation enhancers that enzymatically modify 5mC and 5hmC to form a form that is not a substrate for apodec. The TET2 enzyme converts 5mC to 5 cat and the oxidation enhancer converts 5hmC to 5ghmC. Finally, cytosine is sequenced to thymine and 5mC and 5hmC are sequenced to cytosine, thereby preserving the integrity of the original 5mC and 5hmC sequence information.

In one embodiment, one or more nucleic acid analytes are introduced into the epigenetic modification susceptible or epigenetic modification dependent restriction endonuclease prior to or during step (a).

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is McrBC.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is a member of the MspJI family.

In one embodiment, the endonuclease is asphi. In one embodiment, the endonuclease is FspEI.

In one embodiment, the endonuclease is LpnPI.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is a member of the PvuRts1I/AbaS family.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is a type IIM endonuclease.

In one embodiment, the endonuclease is dpnl.

In one embodiment, the endonuclease is BisI.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is a type IV endonuclease.

In one embodiment, the endonuclease is EcoKMcrBC.

In one embodiment, the endonuclease is SauUSI.

In one embodiment, the endonuclease is GmrSD.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is selected from the group consisting of the DpnII restriction endonuclease family.

In one embodiment, the endonuclease is dpnli.

In one embodiment, the endonuclease is dpnl.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is an HpaI.

In one embodiment, the epigenetic modification sensitive or epigenetic modification dependent restriction endonuclease is HpaII.

In some embodiments, one or more nucleic acid analytes are introduced into the methylation sensitive or methylation dependent restriction endonuclease prior to or during step (a).

In some embodiments, one or more nucleic acid analytes are introduced into a methylation sensitive or methylation dependent restriction endonuclease prior to or during step (a), followed by selective amplification of a target polynucleotide sequence containing a methylation state of interest by methylation specific multiplex ligation dependent probe amplification (MS-MLPA) of the methylated DNA.

In some embodiments, the population of methylated or unmethylated nucleic acid analytes is reduced prior to or during step (a).

In some embodiments, the reduction is performed using methylated DNA immunoprecipitation (MeDIP).

In some embodiments, the reduction is performed using a methyl binding protein such as MBD2b or MBD2b/MBD3L1 complex.

It will be apparent to those skilled in the art that the present invention extends to the detection of any epigenetic modification, and is not limited to the detection of the methylation state of a target polynucleotide sequence. For example, the invention may be equally applicable to the detection of other epigenetic modifications, including methylolation-e.g., the 5mC hydroxylated form (5-hmC). This recently recognized form of epigenetic modification is an important epigenetic marker that affects gene expression and differs from CpG methylation. Other epigenetic modifications occur on the RNA, such as methyladenosine, and can be detected by the methods of the invention.

In some embodiments, the method according to the invention is wherein the epigenetic modification is methylation. In further embodiments, the epigenetic modification is methylation at a CpG island or by methylolation at a CpG island.

In some embodiments, the epigenetic modification is methylation of adenine in RNA or DNA.

In some embodiments, one or more oligonucleotides of the invention are rendered resistant to pyrophosphorolysis and/or exonuclease digestion by the presence of one or more quenchers.

In some embodiments, after addition of a suitable wash buffer, the resulting reaction mixture is mixed.

In some embodiments, the resulting reaction mixture is mixed by vortexing.

In some embodiments, the resulting reaction mixture is mixed by movement of one or more magnetic beads present in the mixture.

In some embodiments, each washing step comprises using a wash buffer comprising one or more of: tris.HCl pH 7.5-8.0 5mM-20mM, naCl 0.4M-2M, EDTA0.1mM-1mM and/or Tween200-0.1%.

In some embodiments of any of the previously or subsequently described methods, one or more of the reaction mixtures may be combined.

In some embodiments, either:

-A ₁ cyclisation by ligation of the 3 'and 5' ends thereof to form A ₂ The method comprises the steps of carrying out a first treatment on the surface of the Or alternatively

The second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a ligation probe oligonucleotide C, and in order to form A ₂ ，A ₁ The connection experienced is A ₁ A 3 'end of (C) is linked to a 5' end of C.

In some embodiments, a ₁ The connection of (2) occurs:

During step (b);

during step (c); or (b)

Between step (b) and step (c).

In some embodiments, oligonucleotide C further comprises a 3' modification or internal modification that protects it from 3' -5' exonuclease digestion.

In some embodiments, oligonucleotide C further comprises a 5' modification that protects it from 5' -3' exonuclease digestion.

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises splint oligonucleotide D.

In some embodiments, D comprises a group selected from the group consisting of ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

In some embodiments, the 3 'end of D is modified or linked to A by 3' modification ₁ Mismatch between corresponding regions of (a), D cannot be directed to a ₁ Extension is performed.

In some embodiments, the method further comprises a two-step amplification performed between steps (b) and (c). In some embodiments, the reaction volume is divided into two or more separate volumes prior to the second amplification.

Those skilled in the art will appreciate that there are many 3' modifications that can be used to prevent extension.

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a 5'-3' exonuclease, and wherein a ₀ Is rendered resistant to 5'-3' exonuclease digestion.

In some embodiments, the product of the previous step is treated with pyrophosphatase either before or during the final step.

In some embodiments, the product of the previous step is treated with an exonuclease prior to or during the final step.

In some embodiments, detection is achieved using one or more oligonucleotide fluorescent binding dyes or molecular probes.

In some embodiments, the method of A ₂ The increase in signal over time resulting from the generation of the amplicon is used to infer the concentration of the target sequence in the analyte.

In some embodiments, more than one probe A is employed ₀ Wherein each A ₀ Having selectivity for different target sequences and comprising a recognition region, is further characterized by A ₂ Comprises recognition of the amplicon of (a)The region, and thus the target sequence present in the analyte, is inferred by detection of the recognition region.

In some embodiments, more than one probe A is employed ₀ More than one blocking oligonucleotide is also employed.

In some embodiments, detection of the recognition region is performed using molecular probes or by sequencing.

In some embodiments, the final step of the method further comprises the steps of:

i. labeling the product of the previous step with one or more oligonucleotide fluorescent binding dyes or molecular probes;

measuring the fluorescence signal of the product;

exposing the product to a set of denaturing conditions; and

the polynucleotide target sequence in the analyte is identified by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions.

In some embodiments, one or more nucleic acid analytes are separated into more than one reaction volume, each volume having one or more probe oligonucleotides A introduced to detect different target sequences ₀ 。

In some embodiments, one or more nucleic acid analytes are separated into more than one reaction volume, each volume having one or more probe oligonucleotides A ₀ 。

In some embodiments, different probes a ₀ Comprising a common priming site allowing A to be amplified using a single primer or a single set of primers ₂ Is a region of (a) in the above-mentioned region(s).

In an alternative embodiment, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the products of the pyrophosphorolysis step are introduced prior to the detection step further comprises one or more partially double stranded DNA constructs, wherein each construct comprises one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are positioned in sufficient proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

In some embodiments, the construct is a DNA strand having a self-complementary region that loops back on itself.

In some embodiments, the construct comprises one primer of a primer pair.

In some embodiments, the fourth reaction mixture further comprises the other primer of the primer pair.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct. The primer is then extended against the construct, displacing the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal indicative of A in the reaction mixture ₂ Is present.

In such embodiments, the construct may be referred to as a Sunrise (Sunrise) primer.

In some embodiments, the construct comprises two separate DNA strands.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct. The primer is then extended against the construct in the direction of the double stranded segment, displacing the shorter strand of the DNA strand, and thus the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicative of a in the reaction mixture ₂ Is present.

In such embodiments, the construct may be referred to as a molecular zipper.

Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, one or more fluorophores and one or more quencher pairs may be located at different positions within each respective construct. The key feature is that each pair is located close enough to each other,so that in the absence of A ₂ When extension and strand displacement do not occur, no fluorescent signal is emitted.

In some embodiments according to any of the methods described previously or subsequently, the RNA present in the sample is not transcribed into DNA. In such embodiments, A ₀ Undergo pyrophosphorolysis against RNA sequences to form partially digested strand A ₁ And the method then proceeds as previously or subsequently described.

In some embodiments of any of the previously or subsequently described methods, one or more of the reaction mixtures may be combined. According to the present invention, there is also provided a method of detecting a target polynucleotide sequence in a given nucleic acid analyte. Analytes to which the various methods of the invention can be applied can be prepared from the above biological samples by a series of preliminary steps designed to amplify the analytes and separate them from background genomic DNA, which is typically present in significant excess.

In some embodiments, the target polynucleotide sequence in the analyte will be a gene or chromosomal region in the DNA or RNA of a cancerous tumor cell, and is characterized by the presence of one or more mutations; for example in the form of one or more Single Nucleotide Polymorphisms (SNPs). Thus, the present invention will be useful in monitoring and/or treating disease recurrence. Patients who are declared disease-free after treatment may be monitored over time to detect recurrence of the disease. This needs to be done non-invasively and requires sensitive detection of the target sequence from the blood sample. Also, for some cancers, there are residual cancer cells in the patient after treatment. The use of the present invention to monitor the levels of these cells (or cell-free DNA) present in the patient's blood allows for detection of recurrence of disease or failure of current treatments and the need to switch to an alternative.

In some embodiments, detection of the target polynucleotide sequence will allow repeated testing of patient samples during disease treatment to allow early detection of the resulting resistance to treatment. For example, epidermal Growth Factor Receptor (EGFR) inhibitors, such as gefitinib, erlotinib, are commonly used as first line treatment for non-small cell lung cancer (NSCLC). During treatment, tumors often develop mutations in the EGFR gene (e.g., T790M, C797S), which create resistance to treatment. Early detection of these mutations allows patients to shift to alternative therapies.

In some embodiments, the target polynucleotide sequence in the analyte will be a gene or chromosomal region in DNA or RNA of fetal origin and is characterized by the presence of one or more mutations; for example in the form of one or more Single Nucleotide Polymorphisms (SNPs). Thus, the present invention can be used to detect mutations of very low allele fractions at an earlier stage of pregnancy than other available detection techniques.

In another embodiment, the target polynucleotide sequence may be a gene or genomic region derived from an otherwise healthy individual, but the genetic information obtained may help generate valuable companion diagnostic information in one or more defined populations in the human population that allows medical or therapeutic conclusions to be drawn.

In yet another embodiment, the target polynucleotide sequence may be characteristic of an infectious disease, or of resistance of an infectious disease to treatment with certain therapies; for example, a polynucleotide sequence specific for a gene or chromosomal region of a bacterium or virus, or a mutation therein conferring resistance to therapy.

In some embodiments, the target polynucleotide sequence may be unique to the donor DNA. When a transplanted organ is rejected by a patient, DNA from the organ sloughs into the patient's blood stream. Early detection of this DNA would allow early detection rejection. This can be accomplished using a custom set of donor-specific markers, or by using a set of variants known to be common in the population, some of which will be present in the donor and some in the recipient. Thus, the organ recipients can be routinely monitored over time by the claimed methods.

The success of organ transplantation may depend on the overall level of cumulative damage to the organ caused by several events in the donor. This includes the age, lifestyle, ischemia/reperfusion injury (IRI) and immune response of the recipient. Studies have shown that IRI can lead to epigenetic changes in donor organs. The promoter region of the C3 gene becomes demethylated in the kidney, which is associated with chronic kidney disease after transplantation. DNA methylation is a major contributor to the balanced immune response of the graft, as it regulates the function of cells of the immune system. Thus, detecting the methylation status of a particular DNA sequence may allow identification of patients at risk of post-transplant complications.

In yet another embodiment, different versions of the method using different combinations of probes (see below) are used in parallel, such that more than one target sequence of an analyte can be screened simultaneously; such as a cancer source, a cancer indicator, or more than one infection source. In this method, the amplification products obtained by applying the method in parallel are contacted with a detection set comprising one or more oligonucleotide-binding dyes or sequence-specific molecular probes such as molecular beacons, hairpin probes, etc. Thus, in another aspect of the invention, there is provided the use of at least one probe and optionally one linking oligonucleotide in combination with one or more chemical and biological probes selective for a target polynucleotide sequence, or the use of at least one probe and optionally one linking oligonucleotide in combination with the use of sequencing to identify amplified probe regions.

In some embodiments, single stranded probe oligonucleotide A ₀ Comprising a priming region and a 3' end complementary to a target polynucleotide sequence to be detected. In this way, a first intermediate product is produced that is at least partially double stranded. In some embodiments, this step is in the presence of an excess of A ₀ And in an aqueous medium containing the analyte and any other nucleic acid molecules.

During step (b), the double-stranded region of the first intermediate product is removed from A thereof ₀ The 3' -end of the chain is pyrophosphorolyzed in the 3' -5' direction. Thus, A ₀ The strand is digested stepwise, resulting in a partially digested strand; hereinafter referred to as A ₁ . When the probe oligonucleotide hybridizes erroneously to a non-target sequence, the pyrophosphorolysis reaction will stop at any mismatch, preventing the subsequent steps of the method from proceeding. In another embodiment, this digestion is continued until A ₁ Lack of sufficient complementarity to form a stable duplex with the analyte or target region therein. At this time, the individual strands are then separated by melting, thereby producing a single-stranded form of a ₁ . Under typical pyrophosphorolysis conditions, this separation occurs between analyte and A ₀ With between 6 and 20 complementary nucleotides.

In another embodiment, digestion continues until A ₁ Lack sufficient complementarity to the analyte or target region therein to allow pyrophosphorolysis enzyme binding or pyrophosphorolysis reaction to proceed. This typically occurs when there are 6 to 20 complementary nucleotides left between the analyte and the probe. In some embodiments, this occurs when there are 6 to 40 complementary nucleotides remaining.

Wherein the use of A is as follows ₁ In another embodiment of splint oligonucleotide D (see below) having complementarity at the 5 'and 3' ends, digestion continues until A ₁ The complementary length between the target is reduced to energetically favor oligonucleotide D from A ₁ The point of displacement of the analyte molecule. This usually occurs at A ₁ And the region of complementarity between the analyte molecules and oligonucleotides D and A ₁ The length of the region of complementarity between the 3' ends of (C) is similar or shorter, but may have been similar to A ₁ The advantage of intramolecular hybridization of oligonucleotide D hybridized at the 5' end of (C) may also occur at A ₁ And the complementarity ratio between analyte molecules oligonucleotides D and A ₁ Longer in the region of complementarity between the 3' ends of (c).

Wherein A is performed using analyte molecules as a splint ₁ In another embodiment of the ligation (see FIG. 8), digestion is continued until A ₁ Is capable of hybridizing to an analyte molecule such that A ₁ Adjacent to the 3 'and 5' ends and separated by only one incision (nick) at which point A ₁ The 3 'and 5' ends of (C) are joined together by a ligase and digestion is no longer possible.

Suitably, pyrophosphorolysis is carried out in the presence of at least one polymerase exhibiting pyrophosphorolysis activity and a source of pyrophosphate ions in a reaction medium at a temperature in the range of 20℃to 90 DEG C. Further information about pyrophosphorolysis reactions applied to polynucleotide digestion can be found, for example, in j.biol.244(1969) pp.3019-3028 or in our earlier patent applications.

In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess focused phosphate (polyphosphate) source, suitable sources include those compounds containing 3 or more phosphorus atoms.

In some embodiments, the second reaction mixture comprises an excess focused phosphoric acid source.

In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess of modified pyrophosphate source. Suitable modified pyrophosphoric acids include those that are substituted for bridging oxygens with other atoms or groups, or pyrophosphoric acids substituted with substitution or modification groups on other oxygens (or focused phosphoric acids). Those skilled in the art will appreciate that there are many examples of such modified pyrophosphoric acids suitable for use in the present invention, non-limiting choices of which are:

In some embodiments, the second reaction mixture comprises an excess of a modified focused phosphate source.

In a preferred embodiment, the source of pyrophosphate ions is PNP, PCP or tripolyphosphate (PPPi).

Further, but not limited to, examples of sources of pyrophosphate ions used in pyrophosphorolysis step (c) can be found in WO2014/165210 and WO 00/49180.

In some embodiments, the excess modified pyrophosphate source may be represented as Y-H, where Y corresponds to the general formula (X-O) ₂ P(＝B)-(Z-P(＝B)(O-X)) _n -, wherein n is an integer from 1 to 4; each Z-is independently selected from-O-, -NH-or-CH ₂ -; each B is independently O or S; the X groups are independently selected from-H, -Na, -K, alkyl, alkenyl or heterocyclic groups, provided that when Z and B both correspond to-O-, and when n is 1, at least one X group is not H.

In one placeIn some embodiments, Y corresponds to the general formula (X-O) ₂ P(＝B)-(Z-P(＝B)(O-X)) _n Wherein n is 1, 2, 3 or 4. In another embodiment, the Y group corresponds to the general formula (X-O) ₂ P (=o) -Z-P (=o) (O-H) -, wherein one of the X groups is-H. In yet another preferred embodiment, Y corresponds to the general formula (X-O) ₂ P (=o) -Z-P (=o) (O-X) -, wherein at least one of the X groups is selected from methyl, ethyl, allyl or dimethylallyl.

In an alternative embodiment, Y corresponds to the general formula (H-O) ₂ P (=O) -Z-P (=O) (O-H) - (wherein Z is-NH-or-CH 2-or (X-O) ₂ P (=o) -Z-P (=o) (O-X) -, wherein X groups are both-Na or-K, and Z is-NH-or-CH 2-.

In another embodiment, Y corresponds to the general formula (H-O) ₂ P (=b) -O-P (=b) (O-H) -, wherein each B group is independently O or S, and at least one is S.

Specific examples of preferred embodiments of Y include those of the formula (X1-O) (HO) P (=O) -Z-P (=O) (O-X2) wherein Z is O, NH or CH ₂ And (a) X1 is γ, γ -dimethylallyl, and X2 is-H; or (b) X1 and X2 are both methyl; or (c) X1 and X2 are both ethyl; or (d) X1 is methyl and X2 is ethyl, or vice versa.

In some embodiments, probe oligonucleotide a when detection is to be performed using molecular probes ₀ Is configured to include an oligonucleotide recognition region on the 5' side of the region complementary to the target sequence, and the molecular probe used is designed to anneal to the recognition region. In some embodiments, only A ₀ Is capable of annealing to a target; that is, any other region lacks sufficient complementarity to the analyte that a stable duplex exists at the temperature at which the pyrophosphorolysis step is performed. Here and throughout, the term 'sufficient complementarity' means that the region of complementarity is more than 10 nucleotides long in terms of complementarity of a given region to a given region on the analyte.

In another aspect of the methods of the invention, alternative embodiments are provided wherein the step of phospholysis of any of the previous embodiments is replaced with an exonuclease digestion step using a double-strand specific exonuclease. Those skilled in the art will appreciate that double strand specific exonucleases include those that read in the 3'-5' direction, such as ExoIII, as well as those that read in the 5'-3' direction, such as Lambda Exo, and the like.

In some embodiments of the invention, wherein the exonuclease digestion step utilizes a double strand specific 5'-3' exonuclease, a ₀ Is complementary to the target analyte, and the co-priming sequence and blocking group are located 3' to the region complementary to the target. In another embodiment, probe oligonucleotide A when detection is to be performed using molecular probes ₀ Is configured to include an oligonucleotide recognition region on the 3' side of the region complementary to the target sequence, and the molecular probe used is designed to anneal to the recognition region.

In embodiments of the invention in which the exonuclease digestion step utilizes a double strand specific 5'-3' exonuclease, an exonuclease having 3 'to 5' exonuclease activity may optionally be added to the second reaction mixture or combined reaction mixture or third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step to digest any other nucleic acid molecules present while allowing A to proceed ₀ And chain A comprising partial digestion ₁ Is kept intact. Suitably, such resistance to exonucleolytic events is achieved as described elsewhere in the present application.

In a preferred embodiment of the application, A ₀ The 5 'end of (E) or the internal site 5' to the priming region is rendered resistant to exonucleic acid cleavage. In this way, and after or simultaneously with the pyrophosphorolysis step, an exonuclease having 5'-3' exonuclease activity can optionally be added to the reaction medium to digest any other nucleic acid molecules present, while allowing A to occur ₀ And chain A comprising partial digestion ₁ Is complete. Suitably, this resistance to exonuclease is achieved by the presence of oligonucleotide A ₀ Is achieved by introducing one or more blocking groups at the desired site(s). In some embodimentsIn schemes, these blocking groups may be selected from phosphorothioate linkages (phosphorothioate linkage) and other backbone modifications commonly used in the art, C3 spacers, phosphate groups (phospho groups), modified bases, and the like.

In some embodiments, the recognition region will comprise or be embedded in a barcode coding region (barcoding region) having a unique sequence and suitable for use with component A for amplification ₂ Indirectly by sequencing of these components, or directly by sequencing of these components. Examples of molecular probes that may be used include, but are not limited to, molecular beacons,Probe, & lt/EN & gt>Probes, and the like.

In some embodiments, A is ₂ The strand or desired region thereof undergoes amplification to produce more than one copy, typically millions of copies. This is accomplished by priming A with a single stranded primer oligonucleotide ₂ Is then defined by A ₂ Any amplicon derived, provided for example in the form of a forward/reverse or sense/antisense pair, which can anneal to a ₂ Region of (c) and subsequent a ₂ Complementary regions on any amplicon that is derivatized. The primed strand then becomes the starting point for amplification. Amplification methods include, but are not limited to, thermocycling and isothermal methods such as polymerase chain reaction, recombinase polymerase amplification and rolling circle amplification; when A is ₂ The last term applies when cyclized. By any of these methods, A ₂ Many amplicon copies of a region of (a) and in some cases its sequence complement can be rapidly produced. The exact method of performing any of these amplification methods is well known to the ordinarily skilled artisan, and the exact conditions and temperature patterns employed are readily available in the general literature as read by the reader. In particular, in the case of Polymerase Chain Reaction (PCR), the method generally comprises Use of a polymerase and multiple sources of mononucleoside triphosphates in the 5'-3' direction for A ₂ The primer oligonucleotide is chain extended until a complementary strand is produced; dehybridizing the double stranded product to regenerate A ₂ A strand and a complementary strand; reinitiation A ₂ The strand and any amplicon thereof, and then repeating these extension/dehybridization/re-priming steps multiple times to introduce A ₂ The concentration of the amplicon builds up to a level where it can be reliably detected.

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a ligation probe oligonucleotide C, and the partially digested strand A ₁ At the 3 'end with the 5' end of C, and in another embodiment, A ₁ Cyclizing by ligation of the 3 'and 5' ends thereof;

production of oligonucleotide A in each case ₂ 。

In some embodiments, a ₁ The connection of (2) occurs:

during step (b); or (b)

During step (c); or (b)

Between step (b) and step (c).

In some embodiments, a ₁ Optionally extending in the 5'-3' direction prior to ligation.

In some embodiments, this optional extension and ligation is performed against the target oligonucleotide, while in another embodiment they are performed by adding an additional splint oligonucleotide D, A ₁ Annealing to splint oligonucleotide D prior to extension and/or ligation. In some embodiments, D comprises a group selected from the group consisting of ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region. In another embodiment, the 3 'end is modified or by the 3' end of D and A ₁ Nucleotide mismatches between the corresponding regions of (a), D cannot be directed to A ₁ Extending.

In some embodiments, ligation probe C has at least a 5' end region with splint oligonucleotide DA portion or a 5' region complementary to a target oligonucleotide. By such a process, a second intermediate product is formed, wherein A ₂ The chain comprises A ₁ C and optionally A ₁ An intermediate region extending in the 5' -3' direction so as to meet the 5' -end of C. In such an embodiment, if primers are used in step (d), they are selected to amplify A ₂ Comprises occurrence A of ₁ A site for attachment to C. In this embodiment, we have found that it is advantageous to include a 3' blocking group on C, so that 3' -5' exonucleases can be used to digest any unbound A prior to amplification and/or detection ₁ 。

In some embodiments, the second reaction mixture or the combined reaction mixture or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step further comprises a phosphatase or phosphohydrolase to remove nucleoside triphosphates produced by the pyrophosphorolysis reaction by hydrolysis, thereby ensuring that the pyrophosphorolysis reaction can continue and does not compete for an out-commanded forward polymerization reaction.

In some embodiments, prior to or during step (c), the product of the previous step is treated with pyrophosphatase to hydrolyze pyrophosphate ions, preventing further pyrophosphorolysis from occurring and facilitating forward polymerization. In some embodiments, the product of the previous step is treated with an exonuclease prior to or during step (c).

In some embodiments, for a ₀ Pyrophosphorolysis to form partially digested strand A ₁ Enzymes also amplify A ₂ . Those skilled in the art will recognize that there are many such enzymes.

Detection oligonucleotide A ₂ And the information obtained is used to infer whether the polynucleotide target sequence is present in and/or associated with the original analyte. In this way, for example, target sequences specific to cancerous tumor cells can be detected with reference to the particular SNP being sought. As a further example, target sequences specific to cancerous tumor cells may be detected with reference to the particular methylation site being sought.

In another embodiment, target sequences specific for the viral or bacterial genome (including novel mutations thereof) may be detected. Many assays A can be employed ₂ Including, for example, oligonucleotide binding dyes, sequence specific molecular probes such as fluorescently labeled molecular beacons or hairpin probes. Alternatively, A ₂ Or the direct sequencing of the amplicon thereof, may be performed using one of the direct sequencing methods employed or reported in the art. When using oligonucleotide-bound dyes, fluorescently labeled beacons or probes, it is convenient to use an arrangement comprising a source of stimulating electromagnetic radiation (laser, LED, lamp, etc.) and a photodetector arranged to detect the emitted fluorescence and generate therefrom a signal comprising a data stream that can be analyzed by a microprocessor or computer using specifically designed algorithms.

In some embodiments, detection is achieved using one or more oligonucleotide fluorescent binding dyes or molecular probes. In such embodiments, the method of the present invention is defined by A ₂ The increase in signal over time resulting from the generation of the amplicon(s) is used to infer the concentration of the target sequence in the analyte. In some embodiments, the final step of the method further comprises the steps of:

i. labeling the product of step (b) with one or more oligonucleotide fluorescent binding dyes or molecular probes;

measuring the fluorescence signal of the product;

exposing the product to a set of denaturing conditions; and

In another aspect of the invention, there is provided a method of identifying a target polynucleotide sequence in a given nucleic acid analyte, characterized by the steps of any of the previous embodiments of the invention, wherein more than one copy of A is labeled with one or more oligonucleotide fluorescent binding dyes or molecular probes ₂ Or A ₂ Is a region of (a) in the above-mentioned region(s). Measuring fluorescent signals of more than one copy, and comparing the more than one copyExposed to a set of denaturing conditions. The target polynucleotide sequence is then identified by monitoring changes in the fluorescent signal of more than one copy during exposure to denaturing conditions.

In some embodiments, denaturing conditions may be provided by changing the temperature, for example, by increasing the temperature to the point where the double strand begins to dissociate. Additionally or alternatively, denaturing conditions may also be provided by changing the pH to make the conditions acidic or basic, or by adding additives or reagents such as strong acids or bases, concentrating inorganic salts or organic solvents such as alcohols.

In another aspect of the invention, there is provided the use of the above method for screening a mammalian subject, in particular a human patient, for the presence of an infectious disease, cancer or for generating concomitant diagnostic information.

In another aspect of the present invention, there is provided a control probe for use in the above method. Embodiments of the invention include those that elucidate the presence of one or more specific target sequences by generating a fluorescent signal. In such embodiments, there may inevitably be signal levels generated by non-target DNA present in the sample. For a given sample, the background signal is later than the start time of the "true" signal, but such start may differ from sample to sample. Thus, accurate detection of the presence of a low concentration of one or more target sequences depends on knowing what signal is expected in the absence of target sequences. For human samples (controlled samples), references are available, but this is not the case for truly "blind" samples from patients. Control probe (E) ₀ ) For determining the expected background signal profile for each assay probe. The control probe targets sequences that are not expected to be present in the sample, and the signal generated from the probe can then be used to infer the expected rate of signal generation from the sample in the absence of the target sequence.

Thus, there is provided a method of detecting a target polynucleotide sequence in a given nucleic acid analyte according to any of the preceding methods, characterized by the steps of:

a. Using separate aliquots of the sample or in the same aliquot and allowingOligonucleotide E with a second detection channel using a second single stranded probe ₀ Subsequently or simultaneously repeating the steps of the method, single-stranded probe oligonucleotide E ₀ A 3' end region having at least a partial mismatch with the target sequence;

b. in the absence of any target analyte in the sample, it is inferred that the target analyte is expected to be detected from A ₀ A background signal generated; and

c. the presence or absence of a polynucleotide target sequence in the analyte is inferred by comparing the expected background signal inferred in (a) to the actual signal observed in the presence of the target analyte.

In some embodiments, the control probe (E ₀ ) And A ₀ Is added to a different portion of the sample, while in another embodiment E ₀ And A ₀ Is added to the same portion of the sample and different detection channels (e.g., different color dyes) are used to measure their respective signals. Then can utilize E ₀ The resulting signal is used to infer and correct the expected signal expected from A in the absence of the polynucleotide target sequence in the sample ₀ A background signal is generated. For example, correction of the background signal may include the correction of the background signal from A ₀ Subtracting from E the observed signal ₀ Observed signal, or by using A ₀ And E is ₀ Calibration curve of relative signals generated under different conditions to calibrate slave A ₀ The observed signal.

In some embodiments, an E may be used ₀ To calibrate all assay probes that may be generated.

In some embodiments, a separate E may be used ₀ To calibrate each amplicon of the sample DNA generated in the initial amplification step. Each amplicon may contain more than one mutation/target sequence of interest, but a single E ₀ It is sufficient to calibrate all assay probes for a single amplicon.

In another embodiment, separate E's may be used for each target sequence ₀ . For example, if C>T mutation is targeted, then an E can be designed ₀ Which targets C at the same site in the patient where it is unknown to exist>G mutation. E (E) ₀ Signal curves generated under a variety of conditions can be evaluated in a calibration reaction, and these data are used to infer that the variant is from targeting C when it is not present>Measurement of T variant the predicted signal of the probe.

The specificity of the method of the invention can be improved by introducing blocking oligonucleotides. For example, a blocking oligonucleotide may be introduced to hybridize to at least a portion of wild-type DNA to facilitate A ₀ Annealing only to the target polynucleotide sequence and not to the wild type. Alternatively or additionally, blocking oligonucleotides may be used to improve the specificity of the Polymerase Chain Reaction (PCR) to prevent amplification of any wild-type sequences present. A common technique is to design an oligonucleotide that anneals between PCR primers and cannot be displaced or digested by PCR polymerase. Oligonucleotides are designed to anneal to non-target (usually healthy) sequences, but to mismatch (usually by a single base) to target (mutated) sequences. Such mismatches result in different melting temperatures for the two sequences, and the oligonucleotide is designed to remain annealed to the non-target sequence while dissociating from the target sequence at the PCR extension temperature.

The blocking oligonucleotide may generally have modifications to prevent digestion by the exonuclease activity of the PCR polymerase or to increase the melting temperature difference between the target and non-target sequences.

Incorporation of Locked Nucleic Acid (LNA) or other modifications that alter the melting temperature in the blocking oligonucleotide can significantly increase the difference in melting temperature of the oligonucleotide for target and non-target sequences.

Thus, embodiments of the invention are provided wherein a blocking oligonucleotide is used. In some embodiments, the blocking oligonucleotides must withstand pyrophosphorolysis (PPL) reactions to ensure that they are not digested or displaced. This can be achieved in a number of different ways, for example by a mismatch at the 3' end or by modification such as phosphorothioate linkages or spacers.

In such embodiments or aspects of the invention using blocking oligonucleotides, the method of detecting a target polynucleotide sequence in a given nucleic acid analyte is characterized in that, in the step of oligomerizing the analyte target sequence with a single stranded probeNucleotide A ₀ Annealing to produce at least partially double strand and wherein A ₀ Before or during the same step as the first intermediate of the analyte target sequence to form a double-stranded complex, annealing the single-stranded blocking oligonucleotide to at least a subset of the non-target polynucleotide sequences.

In some embodiments, the blocking oligonucleotide becomes resistant to pyrophosphorolysis by a mismatch at its 3' end. In another embodiment, the blocking oligonucleotide is made tolerant by the presence of a 3' -blocking group. In another embodiment, the blocking oligonucleotide is made tolerant by the presence of a spacer or other internal modification. In another embodiment, the blocking oligonucleotide comprises both modified or modified nucleotide bases that increase the melting temperature and becomes resistant to pyrophosphorolysis.

Reference herein to a 'phosphatase' is to any enzyme or functional fragment thereof that has the ability to remove nucleoside triphosphates produced by the method of the present invention by hydrolysis. This includes any enzyme or functional fragment thereof that has the ability to cleave a phosphomonoester into a phosphate ion and an alcohol.

Reference herein to 'pyrophosphatase' is to any enzyme or functional fragment thereof that has the ability to catalyze the conversion of one pyrophosphate ion to two phosphate ions.

This also includes inorganic pyrophosphatases and inorganic bisphosphatases. One non-limiting example is thermostable inorganic pyrophosphatase (TIPP).

In some embodiments, a modification of any of the previously described embodiments is provided, wherein the use of pyrophosphatase is optional.

Some embodiments of the method of the present invention can be seen in fig. 8-11.

In FIG. 8, single-stranded Probe oligonucleotide A ₀ Annealing to the target polynucleotide sequence to produce a first intermediate product that is at least partially double-stranded, and wherein A ₀ Forms a double-stranded complex with the target polynucleotide sequence at the 3' end of (2). In this simplified embodiment of the invention, there are two A ₀ Molecules and a target polynucleotide sequence to illustrate A that is not annealed to the target ₀ How to not participate in further steps of the method. In this illustrative example, A ₀ Annealing to the target polynucleotide sequence at the 3' end of (A) ₀ Is not annealed to the target polynucleotide sequence. A is that ₀ Comprising a 5' chemical blocking group, a co-priming sequence, and a barcode region.

In FIG. 9, A ₁ Annealing to Single-stranded trigger oligonucleotide B, and A ₁ Strand-directed B extends in the 5'-3' direction to produce oligonucleotide A ₂ . In this illustrative example, trigger oligonucleotide B has a 5' chemical blocking. Any undigested A ₀ Annealing to trigger oligonucleotide B, however undigested A ₀ It is not possible to extend in the 5'-3' direction against B to produce a sequence of targets that are a subsequent part of the method. In this example, A ₂ Priming with at least one single stranded primer oligonucleotide and generating A ₂ Or A ₂ More than one copy of the region of (c).

In FIG. 10, A ₁ Anneals to splint oligonucleotide D and then circularizes by ligating its 3 'and 5' ends. Now cyclized A ₂ Priming with at least one single stranded primer oligonucleotide and generating A ₂ Or A ₂ More than one copy of the region of (c). In this illustrative example, the modification is due to 3 '-modification (in this example chemical modification) or through the 3' end of D and A ₂ Nucleotide mismatches between the corresponding regions of (a) so that splint oligonucleotide D cannot be directed against a ₁ Extending.

In FIG. 11, the 3' region of splint oligonucleotide D anneals to A ₁ While the 5 'region of splint oligonucleotide D anneals to the 5' region of ligation probe C. Thus, a second intermediate product A is formed ₂ It comprises A ₁ C and optionally A ₁ Extending in the 5' -3' direction to meet the 5' -end of CAnd a formed middle region. In this illustrative example, ligation probe C has a 3' chemical blocking group, so 3' -5' exonuclease can be used to digest any unconnected A ₁ 。

In some embodiments of the invention, there is provided a kit for a method of detecting a target polynucleotide sequence in a given nucleic acid analyte present in a sample, comprising:

(a) A blocking oligonucleotide, as previously or subsequently described;

(b) Single-stranded Probe oligonucleotide A ₀ Capable of forming a first intermediate with a target polynucleotide sequence, said intermediate being at least partially double-stranded;

(c) A ligase;

(d) Pyrophosphorolysis enzyme capable of reacting with pyrophosphorolysis enzyme A ₀ Digestion of the first intermediate in the 3'-5' direction from the end of (a) to yield partially digested strand A ₁ ；

(e) Suitable buffers.

In one embodiment, A ₀ Is complementary to the target sequence at the 3' end of (2).

In one embodiment, A ₀ Is fully complementary to the target sequence at the 3' end.

In one embodiment, the kit comprises at least one of the compounds A and A ₀ Single stranded primer oligonucleotides that are substantially complementary to portions of (a) the primer.

In one embodiment, the kit further comprises an amplification enzyme.

In one embodiment, the kit further comprises one or more primers, wherein the one or more primers have non-complementary 5' tails.

In one embodiment, one or more of the primers has a 5' phosphate.

In one embodiment, one or more of the primers is 5' protected.

In one embodiment, A ₀ Is fully complementary to the target polynucleotide sequence at the 3' end.

In one embodiment, the ligase substantially lacks single-stranded ligation activity.

In some embodiments, the kit comprises single stranded probe oligonucleotide a ₀ Single-stranded probe oligonucleotide A ₀ Capable of forming a first intermediate with a target polynucleotide sequence, said intermediate being at least partially double-stranded;

(a) A blocking oligonucleotide, as previously or subsequently described;

(b) A ligase;

(c) Pyrophosphorolysis enzyme capable of reacting with pyrophosphorolysis enzyme A ₀ Digestion of the first intermediate in the 3'-5' direction from the end of (a) to yield partially digested strand A ₁ ；

(d) Suitable buffers.

In some embodiments, the kit may optionally further comprise:

-and A ₁ Two or more Ligation Chain Reaction (LCR) probe oligonucleotides complementary to the upper adjacent sequences, wherein the 5 'phosphate of one LCR probe is immediately adjacent to the 3' OH of the other LCR probe when the probes are successfully annealed; and

-one or more ligases.

In some embodiments, in the presence of A ₂ In the case of (a) the two LCR probes will successfully anneal to a ₂ And are linked together to form an oligonucleotide molecule which then acts as a new target for the second round of covalent attachment, resulting in a target of interest, in this case A ₂ Is a geometric amplification of (a). Ligation of product or amplicon with A ₂ Complementary, and serve as targets in the next amplification cycle. Thus, exponential amplification of a particular target DNA sequence is achieved by repeated cycles of denaturation, hybridization, and ligation in the presence of excess LCR probes. From this, infer A ₂ And thus infer the presence of the target polynucleotide sequence.

In some embodiments, in the presence of A ₂ In the case of (2) two PCR probes will successfully anneal A ₂ And is connected toTo form an oligonucleotide molecule which then serves as a new target for the second round of covalent attachment, resulting in a target of interest (in this case a ₂ ) Is then amplified by the geometry of the target of interest (in this case a ₂ ) Is detected.

In some embodiments, the kit may optionally further comprise:

-ligating probe oligonucleotide C;

-splint oligonucleotide D;

wherein C has a 5 'phosphate, the 3' end of the splint oligonucleotide D is complementary to the 5 'end of C, and the 5' end of D is complementary to A ₁ Is complementary to the 3' end of (A) such that A ₁ And C can be linked together to form A ₂ 。

In some embodiments, the kit may further comprise:

hairpin oligonucleotide 1 (HO 1) comprising a fluorophore-quencher pair, wherein HO1 and A ₂ Complementary to, and when in contact with A ₂ Upon annealing, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; and

hairpin oligonucleotide 2 (HO 2) comprising a fluorophore-quencher pair, wherein HO2 is complementary to the opened HO1, and when annealed to HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates.

In some embodiments, the kit may further comprise more than one HO1 and HO2.

In some embodiments, the kit may alternatively further comprise an oligonucleotide a comprising a substrate arm, a portion of a catalytic core, and a sensor arm;

-a substrate comprising a fluorophore-quencher pair;

wherein the sensor arms of oligonucleotide A and oligonucleotide B are identical to A ₂ Is complementary to the flanking regions of (a) such that in the presence of a ₂ In the presence of a catalytic, multicomponent nuclease (MNAzyme) is formed by combining oligonucleotide a and oligonucleotide B.

In some embodiments, the kit may alternatively further comprise a partially double-stranded nucleic acid construct, wherein:

One strand comprising at least one RNA base, at least one fluorophore, and wherein the region of the strand is identical to A ₂ And wherein the strand may be referred to as a 'substrate' strand; and is also provided with

The other strand comprises at least one quencher, and wherein the region of the strand is complementary to A ₂ Is complementary to a region adjacent to the region complementary to the substrate strand such that in the presence of A ₂ In the above, the partially double-stranded nucleic acid construct becomes substantially more double-stranded.

In some embodiments, the kit may further comprise an enzyme for removing at least one RNA base.

In some embodiments, the enzyme is uracil-DNA glycosidase (UDG) and the RNA base is uracil.

In some embodiments, the kit may optionally further comprise:

-and A ₂ An oligonucleotide comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity to each other or by their proximity to one or more fluorescence quenchers;

-a double-strand specific DNA digestive enzyme;

wherein in the presence of A ₂ The labeled oligonucleotides are digested such that the fluorophores are separated from each other or from their corresponding quenchers, and the fluorescent signal, and thus A ₂ Is detectable.

In some embodiments, the double-strand specific DNA-digesting enzyme is an exonuclease.

In some embodiments, the double-strand specific DNA digestive enzyme is a polymerase with proofreading activity.

In some embodiments, the fluorophore of the kit may be selected from the group consisting of a fluorescein family, a carboxyrhodamine family, a cyanine family, a rhodamine family, a polyhalofluorescein family dye, a hexachlorofluorescein family dye, a coumarin family dye, an oxazine family dye, a thiazine family dye, a squaraine family dye, and a chelate lanthanide dye.

In some embodiments, the fluorophore of the kit may be selected from any commercially available dye.

In some embodiments, the quencher of the kit may be selected from the group of quenchers under the trade name Black Hole ^TM 、Eclipse ^TM Dark, qx1J, and Iowa Black ^TM Those provided.

In some embodiments, the quencher of the kit may be selected from any commercially available quencher.

In some embodiments, the kit may further comprise one or more partially double-stranded DNA constructs, wherein each construct comprises one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are positioned in sufficient proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

In some embodiments, the construct comprises one primer of a primer pair.

In some embodiments, the kit may further comprise the other primer of the primer pair.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct. The primer is then extended against the construct, displacing the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicative of a ₂ Is present.

In such embodiments, the construct may be referred to as a sunrise primer.

In some embodiments, the construct comprises two separate DNA strands.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct. The primer is then extended against the construct in the direction of the double stranded segment, displacing the shorter DNA strand, and thus the one or more fluorophores and one or more dyes are sufficiently separated to detect a fluorescent signal, indicative of a ₂ Is present.

In such embodiments, the construct may be referred to as a molecular zipper.

Those skilled in the art will appreciate that for both the sunrise primer and the molecular zipper, one or more fluorophores and one or more quencher pairs may be located at different positions within each respective construct. The key feature is that each pair is located close enough to each other that in the absence of A ₂ When extension and strand displacement do not occur, no fluorescent signal is emitted.

In one embodiment, the kit further comprises a source of pyrophosphate ions. Suitable sources of pyrophosphate ions are as previously described.

In some embodiments, the kit further comprises suitable positive and negative controls.

In some embodiments, the kit may further comprise one or more control probes (E ₀ )。

In some embodiments, the kit may further comprise one or more control probes (E ₀ ) And one or more blocking oligonucleotides.

In some embodiments, a ₀ May be rendered resistant to 5'-3' exonuclease digestion, and the kit may further comprise a 5'-3' exonuclease.

In some embodiments, the kit may further comprise a ligation probe oligonucleotide C.

In some embodiments, the kit may further comprise splint oligonucleotide D.

In some embodiments, the kit may comprise both C and D.

Ligation probe C may comprise a 3' modification or an internal modification that protects it from 3' -5' exonuclease digestion.

D may comprise a group of the same as A ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

In some embodiments, the 3 'end of D is modified or linked to A by 3' modification ₁ Or mismatches between corresponding regions of C, D may not be directed to A ₁ Extension is performed.

In some embodiments, the kit may further comprise dntps, a polymerase, and a suitable buffer for initial amplification of a target polynucleotide sequence present in the sample.

In some embodiments, the kit may further comprise a high fidelity polymerase incorporating dUTP, and uracil-DNAN-glycosidase (UDG).

In some embodiments, the kit may further comprise a phosphatase or a phosphohydrolase.

In some embodiments, the kit may further comprise pyrophosphatase. Pyrophosphatase may be hot-started.

In some embodiments, the kit may further comprise a protease.

In some embodiments, the kit may further comprise one or more oligonucleotide-binding dyes or molecular probes.

In some embodiments, the kit may further comprise more than one a ₀ Each A ₀ Has selectivity for different target sequences, and each A ₀ Including the identification area.

In some embodiments, the kit may further comprise an enzyme for forming DNA from the RNA template.

In some embodiments, the enzyme is a reverse transcriptase.

In some embodiments, one or more enzymes of the kit may be hot-started.

In some embodiments, one or more enzymes of the kit may be thermostable.

In some embodiments, the kit may further comprise suitable wash reagents and buffer reagents.

In some embodiments, the amplification enzyme and pyrophosphorolysis enzyme (pyrophosphorolysing enzyme) are the same.

In some embodiments, the amplification enzyme and pyrophosphorolysis enzyme (pyrophosphorolysis enzyme) are the same.

The kit may further comprise purification devices and reagents for isolating and/or purifying a portion of the polynucleotide after treatment as described herein. Suitable reagents are well known in the art and include gel filtration columns and wash buffers.

In some embodiments, the kit further comprises an epigenetic sensitive and/or epigenetic dependent restriction enzyme, which may be as previously described.

In some embodiments, the kit further comprises a methylation sensitive and/or methylation dependent restriction enzyme.

In some embodiments, the kit further comprises one or more methyl-CpG binding domain (MBD) proteins.

In some embodiments, the kit further comprises one or more 5-methylcytidine (5-mC) antibodies.

In some embodiments, the kit further comprises one or more MBD2b proteins and/or one or more MBD2b/MBD3L1 complexes.

In some embodiments, the kit further comprises reagents suitable for methylation specific multiplex ligation dependent probe amplification (MS-MLPA).

In one embodiment of the present invention, there is provided an apparatus comprising:

at least one fluid channel between the first region, the second region, and the third region, wherein the first region comprises one or more apertures, wherein each aperture comprises:

dNTP；

at least one single stranded primer oligonucleotide;

an amplifying enzyme for initially amplifying the DNA present in the sample; and is also provided with

Wherein the second region comprises one or more apertures, wherein each aperture comprises:

single-stranded Probe oligonucleotide A ₀ Capable of forming a first intermediate with a target polynucleotide sequence, said intermediate being at least partially double-stranded;

pyrophosphorolysis enzyme capable of reacting with pyrophosphorolysis enzyme A ₀ Digestion of the first intermediate in the 3'-5' direction from the end of (a) to yield partially digested strand A ₁ The method comprises the steps of carrying out a first treatment on the surface of the And is also provided with

Wherein the third region comprises one or more apertures, wherein each aperture comprises:

dNTP；

a buffer;

amplifying the enzyme;

for detecting the source A ₂ Or a part thereof, or A ₂ Means for signaling more than one copy of the signal of the more than one copy or portion thereof; and is also provided with

Wherein the apertures of the second region or the apertures of the third region further comprise at least one of the groups A ₀ Single stranded primer oligonucleotides that are substantially complementary to portions of (a) the primer.

In some embodiments, the one or more pores of the first region comprise one or more blocking oligonucleotides as previously or subsequently described.

In some embodiments, the one or more pores of the second region comprise one or more blocking oligonucleotides as previously or subsequently described.

In some embodiments, the pores of the first region comprise:

-dNTP；

-one or more single stranded primer oligonucleotides;

-an amplifying enzyme for initially amplifying DNA present in the sample;

wherein one or more of the primers has a non-complementary 5' tail.

In some embodiments, one or more primers have a 5' phosphate.

In some embodiments, one or more primers are 5' protected.

In some embodiments, the means for detecting a signal is located within one or more wells of the third region.

In some embodiments, the means for detecting a signal is located within a third region of the device.

In some embodiments, the means for detecting a signal is located within a contiguous region of the device.

In some embodiments, the dntps of each well of the first region may be dUTP, dGTP, dATP and dCTP, and each well may further comprise a dUTP-doped high-fidelity polymerase and uracil-DNA N-glycosidase (UDG).

In some embodiments, the dntps of each well of the third region may be dUTP, dGTP, dATP and dCTP, and each well may further comprise a dUTP-doped high-fidelity polymerase and uracil-DNAN-glycosidase (UDG).

In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions.

In some embodiments, a ₀ The 5' end of (c) may be rendered resistant to 5' -3' exonuclease digestion and the pore of the second region may further comprise a 5' -3' exonuclease.

In some embodiments, each well of the second region or the third region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

Splint oligonucleotide D may comprise a sequence identical to A ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

Due to 3 'modification or by 3' end of D with A ₁ Or mismatches between corresponding regions of C, D may not be directed to A ₁ Extension is performed.

In some embodiments, the dntps may be hot-started, and each well of the second region may further comprise a phosphatase or a phosphohydrolase.

In some embodiments, each well of the second region may further comprise pyrophosphatase.

In some embodiments, the pyrophosphatase may be hot-started.

In some embodiments, each well of the third region may further comprise one or more oligonucleotide-binding dyes or molecular probes.

In some embodiments, each well of the second region may comprise at least one or more different a selective for the target sequence ₀ ，A ₀ Including the identification area.

In some embodiments, the amplification enzyme and pyrophosphorolysis enzyme in the second region may be the same.

In some embodiments, there may be a fourth region comprising one or more pores, wherein each pore may comprise a protease, and wherein the fourth region may be located between the first region and the second region.

In some embodiments, the second region and the third region of the device may be combined such that the pores of the second region further comprise:

dNTP；

A buffer;

amplifying the enzyme; and

for detecting the source A ₁ Or a part thereof, or A ₁ More than one copy of the signal of the or a portion thereof.

The pores of the second region may also comprise one or more blocking oligonucleotides as described previously or subsequently.

In some embodiments, the means for detecting a signal is located within one or more wells of the second region.

In some embodiments, the means for detecting a signal is located within a second region of the device.

In some embodiments, there is provided an apparatus comprising:

a fluid passageway between a first region and a second region, wherein the first region comprises one or more apertures, wherein the one or more apertures comprise:

single-stranded Probe oligonucleotide A ₀ The single-stranded probe oligonucleotide A ₀ Capable of forming a first intermediate with a target polynucleotide sequence, said intermediate being at least partially double-stranded;

pyrophosphorolysis enzyme capable of reacting with pyrophosphorolysis enzyme A ₀ Digestion of the first intermediate in the 3'-5' direction from the end of (a) to yield partially digested strand A ₁ The method comprises the steps of carrying out a first treatment on the surface of the And

One or more kinds of connections A ₁ To generate oligonucleotide A ₂ Is a ligase of (a).

Wherein the second region comprises one or more apertures.

The pores of the first region may also comprise one or more blocking oligonucleotides as described previously or subsequently.

In some embodiments, one or more of the pores in the first region may further comprise an ion source that drives the pyrophosphorolysis reaction forward.

In some embodiments, the ion is a pyrophosphate ion.

In some embodiments, a ₀ Is resistant to 5'-3' exonuclease digestion, and wherein the pores of the first region further comprise a 5'-3' exonuclease.

In some embodiments, the device may further comprise a third region comprising one or more apertures connected to the first region by a fluid channel, and wherein the one or more apertures of the third region comprise:

dNTP；

a single-stranded primer oligonucleotide; and

amplifying the enzyme.

The pores of the third region may also comprise one or more blocking oligonucleotides as described previously or subsequently.

In some embodiments, dntps of the third region may be dUTP, dGTP, dCTP and dATP; the amplification enzyme may be a dUTP-doped high-fidelity polymerase; and one or more of the pores of the third region may further comprise uracil-DNA N-glycosidase.

In some embodiments, the device may further comprise a fourth region between the first region and the third region, the fourth region comprising one or more pores, wherein the one or more pores may comprise a protease.

In some embodiments, one or more of the pores of the first region or the second region may further comprise a ligase and a ₀ Is complementary to the region of ligation probe oligonucleotide C.

In some embodiments, one or more of the pores of the first region or the second region may further comprise a ligase and a ₀ Splint oligonucleotide D complementary to the region of (b).

In some embodiments, one or more of the wells of the first region or the second region may further comprise a ligase, splint oligonucleotide D, and ligation probe oligonucleotide C.

In some embodiments, ligation probe oligonucleotide C may comprise a 3' modification or an internal modification that protects it from 3' -5' exonuclease digestion.

In some embodiments, D may comprise a different amino acid than a ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

In some embodiments, the one or more apertures of the first region may comprise at least one or more different a ₀ Each A ₀ Selectivity for different target sequences, and each A ₀ Including the identification area.

In some embodiments, the pores of the second region may comprise:

dNTP；

a buffer;

amplifying the enzyme;

Embodiments of the invention may comprise one or more blocking oligonucleotides in one or more regions comprising dntps, buffers, amplification enzymes, and the like.

In some embodiments, one or more pores of the second region may further comprise one or more oligonucleotide-binding dyes or molecular probes.

In some embodiments, the amplification enzyme and pyrophosphorolysis enzyme of the device are the same.

In some embodiments, the pores of the second region further comprise:

-one or more ligases.

In some embodiments, the pores of the second region may comprise:

-ligating probe oligonucleotide C;

-splint oligonucleotide D;

wherein C has a 5 'phosphate, the 3' end of splint oligonucleotide D is 5 'to C'The ends are complementary, and the 5' end of D is complementary to A ₁ Is complementary to the 3' end of (A) such that A ₁ And C can be linked together to form oligonucleotide A ₂ 。

In some embodiments, the apertures of the second region may further comprise:

In some embodiments, the pores of the second region may also contain more than one HO1 and HO2.

In some embodiments, the apertures of the second region may further comprise:

-a substrate comprising a fluorophore-quencher pair;

In some embodiments, the pore of the second region may comprise a partially double-stranded nucleic acid construct, wherein:

The other strand comprises at least one quencher, and wherein the region of the strand is complementary to A ₂ Is complementary to a region adjacent to the region complementary to the substrate strand such that in the presence of A ₂ In the case of (2), a partial double strandBecomes substantially more double stranded.

In some embodiments, the well of the second region may further comprise an enzyme for removing at least one RNA base.

In some embodiments, the one or more apertures of the second region may further comprise:

and A is a ₂ An oligonucleotide comprising one or more fluorophores arranged such that their fluorescence is quenched by their proximity to each other or by their proximity to one or more fluorescence quenchers;

double-strand specific DNA digestive enzymes;

wherein in the presence of A ₂ In the presence of a quencher, the labeled oligonucleotides are digested such that the fluorophores are separated from each other or from their corresponding quenchers, and the fluorescent signal, and thus A ₂ Is detectable.

In some embodiments, the fluorophore is selected from the group consisting of a fluorescein family, a carboxyrhodamine family, a cyanine family, a rhodamine family, a polyhalofluorescein family dye, a hexachlorofluorescein family dye, a coumarin family dye, an oxazine family dye, a thiazine family dye, a squaraine family dye, and a chelate lanthanide dye.

In some embodiments, the fluorophore of the device may be selected from any commercially available dye.

In some embodiments, the quencher of the device is selected from the group consisting of Black Hole under the trade name ^TM 、Eclipse ^TM 、Dark、Qx1J、Iowa Black ^TM Those provided by ZEN and/or TAO.

In some embodiments, the quencher of the device may be selected from any commercially available quencher.

In some embodiments, the one or more wells of the second region may further comprise one or more partially double-stranded DNA constructs, wherein each construct comprises one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are positioned in sufficient proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

In some embodiments, the construct comprises one primer of a primer pair.

In some embodiments, one or more of the wells of the second region may further comprise the other primer of the primer pair.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct, displaying a ₂ . The primer is then extended against the construct, displacing the self-complementary region. Thus, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicative of a ₂ Is present.

In such embodiments, the construct may be referred to as a sunrise primer.

In some embodiments, the construct comprises two separate DNA strands.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct, displaying a ₂ . The primer is then extended against the construct in the direction of the double stranded segment, displacing the shorter DNA strand, and thus the one or more fluorophores and one or more dyes are chargedSeparation to detect fluorescent signals, indicative of A ₂ Is present.

In such embodiments, the construct may be referred to as a molecular zipper.

In some embodiments, one or more pores of one or more regions may further comprise pyrophosphatase.

In some embodiments, one or more wells of one or more regions of the device may further comprise a phosphatase or phosphohydrolase.

In some embodiments, one or more wells of the first region of the device may further comprise an enzyme for forming DNA from the RNA template.

In some embodiments, the enzyme is a reverse transcriptase.

In some embodiments, the one or more enzymes present in the device are hot-started.

In some embodiments, one or more enzymes present in the device are thermostable.

In some embodiments, the first region and the second region of the device are combined.

In some embodiments of the present invention, there is provided an apparatus comprising:

-at least one fluid channel between a first region, a second region and a third region, wherein the first region comprises one or more holes, wherein each hole comprises:

-dNTP；

at least one single stranded primer oligonucleotide;

-an amplifying enzyme for initially amplifying DNA present in the sample; and is also provided with

-pyrophosphorolysis enzyme capable of reacting with pyrophosphorolysis enzyme from A ₀ Digestion of the first intermediate in the 3'-5' direction from the end of (a) to yield partially digested strand A ₁ The method comprises the steps of carrying out a first treatment on the surface of the And is also provided with

-dNTP；

-a buffer;

-optionally an amplification enzyme;

-optionally for detecting a signal derived from a ₂ Or a part thereof, or A ₂ Means for signaling more than one copy of the signal of the more than one copy or portion thereof; and is also provided with

In some embodiments, the pores of the second region comprise:

-dNTP；

-one or more single stranded primer oligonucleotides;

-an amplifying enzyme for initially amplifying DNA present in the sample;

wherein one or more of the primers has a non-complementary 5' tail.

In some embodiments, one or more primers have a 5' phosphate.

In some embodiments, one or more primers are 5' protected.

In some embodiments, pyrophosphorolytic enzymes present in the pores of the second region are carried through to the pores of the third region, where Kong Zhongjiao phosphohydrolase in the third region proceeds A in the presence of dNTPs and a suitable buffer ₂ Is amplified by (a) and (b).

In some embodiments, each well of the second or third region may further comprise a ligase.

In some embodiments, dntps may be hot-started.

In some embodiments, each well of the second region may further comprise a phosphatase or a phosphohydrolase.

In some embodiments, the pyrophosphatase is hot-started.

-dNTP；

-a buffer;

-an amplification enzyme; and

-optionally dntps;

-optionally an amplification enzyme;

-a buffer; and

-a labelled oligonucleotide probe.

In some embodiments, a is performed using pyrophosphorolytic enzyme present in the pores of the second region in the presence of dntps and a suitable buffer ₂ Is amplified by (a) and (b).

In some embodiments, the first region may be fluidly connected to the sample container via a fluid interface.

-at least one fluid channel between a first region, a second region, a third region and a fourth region, wherein the first region comprises one or more wells, wherein each well comprises means for selectively modifying a nucleic acid;

-dNTP；

at least one single stranded primer oligonucleotide;

Wherein the fourth region comprises one or more apertures, wherein each aperture comprises:

-dNTP；

-a buffer;

-optionally an amplification enzyme;

-for detecting a source derived from a ₂ Or a part thereof, or A ₂ Means for signaling more than one copy of the signal of the more than one copy or portion thereof; and is also provided with

Wherein the apertures of the third region or the apertures of the fourth region further comprise at least one of the groups A ₀ Single stranded primer oligonucleotides substantially complementary to portions of (a)And (3) acid.

In some embodiments, the means for selectively modifying a nucleic acid may be a chemical capable of converting an unmodified cytosine base in a target polynucleotide sequence.

In some embodiments, the means for selectively modifying a nucleic acid may be an enzyme capable of converting an unmodified cytosine base in a target polynucleotide sequence.

In some embodiments, the pores of the second or third region may further comprise a restriction endonuclease.

In some embodiments, the region located between the first and second regions may be a region comprising one or more pores, wherein each pore may comprise a restriction endonuclease.

In some embodiments, the restriction endonuclease can recognize a sequence in the target polynucleotide sequence that is produced by chemical or enzymatic conversion of an unmodified cytosine base.

In some embodiments, the sequence that can be recognized by the restriction endonuclease in the target polynucleotide sequence is removed by chemical or enzymatic conversion of the unmodified cytosine base.

In some embodiments, the restriction endonuclease may be a methylation sensitive or methylation dependent restriction endonuclease.

In some embodiments, the well of the second region may comprise reagents for modification-specific multiplex ligation-dependent probe amplification (MS-MLPA) of epigenetic-modified DNA.

In some embodiments, the region located between the first and second regions may be a region comprising one or more wells, wherein each well may comprise reagents for PCR.

In some embodiments, the region located between the first and second regions can be a region comprising one or more wells, wherein each well can comprise an agent for reducing the population of epigenetic modified or unmodified target sequences.

In some embodiments, the agent for reducing the population of epigenetic modified or unmodified target sequences is an agent for immunoprecipitation of epigenetic modified DNA, optionally immunoprecipitation of methylated DNA (MeDIP).

In some embodiments, the agent for reducing the population of epigenetically modified or unmodified target sequences is a methyl binding protein, such as MBD2b or MBD2b/MBD3L1 complex.

In some embodiments, an agent for reducing the population of epigenetic modified or unmodified target sequences is located within one or more wells of the first region.

In some embodiments of the present device, the epigenetic modification may be methylation. In some embodiments, it may be methylation at CpG islands. In some embodiments, it may be a methylolation at a CpG island.

In some embodiments, the apertures of the second, third or fourth regions may comprise:

-dNTP；

-at least one single stranded primer oligonucleotide; and

-an amplification enzyme.

In some embodiments, the dntps of each well may be dUTP, dGTP, dATP and dCTP, and each well may further comprise a dUTP-doped high-fidelity polymerase and uracil-DNAN-glycosidase (UDG).

In some embodiments, each well may further comprise a source of pyrophosphate ions.

In some embodiments, a ₀ The 5' end of (c) may be rendered resistant to 5' -3' exonuclease digestion and the pore of the second or third region may also contain a 5' -3' exonuclease.

In some embodiments, each well of the third or fourth region may further comprise a ligase.

In some embodiments, each well of the third region or the fourth region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

Splint oligoNucleotide D may comprise a nucleotide sequence identical to A ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

In some embodiments, dntps may be hot-started.

In some embodiments, each well of the third region may further comprise a phosphatase or a phosphohydrolase.

In some embodiments, each well of the third region may further comprise pyrophosphatase.

In some embodiments, each well of the fourth region may further comprise pyrophosphatase.

In some embodiments, the pyrophosphatase is hot-started.

In some embodiments, each well of the fourth region may further comprise one or more oligonucleotide-binding dyes or molecular probes.

In some embodiments, each well of the third region may comprise at least one or more different a selective for the target sequence ₀ ，A ₀ Including the identification area.

In some embodiments, the amplification enzyme in the fourth region and the pyrophosphorolysis enzyme in the third region may be the same, and thus in some embodiments, no amplification enzyme is required in the fourth region.

In some embodiments, there may be a fifth region comprising one or more pores, wherein each pore may comprise a protease, and wherein the fifth region may be located between the first region and the second region.

In some embodiments, the fifth region may be located between the second and third regions.

In some embodiments, the third region and the fourth region of the device may be combined such that the wells of the third region further comprise:

-dNTP；

-a buffer;

-an amplification enzyme; and

In some embodiments, the means for detecting a signal is located within the third region.

In some embodiments, the means for detecting a signal is located in an adjacent region.

In some embodiments, the apertures of the third or fourth regions may further comprise:

-one or more ligases.

In some embodiments, the pores of the third region may comprise:

-ligating probe oligonucleotide C;

-splint oligonucleotide D;

wherein C has a 5 'phosphate, the 3' end of the splint oligonucleotide D is complementary to the 5 'end of C, and the 5' end of D is complementary to A ₁ Complementary to the 3' end of A ₁ And C is capable of ligating to form oligonucleotide A ₂ 。

In some embodiments, the aperture of the third region may further comprise:

In some embodiments, the pores of the third region may also contain more than one HO1 and HO2.

In some embodiments, the aperture of the third region may further comprise:

-a substrate comprising a fluorophore-quencher pair;

In some embodiments, the pore of the third region may comprise a partially double-stranded nucleic acid construct, wherein:

In some embodiments, the well of the third region may further comprise an enzyme for removing at least one RNA base.

In some embodiments, the one or more apertures of the third region may further comprise:

double-strand specific DNA digestive enzymes;

In some embodiments, the well of the third region may comprise one or more partially double-stranded DNA constructs, wherein each construct comprises one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are positioned in sufficient proximity to each other such that sufficient quenching of the one or more fluorophores occurs.

In some embodiments, the construct comprises one primer of a primer pair.

In some embodiments, the well of the third region may further comprise the other primer of the primer pair.

In such embodiments, the construct may be referred to as a sunrise primer.

In some embodiments, the construct comprises two separate DNA strands.

In some embodiments, the portion of the single stranded segment of the construct is identical to a ₂ Hybridization and targeting A by DNA polymerase ₂ Extending. In some embodiments, the other primer of the primer pair is then hybridized to the extended construct, displaying a ₂ . The primer is then extended against the construct in the direction of the double stranded segment, displacing the shorter strand of the DNA strand, and thus the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal, indicative of a in the reaction mixture ₂ Is present.

In such embodiments, the construct may be referred to as a molecular zipper.

In some embodiments, one or more wells of the second region of the device may further comprise an enzyme for transcription of RNA into DNA.

In some embodiments, the enzyme is a reverse transcriptase.

In some embodiments, the second region and the third region of the device are combined.

In some embodiments, the third region and the fourth region of the device are combined.

In some embodiments, one or more fluid channels are positioned between one or more apertures of one region and/or between one or more regions of the device.

In some embodiments, heating and/or cooling elements may be present in one or more areas of the device.

In some embodiments, heating and/or cooling may be applied to one or more regions of the apparatus.

In some embodiments, each region of the device may independently comprise at least 100 or 200 wells.

In some embodiments, each region of the device may independently comprise between about 100 and 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more wells. The holes may be of any shape and their locations may be arranged in any format or pattern on the substrate.

In some embodiments, the pore substrate may be composed of a metal (e.g., gold, platinum, or nickel alloy, as non-limiting examples), ceramic, glass, or other PCR-compatible polymeric material or composite material. The aperture substrate includes more than one aperture.

In some embodiments, the holes may be formed in the hole substrate as blind holes or through holes. For example, the holes may be created in the hole substrate by laser drilling (e.g., an excimer laser or a solid state laser), ultrasonic imprinting, hot imprint lithography, electroforming nickel molds, injection molding, and injection molding.

In some embodiments, the individual pore volume may be in the range of 0.1nl to 1500 nl. In one embodiment, 0.5nL to 50nL. Each well can have about 0.1nL, 0.2nL, 0.3nL, 0.4nL, 0.5nL, 0.6nL, 0.7nL, 0.8nL, 0.9nL, 1nL, 1.5nL, 2nL, 2.5nL, 3nL, 3.5nL, 4nL, 4.5nL, 5nL, 5.5nL, 6nL, 6.5nL, 7nL, 7.5nL, 8nL, 8.5nL, 9nL, 9.5nL, 10nL, 11nL, 12nL, 13nL, 14nL, 15nL, 16nL, 17nL, 18nL, 19nL, 20nL, 18nL, a volume of 25nL, 30nL, 35nL, 40nL, 45nL, 50nL, 55nL, 60nL, 65nL, 70nL, 75nL, 80nL, 85nL, 90nL, 95nL, 100nL, 110nL, 120nL, 130nL, 140nL, 150nL, 160nL, 170nL, 180nL, 190nL, 200nL, 225nL, 250nL, 275nL, 300nL, 325nL, 350nL, 375nL, 400nL, 425nL, 450nL, 475nL, or 500 nL.

In some embodiments, the aperture dimension (dimension) may have any shape, for example, circular, elliptical, square, rectangular, oval, hexagonal, octagonal, conical, and other shapes known to those skilled in the art.

In some embodiments, the aperture shape may have a cross-sectional area that varies along the axis. For example, the square aperture may taper from a first size to a second size that is a fraction of the first size.

In some embodiments, the hole dimensions may be square, with approximately equal diameters and depths.

In some embodiments, the walls defining the aperture may be non-parallel.

In some embodiments, the walls defining the aperture may converge to a point. The pore dimensions can be derived from the total volume of the pore substrate.

In some embodiments, the pore depth may be in the range of 25 μm to 1000 μm.

In one embodiment, the pores may have a depth of 25 μm, 50 μm, 75 μm, 100 μm, 150 μm, 200 μm, 250 μm, 300 μm, 350 μm, 400 μm, 450 μm, 500 μm, 550 μm, 600 μm, 650 μm, 700 μm, 750 μm, 800 μm, 850 μm, 900 μm, 950 μm, or 1000 μm.

In some embodiments, the pore diameter may be in the range of about 25 μm to about 500 μm.

In some embodiments, the pores may have a width of 25 μm, 50 μm, 75 μm, 100 μm, 125 μm, 150 μm, 175 μm, 200 μm, 225 μm, 250 μm, 275 μm, 300 μm, 325 μm, 350 μm, 375 μm, 400 μm, 425 μm, 450 μm, 475 μm, or 500 μm.

In some embodiments, portions of one or more regions of the device may be modified to promote or prevent fluid adhesion. The surfaces defining the pores may be coated with a hydrophilic material (or modified to be hydrophilic) and thereby promote retention of the fluid.

In some embodiments, portions of one or more regions of the device may be coated with a hydrophobic material (or modified to be hydrophobic) and thereby inhibit fluid from remaining thereon. Those skilled in the art will appreciate that other surface treatments may be performed so that the fluid is preferably held within the pores rather than at the upper surface in order to facilitate drainage of excess fluid.

In some embodiments, the holes of the hole substrate may be patterned to have a simple geometric pattern of aligned rows and columns, or in a pattern of diagonal or hexagonal arrangements. In one embodiment, the holes of the hole substrate may be patterned to have a complex geometric pattern, such as a chaotic pattern or an isogeometric design pattern.

In some embodiments, the pores may be geometrically separated from each other and/or have a large aspect ratio (depth to width ratio) to help prevent cross-contamination of reagents.

In some embodiments, the apparatus may include one or more auxiliary zones that may be used to provide a processing fluid (process fluid), such as oil or other chemical solution, to one or more zones of the apparatus. Such auxiliary areas may be fluidly connected to one or more areas of the device by one or more membranes, valves and/or pressure-separable substrates (i.e., materials that rupture when subjected to a predetermined amount of pressure from the fluid within the auxiliary area or adjacent portion of the fluid channel), such as metal foils or films.

In some embodiments, the fluid channel of the device may include a broad tortuous portion. The tortuous path between the inlet channel of the fluid channel and one or more regions of the apparatus helps control and treat fluid processing. The tortuous path may help reduce the formation of bubbles that may interfere with the flow of oil through the fluid passage.

In some embodiments, the device may further comprise a gas permeable membrane that enables gas to be vented from the pores of one or more regions of the device without allowing fluid to pass through. The gas permeable membrane may be adhered to the porous substrate of the device by a gas permeable adhesive. In one embodiment, the membrane may be made of Polydimethylsiloxane (PDMS) and have a thickness in the range of 20 μm to 1000 μm. In some embodiments, the film may have a thickness in the range of 100 μm to 200 μm.

In some embodiments, all or part of the pore substrate may contain a conductive (e.g., gold) metal portion to enable heat transfer from the metal to the pores. In one embodiment, the inner surfaces of the holes may be coated with a metal to effect heat transfer.

In some embodiments, an insulating oil or thermally conductive liquid may be applied to the device to prevent cross-talk after the appropriate reagents have filled the pores of one or more areas of the device.

In some embodiments, the apertures of one or more regions of the device may be shaped to taper from a large diameter to a smaller diameter, similar to a cone. Tapered holes with sloped walls can use a non-contact deposition method of the reagent (e.g., inkjet). The conical shape also aids in drying and has been found to prevent air bubbles and leakage in the presence of a gas permeable membrane.

In some embodiments, the pores of one or more regions of the device may be filled by pushing the sample fluid (e.g., by pressure) along the fluid channel of the device. As the fluid passes through the apertures of one or more regions of the device, each aperture becomes filled with fluid, which is retained within the aperture primarily by surface tension. As previously described, portions of the well substrate of the device may be coated with hydrophilic/hydrophobic substances as needed to promote complete and uniform filling of the well as the sample fluid passes therethrough.

In some embodiments, the pores of one or more regions of the device may be "capped" with oil after filling. This can then help reduce evaporation when the pore substrate is subjected to thermal cycling. In one embodiment, after oil coverage, the aqueous solution may fill one or more areas of the device to improve thermal conductivity.

In some embodiments, the stationary aqueous solution may be pressurized in one or more areas of the apparatus to prevent movement of the fluid and any bubbles.

In some embodiments, an oil, such as mineral oil, may be used to isolate the pores of one or more regions of the device and provide thermal conductivity. However, any thermally conductive liquid may be used, such as a fluorinated liquid (e.g., 3M FC-40). References to oil in this disclosure should be understood to include applicable alternatives as will be appreciated by those skilled in the art.

In some embodiments, the apparatus may further comprise one or more sensor assemblies.

In some embodiments, one or more sensor assemblies may include a Charge Coupled Device (CCD)/Complementary Metal Oxide Semiconductor (CMOS) detector coupled to a Fiber Optic Faceplate (FOFP). The filter may be laminated on top of the FOPF and placed against or adjacent to the aperture substrate. In one embodiment, the filter may be layered (glued) directly on top of the CCD, with the FOPF placed on top.

In some embodiments, a hydrating fluid, such as distilled water, may be heated in one of the first or auxiliary zones such that one or more zones of the device have a humidity of up to 100%, or at least sufficient humidity to prevent excessive evaporation during thermal cycling.

In some embodiments, after filling of the device is completed, the well substrate may be heated by an external device in thermal contact with the device to perform thermal cycling of the PCR.

In some embodiments, non-contact heating methods such as RFID, curie point, induction heating, or microwave heating may be employed. These and other non-contact heating methods will be well known to those skilled in the art. During thermal cycling, the chemical reaction of the device may be monitored by the previously described sensor arrangement.

In some embodiments, the reagents deposited in one or more wells of one or more areas of the device are deposited in a predetermined arrangement.

In some embodiments, a method is provided, the method comprising:

providing a sample fluid to a fluid channel of a device, wherein the device comprises at least one fluid channel between a first region, a second region, and a third region, wherein the first region, the second region, and the third region independently comprise one or more apertures;

filling the second region with an amplification fluid from the first region such that one or more wells of the second region are covered by the amplification fluid;

withdrawing the amplification fluid from the second zone such that one or more wells remain wetted by at least some of the amplification fluid;

Filling the third region with fluid drawn from the second region such that one or more apertures of the third region are covered by the fluid; and

fluid is drawn from the third chamber such that the one or more apertures remain wetted by at least some of the fluid.

In some embodiments of the method, the fluid channel may be valveless.

In some embodiments of the method, the extracted second region may be filled with a hydrophobic substance.

In some embodiments of the method, the extracted third region may be filled with a hydrophobic substance.

In some embodiments of the method, the hydrophobic substance may be supplied from an oil chamber in fluid communication with the second region and the third region.

In some embodiments of the method, the sample fluid may travel along the fluid channel in a serpentine manner.

In some embodiments, the method may further comprise applying a heating and cooling cycle to one or more of the first region, the second region, or the third region.

Various additional aspects and embodiments of the invention will be apparent to those skilled in the art in view of this disclosure.

As used herein, "and/or" should be considered as a specific disclosure of each of two specified features or components with or without the other. For example, "a and/or B" should be considered as a specific disclosure of each of (i) a, (ii) B, and (iii) a and B, as if each were individually listed herein.

Unless the context indicates otherwise, the descriptions and definitions of the features listed above are not limited to any particular aspect or embodiment of the invention, and apply equally to all aspects and embodiments described.

It will be further understood by those skilled in the art that while the present invention has been described by way of example with reference to several embodiments, the invention is not limited to the embodiments disclosed and that alternative embodiments may be established without departing from the scope of the invention as defined in the appended claims.

As used herein, a "magnetic particle" is a magnetically responsive particle that is attracted by a magnetic field. The magnetic particles used in the method of the invention comprise a magnetic metal oxide core, which is typically surrounded by a polymer coating that creates a surface to which DNA, RNA or PNA can bind. The magnetic metal oxide core is preferably iron oxide, wherein the iron is Fe ²⁺ And Fe (Fe) ³⁺ Is a mixture of (a) and (b). Preferred Fe ²⁺ /Fe ³⁺ The ratio is preferably 2/1, but may vary from about 0.5/1 to about 4/1And (5) melting.

Those skilled in the art will appreciate that when the term "infer" is used, for example, "infer the presence or absence of a particular sequence" refers to that based on A ₂ Or A ₂ Or A ₂ Or A ₂ The presence or absence of copies of the region of (c) to determine the presence or absence of a particular feature.

Those skilled in the art will appreciate that embodiments in which "primers" are described include within their scope primers as previously or subsequently described in this document.

Those of skill in the art will understand that embodiments in which a "primer" is described as being located within a particular region/well of a device or being present in a particular reaction mixture include within its scope embodiments in which one or more blocking oligonucleotides (as previously or subsequently described) are also present within the same region/well or reaction mixture.

Those skilled in the art will appreciate that "Single-stranded Probe oligonucleotide A" therein ₀ Embodiments described as being located within a particular region/well of a device or being present in a particular reaction mixture include within their scope embodiments in which one or more blocking oligonucleotides (as previously or subsequently described) are also present.

Example 1: detection of EGFR exon 19cosm12384 mutation

In this example, different concentrations of blocking oligonucleotide were used in the initial PCR amplification.

PCR amplification

A mixture was prepared, which corresponds to:

1x Q5U buffer

200nM primer mix 1

20U/mL Q5U polymerase

10U/mL thermolabile UDG

0.4ng/uL fragmented human genomic DNA

+/-0.2aM mutant oligonucleotides

Blocking oligonucleotides of 0-300nM

Total volume of 50uL

Q5 buffer

The Q5 buffer is available from commercial suppliers NEB.

Primer mixture 1:

FWD(SEQ ID NO 1)：

5’-C*C*C*AACCAAGCTCTCTTGAGGATCTTG-3’

REV(SEQ ID NO 2)：

5’-/5Phos/GGGACCTTACCTTATACACCGTGCCG-3’

FWD(SEQ ID NO 3)：

5’-G*C*C*TCCCTCGCGCCATCAGAAGGTGAGAAAGTTAAAATTCCCGTC-3’

REV(SEQ ID NO 4)：

5’-/5Phos/GCCTTGCCAGCCCGCTCAGACAGCAAAGCAGAAACTCACATCG-3’

FWD(SEQ ID NO 5)：

5’-G*C*C*TCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3’

REV(SEQ ID NO 6)：

5’-/5Phos/GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGAC-3’

FWD(SEQ ID NO 7)：

5’-G*A*A*GCCACACTGACGTGCCTCTC-3’

REV(SEQ ID NO 8)：

5’-/5Phos/AGGCAGATGCCCAGCAGGCGGCA-3’

FWD(SEQ ID NO 9)：

5’-A*C*G*TACTGGTGAAAACACCGCAG-3’

REV(SEQ ID NO 10)：

5’-/5Phos/GCCTCCTTCTGCATGGTATTCTTT-3’

FWD(SEQ ID NO 11)：

5’-G*C*C*TCCCTCGCGCCATCAGAATGACTGAATATAAACTTGTGGTAGTTGGAG-3’

REV(SEQ ID NO 12)：

5’-/5Phos/GCCTTGCCAGCCCGCTCAGGAATTAGCTGTATCGTCAAGGCACTCTTG-3’

FWD(SEQ ID NO 13)：

5’-C*T*G*GTCCCTCATTGCACTGTACTCC-3’

REV(SEQ ID NO 14)：

5’-/5Phos/AGAAACCTGTCTCTTGGATATTCTCGACAC-3’

FWD(SEQ ID NO 15)：

5’-/5Phos/GCCTCCCTCGCGCCATCAGCCACAAAATGGATCCAGACAACTGTTCAAA-3’

REV(SEQ ID NO 16)：

5’-G*C*C*TTGCCAGCCCGCTCAGTCTTCATGAAGACCTCACAGTAAAAATAGGTGA-3’

FWD(SEQ ID NO 17)：

5’-/5Phos/CCCCCAGCCCTCTGACGTCC-3’

REV(SEQ ID NO 18)：

5’-A*T*C*TTCTGCTGCCGTCGCTTGA-3’

FWD(SEQ ID NO 19)：

5’-T*A*C*CCTTGTCCCCAGGAAGCATA-3’

REV(SEQ ID NO 20)：

5’-/5Phos/ATGCCCAGAAGGCGGGAGACAT-3’

mutant oligonucleotide (SEQ ID NO 21):

5’-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGTTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3’

blocking oligonucleotide (SEQ ID NO 22):

5’-/5Phos/CTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGG/3InvdT/-3’

wherein represents a phosphorothioate linkage,/5 Phos/represents a 5 'terminal phosphate,/3 InvdT/represents a 3' terminal inverted dT

The mixture was then incubated:

b. proteinase K treatment

A mixture was prepared, which corresponds to:

0.44 Xproteinase K buffer

20U/mL proteinase K

40uL mixture of Point a

Total volume of 90uL

1x proteinase K buffer composition

Tris acetate ph=8.0.10 mm

Potassium acetate 25mM

Magnesium acetate 5mM

Tween-20 0.1％

The mixture was then incubated at 55℃for 5min and at 95℃for 10min.

c. Pyrophosphorolysis (PPL) and ligation

A mixture was prepared, which corresponds to:

1xBFF6

20U/mL Klenow(exo-)

100U/mL E.coli (E.coli) ligase

2U/mL apyrase (apyrase)

100U/mL Lambda exo

0.5mM PPi

20 nM probe oligonucleotides

30 nM splint oligonucleotides

2.2uL of the mixture from point b.

Total volume of 10uL

1xBFF6 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Tween-20 0.1％

Probe (SEQ ID NO 23):

5’-/5Phos/A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGAGCTTTCGGAACCTTGATA-3’

splint oligonucleotide (SEQ ID NO 24):

5’-TGTCAAAGCTCATCGAACATTTCCGAAAGCCATCGG-3’

wherein represents a phosphorothioate linkage,/5 Phos/represents a 5' -terminal phosphate

The mixture was then incubated at 45℃for 30min.

d. detection-RCA

A mixture corresponding to the following was prepared:

isothermal buffer (53.2 mM Tris-HCl,26.6mM (NH) ₄ ) ₂ SO ₄ ，133mM KCl，5.32mM MgSO ₄ ，0.266％Tween-20，pH 8.8)

0.28uM primer mix 2

284.4U/mL BST 2.0WarmStart

14.67U/mLTIPP

1.06mM dNTP

Syto82 dye 3uM

1.2uL of reaction mixture from point c.

Total volume of 11.2uL

Primer mixture 2:

FWD(SEQ ID NO 25)：

5'-T*C*GCAACATCCTATATCTGC-3’

REV(SEQ ID NO 26)：

5'-T*G*AGCTTTGACAATACTTGA-3’

wherein represents phosphorothioate linkages

The mixture was then incubated at 60℃for 90min. Fluorescence measurements were performed every 1 minute. The results are shown in fig. 1. The results show that the higher the blocking oligonucleotide concentration, the greater the difference between the Cq values for 0% and 0.1% af.

Example 2: the blocking oligonucleotide was introduced after initial PCR amplification followed by a combined pyrophosphorolysis and ligation step, and detection of 0.1% af t790m.

PCR amplification

A mixture was prepared, which corresponds to:

1x Q5U buffer

200nM primer mix 1 (example 1, SEQ ID NO 1-20)

20U/mL Q5U polymerase

10U/mL thermolabile UDG

0.4ng/uL fragmented human genomic DNA

+/-0.2aM mutant oligonucleotides

Total volume of 50uL

The mixture was then incubated:

Q5 buffer

The Q5 buffer is available from commercial suppliers NEB.

Mutant oligonucleotide (SEQ ID NO 27):

5’-CATCTGCCTCACCTCCACcgTgcagcTcaTcaTgcagcTcaTgcccTTcggcTgccTccTggacTaTgTCCGGGAACACAAAGACAATAT-3’

b. Proteinase K treatment

A mixture was prepared, which corresponds to:

0.44 Xproteinase K buffer

20U/mL proteinase K

40uL mixture of Point a

Total volume of 90uL

The mixture was then incubated at 55℃for 5min and at 95℃for 10min.

1x proteinase K buffer composition

Tris acetate ph=8.0.10 mm

Potassium acetate 25mM

Magnesium acetate 5mM

Tween-20 0.1％

c. Annealing of blocking oligonucleotides

2.2uL mixtures of Point b

30nM blocking oligonucleotides

Total volume 5uL

The mixture was then incubated at 95℃for 5min and cooled to 4 ℃.

Blocking oligonucleotide (SEQ ID NO 28):

5’-A*TGAGCTGCGTGATGAG*G*A*A-3’

wherein represents phosphorothioate linkages

d. Pyrophosphorolysis (PPL) and ligation

A mixture was prepared, which corresponds to:

1xBFF6

20U/mL Klenow(exo-)

coli ligase of 100U/mL

2U/mL apyrase

100U/mL Lambda exo

0.5mM PPi

10nM probe oligonucleotide

15nM splint oligonucleotide

5uL of the mixture from point c.

Total volume of 10uL

The mixture was then incubated at 45℃for 30min.

1xBFF6 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Tween-20 0.1％

Probe (SEQ ID NO 29):

5’-/5Phos/A*T*G*TTCGATGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATG-3’

splint oligonucleotide (SEQ ID NO 30):

5’-CAAAGCTCATCGAACATATGCCCTTCGCAACT/3InvdT/-3’

Wherein represents a phosphorothioate linkage,/5 Phos/represents a 5 'terminal phosphate,/3 InvdT/-represents a 3' terminal inverted dT

e. detection-RCA

A mixture corresponding to the following was prepared:

0.28uM primer mix 2 (example 1,SEQ ID NO 25&26)

284.4U/mLBST 2.0WarmStart

14.67U/mLTIPP

1.06mM dNTP

Syto82 dye 3uM

1.2uL of reaction mixture from point d.

Total volume of 11.2uL

The mixture was then incubated at 60℃for 90min. Fluorescence measurements were performed every 1 minute. The results can be seen in fig. 2. The difference between the Cq values of 0% and 0.1% af increased when blocking oligonucleotides were present.

Example 3: different concentrations of blocking oligonucleotides fully complementary to target sequences were used in the method of detecting 0.1% AF T790M

PCR amplification

A mixture was prepared, which corresponds to:

1x Q5U buffer

200nM primer mix 1 (e.g.1SEQ ID NO 1-20)

20U/mL Q5U polymerase

10U/mL thermolabile UDG

0.4ng/uL fragmented human genomic DNA

+/-0.2aM mutant oligonucleotides (example 2, SEQ ID NO 27)

Total volume of 50uL

The mixture was then incubated:

q5 buffer

The Q5 buffer is available from commercial suppliers NEB.

b. Proteinase K treatment

A mixture was prepared, which corresponds to:

0.44 Xproteinase K buffer

20U/mL proteinase K

40uL mixture of Point a

Total volume of 90uL

The mixture was then incubated at 55℃for 5min and at 95℃for 10min.

1x proteinase K buffer composition

Tris acetate ph=8.0.10 mm

Potassium acetate 25mM

Magnesium acetate 5mM

Tween-20 0.1％

c. Annealing of blocking oligonucleotides

2.2uL mixtures of Point b

Blocking oligonucleotides of 0-120nM

Total volume 5uL

The mixture was then incubated at 95℃for 5min and cooled to 4 ℃.

Blocking oligonucleotide (SEQ ID NO 31):

5’-A*GCCGAAGAGCATGAGCTGCATGATG-3’

wherein represents phosphorothioate linkages

d. Pyrophosphorolysis (PPL) and ligation

A mixture was prepared, which corresponds to:

1xBFF6

20U/mL Klenow(exo-)

coli ligase of 100U/mL

2U/mL apyrase

100U/mL Lambda exo

0.5mM PPi

10nM probe oligonucleotide (example 2, SEQ ID NO 29)

15nM splint oligonucleotide (example 2, SEQ ID NO 30)

5uL of the mixture from point c.

Total volume of 10uL

The mixture was then incubated at 45℃for 30min.

1xBFF6 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Tween-20 0.1％

e. detection-RCA

A mixture corresponding to the following was prepared:

0.28uM primer mix 2 (example 1,SEQ ID NO 25&26)

284.4U/mLBST 2.0WarmStart

14.67U/mLTIPP

1.06mM dNTP

Syto82 dye 3uM

1.2uL of reaction mixture from point d.

Total volume of 11.2uL

The mixture was then incubated at 60℃for 90min. Fluorescence measurements were performed every 1 minute. The results can be seen in fig. 3. The results show that the presence of blocking oligonucleotides increases the difference between the Cq values for 0% and 0.1% af.

Example 4:

a.PCR

a PCR mixture was prepared, corresponding to:

400nM primer mix 1 or primer mix 2

20U/mL Q5U polymerase

10U/mL thermolabile UDG

0.4ng/uL fragmented human genomic DNA

+/-0.2aM mutant oligonucleotide 1

+/-0.2aM mutant oligonucleotide 2

Total volume: 50uL

Primer mixture 1:

FWD(SEQ ID NO 32)：

5’-A*A*G*TTAAAATTCCCGTCGCTA-3’

REV(SEQ ID NO 33)：

5’-/5Phos/AGCAAAGCAGAAACTCACATCG-3’

primer mixture 2:

FWD(SEQ ID NO 34)：

5’-G*C*C*TCCCTCGCGCCATCAGAAGTTAAAATTCCCGTCGCTA-3’

REV(SEQ ID NO 35)：

5’-/5Phos/GCCTTGCCAGCCCGCTCAGAGCAAAGCAGAAACTCACATCG-3’

mutant oligonucleotide 1 (SEQ ID NO 36):

5’-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3’

mutant oligonucleotide 2 (SEQ ID NO 37):

5’-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3’

The mixture was then incubated as detailed below:

b. proteinase K treatment

A mixture was prepared, which corresponds to:

0.44xA7 buffer

20U/mL proteinase K

40uL mixture of Point a

Total volume of 90uL

1xA7

Tris acetate ph=8.0.10 mm

Potassium acetate 25mM

Magnesium acetate 5mM

Triton-X 100 0.1％

The mixture was then incubated at 55℃for 5min and at 95℃for 10min.

c. Pyrophosphorolysis (PPL) and ligation

A mixture was prepared, which corresponds to:

1xBFF1

20U/mL Klenow(exo-)

coli ligase of 100U/mL

1.2U/mL apyrase

100U/mL Lambda exo

0.25mM PPi

20nM Probe oligonucleotide 1 or Probe oligonucleotide 2

30nM splint oligonucleotide 1 or splint oligonucleotide 2

1.25uL of the mixture from point b.

Total volume of 10uL

1xBFF1 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Triton-X 100 0.1％

Probe oligonucleotide 1 (SEQ ID NO 38):

5’/5Phos/A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGATCGGAGATGTCTTGATAG-3’

splint oligonucleotide 1 (SEQ ID NO 39):

5’-TGTCAAAGCTCATCGAACATACATCTCCGAAATCGG-3’

probe oligonucleotide 2 (SEQ ID NO 40):

5’/5Phos/A*T*G*TTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACGGAGATGTTGCTTCCTTGA-3’

splint oligonucleotide 2 (SEQ ID NO 41):

5’-TGTCAAAGCTCATCGAACATCAACATCTCTCGCAAG-3’

The mixture was then incubated at 45℃for 15min.

d. detection-RCA

A mixture corresponding to the following was prepared:

0.28uM primer mix 2 (example 2,SEQ ID NO 25&26)

284.4U/mL BST 2.0WarmStart

14.67U/mL TIPP

1.06mM dNTP

Syto82 dye 3uM

1.25uL of reaction mixture from point c.

Total volume of 11.25uL

The mixture was then incubated at 60℃for 90min. Fluorescence measurements were performed every 1 minute. The results can be seen in fig. 13.

Example 5 shows data of the effect of Blocking Oligonucleotides (BO) added before or during the PPL step:

a mixture was prepared, which corresponds to:

200nM primer mix 1 (example 1, SEQ ID NO 1-20)

20U/mL Q5U polymerase

10U/mL thermolabile UDG

0.4ng/uL fragmented human genomic DNA

+/-0.2aM mutant oligonucleotides (e.g.example 1, SEQ ID NO 21)

Total volume of 50uL

The mixture was then incubated:

b. proteinase K treatment

A mixture was prepared, which corresponds to:

0.44 Xproteinase K buffer

20U/mL proteinase K

40uL mixture of Point a

Total volume of 90uL

The mixture was then incubated at 55℃for 5min and at 95℃for 10min.

1x proteinase K buffer composition

Tris acetate ph=8.0.10 mm

Potassium acetate 25mM

Magnesium acetate 5mM

Tween-20 0.1％

c. Addition of blocking oligonucleotides prior to the PPL step

c.1. Annealing of blocking oligonucleotides

2.2uL mixtures of Point b

30nM blocking oligonucleotide (example 3, SEQ ID NO 31)

Total volume 5uL

The mixture was then incubated at 95℃for 5min and cooled to 4 ℃.

c.2. Pyrophosphorolysis (PPL) and ligation

A mixture was prepared, which corresponds to:

1xBFF6

20U/mL Klenow(exo-)

coli ligase of 100U/mL

2U/mL apyrase

100U/mL Lambda exo

0.5mM PPi

5nM of each probe oligonucleotide

10nM of each splint oligonucleotide

5uL c.1. Mixture

Total volume of 10uL

The mixture was then incubated at 45℃for 30min.

1xBFF6 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Tween-20 0.1％

T790M probe (SEQ ID NO 42): 5'-/5Phos/a T G TTCGATGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATG-3'

T790M splint oligonucleotide (SEQ ID NO 43): 5'-CAAAGCTCATCGAACATATGCCCTTCGCAACT/3InvdT/-3'

G719x_6239 probe (SEQ ID NO 44): 5'/5Phos/A T G TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGAAACGCACCGGAGGCCAGCACTTTG-3'

G719x_6239 splint oligonucleotide (SEQ ID NO 45): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAA-3'

G719x_6252 probe (SEQ ID NO 46): 5'/5Phos/C TGTCCAGTGAGCTTTGACAATACTTGACATGCCGAGTAATGAGAGTTTCGCAAACGCACCGGAGCTCAGCACTTTG-3'

G719x_6252 splint oligonucleotide (SEQ ID NO 47): 5'-TGTCAAAGCTCACTGGACAGCCGGTGCGTTCGGCAA-3'

G719x_6253 probe (SEQ ID NO 48): 5'/5Phos/A CCTGATCTGAGCTTTGACAATACTTGACATGCGAGCAATTAGGTAGTGTCGTAACGCACCGGAGCACAGCACTTTG-3'

G719x_6253 splint oligonucleotide (SEQ ID NO 49): 5'-TGTCAAAGCTCAGATCAGGTCCGGTGCGTTCGGCAA-3'

d. Addition of blocking oligonucleotides during the PPL step

A mixture was prepared, which corresponds to:

1xBFF6

20U/mL Klenow(exo-)

coli ligase of 100U/mL

2U/mL apyrase

100U/mL Lambda exo

0.5mM PPi

5nM probe oligonucleotide (example 5 step c, SEQ ID NOs 42, 44, 46, 48)

10nM splint oligonucleotide (example 5 step c, SEQ ID NOs 43, 45, 47, 49)

2.2uLb. Mixtures

30nM blocking oligonucleotide (example 3, SEQ ID NO 31)

Total volume of 10uL

The mixture was then incubated at 45℃for 30min.

1xBFF6 composition

Tris acetate ph=7.0.10 mm

Potassium acetate 30mM

Magnesium acetate 17.125mM

Tween-20 0.1％

e. detection-RCA

A mixture corresponding to the following was prepared:

2.66x Thermopol(53.2mM Tris-HCl，26.6mM(NH ₄ ) ₂ SO ₄ ，2.66mM KCl，5.32mM MgSO ₄ ，0.266％Tween-20，pH 8.8)

1x primer mix 2

571.4U/mLBST 2.0WarmStart

1.07mM dNTP

1.2uL of reaction mixture from points d or c.

Total volume of 11.2uL

Primer mixture 2 consisted of:

40. Mu.M primer 1 (SEQ ID NO 50): 5'-T G AGCTTTGACAATACTTGA-3'

10. Mu.M primer 2 (SEQ ID NO 51): 5' -/5Cy5/A CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATCGCAACATCCTATATCTGCGC

10. Mu.M primer 3 (SEQ ID NO 52): 5' -/5TEX615/A CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATGCGAAACTCTCATTACTCGGC

10. Mu.M primer 4 (SEQ ID NO 53): 5' -/5HEX/T ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTACGACACTACCTAATTGCTCGC

10. Mu.M primer 5 (SEQ ID NO 54): 5' -/5ATTO488N/T ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTTCGGTGATCAGTCCTCGATG

20. Mu.M primer 6 (SEQ ID NO 55): 5' -TCGATCATGGCGACAGCGATTGTCATGGAGCTGGTCAGT/3 IAbRQSp-

20. Mu.M primer 7 (SEQ ID NO 56): 5' -AGCATACTGCGGACTGCTGTAAGGAGTGAGTCGGTCGTA/3 IABkFQ-

Wherein represents phosphorothioate bond,/5 Cy 5/represents Cy5 dye,/5 TEX615/A represents Texas Red dye,/5 HEX/represents Hex dye,/5 ATTO 488N/represents Atto488 dye,/3 IAbRQSp/represents IowaRQ quencher,/3 IABkFQ/represents Iowa +.>FQ

The mixture was then incubated at 58℃for 120min. Fluorescence measurements were performed in four read channels every 1 minute. The results can be seen in fig. 12.

Example 6: additional applications of the method of the invention

Methylation frequency of Highly Related Methylation Genes (HRMG) in human cancers

/>

Methylation of lung cancer biomarkers

Lung cancer is the leading cause of cancer-related mortality, for a number of reasons, including advanced manifestations of its symptoms and low sensitivity of screening techniques such as chest radiography. DNA fragments shed from tumor cells, which are present in cell-free DNA (cfDNA) isolated from the blood of cancer patients, can provide convenient and minimally invasive access to a portrait of cancer molecules. Cell free circulating tumor DNA (ctDNA) in plasma appears as representative of the entire cancer genome; in many cancer patients, especially in early stages of the disease, the proportion of ctDNA to total cfDNA is as low as 0.05% or less. These properties make aberrant methylation of ctDNA a promising cancer biomarker, and recent high-throughput studies have shown correspondence between methylation profile changes of ctDNA and DNA from paired tumor tissue. The list of methylation markers for lung cancer diagnosis and prognosis is shown below:

/>

Methylation of TERT and MGMT promoters and effects on brain cancer

O ⁶ The methylguanine-DNA methyltransferase (MGMT) gene encodes a evolutionarily conserved and ubiquitously expressed methyltransferase involved in DNA repair. MGMT removes alkyl adducts from the O6 position of guanine, prevents DNA damage and confers normal cytoprotection. However, the endogenous function of MGMT also protects tumor cells from the otherwise lethal effects of chemotherapy with alkylating agents such as Temozolomide (TMZ). MGMT was observed to silence or reduce expression by methylation of its respective gene promoter in 50% of grade IV gliomas, thereby compromising DNA repair and thus increasing chemosensitivity to agents such as TMZ. Thus, the methylation status of the MGMT promoter is likely to serve as a biomarker for susceptibility to alkylation chemotherapy, ultimately affecting clinical practice. Their ability to serve as both predictive and prognostic biomarkers has been widely studied, however, currently no consensus has been reached on the best method to assess MGMT gene promoter methylation.

Maintenance of telomeres protects the integrity of chromosomal ends, enabling replication immortality (a marker for human cancer). Telomerase reverse transcriptase (TERT) oncogenes encode the rate-limiting catalytic subunit of telomerase holoenzyme, which is responsible for telomere maintenance and is normally expressed only in a subset of stem cells. TERT genes are re-activated in approximately 90% of cancer cells, allowing for unlimited proliferation and immortalization of these cell types. Various potential genetic and epigenetic mechanisms of TERT dysregulation have been identified, with hypermethylation of the TERT promoter region representing a unique feature of cancer cells. Interestingly, methylation, rather than mutation, of the TERT gene upstream of the transcription initiation site (UTSS) was found to be closely related to increased TERT expression and poor prognosis in pediatric brain tumors. Given the ubiquity of TERT promoters hypermethylation in a wide variety of cancer cell types, such epigenetic modifications represent a useful prognostic biomarker.

Methylation of prostate cancer genes and the like, which genes are methylated/unmethylated

Prostate cancer is the most frequently diagnosed non-cutaneous malignancy and is the leading cause of cancer-related death in men in western industrialized countries. Many DNA methylation changes are observed between benign and cancerous prostate tissue, which are often early and recurrent, suggesting a possible functional role. Several genome-wide studies have reported that several genes and gene families are recurrent hypermethylated in prostate cancer. This includes, but is not limited to, GSTP1, MGMT, AR, ER, VHL, RB, APC, DAPK, CD, AOX1, APC, CDKN2A, HOXD3, PTGS2, RARB, WT1, ZNF154, C20orf103, EFS, HOXC11, LHX9, RUNX3, TBX15, BARRH 2, BDNF, CCDC8, CYP27A ₁ DLX1, EN2, ESR1, FBLN1, FOXE3, GP5, FRSP, HHEX, HOXA3, HOXD4, HOXD8, IRX1, KIT, LBX1, LHX2, NKX2-1, NKX2-2, NKX2-5, PHOXRA, POU3F3, RHG, SIX6, TBX3, TMEM106, VAX1 and WNT2.

Methylation of pancreatic cancer markers

Pancreatic Ductal Adenocarcinoma (PDAC) is one of the most deadly types of cancer. This form of cancer is difficult to diagnose because there is no early diagnostic test available at present, meaning that diagnosis usually occurs when the disease is already in an advanced state (> 75% of diagnosed cases are stage III/IV disease). This has led to a high mortality rate of the recordings. Early diagnosis has proven difficult due to the lack of reliable biomarkers that can capture the early development and/or progression of PDACs. Currently, the only FDA-approved biomarker for prognosis monitoring of PDAC patients is the carbohydrate antigen 19-9 (CA 19-9 or sialyl Lewis antigen). Such antigens exhibit low sensitivity and specificity in disease detection. Thus, it is discouraged from being used for diagnostic purposes unless used in combination with other circulating biomarkers.

Recent studies have shown that cell-free DNA (cfDNA) methylation analysis represents a promising non-invasive approach for the discovery of biomarkers with diagnostic potential. cfDNA methylation is likely to be used to identify disease-specific features in pre-neoplastic lesions or Chronic Pancreatitis (CP). Since CP generally precedes PDAC, the dynamic DNA methylation pattern of a given set of genes may be the basis for disease progression. The ductal cellular marker CUX2 showed an increase in signal in PDAC; and the catheter and the acrylic cell marker REG1A showed increased signals in chronic pancreatitis. The biomarkers ADAMTS1 and BNC1 have been observed to have high methylation frequencies in primary PDACs and pre-neoplastic Pancreatic Intraepithelial Neoplasia (PIN) (ADAMTS 1 and BNC1 are 25% and 70%, respectively). The combined cfDNA methylation of ADAMTS1 and BNC1 can be used for early diagnosis of pancreatic cancer (i.e., stage I and stage II). A list of potential biomarkers is shown below:

KRAS detection

The KRAS gene controls cell proliferation, and when it mutations, this negative signaling (negative signalling) is disrupted and the cell is able to continue to proliferate, often to develop cancer. Single amino acid substitutions, and in particular single nucleotide substitutions, result in activating mutations involved in a variety of cancers: lung adenocarcinoma, mucous adenoma, pancreatic ductal carcinoma, and colorectal carcinoma. KRAS mutations have been used as prognostic biomarkers for, for example, lung cancer.

The driving mutations in KRAS are associated with up to 20% of human cancers, and targeted therapies for this mutation and its related diseases are under development, a non-limiting list of some such therapies can be seen in the following table:

it has been found that the presence of KRAS mutations reflects a very poor response to the EGFR inhibitors panitumumab (Vectibix) and cetuximab (Erbitux). Activating mutations in the gene encoding KRAS occur in 30% -50% of colorectal cancers, and studies have shown that patients whose tumors express this mutated form of the KRAS gene are not responsive to panitumumab and cetuximab. The presence of the wild-type KRAS gene does not guarantee that the patient responds to these drugs, however, studies have shown that cetuximab has significant efficacy in patients with metastatic colorectal cancer with wild-type KRAS tumors. The response rate of KRAS mutation positive (wild-type EGFR) lung cancer patients to the EGFR antagonist erlotinib or gefitinib was estimated to be 5% or less compared to 60% for patients without KRAS mutation.

Early detection of the occurrence of KRAS mutations (activation or overexpression), a common driver of acquired resistance of colorectal cancer to cetuximab therapy (anti-EGFR therapy), allows modification of the treatment (e.g., early initiation of mitogen activated protein kinase [ MEK ] inhibitors) to delay or reverse resistance, and thus the method of the invention allows for rapid and inexpensive detection of KRAS status in patients to be advantageous.

A non-limiting list of mutations is: G12D, G12A, G12C, G D, G V, G12S, G R, A T/E/G, Q61H, Q61K, Q R/L, K117N and A146P/T/V.

Additional non-limiting lists of mutations are shown in the following table:

BRAF detection

BRAF is a human gene encoding a protein called B-Raf, which is involved in intracellular signaling that is involved in directing cell growth. It has been shown to mutate in some human cancers. B-Raf is a member of the Raf kinase family of growth signal transduction protein kinases and plays a role in regulating the MAP kinase/ERKs signaling pathway, which, among other things, affects cell division.

Some other inherited BRAF mutations lead to birth defects.

More than 30 mutations of the BRAF gene have been identified that are associated with human cancers. In 90% of cases thymine is replaced by adenine at nucleotide 1799. This results in the substitution of valine (V) at codon 600 of the activating segment found in human cancer with glutamic acid (E) (now referred to as V600E). Such mutations are widely observed in the following:

colorectal cancer

Melanoma (melanoma)

Papillary thyroid carcinoma

-non-small cell lung cancer

Ameloblastoma (ameloblastoma)

A non-limiting list of other mutations that have been found are: R461I, I462S, G463E, G463V, G A, G E, G465V, G468A, G468E, N580S, E585K, D593V, F594L, G595R, L596V, T598I, V599D, V599E, V599K, V R, V K and a727V.

Drugs have been developed to treat cancers driven by BRAF mutations; vitamin Mo Feini and dabrafenib are FDA approved for the treatment of advanced melanoma. For metastatic melanoma, the response rate of vitamin Mo Feini treatment was 53%, compared to 7% -12% for the previously best chemotherapeutic drug dacarbazine.

ERBB2/HER2 detection

Human epidermal growth factor receptor 2 (HER 2), also known as CD340 (cluster of differentiation 340), proto-oncogene Neu, erbb2 (rodent) or Erbb2 (human), is a protein encoded by the Erbb2 gene. Amplification or overexpression of this oncogene plays an important role in the progression of invasive types of breast cancer. It is also known that overexpression of ERBB2 gene occurs in ovarian cancer, gastric cancer, lung adenocarcinoma, invasive uterine cancer and 30% of salivary duct cancers. Structural changes that lead to receptor-independent ligand excitation (firing) without over-expression were also determined.

There are many approved and developing targeted therapies for this mutation and its related diseases, a non-limiting list of some of these therapies is set forth in the following table:

HER2 tests are routinely performed in breast cancer patients to assess prognosis, monitor response to treatment, and determine suitability of targeted therapies (trastuzumab, etc.). Since trastuzumab is expensive and associated with serious side effects (cardiotoxicity), it is important to select only her2+ patients to accept it, and thus the method of the invention allows for a rapid and inexpensive detection of HER2 status of the patient to be advantageous.

In one embodiment, the presence or absence of an ERRB2 exon 20 insertion mutation is detected using the methods of the invention.

Additional non-limiting lists of ERBB2 mutations are shown in the following table:

EML4-ALK detection

EML4-ALK is an abnormal gene fusion of the echinoderm microtubule-associated protein-like 4 (EML 4) gene and the Anaplastic Lymphoma Kinase (ALK) gene. This gene fusion results in the production of the protein EML4-ALK, which is shown to promote and maintain malignant behavior in cancer cells. EML4-ALK positive lung cancer is a primary malignant lung tumor containing such mutations in cells.

There are many approved and developing targeted therapies for this mutation and its related diseases, and a non-limiting list of some such therapies can be seen in the following table:

EML4-ALK gene fusion results in about 5% of non-small cell lung cancers (NSCLC), with about 9,000 new cases per year in the united states, and about 45,000 worldwide.

There are many variants of EML4-ALK that are required for transformation activity, all of which have the requisite coiled coil domains in the N-terminal portion of EML4 and in the kinase domain of ALK exon 20. Fusion of exon 13 of EML4 with exon 20 of ALK (variant 1:v1), fusion of exon 20 of EML4 with exon 20 of ALK (V2), and fusion of exon 6 of EML4 with exon 20 of ALK (V3) are some of the more common variants. The clinical significance of these different variants has recently become clearer.

V3 has become a marker suitable for selecting patients who may have a shorter Progression Free Survival (PFS) following non-Tyrosine Kinase Inhibitor (TKI) treatment such as chemotherapy and radiation therapy. There is further evidence that V3 is associated with shorter PFS and worse Overall Survival (OS) in patients receiving first and second generation treatment lines compared to V1 and V2 of EML 4-ALK.

It was also found that V3 positive patients develop resistance to the first and second treatment lines by developing resistance mutations, and that this resistance may be promoted by incomplete tumor cell inhibition due to the higher IC50 of wild type V3. The detection of adverse V3 can be used to select patients for whom a more aggressive monitoring and treatment strategy is desired. It is shown that administration of third generation luratinib to patients with V3 may confer longer PFS than patients with V1, and thus the method of the invention allows for rapid and inexpensive detection of variants that patients may have to be advantageous.

The methods of the invention also allow detection of resistance mutations such as, but not limited to: G1202R, G1269A, E1210K, D1203, S1206C, L1196M, F1174C, I1171T, I1171N/S, V1180L, T1151K and C1156Y.

For example, G1202R is a solvent-front mutation (solvent-front mutation) that interferes with drug binding and confers high levels of resistance to first and second generation ALK inhibitors. Thus, the methods of the present invention allow for the identification of those patients who may have such mutations and benefit from treatment beginning with third generation treatments rather than first or second generation treatments.

Additional non-limiting lists of EML4-ALK mutations are shown in the following table:

EGFR detection

Identification of Epidermal Growth Factor Receptor (EGFR) as an oncogene has led to the development of targeted therapies such as gefitinib, erlotinib, afatinib, butinib and icotinib for lung cancer, and cetuximab for colon cancer. However, many people develop resistance to these therapies. Two major sources of resistance are the T790M mutation and the MET oncogene.

EGFR mutations occur in EGFR exons 18-21 and exons 18, 19 and 21 and indicate the suitability of treatment with EGFR-TKI (tyrosine kinase inhibitor). Mutations in exon 20 (except for a few mutations) indicate that tumors are EGFR-TKI resistant and unsuitable for treatment with EGFR-TKI.

Two of the most common EGFR mutations are the short in-frame deletion of exon 19 (short in-frame deletion) and the point mutation of exon 21 at nucleotide 2573 (CTG to CGG), which result in the substitution of leucine at codon 858 with arginine (L858R). Together, these two mutations account for 90% of all EGFR mutations in non-small cell lung cancer (NSCLC). Screening for these mutations in NSCLC patients can be used to predict which patients will respond to TKIs.

Thus, the methods of the invention allow for the identification of those patients who may have these mutations and benefit from treatment beginning with a TKI to be advantageous. Those skilled in the art will appreciate that the methods of the invention allow for the identification of a range of EGFR mutations, a non-exhaustive list of such mutations being: G719X, ex Del, S768I, ex Ins and L861Q.

Additional non-limiting lists of mutations are shown in the following table:

/>

ROS1

ROS1 is a receptor tyrosine kinase (encoded by the gene ROS 1) that has structural similarity to the Anaplastic Lymphoma Kinase (ALK) protein (encoded by the c-ROS oncogene).

A non-limiting list of ROS1 mutations is shown in the table below:

/>

RET protooncogene

The RET proto-oncogene encodes a receptor tyrosine kinase of a member of the glial cell-derived neurotrophic factor (GDNF) family of extracellular signaling molecules.

A non-limiting list of RET mutations is shown in the following table:

MET exon 14

MET exon 14 skipping (skip) occurs in NSCLC at a frequency of about 5% and is visible in both squamous cell carcinoma and adenocarcinoma histologies.

A non-limiting list of MET mutations is shown in the table below:

exons	Mutation name	COSM numbering	Mutant sequences
				Skip 14	MET-MET	COSM29312	M13_M15

NTRK protooncogene

NTRK gene fusion results in an abnormal protein called TRK fusion protein, which may lead to cancer cell growth. NTRK gene fusions may be present in certain types of cancers, including brain cancer, head and neck cancer, thyroid cancer, soft tissue cancer, lung cancer, and colon cancer. Also known as neurotrophic tyrosine receptor kinase gene fusion.

A non-limiting list of NTRK mutations is shown in the following table:

group of

In one embodiment of the invention, a kit comprising more than one probe molecule (A ₀ ) Wherein each A ₀ Complementary to the target mutation. The mutation may be selected from any of the mutations previously or subsequently described or known. Thus, those of skill in the art will understand that a set of one or more mutations that can be used to detect any protooncogene or oncogene previously or subsequently described or known is included within the scope of the present invention.

In one embodiment, the panel comprises 5-500 individual probe molecules, each probe molecule being complementary to a particular target mutation. In one embodiment, the panel comprises 5-400 individual probe molecules, each probe molecule being complementary to a particular target mutation. In one embodiment, the panel comprises 5-300 individual probe molecules, each complementary to a particular target mutation. In one embodiment, the panel comprises 5-200 individual probe molecules, each probe molecule being complementary to a particular target mutation. In one embodiment, the panel comprises 5-100 individual probe molecules, each probe molecule being complementary to a particular target mutation. In one embodiment, the panel comprises 5-50 individual probe molecules, each probe molecule being complementary to a particular target mutation.

In one embodiment, there may be more than one probe molecule specific for the same mutation. In one embodiment, there may be only one probe molecule specific for each mutation of the set.

In one embodiment, a panel is provided, wherein the panel comprises more than one probe molecule, wherein one or more probes are complementary to the EGFR mutation, one or more probes are complementary to the KRAS mutation, one or more probes are complementary to the ERBB2/HER2 mutation, one or more probes are complementary to the EML4-ALK mutation, one or more probes are complementary to the ROS1 mutation, one or more probes are complementary to the RET mutation, and one or more probes are complementary to the MET mutation.

In one embodiment, a panel is provided, wherein the panel comprises more than one probe molecule, wherein one or more probes may be complementary to an EGFR mutation, one or more probes may be complementary to a KRAS mutation, one or more probes may be complementary to an ERBB2/HER2 mutation, one or more probes may be complementary to an EML4-ALK mutation, one or more probes may be complementary to an ROS1 mutation, one or more probes may be complementary to a RET mutation, and one or more probes may be complementary to a MET mutation.

In one embodiment, a set of probes selective for one or more EGFR, KRAS, BRAF, ERBB2/HER2, EML4-ALK, ROS1, RET, MET mutations is provided.

In one embodiment, a set of probe molecules selective for EGFR mutations is provided.

In one embodiment, a set of probe molecules selective for KRAS mutations is provided.

In one embodiment, a set of probe molecules selective for BRAF mutations is provided.

In one embodiment, a set of probe molecules selective for ERBB2/HER2 mutations is provided.

In one embodiment, a set of probe molecules selective for EML4-ALK mutations is provided.

In one embodiment, a set of probe molecules selective for ROS1 mutations is provided.

In one embodiment, a set of probe molecules selective for RET mutations is provided.

In one embodiment, a set of probe molecules selective for NTRK mutations is provided.

In one embodiment, a set of probe molecules selective for MET exon 14 mutations is provided.

In one embodiment, a set comprising more than one probe molecule selective for one or more coding sequences (CDS) is provided.

In one embodiment, a method of detecting one or more mutations using one or more of the previously described groups is provided.

In one embodiment, a method of detecting the presence or absence of one or more mutations using one or more of the previously described groups is provided.

In one embodiment, a kit is provided comprising a set, which may be as previously or subsequently described, in combination with one or more reagents, which may be as previously or subsequently described.

Those skilled in the art will appreciate that disclosure A ₀ Embodiments of the kit of parts include within its scope embodiments wherein the presence includesMore than one A ₀ Is a group of (a).

Those of skill in the art will appreciate that the disclosure of the present application also encompasses the inclusion of capture oligonucleotide B ₀ Embodiments of the group of (2). This includes where A ₀ And B ₀ Is the same oligonucleotide C ₀ Is described in the above, is provided.

In one embodiment, a methylation detection panel is provided.

In one embodiment, a methylation detection kit is provided.

Companion diagnostics

The methods of the application can be used to detect specific genetic markers in a sample, which can be used to help guide the selection of an appropriate therapy. These markers may be tumor-specific mutations, or may be wild-type genomic sequences, and may be detected using tissue, blood, or any other patient sample type. The marker may be an epigenetic marker.

Resistance monitoring

Repeated detection of patient samples during disease treatment may allow early detection of resistance to treatment. One example of such an application is non-small cell lung cancer (NSCLC), where an Epidermal Growth Factor Receptor (EGFR) inhibitor (e.g., gefitinib, erlotinib) is commonly used as a first-line therapy. During treatment, tumors may often develop mutations in the EGFR gene (e.g., T790M, C797S) that confer resistance to drugs. Early detection of these mutations may allow patients to shift to alternative therapies such as tagriss (Tagrisso). Epigenetic changes in the patient's DNA may indicate the development of drug resistance.

In general, a patient being monitored for the development of resistance may be ill-conditioned to be able to perform repeated tissue biopsies. Repeated tissue biopsies can also be expensive, invasive, and carry associated risks. Preferably from blood, but in reasonable blood samples there may be very low copy number mutations of interest. Monitoring therefore requires sensitive testing from blood samples using the method of the present invention, which is simple and cost effective to implement and thus can be performed on a regular basis.

Recurrence monitoring

In this application example, patients who are declared disease-free after treatment may be monitored over time to detect recurrence of the disease. This needs to be done non-invasively and requires sensitive detection of the target sequence from the blood sample. By using the method of the present invention, it provides a simple and low cost method that can be performed periodically. The sequence targeted may be a universal mutation known to be common in the disease of interest, or may be a set of custom targets designed for a particular patient based on detection of variants in pre-remission tumor tissue.

Minimal Residual Disease (MRD) monitoring

For some cancers, residual cancer cells remain in the patient after treatment, which is the primary cause of cancer and leukemia recurrence. MRD monitoring and detection have several important roles: determining whether the treatment has eradicated the cancer or left a residual, comparing the efficacy of the different treatments, monitoring the patient's remission status and detecting the recurrence of leukemia, and selecting the treatment that best meets these needs.

Screening

Population screening to detect disease early is a long-term goal, particularly in the diagnosis of cancer. The challenge is twofold: identifying a set of markers that allow reliable disease detection without too many false negatives, and developing a method with sufficient sensitivity and low enough cost. The method of the invention can be used to handle larger sets of mutations compared to PCR-based detection, but is simpler and less costly to work with than sequencing-based diagnosis.

Organ transplant rejection

When the transplanted organ is rejected by the recipient, DNA from the organ sloughs off into the recipient's blood stream. Early detection of such DNA would allow early detection rejection. This can be accomplished using a custom set of donor-specific markers, or by using a set of variants known to be common in the population (some of which will be present in the donor and some in the recipient). Routine monitoring of organ recipients over time can be achieved through the low cost and simple workflow of the invention disclosed herein.

Noninvasive prenatal testing (NIPT)

It has long been known that fetal DNA is present in maternal blood and the NIPT market has now been saturated with companies that use sequencing to identify mutations and count the copy number of specific chromosomes to enable detection of fetal abnormalities. The methods of the invention disclosed herein have the ability to detect mutations at very low allele fractions, potentially allowing for earlier detection of fetal DNA. Identifying common mutations in a given population will allow for the development of assays that target mutations that may be present in maternal or fetal DNA, or allow for the detection of abnormalities at a earlier stage of pregnancy.

Various other aspects and embodiments of the invention will be apparent to those skilled in the art in view of this disclosure.

As used herein, "and/or" is considered a specific disclosure of each of two specified features or components with or without the other. For example, "a and/or B" is considered a specific disclosure of each of (i) a, (ii) B, and (iii) a and B, as if each were individually listed herein.

It will be further understood by those skilled in the art that while the present invention has been described by way of example with reference to several embodiments, the invention is not limited to the embodiments disclosed and that alternative embodiments may be constructed without departing from the scope of the invention as defined in the appended claims.

Those skilled in the art will understand that reference is made to "partially digested chain A ₁ "may refer to A when hybridized to a target analyte sequence ₀ The single stranded oligonucleotide formed is digested stepwise in the 3'-5' direction until the strand dissociates due to the lack of complementarity.

Those skilled in the art will appreciate that reference to a "partially double-stranded" nucleic acid may refer to a nucleic acid in which one or more portions are double-stranded and one or more portions are single-stranded.

Those of skill in the art will appreciate that reference to a "substantially double-stranded" nucleic acid may refer to a nucleic acid in which one or more portions are double-stranded and one or more smaller portions are single-stranded.

Sequence listing

<110> biological Fidelity Co., ltd

<120> method for Polynucleotide detection

<130> P33949WO1

<150> GB 2102178.7

<151> 2021-02-16

<160> 56

<170> PatentIn version 3.5

<210> 1

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 1

<220>

<221> phosphorothioate_bond

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 1

cccaaccaag ctctcttgag gatcttg 27

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 1

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphoric acid

<400> 2

gggaccttac cttatacacc gtgccg 26

<210> 3

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 2

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 3

gcctccctcg cgccatcaga aggtgagaaa gttaaaattc ccgtc 45

<210> 4

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 2

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 4

gccttgccag cccgctcaga cagcaaagca gaaactcaca tcg 43

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 3

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 5

gcctccctcg cgccatcagc atctgcctca cctccaccg 39

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 3

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 6

gccttgccag cccgctcaga tattgtcttt gtgttcccgg ac 42

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 4

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 7

gaagccacac tgacgtgcct ctc 23

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 8

aggcagatgc ccagcaggcg gca 23

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 5

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 9

acgtactggt gaaaacaccg cag 23

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 5

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 10

gcctccttct gcatggtatt cttt 24

<210> 11

<211> 51

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 6

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 11

gcctccctcg cgccatcaga atgactgaat ataaacttgt ggtagttgga g 51

<210> 12

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 6

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 12

gccttgccag cccgctcagg aattagctgt atcgtcaagg cactcttg 48

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 7

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 13

ctggtccctc attgcactgt actcc 25

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 7

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 14

agaaacctgt ctcttggata ttctcgacac 30

<210> 15

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 8

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 15

gcctccctcg cgccatcagc cacaaaatgg atccagacaa ctgttcaaa 49

<210> 16

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 8

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 16

gccttgccag cccgctcagt cttcatgaag acctcacagt aaaaataggt ga 52

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 9

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 17

cccccagccc tctgacgtcc 20

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 9

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 18

atcttctgct gccgtcgctt ga 22

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1-FWD 10

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate linkage between residues 1 and 2, 2 and 3, 3 and 4

<400> 19

tacccttgtc cccaggaagc ata 23

<210> 20

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1-REV 10

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 20

atgcccagaa ggcgggagac at 22

<210> 21

<211> 118

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mutant oligonucleotides

<400> 21

ctgtcatagg gactctggat cccagaaggt gagaaagtta aaattcccgt cgctatcaag 60

gttccgaaag ccaacaagga aatcctcgat gtgagtttct gctttgctgt gtgggggt 118

<210> 22

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> blocking oligonucleotides

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<220>

<221> 3InvdT

<222> (46)..(46)

<223> 3' end inversion dT

<400> 22

ctatcaagga attaagagaa gcaacatctc cgaaagccaa caaggt 46

<210> 23

<211> 71

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Probe

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 23

atgttcgatg agctttgaca atacttgatc gatgcagata taggatgttg cgagctttcg 60

gaaccttgat a 71

<210> 24

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> splint oligonucleotide

<400> 24

tgtcaaagct catcgaacat ttccgaaagc catcgg 36

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 2 FWD

<220>

<221> *

<222> (1)..(3)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3

<400> 25

tcgcaacatc ctatatctgc 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 2 REV

<220>

<221> *

<222> (1)..(3)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3

<400> 26

tgagctttga caatacttga 20

<210> 27

<211> 90

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mutant oligonucleotides

<400> 27

catctgcctc acctccaccg tgcagctcat catgcagctc atgcccttcg gctgcctcct 60

ggactatgtc cgggaacaca aagacaatat 90

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> blocking oligonucleotides

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> *

<222> (17)..(20)

<223> phosphorothioate linkage between bases 17 and 18, 18 and 19, 19 and 20

<400> 28

atgagctgcg tgatgaggaa 20

<210> 29

<211> 73

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Probe

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<400> 29

atgttcgatg agctttgaca atacttgagc acggcagata taggatgttg cgaagggcat 60

gagctgcatg atg 73

<210> 30

<211> 33

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> splint oligonucleotide

<220>

<221> 3InvdT

<222> (33)..(33)

<223> 3' end inversion dT

<400> 30

caaagctcat cgaacatatg cccttcgcaa ctt 33

<210> 31

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> blocking oligonucleotides

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<400> 31

agccgaagag catgagctgc atgatg 26

<210> 32

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 1 FWD

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<400> 32

aagttaaaat tcccgtcgct a 21

<210> 33

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 1 REV

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 33

agcaaagcag aaactcacat cg 22

<210> 34

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mixture 2 FWD

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<400> 34

gcctccctcg cgccatcaga agttaaaatt cccgtcgcta 40

<210> 35

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer mix 2 REV

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 35

gccttgccag cccgctcaga gcaaagcaga aactcacatc g 41

<210> 36

<211> 122

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mutant oligonucleotide 1

<400> 36

ctgtcatagg gactctggat cccagaaggt gagaaagtta aaattcccgt cgctatcaag 60

acatctccga aagccaacaa ggaaatcctc gatgtgagtt tctgctttgc tgtgtggggg 120

tc 122

<210> 37

<211> 128

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> mutant oligonucleotide 2

<400> 37

ctgtcatagg gactctggat cccagaaggt gagaaagtta aaattcccgt cgctatcaag 60

gaagcaacat ctccgaaagc caacaaggaa atcctcgatg tgagtttctg ctttgctgtg 120

tgggggtc 128

<210> 38

<211> 71

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Probe oligonucleotide 1

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 38

atgttcgatg agctttgaca atacttgatc gatgcagata taggatgttg cgatcggaga 60

tgtcttgata g 71

<210> 39

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> splint oligonucleotide 1

<400> 39

tgtcaaagct catcgaacat acatctccga aatcgg 36

<210> 40

<211> 73

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Probe oligonucleotide 2

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 40

atgttcgatg agctttgaca atacttgatc gatgcagata taggatgttg cgacggagat 60

gttgcttcct tga 73

<210> 41

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> splint oligonucleotide 2

<400> 41

tgtcaaagct catcgaacat caacatctct cgcaag 36

<210> 42

<211> 73

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> T790M Probe

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 42

atgttcgatg agctttgaca atacttgagc acggcagata taggatgttg cgaagggcat 60

gagctgcatg atg 73

<210> 43

<211> 33

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> T790M splint oligonucleotides

<220>

<221> 3InvdT

<222> (33)..(33)

<223> 3' end inversion dT

<400> 43

caaagctcat cgaacatatg cccttcgcaa ctt 33

<210> 44

<211> 77

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6239 Probe

<220>

<221> *

<222> (1)..(4)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3, 3 and 4

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 44

atgttcgatg agctttgaca atacttgaca tgcgcagata taggatgttg cgaaacgcac 60

cggaggccag cactttg 77

<210> 45

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6239 splint oligonucleotides

<400> 45

tgtcaaagct catcgaacat ccggtgcgtt cggcaa 36

<210> 46

<211> 77

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6252 Probe

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 46

ctgtccagtg agctttgaca atacttgaca tgccgagtaa tgagagtttc gcaaacgcac 60

cggagctcag cactttg 77

<210> 47

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6252 splint oligonucleotides

<400> 47

tgtcaaagct cactggacag ccggtgcgtt cggcaa 36

<210> 48

<211> 77

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6253 Probe

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5Phos

<222> (1)..(1)

<223> 5' -terminal phosphorylation

<400> 48

acctgatctg agctttgaca atacttgaca tgcgagcaat taggtagtgt cgtaacgcac 60

cggagcacag cactttg 77

<210> 49

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> G719X_6253 splint oligonucleotides

<400> 49

tgtcaaagct cagatcaggt ccggtgcgtt cggcaa 36

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 1

<220>

<221> *

<222> (1)..(3)

<223> phosphorothioate bond between bases 1 and 2, 2 and 3

<400> 50

tgagctttga caatacttga 20

<210> 51

<211> 61

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 2

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5Cy5

<222> (1)..(1)

<223> 5' Cy5 dye

<400> 51

actgaccagc tccatgacaa tcgctgtcgc catgatcgat cgcaacatcc tatatctgcg 60

c 61

<210> 52

<211> 61

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 3

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5TEX615

<222> (1)..(1)

<223> 5' Texas Red dye

<400> 52

actgaccagc tccatgacaa tcgctgtcgc catgatcgat gcgaaactct cattactcgg 60

c 61

<210> 53

<211> 61

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 4

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5HEX

<222> (1)..(1)

<223> 5' Hex dye

<400> 53

tacgaccgac tcactcctta cagcagtccg cagtatgcta cgacactacc taattgctcg 60

c 61

<210> 54

<211> 59

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 5

<220>

<221> *

<222> (1)..(2)

<223> phosphorothioate bond between bases 1 and 2

<220>

<221> 5ATTO488N

<222> (1)..(1)

<223> 5' Atto488 dye

<400> 54

tacgaccgac tcactcctta cagcagtccg cagtatgctt cggtgatcag tcctcgatg 59

<210> 55

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 6

<220>

<221> 3IAbRQSp

<222> (39)..(39)

<223> 3' Iowa Black RQ quencher

<400> 55

tcgatcatgg cgacagcgat tgtcatggag ctggtcagt 39

<210> 56

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> primer 7

<220>

<221> 3IABkFQ

<222> (39)..(39)

<223> 3' Iowa Black FQ

<400> 56

agcatactgc ggactgctgt aaggagtgag tcggtcgta 39

Claims

1. A method of detecting a target polynucleotide sequence in a given nucleic acid analyte present in a sample, the method comprising the steps of:

(b) Introducing the mixture produced in (a) into a second reaction comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Pyrophosphorolytic enzyme; and

ligase;

wherein a target analyte is associated with the single-stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ ；

(c) Detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of the polynucleotide target sequence in the analyte.

2. The method of claim 1, comprising generating amplicons of the analyte by PCR of the biological sample comprising the analyte and optionally background genomic DNA, deriving one or more single stranded analytes from the biological sample, wherein one or more of the primers have non-complementary 5' tails.

3. The method of claim 2, comprising generating amplicons of the analyte by PCR of the biological sample comprising the analyte and optionally background genomic DNA, deriving one or more single stranded analytes from the biological sample, wherein one or more of the primers has a non-complementary 5 'tail, one or more of the primers is 5' protected, and the products of the PCR are treated with a 5'-3' exonuclease.

4. The method of any one of claims 1 to 3, further characterized in that the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dntps), and an amplifying enzyme, and during step (a) the nucleic acid analyte present in the sample is subjected to amplification, and wherein the sample is further treated with a protease after amplifying the given nucleic acid analyte and before (b).

5. The method of claim 1, further characterized by combining the first reaction mixture and the second reaction mixture, the method comprising the steps of:

(c) Introducing one or more nucleic acid analytes into a combined reaction mixture comprising:

i. single-stranded Probe oligonucleotide A ₀ ；

Blocking the oligonucleotide;

pyrophosphorolysis enzyme; and

ligase;

wherein the blocking oligonucleotide anneals to at least a subset of non-target polynucleotide sequences, and wherein the target analyte is annealed to single stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ ；

(d) Detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of the polynucleotide target sequence in the analyte.

6. The process of any preceding claim, further characterized in that the reaction mixture comprising the pyrophosphorolysis enzyme further comprises a source of pyrophosphate ions.

7. The method of any preceding claim, further characterized by reverse transcribing a target region of RNA present in the biological sample to DNA by a reverse transcriptase prior to introducing the one or more nucleic acid analytes into a reaction mixture comprising the pyrophosphorolysis enzyme.

8. The method of any one of claims 1 to 3, 5 or 6, further characterized in that the blocking oligonucleotide is fully complementary to a target nucleic acid analyte and mismatched to a non-target nucleic acid analyte, wherein:

incompletely annealing the non-target nucleic acid analyte to the blocking oligonucleotide to form an intermediate that is not pyrophosphorolysis digested to the extent necessary for the blocking oligonucleotide to melt with the non-target molecule;

The target nucleic acid analyte is fully annealed to the blocking oligonucleotide to form an intermediate that is at least partially double-stranded, and the blocking oligonucleotide is pyrophosphorolyzed in the 3'-5' direction, releasing the target nucleic acid analyte;

the target nucleic acid analyte and single-stranded probe oligonucleotide A ₀ Annealing to produce an at least partially double-stranded first intermediate product, and wherein A ₀ Is a double-stranded complex at the 3' -end of (A) ₀ Pyrophosphorolysis from the 3' -end in the 3' -5' direction to yield at least partially digested strand A ₁ And A is ₁ Undergo ligation to form A ₂ The method comprises the steps of carrying out a first treatment on the surface of the And

detecting a signal derived from a product of a previous step, wherein the product is A ₂ Or a portion thereof, or A ₂ More than one copy of (a) or a portion thereof, and deducing therefrom the presence or absence of the polynucleotide target sequence in the analyte.

9. The method of any one of claims 1 to 8, further characterized in that the blocking oligonucleotide comprises a 3 'or 5' modification to confer resistance to digestion.

10. The method of any preceding claim, further characterized in that the second reaction mixture or combined reaction mixture further comprises at least one of the following a ₀ Single-stranded primer oligonucleotides that are substantially complementary, and deoxyribonucleotide triphosphates (dNTPs).

11. The method of claim 10, further characterized in that the second reaction mixture or combined reaction mixture further comprises an amplification enzyme.

12. The method of any one of claims 1 to 11, further characterized by introducing the product of the pyrophosphorolysis reaction into a third reaction mixture comprising at least one single stranded primer oligonucleotide and dntps prior to the detecting step.

13. The method of claim 12, further characterized in that the third reaction mixture further comprises an amplification enzyme.

14. The method of any one of claims 1 to 13, further characterized in that the second reaction mixture or combined reaction mixture further comprises:

one or more ligases; and

and A is a ₂ Two or more LCR probe oligonucleotides complementary to upper adjacent sequences, wherein when the probe successfully anneals to A ₂ When the 5 'phosphate of one LCR probe is directly adjacent to the 3' OH of the other LCR probe;

wherein in the presence of A ₂ In the case of (a), the two LCR probes will successfully anneal to a ₂ And are linked together to form an oligonucleotide molecule which then acts as a second round of covalently linked new target, resulting in geometric amplification of the target of interest, in which case the target of interestIs A ₂ The target of interest is then detected.

15. The method of any one of claims 1 to 13, further characterized by introducing the product of the pyrophosphorolysis reaction into a third reaction mixture prior to the detecting step, the third reaction mixture comprising:

one or more ligases; and

wherein in the presence of A ₂ In the case of (a), the two LCR probes will successfully anneal to a ₂ And are linked together to form an oligonucleotide molecule which then acts as a second round of covalently linked new target, resulting in geometric amplification of the target of interest, in this case A ₂ The target of interest is then detected.

16. The method of any one of claims 1 to 13, further characterized in that the second reaction mixture or combined reaction mixture further comprises:

double-strand specific DNA digestive enzymes;

17. The method of any one of claims 1 to 13, further characterized by introducing the product of the pyrophosphorolysis reaction into a third reaction mixture prior to the detecting step, the third reaction mixture comprising:

Double-strand specific DNA digestive enzymes;

18. The method of any one of claims 1 to 17, further characterized in that the partially digested strand a ₁ Cyclization by ligation of 3 'and 5' ends thereof to generate oligonucleotide A ₂ 。

19. The method of any one of claims 1 to 17, further characterized in that the second reaction mixture or combined reaction mixture further comprises ligation probe oligonucleotide C, and the partially digested strand a ₁ Ligating at the 3 'end to the 5' end of C to generate oligonucleotide A ₂ 。

20. The method of claim 19, further characterized in that the oligonucleotide C further comprises a 3' modification or an internal modification that protects it from digestion by a 3' -5' exonuclease.

21. The method of any one of claims 1 to 20, further characterized in that the first, second, third, or combined reaction mixture further comprises splint oligonucleotide D.

22. The method of claim 21, wherein D comprises a value equal to a ₁ An oligonucleotide region complementary to the 3 'end of oligonucleotide C, and 5' end or A of oligonucleotide C ₁ Is complementary to the 5' -end of the (a) region.

23. The method of claim 21 or claim 22, further characterized by the fact that, due to the 3 'modification or through the 3' end of D and a ₁ Mismatch between corresponding regions of (a), D cannot be directed to a ₁ Extension is performed.

24. The method of any preceding claim, further characterized in that the first reaction mixture, second reaction mixture, or combined reaction mixture further comprises a 5'-3' exonuclease, and wherein a ₀ Is rendered resistant to 5'-3' exonuclease digestion.

25. The method of any preceding claim, further characterized in that the first reaction mixture, second reaction mixture, or combined reaction mixture further comprises a phosphatase or phosphohydrolase.

26. The method of any preceding claim, further characterized by treating the product of the previous step with pyrophosphatase or exonuclease prior to or during the detection step.

27. The method of any preceding claim, further characterized by, for a ₀ Pyrophosphorolysis to form partially digested strand A ₁ Enzymes also amplify A ₂ 。

28. The method of any one of the preceding claims, further characterized by the use of one or more oligonucleotide fluorescent binding dyes or molecular probes to effect detection.

29. According to claim 28The method is further characterized by generating A ₂ The increase in signal over time caused by the amplicon of (c) is used to infer the concentration of the target sequence in the analyte.

30. The method of any of the preceding claims, further characterized by using more than one probe a ₀ Each probe A ₀ Selectivity for different target sequences, and each probe A ₀ Containing an identification zone and is further characterized by A ₂ Comprises this recognition region, and thus deducing the target sequence present in the analyte by detecting the recognition region.

31. The method of claim 30, further characterized by detecting the recognition region using molecular probes or by sequencing.

32. The method of claim 28, further characterized in that the final step of the method further comprises the steps of:

i. labeling the product of the pyrophosphorolysis step with one or more oligonucleotide fluorescent binding dyes or molecular probes;

Measuring the fluorescence signal of the product;

exposing the product to a set of denaturing conditions; and

identifying the polynucleotide target sequence in the analyte by monitoring changes in the fluorescent signal of the product during exposure to the denaturing conditions.

33. The method of claims 1 to 32, further characterized by dividing the one or more nucleic acid analytes into more than one reaction volume, each volume having one or more probe oligonucleotides a introduced to detect different target sequences ₀ The probe A is also characterized in that ₀ The inclusion of a common priming site allows amplification to be performed using a single primer or a single set of primers.