CN116917328A - Armed Dual CAR-T Compositions and Methods for Cancer Immunotherapy - Google Patents

Armed Dual CAR-T Compositions and Methods for Cancer Immunotherapy Download PDF

Info

Publication number
CN116917328A
CN116917328A CN202180078269.XA CN202180078269A CN116917328A CN 116917328 A CN116917328 A CN 116917328A CN 202180078269 A CN202180078269 A CN 202180078269A CN 116917328 A CN116917328 A CN 116917328A
Authority
CN
China
Prior art keywords
seq
amino acid
binding
polynucleotide
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180078269.XA
Other languages
Chinese (zh)
Inventor
任圣俊
哈南·达彻
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiansheng Innovation Co
Original Assignee
Xiansheng Innovation Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiansheng Innovation Co filed Critical Xiansheng Innovation Co
Priority claimed from PCT/US2021/072533 external-priority patent/WO2022109611A1/en
Publication of CN116917328A publication Critical patent/CN116917328A/en
Pending legal-status Critical Current

Links

Abstract

Disclosed herein are polynucleotides and vectors comprising sequences encoding monospecific or bispecific CARs capable of binding to a first TAA, or T cell adaptors capable of binding to CD3 and a second TAA, or combinations thereof. Also disclosed herein are T lymphocytes comprising one or more of the polynucleotides or vectors; compositions (e.g., pharmaceutical compositions) and kits comprising one or more of the T lymphocytes; methods of treating cancer in a mammalian subject (e.g., a human), and methods of T cell mediated lysis of cancer cells (e.g., solid tumor cells).

Description

Armed dual CAR-T compositions and methods for cancer immunotherapy
The present application claims priority from prior applications of U.S. provisional application No.63/116,402, filed 11/20/2020, and U.S. provisional application No.63/243,486, filed 09/13 2021. The entire contents of the above-mentioned prior application are incorporated by reference into the present application.
Material incorporated by reference into ASCII text files
The present application incorporates by reference the sequence listing contained in the following ASCII text file filed concurrently with the present application:
file name: 5801000003sequencer listing. Txt; created at 2021, 11, 19, size 1,208,885bytes.
Background
Therapies that attack tumors by participation in the immune system have been effective against an increasing number of cancers. However, in some cancer types, particularly in solid tumors such as Glioblastoma (GBM), antigen escape variants can lead to tumor recurrence following treatment with Chimeric Antigen Receptor (CAR) T cells redirected to a single tumor-associated antigen (TAA). The limited T cell specificity profile remains a major challenge for CAR T cell therapy of solid tumors in the face of heterogeneous and potentially dynamic antigen environments.
Disclosure of Invention
There is an urgent need to develop cancer therapies that increase T cell function and reduce antigen escape.
The present invention is based, in part, on the discovery that T lymphocytes that have been engineered to express both a Chimeric Antigen Receptor (CAR) (e.g., a bispecific CAR capable of binding HER2 and IL13 ra 2) and a T cell adapter capable of binding CD3 and TAA (e.g., a tumor antigen, such as a glioblastoma tumor antigen) exhibit enhanced efficacy in treating certain types of cancers (e.g., tumors). Accordingly, the invention relates generally to polynucleotides comprising sequences encoding one or more CARs, one or more T cell adaptors, or combinations thereof; vectors (e.g., expression vectors), fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions) and kits comprising the polynucleotides; and methods of treating cancer in a subject using the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions and kits.
In one aspect, the invention provides a polynucleotide comprising a sequence encoding a Chimeric Antigen Receptor (CAR) capable of binding to one or more tumor-associated antigens (TAA) and a T cell adapter capable of binding to a T cell and a second TAA.
In another aspect, the invention provides a T cell adapter capable of binding to a T cell, a first TAA epitope, and a second TAA epitope. In another aspect, the T cell adapter is generated in situ by the CAR T-cell through interaction between the CAR and the first TAA.
In another aspect, the invention provides a polynucleotide comprising a sequence encoding a T cell adapter capable of binding to a T cell, a first TAA epitope, and a second TAA epitope.
In another aspect, the invention provides a polynucleotide comprising an amino acid sequence having at least 90% identity to at least one of the amino acid sequences independently selected from the group consisting of SEQ ID NOs: SEQ ID NOs:2-4, SEQ ID NOs:11-13 and 52, SEQ ID NOs:15-17, SEQ ID NOs:21-23 and 109-111,SEQ ID NOs:49 and 50, SEQ ID NOs:53-70, SEQ ID NOs:72-82, SEQ ID NOs:83-104,SEQ ID NOs:120-137,SEQ ID NOs:139-149,SEQ ID NOs:150-171,SEQ ID NOs:188-191,SEQ ID NOs:204 and 206-214,SEQ ID NOs:215-221, or SEQ ID NOs:242-291, or a combination thereof.
In a still further aspect, the invention provides a vector, wherein the vector comprises one or more polynucleotides described herein.
In another aspect, the invention provides a fusion protein encoded by any one of the polynucleotides or vectors described herein.
In another aspect, the invention provides a host cell, wherein the host cell comprises one or more polynucleotides, vectors or fusion proteins described herein.
In another aspect, the invention provides a T lymphocyte comprising one or more of the polynucleotides, vectors or fusion proteins described herein.
In a further aspect, the invention provides a composition, wherein the composition comprises one or more polynucleotides, vectors, fusion proteins, host cells, or T lymphocytes described herein.
In another aspect, the invention provides a pharmaceutical composition, wherein the pharmaceutical composition comprises one or more polynucleotides, vectors, fusion proteins, host cells or T lymphocytes described herein, and a pharmaceutically acceptable carrier.
In another aspect, the invention provides a kit comprising a container and optionally instructions for use, wherein the container comprises one or more compositions (e.g., pharmaceutical compositions) described herein.
In another aspect, the invention provides the use of one or more polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or kits described herein in the manufacture of a medicament for treating cancer in a subject in need thereof.
In another aspect, the invention provides one or more polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or kits described herein for treating cancer in a subject in need thereof. In some embodiments, the invention provides one or more T lymphocytes described herein, compositions, pharmaceutical compositions, for use in treating cancer in a subject in need thereof. In certain embodiments, the invention provides one or more T lymphocytes described herein for use in treating cancer in a subject in need thereof.
In another aspect, the invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of one or more T lymphocytes or compositions (e.g., pharmaceutical compositions) described herein.
In another aspect, the invention provides a T cell adapter (TE or BiTE) capable of binding a T cell, a first TAA epitope, and a second TAA epitope, the T cell adapter produced in situ by a CAR T-cell (e.g., released or secreted by the CAR T-cell) by an interaction between the CAR and the first TAA.
In another aspect, the invention provides a polypeptide comprising an amino acid sequence having at least 90% identity to at least one of the amino acid sequences set forth in SEQ ID NOs:2-4,15-17 and 242-291.
In another aspect, the present invention provides a polypeptide capable of specifically binding to glucagon-3 (GPC 3), wherein the polypeptide comprises heavy chain complementarity determining region 1 (HCDR 1), heavy chain complementarity determining region 2 (HCDR 2) and heavy chain complementarity determining region 3 (HCDR 3), each heavy chain complementarity determining region each comprising a heavy chain variable region (V) as set forth in SEQ ID NO. 284,SEQ ID NO:286 or SEQ ID NO. 289 H ) The amino acid sequences of HCDR1, HCDR2 and HCDR3 of the amino acid sequence have an amino acid sequence of at least 90% identity.
Without being bound by any theory or hypothesis, one or more polynucleotides, vectors, fusion proteins, host cells, T lymphocytes or compositions (e.g., pharmaceutical compositions) described herein provide superior (sometimes unexpected) results in killing or otherwise reducing the efficacy of cancer cells when compared to other polynucleotides, vectors, fusion proteins, host cells, T lymphocytes or compositions (e.g., pharmaceutical compositions). Also, without being bound by any theory or hypothesis, one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes or compositions (e.g., pharmaceutical compositions) described herein may be used to effectively treat cancer, particularly to reduce side effects.
Drawings
The patent or patent application contains at least one drawing in color. Copies of this patent or patent application publication with color drawings will be provided by the office upon request and payment of the necessary fee.
The foregoing and other aspects of the invention will become apparent from the following detailed description of the invention and the accompanying drawings. In the drawings, like reference numerals designate like parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating embodiments.
FIG. 1 is a schematic diagram of one non-limiting example of a dual-CAR structure according to the present invention.
Figure 2 shows the average percent targeting in GBM cancer cell lines. U87, U87 KO and U373 were engineered to express luciferase and EGFP. To prepare knockout cells (U87 KO), IL13 ra 2 was knocked out in U87 using CRISPR-CAS9 gene editing. Three rounds of FACS analysis were performed to determine the percent positivity of the targets for each cell line.
FIG. 3 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment with CAR-T at an E/T ratio of 0.5 and was the average of duplicate determinations (n=6).
Fig. 4 shows the results of the RTCA-based (real-time cytolytic analysis) killing test. The target cancer cell line is GBM cell line U373. Each data is the average of duplicate determinations (n=3). This set of data represents CAR-T cell treatment results for three donors.
Fig. 5 shows the results of the RTCA-based killing test. The target cancer cell line is the GBM cell line T98G. Each data is the average of duplicate determinations (n=3). This set of data represents CAR-T cell treatment results for three donors.
FIG. 6 is a schematic diagram of one non-limiting example of a T cell adapter structure according to the present invention.
FIG. 7 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment with BiTE at an E/T ratio of 1 and was the average of duplicate determinations (n=6; biTE concentration: 5 ng/ml).
FIG. 8 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment with BiTE at an E/T ratio of 0.5 and was the average of duplicate determinations (n=6; biTE concentration: 5 ng/ml).
FIG. 9 shows the results of a NFAT-based BiTE induced T cell activation assay. Each data was collected 24 hours after BiTE/NFAT treatment and was the average of duplicate determinations (n= 3;E (NFAT)/T (T98G) =0.5; mk, mock).
FIG. 10 is a schematic diagram of one non-limiting example of a dual-CAR_BiTE structure according to the present invention.
FIG. 11 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment with BiTE at an E/T ratio of 1 and was the average of duplicate determinations (n=3; biTE concentration: 5 ng/ml). The BiTE used herein was generated from a double-CAR-BiTE construct in 293T cells. GFP: GFP PanT cells; PT: panT cells; NT: only SR13 BiTE had no T cells.
Fig. 12 shows the results of the RTCA-based killing test. The target cancer cell line is GBM cell line U373. Each data is the mean of duplicate determinations (n=6; bite concentration: 5ng/ml; E/t=0.5). The BiTE used herein was generated from a double-CAR-BiTE construct in 293T cells.
Fig. 13 shows the results of the RTCA-based killing test. The target cancer cell line is the GBM cell line T98G. Each data is the mean of duplicate determinations (n=6; bite concentration: 5ng/ml; E/t=0.5). The BiTE used herein was generated from a double-CAR-BiTE construct in 293T cells.
FIG. 14 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment and was the average of duplicate determinations (n=6). The BiTE used herein was generated from a double-CAR-BiTE construct in 293T cells.
FIG. 15 shows the results of a NFAT-based BiTE induced T cell activation assay. Each data was collected 24 hours after BiTE/NFAT treatment and was the average of duplicate determinations (n= 3;E (NFAT)/T (T98G) =0.5; biTE concentration: 5ng/ml; GFP, negative control). The BiTE used herein was generated from a double-CAR-BiTE construct in 293T cells.
Fig. 16 shows the results of a luciferase-based killing assay after treatment of GBM cell line U87 for 20 hours with BiTE at an E/T ratio of 0.5 (n=6). Each data is the mean of duplicate determinations (N=6; biTE concentration: 50pg/ml (CART produced), 5ng/ml (293T produced)).
FIG. 17 shows the results of a NFAT-based BiTE induced T cell activation assay. Each data was collected 24 hours after BiTE/NFAT treatment and was the average of duplicate determinations (n= 6;E (NFAT)/T (T98G) =0.5; biTE concentration: 50pg/ml (CART produced), 5ng/ml (293T produced)).
FIG. 18 shows the results of a luciferase-based killing assay. Each data was collected 24 hours after treatment of GBM cell line U87 with CAR-T and was the mean of duplicate determinations (n=3).
FIG. 19 shows the results of a luciferase-based killing assay. Each data was collected 48 hours after treatment of GBM cell line U87 with CAR-T and was the mean of duplicate determinations (n=3).
Fig. 20 shows the results of the RTCA-based killing test. The target cancer cell line is GBM cell line U87. Each data is the average of duplicate determinations (n=3). This set of data represents the CAR-T cell treated group of three donors.
Fig. 21 shows the results of the RTCA-based killing test. The target cancer cell line is the GBM cell line T98G. Each data is the average of duplicate determinations (n=3). This set of data represents the CAR-T cell treated group of three donors.
Fig. 22 shows the results of the RTCA-based killing test. The target cancer cell line is GBM cell line U87. Each data is the average of duplicate determinations (n=6). MK, mock; UNT, pan T cells.
FIG. 23 shows cytokine release assay results. Each data was obtained using CAR-T at an E/T ratio (CAR + Total T cells: 2,500) collected 48 hours after treatment and was the average of duplicate determinations (n=3). UN, pan T cells.
FIG. 24 shows cytokine release assay results. Each data was obtained using CAR-T at an E/T ratio (CAR + Total T cells: 2,500) collected 48 hours after treatment and was the average of duplicate determinations (n=3). UN, pan T cells.
FIG. 25 shows the results of a luciferase-based continuous killing assay. Each data was collected 24 hours after treatment of GBM cell line U87 with CAR-T and was the mean of duplicate determinations (n=18). In 5 consecutive killing experiments, the amplified CAR-T cells were diluted to the corresponding E/T specific concentrations.
FIG. 26 shows the results of T cell expansion capacity assays during CART continuous killing. Each data was collected 24 hours after treatment of GBM cell line U87 with CAR-T and was the mean of duplicate determinations (n=18). In 5 consecutive killing experiments, the amplified CAR-T cells were diluted to the corresponding E/T specific concentrations. SK: and (5) continuous killing.
Fig. 27 shows the results of an RTCA-based killing assay targeting GBM cell line U87 with an extremely low E/T ratio (E: t=1:16) (n=3). SR26 (double arm BiTE CAR-T cells) showed sustained cytolytic activity compared to SR25 (single arm BiTE CAR-T cells), SR27 (control CD19 BiTE CAR-T cells) and SR9 (double CAR-T cells).
Fig. 28 shows the results of a continuous killing assay targeting GBM cell line U87 at a low E/T ratio (E: t=1:1) and very low concentration ([ BiTE ] =0.2 ng/ml) (n=3). In contrast to SR25, SR26 exhibits a balance between continuous cytolytic activity and T cell persistence.
FIG. 29 shows FACS results characterizing cell surface expressed Tumor Associated Antigen (TAA) in GBM cell line U87 expressing GFP and luciferase. EGFR, HER2 and IL13R2a were detected using anti-human EGFR, anti-Her2 and anti-IL13R2a antibody clones.
Fig. 30 shows the results of an RTCA-based killing assay targeting GBM cell line U251 with an extremely low E/T ratio (E: t=1:16) (n=6). SR26 shows continuous cytolytic activity compared to SR24 and SR 25.
FIG. 31 shows the FACS results of characterizing cell surface expressed TAA in GBM cell line U251 expressing GFP and luciferase. EGFR, HER2 and IL13R2a were detected using anti-human EGFR, anti-Her2 and anti-IL13R2a clones.
Fig. 32 shows the results of RTCA-based killing experiments at low E/T ratios (E: t=1:8) (n=3). The target cell was HER 2-positive breast cancer cell line A431. SR26 (double-arm BiTE CAR-T cells) showed continuous cytolytic activity compared to SR24 and SR25 (single-arm BiTE CAR-T cells) and SR27 (CAR-T cells).
FIG. 33 shows the expression levels of EGFR, HER2 and IL13Rα2 in HER 2-positive breast cancer cell line A431.
Fig. 34 shows the results of RTCA-based killing experiments at low E/T ratios (E: t=1:8) (n=3). The target cell is HER 2-positive breast cancer cell line MCF-7. SR26 (double-arm BiTE CAR-T cells) exhibited better continuous cytolytic activity compared to SR24 and SR25 (single-arm BiTE CAR-T cells) and SR27 (CAR-T cells).
FIG. 35 shows the expression levels of EGFR, HER2 and IL13Rα2 in the HER 2-positive breast cancer cell line MCF-7.
Fig. 36 shows the results of RTCA-based killing experiments at low E/T ratios (E: t=1:8) (n=3). The target cell is NSCLC cell line (H-1944). SR26 (double-arm BiTE CAR-T cells) exhibited better continuous cytolytic activity compared to SR24 and SR25 (single-arm BiTE CAR-T cells) and SR27 (CAR-T cells).
Fig. 37 shows the expression levels of EGFR, HER2 and IL13 ra 2 in NSCLC cell line H1944.
Fig. 38 shows the results of RTCA-based killing experiments at low E/T ratios (E: t=1:4) (n=3). The target cell is NSCLC cell line (H-1915). SR26 (double-arm BiTE CAR-T cells) exhibited better continuous cytolytic activity compared to SR24 and SR25 (single-arm BiTE CAR-T cells) and SR27 (CAR-T cells).
Fig. 39 shows the expression levels of EGFR, HER2 and IL13 ra 2 in brain-transferred NSCLC cell line H1915.
Fig. 40 shows the therapeutic effect of SR26 in the U87 cell line. U87 is one of the most malignant GBM models. Figure 40A shows BLI results at key time points. D_ -1: 1 day before treatment; d_n: n days after treatment. Xenograft: 10,000 luciferase-labeled U87 cells were injected into the right forebrain. Treatment: 1. 200,000CAR is injected 4 days after tumor xenograft + T cells. Figure 40B shows BLI radiation results from individual mice. Fig. 40C shows survival.
Fig. 41 depicts the workflow of PK/distribution studies of SR26 (double arm BiTE CAR-T cells), related abbreviations are as follows: h: a heart; l: liver; spl: spleen; lu: a lung; k: a kidney; br: a brain; spi: a spinal cord; bm: bone marrow; bl: blood.
Fig. 42 shows PK/profile. Both CAR and BiTE genes can be detected only in the brain and not in genomic DNA of heart, liver, spleen, lung, kidney, bone marrow, spinal cord or blood, suggesting that infused CAR-T cells are restricted to the brain. The CAR-T cells infiltrate the brain tissue, and the infiltrated CAR-T cells gradually lose viability or reenter a quiescent state in GBM-free mice due to the lack of associated tumor antigen stimulation. M1: mouse #1; m2: mouse #2; m3: mouse #3.
Fig. 43 depicts toxicology study arrangement and workflow, related abbreviations are as follows: h: a heart; l: liver; spl: spleen; lu: a lung; k: a kidney; br: a brain; spi: a spinal cord; bm: bone marrow; bl: blood; UNT: untreated.
FIG. 44 shows the therapeutic effect of SR26 in the U87 cell line. U87 is one of the most malignant GBM models. Fig. 44A shows BLI results at key time points. Related abbreviations are: d_ -1: 1 day before treatment; d_n: n days after treatment. Figure 44B shows BLI radiation results (upper panel) and average total radiation (lower panel) for individual mice.
Fig. 45 summarizes the toxicology study results. SR26 effectively eradicates GBM tumors, and in both acute (day 2) and chronic (day 14) studies, no abnormal response was observed in SR26 treated mice.
Figure 46 is a schematic diagram of one non-limiting example of HER2 CARs.
FIG. 47 is a schematic diagram of a non-limiting example of single arm VHH_EGFR_Bites (up) and dual arm VHH_EGFR_Bites binding IL13R alpha 2CAR (down).
FIG. 48 is a schematic diagram of a non-limiting example of a dual arm EGFR_ BiTE armed dual CAR-Ts.
Fig. 49 shows the results of the RTCA-based killing test. From 39 internally developed candidate molecules, 6 core anti-HER2 VHH nanobody clones (SR 72, SR78-SR80, SR82 and SR 87) were identified through two rounds of CAR-T function screening. Each data is the average of three replicates of the second round of RTCA testing. Wherein E/t=1/2; pan T cells are from healthy receptor 2; SR9, dual CAR-T targeting HER2 and IL13 ra 2 as positive control; IL13Rα2 was positive in both U87 (45%) and U373 (42%).
FIG. 50 shows the quantitative results of cytokine release. After two rounds of CAR-T killing ability assay screening, core anti-HER2 VHH nanobody clones were further validated by quantifying cytokine release. Each data is an average of six parallel replicates of CAR-T treated GBM cancer cell line U373. Wherein E/t=1/8; pan T cells were from healthy donor 2. In combination with cytolytic activity and the ability to induce cytokine release, core clones were further restricted to SR72, SR78, SR79 and SR82.
FIG. 51 shows the results of RTCA-based killing experiments to further verify anti-HER2 VHH nanobody core clones (SR 72, SR78-SR80, SR82 and SR 87). The breast cancer cell line MCF-7 with lower HER2 expression is used as a target cell. Each data is an average of three replicates of the RTCA assay. Wherein E/t=1/8; pan T cells were from healthy donor 2; SRI15, trastuzumab scFv CAR-T, as a control.
FIG. 52 shows the specificity of anti-HER2 VHH nanobody clones in GBM cell line U373. To further verify the specificity of the identified anti-HER2 VHH nanobody core clones (SR 72, SR78-SR80, SR82 and SR 87), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data is the result of the first study. HER2 antibody was a commercially available primary antibody labeled with PE and used as a control.
FIG. 53 shows the specificity of anti-HER2 VHH nanobody clones in GBM cell line U373. To further verify the specificity of the identified anti-HER2 VHH nanobody core clones (SR 72, SR78-SR80, SR82 and SR 87), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data is the result of a second round of study. HER2 antibody was a commercially available primary antibody labeled with PE and used as a control.
FIG. 54 shows the specificity of anti-HER2 VHH nanobody clones in GBM cell line U373. To further verify the specificity of the identified anti-HER2 VHH nanobody core clones (SR 72, SR78-SR80, SR82 and SR 87), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data described is the result of a third study. HER2 antibody was a commercially available primary antibody labeled with PE and used as a control.
FIG. 55 summarizes the results of the study of anti-HER2 VHH nanobody core clones (SR 72, SR78-SR80, SR82 and SR 87) shown in FIGS. 52A-54E, with the relevant abbreviations: WT: wild type GBM cancer cell line U373; KO: HER2 knockout U373 cell line.
FIG. 56 summarizes the K of anti-HER2 VHH nanobody core clones SR72, SR78-SR80, SR82 and SR87 D Values.
Fig. 57 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR142 is the preferred clone of tandem HER2 VHH CAR-T; individual VHH HER2CAR-T SR82 still had mandatory killing activity compared to those tandem CAR-T cells. The breast cancer cell line MCF-7 with lower HER2 expression is used as a target cell. Each data is an average of four replicates of the RTCA assay. Wherein E/t=1/8; pan T cells were from healthy donor 2.
Fig. 58 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR141 and SR142 are preferred clones of tandem HER2 VHH CAR-T; individual VHH HER2 CAR-T SR82 still had mandatory killing activity compared to those tandem CAR-T cells. GBM cell line U373 was used as the target cell. Each data is an average of four replicates of the RTCA assay. Wherein E/t=1/8; pan T cells were from healthy donor 2.
Fig. 59 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR147 is the core clone of the tandem HER2 VHH CAR-T; breast cancer cell line a431 was used as target cell. Each data is an average of six replicates of the RTCA assay. Wherein E/t=1/8; pan T cells were from healthy donor 2.
Fig. 60 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR147 is the core clone of the tandem HER2 VHH CAR-T; the breast cancer cell line BT474 was used as target cell. Each data is an average of six replicates of the RTCA assay. Wherein E/t=1/8; pan T cells were from healthy donor 2.
Fig. 61 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR147 is the core clone of the tandem HER2 VHH CAR-T; NSCLC cell line H1944 was used as the target cell. Each data is an average of six replicates of the RTCA assay. Wherein E/t=1/16; pan T cells were from healthy donor 2.
Fig. 62 shows the results of the RTCA-based killing test. The RTCA-based CAR-T killing assay showed that SR147 is the core clone of the tandem HER2 VHH CAR-T; GBM cell line U251 was used as target cell. Each data is an average of six replicates of the RTCA assay. Wherein E/t=1/16; pan T cells were from healthy donor 2.
Fig. 63 shows the results of the RTCA-based killing test. After two rounds of BiTE functionalization screening, two core anti-EGFR (wt and VIII) VHH nanocolonies (SR 56 and SR 59) were identified from 44 internally developed candidate molecules. Each data is the average of three replicates of the second round of RTCA testing. Wherein E/t=1/2; pan T cells are from healthy receptor 2; SR26, double arm anti-EGFR (BiTE as positive control; SR27, anti-CD19 BiTE as negative control; IL13Rα2 was positive in both U87 (45%) and U373 (42%).
FIG. 64 shows the results of RTCA-based cell growth index assays. The cell growth index of the wild type GBM cell line U373 (u373_wt) was comparable to that of EGFR knocked-out U373 (u373_egfr KO) cells.
Fig. 65 results of a killing test based on RTCA. To verify the specificity of the two core anti-EGFR (wt and VIII) VHH nanocolonies, SR56 and SR59, RTCA-based BiTE-mediated killing experiments were performed. Each data is an average of six replicates of the RTCA assay. Wherein E/t=1/1; pan T cells were from healthy donor 2; SR26, double-arm anti-EGFR BiTE as positive control; anti-CD19 BiTE was used as a negative control; SR116 is bis-EGFR_BiTE; biTE concentration: 1ng/ml, which is produced by 293T cells.
FIGS. 66A-66D show the specificity of anti-EGFR VHH nanoclones in GBM cell line U373. To further verify the specificity of the identified EGFR VHH nanobody core clones (SR 56, SR59 7D12 and 38G 7), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data is the result of the first study. EGFR Ab antibodies were labeled with PE as a commercial primary antibody and used as a control.
FIGS. 67A-67D show the specificity of anti-EGFR VHH nanoclones in GBM cell line U373. To further verify the specificity of the identified EGFR VHH nanobody core clones (SR 56, SR59 7D12 and 38G 7), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data is the result of a second round of study. EGFR Ab antibodies were labeled with PE as a commercial primary antibody and used as a control.
FIGS. 68A-68D show the specificity of anti-EGFR VHH nanoclones in GBM cell line U373. To further verify the specificity of the identified EGFR VHH nanobody core clones (SR 56, SR59 7D12 and 38G 7), both WT and HER2 KO GBM cancer cell line U373 were used for parallel flow staining analysis. Each of the data described is the result of a third study. EGFR Ab antibodies were labeled with PE as a commercial primary antibody and used as a control.
FIG. 69 summarizes the results of the study of anti-EGFR VHH nanobody core clones (SR 56, SR59-80,7D12 and 38G 7) shown in FIGS. 66A-68E, with the relevant abbreviations: WT: wild type GBM cancer cell line U373; KO: EGFR knockout U373 cell line.
FIG. 70 summarizes the K of anti-EGFR VHH nanobody core clones SR56, SR59-80,7D12 and 38G7 D Values.
Fig. 71 shows the results of the RTCA-based killing test. To identify core EGFR VHH dual-arm BiTE clones from the preferred EGFR_BiTE candidate molecules, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is GBM cancer cell line U87 (EGFR +: > 92%); wherein E/t=1/8; pan T cells were from healthy donor 2.
Fig. 72 is a schematic diagram of one non-limiting example of a dual arm egfr_bite equipped with HER2 VHH CAR-Ts.
Fig. 73 is a schematic of one non-limiting example of EGFR CARs.
FIG. 74 is a schematic of one non-limiting example of a dual arm EGFR_BiTE equipped with EGFR VHH CAR-Ts.
Fig. 75 shows the results of the RTCA-based killing test. To identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is GBM cancer cell line U87; wherein E/t=1/4; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 76 shows the results of the RTCA-based killing test. To identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is a breast cancer cell line BT474; wherein E/t=1/4; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 77 shows the results of the RTCA-based killing test. To identify core EGFR VHH CAR-T clones from preferred EGFR VHH CAR-T candidate molecules, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is NSCLC cell line H1944; wherein E/t=1/8; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 78 shows the results of the RTCA-based killing test. To identify core EGFR VHH tandem CAR-T clones from preferred EGFR VHH CAR-T candidate molecules, an RTCA-based killing assay was performed. Each data is an average of three replicates. The target cell is NSCLC cell line H1944; wherein E/t=1/8; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 79 shows the results of the RTCA-based killing test. To identify core double arm EGFR BiTE armed EGFR VHH tandem CAR-T clones from the preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecule, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is brain metastasis NSCLC cell line H1915; wherein E/t=1/2; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 80 shows the results of the RTCA-based killing test. To identify core double arm EGFR BiTE armed EGFR VHH tandem CAR-T clones from the preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecule, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is brain metastasis NSCLC cell line H1915; wherein E/t=1/4; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 81 shows the results of the RTCA-based killing test. To identify core double arm EGFR BiTE armed EGFR VHH tandem CAR-T clones from the preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecule, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is brain metastasis NSCLC cell line H1915; wherein E/t=1/8; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 82 shows the results of the RTCA-based killing test. To identify core double arm EGFR BiTE armed EGFR VHH tandem CAR-T clones from the preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecule, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is brain metastasis NSCLC cell line H1915; wherein E/t=1/16; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
Fig. 83 shows the results of the RTCA-based killing test. To identify core double arm EGFR BiTE armed EGFR VHH tandem CAR-T clones from the preferred EGFR_BiTE armed EGFR VHH CAR-T candidate molecule, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is brain metastasis NSCLC cell line H1915; wherein E/t=1/32; pan T cells were from healthy donor 2; SR126, cetuximab_scFv-EGFR CAR-T as control.
FIG. 84 is a schematic diagram of one non-limiting example of GPC-3 CARs.
FIG. 85 is a schematic diagram of one non-limiting example of a two-arm GPC-3_BiTE armed GPC-3 CAR-Ts.
Fig. 86 shows the results of the RTCA-based killing test. To identify preferred GPC-3VHH CAR-T clones from internally developed GPC-3 nanobody candidate molecules, an RTCA-based killing assay was performed. Each data is an average of three replicates. The target cell is HCC cancer cell line Huh-7; wherein E/t=1/1; pan T cells were from healthy donor 3; SRHC-4, GPC-3GC-33_scFv CAR-T, and SRHCC-2, GPC-3VHH CAR-T served as controls.
Fig. 87 shows the results of the RTCA-based killing test. To identify preferred GPC-3VHH CAR-T clones from internally developed GPC-3 nanobody candidate molecules, an RTCA-based killing assay was performed. Each data is an average of three replicates. The target cell is HCC cancer cell line Huh-7; wherein E/t=1/1; pan T cells were from healthy donor 3; SRHC-4, GPC-3GC-33_scFv CAR-T, VHH72-YP7 CAR-T and SRHCC-2, GPC-3VHH CAR-T served as controls.
Fig. 88 shows the results of the RTCA-based killing test. To identify preferred GPC-3VHH CAR-T clones from internally developed GPC-3 nanobody candidate molecules, an RTCA-based killing assay was performed. Each data is an average of six replicates. The target cell is HCC cancer cell line Hep3B; wherein E/t=1/2; pan T cells were from healthy donor 3; SRHC-4, GPC-3GC-33_scFv CAR-T, and SRHCC-2, GPC-3VHH CAR-T served as controls.
Fig. 89 shows the results of the RTCA-based killing test. To identify core double arm GPC-3BiTE armed GPC-3VHH tan CAR-T clones from preferred GPC-3BiTE armed GPC-3VHH CAR-T candidate molecules, an RTCA based killing test was performed. Each data is an average of four replicates. The target cell is HCC cancer cell line HepG2; wherein E/t=1/4; pan T cells were from healthy donor 5.
Fig. 90 shows the results of the RTCA-based killing test. To identify core double arm GPC-3BiTE armed GPC-3VHH tan CAR-T clones from preferred GPC-3BiTE armed GPC-3VHH CAR-T candidate molecules, an RTCA based killing test was performed. Each data is an average of four replicates. The target cell is HCC cancer cell line Hep3B; wherein E/t=1/4; pan T cells were from healthy donor 5.
Fig. 91 shows the results of the RTCA-based killing test. To further verify the functionality of the core dual arm GPC-3BiTE (SRHC-8_GPC3BiTE_S1-101), a killing test based on RTCA was performed. Each data is an average of twelve replicates. The target cell is HCC cancer cell line Hep3B; wherein E/t=1/1; biTE concentration 4ng/ml; pan T cells were from healthy donor 5.
Fig. 92 shows the results of the RTCA-based killing test. To further verify the functionality of the core dual arm GPC-3BiTE (SRHC-8_GPC3BiTE_S1-101), a killing test based on RTCA was performed. Each data is an average of twelve replicates. The target cell is HCC cancer cell line HepG2; wherein E/t=1/1; biTE concentration 4ng/ml; pan T cells were from healthy donor 5.
FIG. 93 shows the results of NFAT cell-based luciferase assay. To verify the ability of core double arm GPC-3BiTE (SRHC-8_GPC3BiTE_S1-101) to have T cell activation, NFAT cell based luciferase assays were performed. Each data is an average of six replicates. The target cell is HCC cancer cell line Hep3B; wherein E/t=1/1; biTE concentration was 4ng/ml.
FIG. 94 shows the results of NFAT cell-based luciferase assay. To verify the ability of core double arm GPC-3 BiTE (SRHC-8_GPC3BiTE_S1-101) to have T cell activation, NFAT cell based luciferase assays were performed. Each data is an average of six replicates. The target cell is HCC cancer cell line HepG2; wherein E/t=1/1; biTE concentration was 4ng/ml.
FIG. 95 shows the results of NFAT cell-based luciferase assay. To verify the ability of core double arm GPC-3 BiTE (SRHC-8_GPC3BiTE_S1-101) to have T cell activation, NFAT cell based luciferase assays were performed. Each data is an average of six replicates. The target cell is HCC cancer cell line SK-Hep1, which is a GPC-3 negative but EGFR positive cell; wherein E/t=1/1; biTE concentration was 4ng/ml.
Fig. 96 results of a killing test based on RTCA. To identify preferred GPC-3VHH CAR-T clones from internally developed GPC-3 nanobody candidate molecules, an RTCA-based killing assay was performed. The data are the average of four replicates. The target cell is HCC cancer cell line Huh-7; wherein E/t=1/1; pan T cells were from healthy donor 3; SRHC-4, GPC-3GC-33_scFv CAR-T served as control.
Detailed Description
The description of the embodiments is as follows.
Polynucleotides of the invention
Polynucleotides encoding CARs and T cell adaptors (TE or BiTE)
In one aspect, the invention provides a polynucleotide comprising a sequence encoding a Chimeric Antigen Receptor (CAR) and a T cell adapter (TE or BiTE), the CAR being capable of binding to one or more first TAAs and the T cell adapter (TE or BiTE) being capable of binding to a T cell and a second TAA. In some embodiments, the T cell adaptor is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277 or CXCR3. In certain embodiments, the T cell adapter is capable of binding to CD2, CD3, CD31 or CD277. In certain embodiments, the T cell adapter is capable of binding CD3.
In some embodiments, the polynucleotide comprises deoxyribonucleic acid. In certain embodiments, the polynucleotide comprises ribonucleic acid. Non-limiting examples of polynucleotides include single-stranded, double-stranded or multi-stranded DNA or RNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases, or other naturally, chemically or biochemically modified, non-naturally or derivatized nucleotide bases. The backbone of the polynucleotide may include sugar and phosphate groups, modified or substituted sugar or phosphate groups, polymers of synthetic subunits such as phosphoramidates, or combinations thereof.
In some embodiments, the polynucleotide is isolated (e.g., synthesized or produced by molecular cloning). In some embodiments, the polynucleotide is integrated into the genomic DNA of a host cell (e.g., a T lymphocyte). In some embodiments, the polynucleotide is extrachromosomal (e.g., on a plasmid, on a viral vector) within the host cell. In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is RNA. The polynucleotide may be inserted into a plasmid or vector, such as a viral vector (e.g., a lentiviral vector). In addition, the polynucleotide may include one or more modified nucleotides (e.g., one or more chemically modified nucleotides).
In some embodiments, the CAR is monospecific. In other embodiments, the CAR is bispecific. In certain embodiments, the CAR is capable of binding to two epitopes of the first TAA. In a particular embodiment, the CAR is capable of binding two first TAAs.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on blood cancer (e.g., leukemia, lymphoma, myeloma) cells. Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma) and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAA, or both, are expressed on a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma cells.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on cells of a solid tumor (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testis, head and/or neck, pancreas, brain, skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head-neck, pancreas, brain, and skin cancer cells.
In some embodiments, the solid tumor is brain tumor, breast cancer, lung cancer, or liver cancer. In some embodiments, the brain tumor is Glioblastoma (GBM). In certain embodiments, the GBM is primary glioblastoma multiforme. In particular embodiments, the GBM is recurrent glioblastoma multiforme. In some embodiments, the brain tumor is a brain metastasis. In certain embodiments, the brain metastasis is non-small cell lung cancer brain metastasis (NSCLCBM), small Cell Lung Cancer Brain Metastasis (SCLCBM), HER 2-positive metastatic breast cancer or triple negative metastatic breast cancer brain metastasis (TNBCBM). In some embodiments, the liver cancer is hepatocellular carcinoma (HCC).
In some embodiments, the one or more first TAAs are each independently selected from colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphoma antigen APO-1; cancer antigen B1; B7H3; beta-catenin; blood type ALeb/Ley; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (Leb blood group); CO-514 (Lea blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; gpA33; HER2 antigen (e.g., pi85 HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-a receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley.
In some embodiments, the one or more first TAAs are each independently selected from interleukin-13 receptor alpha 2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2); epidermal growth factor receptor 2 (EGFR); EGFR variant III (EGFRvIII); glucagon-3 (GPC 3) or a combination thereof.
In some embodiments, the CAR comprises a mutein, a single chain variable fragment (scFv), a nanobody, or a combination thereof. In certain embodiments, the CAR comprises a mutein and an scFv, two nanobodies, a mutein and two nanobodies, or an scFv and a nanobody.
In some embodiments, the CAR comprises:
IL13 muteins;
HER 2-binding scFv;
IL13 muteins and HER 2-binding scFv;
HER 2-binding nanobodies;
two HER 2-binding nanobodies;
IL13 muteins and two HER 2-binding nanobodies;
EGFR-binding scFv
Egfrvlll-binding scFv;
EGFR-binding nanobody;
egfrvlll-binding nanobody;
two EGFR or egfrvlll-binding nanobodies;
GPC 3-binding nanobodies; or (b)
GPC 3-bound nanobody and GPC 3-bound scFv.
In certain embodiments, the CAR comprises:
the IL13 mutein comprises an amino acid sequence having at least 60% identity to the amino acid sequence shown in SEQ ID NO. 1;
The HER 2-binding scFv comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs 2-4;
the HER 2-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences shown in SEQ ID NOs 242-259;
the EGFR-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs 15-17 and 260-281;
the EGFRvIII-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences shown in SEQ ID NOs 15-17 and 260-281; or (b)
The GPC 3-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences shown in SEQ ID NOS 282-291,
or a combination thereof.
For example, the sequence identity may be at least about 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%.
In a particular embodiment of the present invention,
the IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 1;
the HER 2-binding scFv comprises an amino acid sequence having at least 90% identity to at least one of the amino acid sequences set forth in SEQ ID NOs 2-4;
the HER 2-binding nanobody comprises an amino acid sequence having at least 90% identity to at least one of the amino acid sequences shown in SEQ ID NOs 242-259;
the EGFR-binding nanobody comprises an amino acid sequence having at least 90% identity to at least one of the amino acid sequences set forth in SEQ ID NOs 15-17 and 260-281;
the EGFRvIII-binding nanobody comprises an amino acid sequence having at least 90% identity to at least one of the amino acid sequences shown in SEQ ID NOs 15-17 and 260-281; or (b)
The GPC 3-binding nanobody comprises an amino acid sequence having at least 90% identity to at least one of the amino acid sequences shown in SEQ ID NOS 282-291,
or a combination thereof.
In some embodiments of the present invention, in some embodiments,
the IL13 mutein comprises at least 1 amino acid substitution relative to the amino acid sequence shown in SEQ ID NO. 1;
the HER 2-binding scFv comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOs 2-4;
The HER 2-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences shown in SEQ ID NOs 242-259;
the EGFR-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences shown in SEQ ID NOS 15-17 and 260-281;
the EGFRvIII-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences shown in SEQ ID NOs 15-17 and 260-281; or (b)
The GPC 3-binding nanobody comprises at least 1 amino acid substitution with respect to at least one of the amino acid sequences shown in SEQ ID NOS 282-291,
or a combination thereof.
The amino acid substitutions in the CAR or T cell adaptor (TE or BiTE) of the invention may be with typical amino acids or atypical amino acid substitutions. Atypical amino acids include, but are not limited to, D-amino acids, such as the D-form of a typical L-amino acid.
In some embodiments, the amino acid substitutions comprise at least one conservative substitution.
In some embodiments, the amino acid substitutions comprise at least one highly conservative substitution.
In some embodiments, the at least one amino acid substitution is at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-45 amino acid substitutions, e.g., about: 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12 or 10-12 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1-25 amino acid substitutions, e.g., about: 1-22, 2-20, 3-18, 4-16, 5-14,6-14,6-12, 7-10 or 8-10 amino acid substitutions. In particular embodiments, the at least one amino acid substitution is about 1-12 amino acid substitutions, e.g., about 1-11, 2-10, 3-9, 4-8, 5-7, or 6-7 amino acid substitutions.
In some embodiments of the present invention, in some embodiments,
the IL13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1;
the HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs 2-4;
the HER 2-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOs 242-259;
the EGFR-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS 15-17 and 260-281;
the EGFRvIII-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS 15-17 and 260-281; or (b)
The GPC 3-binding nanobody comprises about 1-12 amino acid substitutions with respect to at least one of the amino acid sequences shown in SEQ ID NOS 282-291,
or a combination thereof.
In a particular embodiment of the present invention,
the IL13 mutein comprises an amino acid sequence shown as SEQ ID NO. 1;
the HER 2-binding scFv comprises an amino acid sequence shown in any one of SEQ ID NOs 2-4;
the HER 2-binding nanobody comprises an amino acid sequence as shown in any one of SEQ ID NOs 242-259;
The EGFR-binding nanobody comprises an amino acid sequence as shown in any one of SEQ ID NOs 15-17 and 260-281;
the EGFRvIII-binding nanobody comprises an amino acid sequence shown in any one of SEQ ID NOs 15-17 and 260-281; or (b)
The GPC 3-binding nanobody comprises an amino acid sequence as shown in any one of SEQ ID NOs 282-291,
or a combination thereof.
In some embodiments, the CAR (e.g., a bispecific CAR) further comprises a linker, a CD8 a signal peptide, a CD8 a hinge, a CD28 transmembrane domain, a 4-1BB costimulatory domain, or a CD3 zeta signal domain, or a combination thereof. In some embodiments, the bispecific CAR further comprises a CD8 a signal peptide, a CD8 a hinge, a CD28 transmembrane domain, a 4-1BB costimulatory domain, and a CD3 zeta signal domain.
In some embodiments, the linker comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 5. In some embodiments, the CD8 a signal peptide comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 6. In some embodiments, the CD8 a hinge comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 7. In some embodiments, the CD28 transmembrane domain comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 8. In some embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 9. In some embodiments, the CD3 zeta signaling domain comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence shown in SEQ ID NO. 10.
In certain embodiments, the linker comprises 1 or 2 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 5. In certain embodiments, the CD 8. Alpha. Signal peptide comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 6. In certain embodiments, the CD8 alpha hinge comprises about 1-5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 7. In certain embodiments, the CD28 transmembrane domain comprises about 1-3 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 8. In certain embodiments, the 4-1BB costimulatory domain comprises about 1-5 amino acid substitutions relative to the amino acid sequence depicted in SEQ ID NO. 9. In certain embodiments, the CD3 zeta signaling domain comprises about 1-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10.
In a particular embodiment, the linker comprises the amino acid sequence shown as SEQ ID NO. 5. In a specific embodiment, the CD 8. Alpha. Signal peptide comprises the amino acid sequence shown in SEQ ID NO. 6. In a particular embodiment, the CD 8. Alpha. Hinge comprises the amino acid sequence shown in SEQ ID NO. 7. In a particular embodiment, the CD28 transmembrane domain comprises the amino acid sequence shown in SEQ ID NO. 8. In a specific embodiment, the 4-1BB costimulatory domain comprises the amino acid sequence depicted as SEQ ID NO. 9. In a particular embodiment, the CD3 zeta signaling domain comprises the amino acid sequence shown in SEQ ID NO. 10.
In some embodiments, the second TAA is IL13 ra 2, her2, egfr, egfrvlll, or GPC3.
In certain embodiments, the T cell adaptor (TE or BiTE) comprises an scFv, nanobody, or combination thereof.
In a specific embodiment, the T cell adapter (TE or BiTE) comprises a CD 3-binding scFv. In a specific embodiment, the T cell adapter (TE or BiTE) comprises an Epidermal Growth Factor Receptor (EGFR) -binding scFv. In certain embodiments, the T cell engager (TE or BiTE) comprises an EGFR-binding nanobody. In a specific embodiment, the T cell adapter (TE or BiTE) comprises two EGFR-binding nanobodies. In a specific embodiment, the T cell adapter (TE or BiTE) comprises two EGFR-binding nanobodies. In a particular embodiment, the T cell adaptor (TE or BiTE) comprises two glucagon-3 (GPC 3) -binding nanobodies.
In some embodiments, the EGFR or EGFRvIII-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences shown in SEQ ID NOS 15-17 and 260-281. In some embodiments, the GPC 3-binding nanobody comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 282-291.
Illustratively, the sequence identity may be at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95%, or 90-95%.
In particular embodiments, the EGFR or EGFRvIII-binding nanobody comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98% or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOS: 15-17 and 260-281. In some embodiments, the GPC 3-binding nanobody comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs: 282-291.
In some embodiments, the EGFR-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOS: 15-17 and 260-281. In some embodiments, the EGFRvIII-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOS 15-17 and 260-281. In some embodiments, the GPC 3-binding nanobody comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences shown in SEQ ID NOs: 282-291.
In some embodiments, the at least one amino acid substitution is at least: 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-45 amino acid substitutions, e.g., about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1-25 amino acid substitutions, e.g., about 1-22, 2-20, 3-18, 4-16, 5-14, 6-12, 7-10 or 8-10 amino acid substitutions. In particular embodiments, the at least one amino acid substitution is about 1-12 amino acid substitutions, e.g., about 1-11, 2-10, 3-9, 4-8, 5-7, or 6-7 amino acid substitutions.
In certain embodiments, the EGFR-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS:15-17 and 260-281. In certain embodiments, the EGFRvIII-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS 15-17 and 260-281. In certain embodiments, the GPC 3-binding nanobody comprises about 1-12 amino acid substitutions relative to at least one of the amino acid sequences shown in SEQ ID NOs: 282-291.
In a specific embodiment, the EGFR or EGFRvIII-binding nanobody comprises an amino acid sequence set forth in any one of SEQ ID NOs:15-17 and 260-281. In a particular embodiment, the GPC 3-binding nanobody comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 282-291.
In some embodiments, the T cell adapter (TE or BiTE) comprises a signal peptide. In certain embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 19.
In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOS.21-27, 109-111, 176-178 and 292. Illustratively, the sequence identity may be at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95%, or 90-95%. In particular embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98% or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOS: 21-27, 109-111, 176-178 and 292.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences shown in SEQ ID NOS.21-23, 109-111. In some embodiments, the at least one amino acid substitution is at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-45 amino acid substitutions, e.g., about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1-25 amino acid substitutions, e.g., about 1-22, 2-20, 3-18, 4-16, 5-14, 6-12, 7-10 or 8-10 amino acid substitutions. In particular embodiments, the at least one amino acid substitution is about 1-12 amino acid substitutions, e.g., about 1-11, 2-10, 3-9, 4-8, 5-7, or 6-7 amino acid substitutions. In certain embodiments, the T cell adapter (TE or BiTE) comprises about 1-40 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS.21-23, 109-111.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOS.24-27, 176-178 and 292. In certain embodiments, the at least one amino acid substitution is at least 2,3,4,5,6,7,8,9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22,23,24,25,26,27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, or 70 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-70 amino acid substitutions, e.g., about 1-65,1-60,1-55, 5-50, 10-50, 10-45, 15-45, 15-40, 20-40, 20-35, 25-35, or 25-30 amino acid substitutions. In certain embodiments, the T cell adapter (TE or BiTE) comprises about 1-55 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS.24-27, 176-178 and 292. In a particular embodiment, the T cell adapter (TE or BiTE) comprises an amino acid sequence as set forth in any one of SEQ ID NOS 21,22,23,24,25,26,27,109,110,111,176,177,178 or 292.
In some embodiments, the polynucleotide sequence encoding the amino acid sequence comprises an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs:31-38,SEQ ID NOs:106-108,SEQ ID NOs:112-119,SEQ ID NOs:173-175,SEQ ID NOs:179-186,SEQ ID NOs:192-203,SEQ ID NOs:222-237 or SEQ ID NOs:239-241, or a combination thereof. Illustratively, the sequence identity may be at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In certain embodiments, the sequence identity is about 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In particular embodiments, the sequence identity is about 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95%, or 90-95%.
In some embodiments, the polynucleotide sequence encoding the amino acid sequence comprises an amino acid sequence that is at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identical to at least one of the amino acid sequences set forth in SEQ ID NOs:31-38,SEQ ID NOs:106-108,SEQ ID NOs:112-119,SEQ ID NOs:173-175,SEQ ID NOs:179-186,SEQ ID NOs:192-203,SEQ ID NOs:222-237 or SEQ ID NOs:239-241, or a combination thereof.
In certain embodiments, the polynucleotide sequence encoding the amino acid sequence comprises at least 1 amino acid substitution relative to at least one of the amino acid sequences each independently selected from the group consisting of SEQ ID NOs:31-38,SEQ ID NOs:106-108,SEQ ID NOs:112-119,SEQ ID NOs:173-175,SEQ ID NOs:179-186,SEQ ID NOs:192-203,SEQ ID NOs:222-237 or SEQ ID NOs:239-241, or a combination thereof. In some embodiments, the at least one amino acid substitution is at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, or 60 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-60 amino acid substitutions, e.g., about 1-55,1-50,1-45,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions. In certain embodiments, the polynucleotide sequence encoding the amino acid sequence comprises about 1-50 amino acid substitutions relative to at least one of the amino acid sequences each independently selected from the group consisting of SEQ ID NOs:31-38,SEQ ID NOs:106-108,SEQ ID NOs:112-119,SEQ ID NOs:173-175,SEQ ID NOs:179-186,SEQ ID NOs:192-203,SEQ ID NOs:222-237 or SEQ ID NOs: 239-241.
In particular embodiments, the polynucleotide sequence encodes an amino acid sequence as set forth in SEQ ID NOs:31-38,SEQ ID NOs:106-108,SEQ ID NOs:112-119,SEQ ID NOs:173-175,SEQ ID NOs:179-186,SEQ ID NOs:192-203,SEQ ID NOs:222-237 or SEQ ID NOs: 239-241.
In one aspect, the present invention provides a first polynucleotide comprising a sequence encoding a humus and antigen receptor (CAR) and a second polynucleotide comprising a T cell adaptor (TE or BiTE), wherein the CAR is capable of binding to one or more first TAAs and the T cell adaptor (TE or BiTE) is capable of binding to a T cell and a second TAA. In some embodiments, the first polynucleotide comprises a polynucleotide as defined herein. In some embodiments, the second polynucleotide comprises a polynucleotide as defined herein.
In another aspect, the invention provides a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, wherein the bispecific CAR comprises an IL13 mutein linked to a HER 2-binding scFv via a linker sequence.
IL13 muteins
In some embodiments, the IL13 mutein comprises the amino acid sequence set forth in SEQ ID NO. 1 (Table 1).
In some embodiments, the IL13 mutein comprises, or consists essentially of, or consists of an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO. 1. Illustratively, the sequence identity to SEQ ID NO. 1 is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 1.
In some embodiments, the IL13 mutein comprises at least 1 amino acid substitution relative to SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to SEQ ID No. 1. In some embodiments, the IL13 mutein comprises about 1-45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises about 1-11,2-12,2-11, 3-10, 4-9, 5-8,6-8 or 6-7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises about 45, 40, 35, 30, 25, 20, 15, 10,6 or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1.
HER 2-binding ScFv
In some embodiments, the HER 2-binding ScFv comprises, or consists essentially of, or consists of, the amino acid sequence shown as SEQ ID NO. 2,3 or 4 (Table 1). In some embodiments, the HER 2-binding ScFv comprises, or consists essentially of, or consists of the amino acid sequence shown in SEQ ID NO. 4.
In some embodiments, the HER 2-binding ScFv comprises or consists essentially of or consists of an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID No. 2,3 or 4, or a combination thereof. Illustratively, the sequence identity to SEQ ID NOs 2,3, or 4, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the HER 2-binding ScFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 2,3 or 4.
In some embodiments, the HER 2-binding ScFv comprises, or consists essentially of, or consists of an amino acid sequence having at least 60% identity to the amino acid sequence shown in SEQ ID NO. 4. Illustratively, the sequence identity to SEQ ID NO. 4 is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the HER 2-binding ScFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 4.
In some embodiments, the HER 2-binding ScFv comprises at least 1 amino acid substitution relative to SEQ ID NO:2,3, or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 amino acid substitutions relative to SEQ ID No. 2,3, or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises about 1-95 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 2,3 or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises about 1-90,2-95,2-90,4-90,4-85,6-85,6-80,8-80,8-75, 10-75, 10-70, 15-70, 15-65, 20-65, 20-60, 25-60, 25-50, 30-50, or 30-40 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 2,3, or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 2,3 or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 2,3, or 4, or a combination thereof. In some embodiments, the HER 2-binding ScFv comprises up to about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 2,3, or 4, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the HER 2-binding ScFv comprises at least 1 amino acid substitution relative to SEQ ID NO. 4. In some embodiments, the HER 2-binding ScFv comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 amino acid substitutions relative to SEQ ID No. 4. In some embodiments, the HER 2-binding ScFv comprises about 1-95 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding ScFv comprises about 1-90,2-95,2-90,4-90,4-85,6-85,6-80,8-80,8-75, 10-75, 10-70, 15-70, 15-65, 20-65, 20-60, 25-60, 25-50, 30-50, or 30-40 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding ScFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding ScFv comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding ScFv comprises up to about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 4. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
3. Connector
In some embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO. 5 (Table 1). In some embodiments, the linker comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 5. In some embodiments, the linker comprises at least 1 amino acid substitution (e.g., 1,2, or 3 amino acid substitutions) relative to SEQ ID No. 5. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
CD8α signal peptide
In some embodiments, the CD 8. Alpha. Signal peptide comprises the amino acid sequence shown as SEQ ID NO. 6 (Table 1). In some embodiments, the CD8 a signal peptide comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 6. In some embodiments, the CD8 a signal peptide comprises at least 1 amino acid substitution (e.g., 1,2, or 3 amino acid substitutions) relative to SEQ ID NO: 6. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
CD8α hinge
In some embodiments, the CD 8. Alpha. Hinge comprises the amino acid sequence shown as SEQ ID NO. 7 (Table 1). In some embodiments, the CD8 a hinge comprises an amino acid sequence having at least 80% (e.g., 81%,82%,83%,84%,85%,86%,87%,88%,89%,90%,91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 7. In some embodiments, the CD 8. Alpha. Hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 7. In some embodiments, the CD8 a hinge comprises at least 1 amino acid substitution (e.g., 1,2,3,4, or 5 amino acid substitutions) relative to SEQ ID NO: 7. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
CD28 transmembrane domain
In some embodiments, the CD28 transmembrane domain comprises the amino acid sequence shown as SEQ ID NO. 8 (Table 1). In some embodiments, the CD28 transmembrane domain comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 8. In some embodiments, the CD28 transmembrane domain comprises at least 1 amino acid substitution (e.g., 1,2, or 3 amino acid substitutions) relative to SEQ ID NO: 8. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
7.4-1BB costimulatory Domain
In some embodiments, the 4-1BB costimulatory domain comprises the amino acid sequence shown as SEQ ID NO. 9 (Table 1). In some embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 9. In some embodiments, the 4-1BB co-stimulatory domain comprises at least 1 amino acid substitution (e.g., 1,2,3, or 4 amino acid substitutions) relative to SEQ ID NO: 9. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
Cd3ζ signaling domain
In some embodiments, the CD3 zeta signaling domain comprises the amino acid sequence shown as SEQ ID NO. 10 (Table 1).
In some embodiments, the CD3ζ signaling domain comprises an amino acid sequence having at least 60% identity to the amino acid sequence shown in SEQ ID NO. 10. Illustratively, the sequence identity to SEQ ID NO. 1 is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the CD3ζ signaling domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence depicted in SEQ ID NO. 10.
In some embodiments, the CD3 zeta signaling domain comprises at least 1 amino acid substitution relative to SEQ ID NO. 10. In some embodiments, the CD3 zeta signaling domain comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to SEQ ID No. 10. In some embodiments, the CD3 zeta signaling domain comprises about 1-45 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10. In some embodiments, the CD3 zeta signaling domain comprises about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO 10. In some embodiments, the CD3 zeta signaling domain comprises about 1-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10. In some embodiments, the CD3 zeta signaling domain comprises about 1-11,2-12,2-11, 3-10, 4-9, 5-8,6-8, or 6-7 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10. In some embodiments, the CD3 zeta signaling domain comprises about 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments:
the IL13 muteins each independently comprise an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 1;
the HER 2-binding scFv each independently comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID No. 2,3 or 4, or a combination thereof;
the CD8 alpha signal peptide comprises an amino acid sequence with at least 90% identity with the amino acid sequence shown in SEQ ID NO. 6;
the CD8 a hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 7;
the CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 8;
the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 9; or (b)
The CD3 zeta signaling domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
In some embodiments of the present invention, in some embodiments,
the IL13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1;
the HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 2,3 or 4, or a combination thereof;
The CD8 alpha signal peptide comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 6;
the linker comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 3;
the CD8 alpha hinge comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 7;
the CD28 transmembrane domain comprises about 1-3 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 8;
the 4-1BB costimulatory domain comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 9; or (b)
The CD3 zeta signaling domain comprises about 1-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located at the N-terminus of the linker, the linker is located at the N-terminus of the HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, and the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta signal domain (fig. 1).
In some embodiments, the bispecific CAR comprises the amino acid sequence as shown in SEQ ID NO. 11,12 or 13 (Table 1).
In some embodiments, the bispecific CAR comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof. Illustratively, the sequence identity to SEQ ID NOs 11,12 or 13, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the bispecific CAR comprises an amino acid sequence that is at least 80%,85%,90%,95%,98%, or 99% identical to the amino acid sequence set forth in SEQ ID No. 11,12, or 13.
In some embodiments, the bispecific CAR comprises at least 1 amino acid substitution relative to SEQ ID No. 11,12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises at least, relative to SEQ ID NO:11,12, or 13, or a combination thereof: 2,3,4,5,6,7,8,9, 10, 11,12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110 or 120 amino acid substitutions. In some embodiments, the bispecific CAR comprises about 1 to 120 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof: 1-110, 2-100, 4-90,6-90,6-80,8-80,8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions. In some embodiments, the bispecific CAR comprises about 1 to 60 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof. In some embodiments, the bispecific CAR comprises about the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof: 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12 or 10-12 amino acid substitutions. In some embodiments, the bispecific CAR comprises up to about the amino acid sequence set forth in SEQ ID No. 11,12, or 13, or a combination thereof: 95 A substitution of 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6 or 5 amino acids. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
B. Polynucleotides encoding T cell adaptors (TEs or Bites)
In another aspect, the invention provides a polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding to a T cell, a first TAA epitope and a second TAA epitope. In some embodiments, the first TAA epitope and the second TAA epitope are on a second TAA. In some embodiments, the first TAA epitope and the second TAA epitope are on two second TAAs.
In some embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, CD31, or CD277. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD3.
In some embodiments, the T cell adapter (TE or BiTE) comprises a first binding moiety and a second binding moiety. In certain embodiments, the first binding moiety is capable of binding to a T cell surface antigen. In certain embodiments, the second binding moiety is capable of binding to the first TAA. In certain embodiments, the T cell adapter (TE or BiTE) comprises a third binding moiety that is capable of binding to a second TAA. In some embodiments, the first TAA and the second TAA are the same. In certain embodiments, the first binding moiety and the second binding moiety are capable of binding two different epitopes. In some embodiments, the first TAA and the second TAA are different.
In some embodiments, the TAA is CEA, GPC3, MUC-1, epCAM, HER receptor, PEM, A33, G250, carbohydrate antigen Ley, lex, leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, erbB2, erbB3, WT1, MUC1, LMP2, idiotype, HPVE6& E7, EGFR, EGFRvIII, HER-2/neu, MAGEA3, p53 non-mutant, p53 mutant, NY-ESO-1, GD2, PSMA, PCSA, PSA, melana/MART1, ras mutant, protease 3 (PR 1), bcr-abl, tyrosinase, survivin, PSA, or hTERT. In some embodiments, the TAA is glioblastoma tumor antigen. In certain embodiments, the TAA is HER2, GPC3, EGFR, or egfrvlll. In a particular embodiment, the TAA is HER2. In a particular embodiment, the TAA is GPC3. In a particular embodiment, the TAA is EFGR. In a particular embodiment, the TAA is egfrvlll.
In some embodiments, the T cell adapter (TE or BiTE) comprises a CD 3-binding scFv.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 EGFR-binding nanobody. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 egfrvlll-binding nanobody. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 GPC 3-binding nanobody. In some embodiments, the T cell adapter (TE or BiTE) comprises 2 EGFR-binding nanobodies. In some embodiments, the T cell adaptor (TE or BiTE) comprises 2 egfrvlll-binding nanobodies. In some embodiments, the T cell adapter (TE or BiTE) comprises 2 GPC 3-binding nanobodies. In some embodiments, the T cell adapter (TE or BiTE) comprises 1 EGFR-binding nanobody and 1 egfrvlll-binding nanobody. In some embodiments, the T cell adapter (TE or BiTE) comprises 1 EGFR-binding nanobody and 1 GPC 3-binding nanobody. In some embodiments, the T cell adapter (TE or BiTE) comprises 1 GPC 3-binding nanobody and 1 egfrvlll-binding nanobody.
In some embodiments, the T cell adapter (TE or BiTE) comprises a linker, a signal peptide or peptide tag, or a combination thereof.
In some embodiments, the polynucleotide is isolated (e.g., produced by synthesis or molecular cloning). In some embodiments, the polynucleotide is integrated into the genomic DNA of a host cell (e.g., a T lymphocyte). In some embodiments, the polynucleotide is extrachromosomal within the host cell (e.g., on a plasmid, on a viral vector). In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is RNA. The polynucleotide may be inserted into a plasmid or vector, such as a viral vector (e.g., a lentiviral vector). In addition, the polynucleotide may include one or more modified nucleotides (e.g., one or more chemically modified nucleotides).
In some embodiments, the first nanobody and the second nanobody each independently comprise an amino acid sequence having at least 60% identity to at least one of the amino acid sequences set forth in SEQ ID NOs:24-27,176-178 and 292. Illustratively, the sequence identity may be at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In certain embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In certain embodiments, the first nanobody/second nanobody, or both, comprise an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to at least one of the amino acid sequences set forth in SEQ ID NOs:24-27,176-178 and 292.
In some embodiments, the first nanobody and the second nanobody each independently comprise an amino acid sequence having at least one amino acid substitution relative to at least one of the amino acid sequences set forth in SEQ ID NOS.24-27, 176-178 and 292. In some embodiments, the at least one amino acid substitution is at least: 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, or 60 amino acid substitutions. In some embodiments, the at least one amino acid substitution is about 1-60 amino acid substitutions, illustratively, about: 1-55,1-50,1-45,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions. In certain embodiments, the first nanobody, the second nanobody, or both comprise an amino acid sequence having at least about 1-50 amino acid substitutions relative to at least one of the amino acid sequences set forth in SEQ ID NOS: 24-27,176-178 and 292.
In a particular embodiment, the first nanobody and the second nanobody each independently comprise an amino acid sequence as set forth in SEQ ID NOS.24-27, 176-178 and 292.
CD3-binding ScFv
In some embodiments, the CD 3-binding ScFv comprises the amino acid sequence as set forth in SEQ ID NO. 14 (Table 2).
In some embodiments, the CD 3-binding ScFv comprises an amino acid sequence having at least 60% identity to the amino acid sequence shown in SEQ ID NO. 14. Illustratively, the sequence identity to SEQ ID NO. 14 is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the CD 3-binding ScFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 14.
In some embodiments, the CD 3-binding ScFv comprises at least 1 amino acid substitution relative to SEQ ID NO. 14. In some embodiments, the CD 3-binding ScFv comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 amino acid substitutions relative to SEQ ID No. 1. In some embodiments, the CD 3-binding ScFv comprises about 1-95 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 14. In some embodiments, the CD 3-binding ScFv comprises about 1-90,2-95,2-90,4-90,4-85,6-85,6-80,8-80,8-75, 10-75, 10-70, 15-70, 15-65, 20-65, 20-60, 25-60, 25-50, 30-50, or 30-40 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 14. In some embodiments, the CD 3-binding ScFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 14. In some embodiments, the CD 3-binding ScFv comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 14. In some embodiments, the CD 3-binding ScFv comprises up to about 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6 or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 14. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
2. Tumor specific antigen (TAA)
In some embodiments, the TAA is glioblastoma tumor antigen.
In some embodiments, the glioblastoma tumor antigen is EGFR.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least one EGFR-binding nanobody.
In some embodiments, the EGFR-binding nanobody comprises the amino acid sequence set forth in SEQ ID NO. 15,16 or 17 (Table 2).
In some embodiments, the EGFR-binding nanobody comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the EGFR-binding nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof.
In some embodiments, the EGFR-binding nanobody comprises at least 1 amino acid substitution relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 15,16, or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises about 1-45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16, or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises about 1-11,2-12,2-11, 3-10, 4-9, 5-8,6-8, or 6-7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16, or 17, or a combination thereof. In some embodiments, the EGFR-binding nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10,6 or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the glioblastoma tumor antigen is egfrvlll.
In some embodiments, the T cell adaptor (TE or BiTE) comprises at least one egfrvlll-binding nanobody.
In some embodiments, the EGFRvIII-binding nanobody comprises an amino acid sequence as set forth in SEQ ID NO. 15,16 or 17 (Table 2).
In some embodiments, the EGFRvIII-binding nanobody comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the EGFRvIII-binding nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof.
In some embodiments, the EGFRvIII-binding nanobody comprises at least 1 amino acid substitution relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the egfrvlll-binding nanobody comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 15,16, or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding nanobody comprises about 1-45 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding nanobody comprises about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16, or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding nanobody comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding nanobody comprises about 1-11,2-12,2-11, 3-10, 4-9, 5-8,6-8, or 6-7 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16, or 17, or a combination thereof. In some embodiments, the EGFRvIII-binding nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10,6 or 5 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least one GPC 3-binding nanobody.
In some embodiments, the GPC 3-binding nanobody comprises an amino acid sequence as set forth in any one of SEQ ID NOS 282-291. In a particular embodiment, the GPC 3-binding nanobody comprises the amino acid sequence shown as SEQ ID NO 284,286 or 289.
In some embodiments, the GPC 3-binding nanobody comprises an amino acid sequence having at least 60% identity to any one of the amino acid sequences shown in SEQ ID NOS 282-291, or a combination thereof. Illustratively, the sequence identity to any one of the amino acid sequences set forth in any one of SEQ ID NOS: 282-291, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the GPC 3-binding nanobody comprises an amino acid sequence having at least 90% identity to any one of the amino acid sequences shown in SEQ ID NOS 282-291, or a combination thereof.
In some embodiments, the GPC 3-binding nanobody comprises at least 1 amino acid substitution relative to the amino acid sequence set forth in any one of SEQ ID NOS 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises about 1-45 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOS: 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises about 1-40,2-45,2-40, 3-35,4-35,4-30, 5-25,6-25,6-20, 7-15, 8-14, 9-12, or 10-12 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOs 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOS: 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises about 1-11,2-12,2-11, 3-10, 4-9, 5-8,6-8, or 6-7 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOS: 282-291, or a combination thereof. In some embodiments, the GPC 3-binding nanobody comprises up to about 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to the amino acid sequence set forth in any one of SEQ ID NOS: 282-291, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
3. Connector
In some embodiments, the T cell adapter (TE or BiTE) comprises at least one EGFR-binding nanobody or EGFR-binding scFv linked to a CD 3-binding scFv by a linker sequence. In some embodiments, the T cell adapter (TE or BiTE) comprises at least one egfrvlll-binding nanobody or egfrvlll-binding scFv linked to a CD 3-binding scFv by a linker sequence. In some embodiments, the linker sequence comprises GGGGS (SEQ ID NO: 18) (Table 2).
In some embodiments, the T cell adapter (TE or BiTE) comprises at least one GPC 3-binding nanobody or GPC 3-binding scFv, which is linked to a CD 3-binding scFv by a linker sequence.
4. Signal peptides
In some embodiments, the T cell adapter (TE or BiTE) comprises a signal peptide. In some embodiments, the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 19 (Table 2).
In some embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 19. In some embodiments, the signal peptide comprises an amino acid sequence that has at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 19. In some embodiments, the signal peptide comprises an amino acid sequence comprising at least 1 amino acid substitution (e.g., 1,2, or 3 amino acid substitutions) relative to the amino acid sequence set forth in SEQ ID NO. 19. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
5. Peptide tag
In some embodiments, the peptide tag comprises a polyhistidine sequence, e.g., 6 XHis (SEQ ID NO: 20) (Table 2).
6. Structure of the
In some embodiments, the T cell adapter (TE or BiTE) comprises an EGFR-binding nanobody. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding nanobody, which is located at the N-terminus of the linker, which is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adaptor (TE or BiTE) comprises egfrvlll-binding nanobodies. In some embodiments, the signal peptide is located at the N-terminus of the egfrvlll-binding nanobody, which is located at the N-terminus of the linker, which is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises GPC 3-binding nanobodies. In some embodiments, the signal peptide is located at the N-terminus of the GPC 3-binding nanobody, the GPC 3-binding nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO. 21,22,23 (Table 2), 109,110 or 111.
In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 80%,85%,90%,95%,98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 amino acid substitution relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22,23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, or 160 amino acid substitutions relative to SEQ ID No. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-160 amino acid substitutions relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-140,2-160,2-140, 4-120,6-120,6-100,8-100,8-80, 10-80, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 21,22,23,109,110 or 111, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the T cell adapter (TE or BiTE) comprises an EGFR-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding scFv, which is located at the N-terminus of the linker, which is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 EGFR-binding nanobodies. In some embodiments, the T cell adapter (TE or BiTE) comprises 2 EGFR-binding nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding nanobody that is located at the N-terminus of a first linker that is located at the N-terminus of a second EGFR-binding nanobody that is located at the N-terminus of a second linker that is located at the N-terminus of a CD 3-binding scFv (fig. 6, middle panel).
In some embodiments, the T cell adaptor (TE or BiTE) comprises an egfrvlll-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the egfrvlll-binding scFv, the egfrvlll-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 egfrvlll-binding nanobodies. In some embodiments, the T cell adaptor (TE or BiTE) comprises 2 egfrvlll-binding nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding nanobody located at the N-terminus of a first linker located at the N-terminus of a second egfrvlll-binding nanobody located at the N-terminus of a second linker located at the N-terminus of a CD 3-binding scFv (fig. 6, middle panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 EGFR-binding nanobody and at least 1 egfrvlll-binding nanobody. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding nanobody, the EGFR-binding nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the egfrvlll-binding nanobody, the egfrvlll-binding nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the CD 3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the egfrvlll-binding nanobody, the egfrvlll-binding nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the EGFR-binding nanobody, the EGFR-binding nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of the CD 3-binding scFv.
In some embodiments, the T cell adapter (TE or BiTE) comprises GPC 3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the GPC 3-binding scFv, the GPC 3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 6, top panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 GPC 3-binding nanobodies. In some embodiments, the T cell adapter (TE or BiTE) comprises 2 GPC 3-binding nanobodies. In some embodiments, the signal peptide is located at the N-terminus of a first GPC 3-binding nanobody, the first GPC 3-binding nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second GPC 3-binding nanobody, the second GPC 3-binding nanobody is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD 3-binding scFv (fig. 6, middle panel).
In some embodiments, the T cell adapter (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO. 24,25 (Table 2), 176 or 177.
In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 60% identity to SEQ ID NO. 24,25,176 or 177, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 24,25,176 or 177, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 80%,85%,90%,95%,98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO. 24,25,176 or 177, or a combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 amino acid substitution relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or 210 amino acid substitutions relative to SEQ ID No. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-210 amino acid substitutions relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-200,2-210,2-200, 4-180,6-180,6-160,8-160,8-140, 10-140, 10-120, 15-120, 15-100, 20-100, 20-80, 25-80, 25-60, 30-60, or 30-40 amino acid substitutions relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 24,25,176 or 177, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 24,25,176 or 177, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 EGFR-binding scFv. In some embodiments, the T cell adapter (TE or BiTE) comprises 2 EGFR-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of a second EGFR-binding scFv, the second EGFR-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a CD 3-binding scFv.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 egfrvlll-binding scFv. In some embodiments, the T cell adaptor (TE or BiTE) comprises 2 egfrvlll-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding scFv, the first egfrvlll-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of a second egfrvlll-binding scFv, the second egfrvlll-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a CD 3-binding scFv.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 EGFR-binding scFv and at least 1 egfrvlll-binding scFv. In some embodiments, the T cell adapter (TE or BiTE) comprises 1 EGFR-binding scFv and 1 egfrvlll-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the EGFR-binding scFv, the EGFR-binding scFv is located at the N-terminus of the first linker, the first linker is located at the N-terminus of the egfrvlll-binding scFv, the egfrvlll-binding scFv is located at the N-terminus of the second linker, and the second linker is located at the N-terminus of the CD 3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of the egfrvlll-binding scFv, the egfrvlll-binding scFv is located at the N-terminus of the first linker, the first linker is located at the N-terminus of the EGFR-binding scFv, the EGFR-binding scFv is located at the N-terminus of the second linker, and the second linker is located at the N-terminus of the CD 3-binding scFv.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 GPC 3-binding scFv. In some embodiments, the T cell adaptor (TE or BiTE) comprises 2 GPC 3-binding scFv. In some embodiments, the signal peptide is located at the N-terminus of a first GPC 3-binding scFv, the first GPC 3-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of a second GPC 3-binding scFv, the second GPC 3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a CD 3-binding scFv.
In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding nanobody that is located at the N-terminus of a first linker that is located at the N-terminus of the CD 3-binding scFv that is located at the N-terminus of a second linker that is located at the N-terminus of a second EGFR-binding nanobody (fig. 6, bottom panel).
In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding nanobody located at the N-terminus of a first linker located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv located at the N-terminus of a second linker located at the N-terminus of a second egfrvlll-binding nanobody (fig. 6, bottom panel).
In some embodiments, the signal peptide is located at the N-terminus of a first GPC 3-binding nanobody, the first GPC 3-binding nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second GPC 3-binding nanobody.
In some embodiments, the signal peptide is located at the N-terminus of an EGFR-binding nanobody that is located at the N-terminus of a first linker that is located at the N-terminus of the CD 3-binding scFv that is located at the N-terminus of a second linker that is located at the N-terminus of an egfrvlll-binding nanobody.
In some embodiments, the signal peptide is located at the N-terminus of an egfrvlll-binding nanobody, the egfrvlll-binding nanobody is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of an EGFR-binding nanobody.
In some embodiments, the T cell adapter (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO 26,27 (Table 2), or 178 or 292.
In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 60% identity to SEQ ID NO. 26,27,178 or 292, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 26,27,178 or 292, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 80%,85%,90%,95%,98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO. 26,27,178 or 292, or a combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 amino acid substitution relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or 210 amino acid substitutions relative to SEQ ID No. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-210 amino acid substitutions relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-200,2-210,2-200, 4-180,6-180,6-160,8-160,8-140, 10-140, 10-120, 15-120, 15-100, 20-100, 20-80, 25-80, 25-60, 30-60, or 30-40 amino acid substitutions relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-60 amino acid substitutions relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-25 amino acid substitutions relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 26,27,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises up to about 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 26,27,178 or 292, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a second EGFR-binding scFv.
In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding scFv, the first egfrvlll-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a second egfrvlll-binding scFv.
In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding scFv, the first GPC 3-binding scFv is located at the N-terminus of a first linker, the first linker is located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminus of a second linker, and the second linker is located at the N-terminus of a second GPC 3-binding scFv.
In some embodiments, the signal peptide is located at the N-terminus of a first EGFR-binding scFv, the first EGFR-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a second egfrvlll-binding scFv.
In some embodiments, the signal peptide is located at the N-terminus of a first egfrvlll-binding scFv, the first egfrvlll-binding scFv being located at the N-terminus of a first linker, the first linker being located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv being located at the N-terminus of a second linker, the second linker being located at the N-terminus of a second EGFR-binding scFv.
T cell adapter (TE or BiTE)
In another aspect, the invention provides a T cell adapter (TE or BiTE) capable of binding T cells, a first TAA epitope and a second TAA epitope. Wherein the T cell adaptor is produced in situ by the CAR T-cell, is secreted or released by the CAR T-cell by interaction of the CAR and the first TAA, or both. In some embodiments, the T cell adaptor (TE or BiTE) is defined as any one of the T cell adaptors (TE or BiTE) described herein.
In some embodiments, the T cell adapter (TE or BiTE) is encoded in a polynucleotide comprising a sequence encoding the CAR. In some embodiments, the CAR T-cell comprises a polynucleotide comprising a sequence encoding the T-cell adapter (TE or BiTE). In some embodiments, the CAR T-cell comprises a polynucleotide comprising a sequence encoding the CAR. In certain embodiments, the CAR T-cell comprises a polynucleotide comprising a sequence encoding the T-cell adapter (TE or BiTE) and a sequence encoding the CAR. In certain embodiments, the CAR T-cell comprises a first polynucleotide comprising a sequence encoding the T cell adapter (TE or BiTE) and a second polynucleotide encoding the sequence of the CAR.
In some embodiments, the CAR is capable of binding to a first TAA. In certain embodiments, the first TAA is CEA, GPC3, MUC-1, epCAM, HER receptor, PEM, caludi 6, cluadi-18.2, mesothelin, A33, G250, carbohydrate antigen Ley, lex, leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, erbB2, erbB3, MUC1, LMP2, idiotype, HPV E6& E7, EGFR, EGFRvIII, HER-2/neu, MAGE A3, NY-ESO-1, GD2, PSMA, PCSA, PSA, melana/MART1, CD19, CD20, CD22, CD33, CD5, CD70 or BCMA. In certain embodiments, the first TAA is HER2, GPC3, EGFR, egfrvlll or GPC3.
In some embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, CD31, or CD277. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD3.
In some embodiments, the first TAA epitope and the second TAA epitope are located on the second TAA. In some embodiments, the first TAA epitope and the second TAA epitope are located on two second TAAs.
In certain embodiments, the second TAA is CEA, GPC3, MUC-1, epCAM, HER receptor, PEM, caludi 6, cluadi-18.2, mesothelin, A33, G250, carbohydrate antigen Ley, lex, leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, erbB2, erbB3, MUC1, LMP2, idiotype, HPV E6& E7, EGFR, EGFRvIII, HER-2/neu, MAGE A3, NY-ESO-1, GD2, PSMA, PCSA, PSA, melana/MART1, CD19, CD20, CD22, CD33, CD5, CD70 or BCMA. In certain embodiments, the second TAA is HER2, GPC3, EGFR, egfrvlll or GPC3. In certain embodiments, the second TAAs are each independently EGFR, egfrvlll or GPC3.
In some embodiments, the T cell adaptor (TE or BiTE) comprises a single chain variable fragment (scFv), nanobody, or combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) is produced in situ by the CAR T cells. In certain embodiments, the T cell adaptor (TE or BiTE) is made in the vicinity of the CAR T cells. In certain embodiments, the T cell adapter (TE or BiTE) is produced in the vicinity of CAR T cells and tumor cells. In certain embodiments, the CAR T cells secrete a T cell adapter (TE or BiTE).
In certain embodiments, the CAR T cells are activated. In certain embodiments, the CAR T cell is activated by a molecule in the environment in which the CAR T cell is located. In certain embodiments, the CAR T cells are activated by a molecule in the tumor microenvironment in which the CAR T cells are located. In certain embodiments, the CAR T cells are activated by an antigen. In a particular embodiment, the CAR T cell is activated by a TAA. In certain embodiments, the CAR T cell is activated by an interaction between a surface receptor on the CAR T cell and a TAA. For example, the surface receptor on the CAR T cell can be a CAR.
In some embodiments, the CAR T cells are activated via an immune synapse. In certain embodiments, the T cell adapter (TE or BiTE) is produced by the CAR T cell via immune synapses by interaction of the CAR and TAA after T cell activation.
C. Polynucleotides encoding dual CAR and T cell adapter (TE or BiTE) fusion proteins
In another aspect, the invention discloses a polynucleotide comprising a sequence encoding a fusion protein of any one of the dual CARs described herein and any one of the T cell adaptors (TE or BiTE) described herein.
In some embodiments, the dual CAR targets HER2 and IL13 ra 2, and the T cell adapter (TE or BiTE) is capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen).
In some embodiments, the bispecific CAR comprises any one of the IL13 muteins described herein linked to any one of the HER 2-binding scFvs described herein by any one of the linker sequences described herein.
In some embodiments, the bispecific CAR further comprises any one of the CD8 a signal peptides described herein, any one of the CD8 a hinges described herein, any one of the CD28 transmembrane domains described herein, any one of the 4-1BB costimulatory domains described herein, any one of the CD3 zeta domains described herein, or a combination thereof. In some embodiments, the bispecific CAR further comprises any one of the CD8 a signal peptides described herein, any one of the CD8 a hinges described herein, any one of the CD28 transmembrane domains described herein, any one of the 4-1BB costimulatory domains described herein, and any one of the CD3 zeta domains described herein.
In some embodiments, the T cell adapter (TE or BiTE) comprises any one of the CD 3-binding scFvs described herein.
In some embodiments, the TAA (e.g., glioblastoma tumor antigen) is EGFR.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 EGFR-binding nanobody described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 EGFR-binding nanobodies described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises any of the anti-EGFR antibodies described herein.
In some embodiments, the TAA (e.g., glioblastoma tumor antigen) is egfrvlll.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 egfrvlll-binding nanobody described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 egfrvlll-binding nanobodies described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises any of the anti-EGFR antibodies described herein.
In some embodiments, the TAA (e.g., glioblastoma tumor antigen) is GPC3.
In some embodiments, the T cell adapter (TE or BiTE) comprises at least 1 GPC 3-binding nanobody described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises at least 2 GPC 3-binding nanobodies described herein. In some embodiments, the T cell adapter (TE or BiTE) comprises any of the anti-GPC3 antibodies described herein.
In some embodiments, the T cell adapter (TE or BiTE) further comprises any one of the linkers described herein, any one of the signal peptides described herein, any one of the peptide tags described herein, or a combination thereof.
1. Self-cleaving peptides
In some embodiments, the dual car_bite fusion protein further comprises a self-cleaving peptide. In some embodiments, the self-cleaving peptide is a self-cleaving T2A peptide.
In some embodiments, the self-cleaving T2A peptide comprises the amino acid sequence shown as SEQ ID NO. 28 (Table 3). In some embodiments, the self-cleaving T2A peptide comprises an amino acid sequence that is at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identical to the amino acid sequence shown in SEQ ID NO. 28. In some embodiments, the signal peptide comprises an amino acid sequence comprising at least 1 amino acid substitution (e.g., 1,2, or 3 amino acid substitutions) relative to the amino acid sequence set forth in SEQ ID NO. 28. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
2. Structure of the
EGFR or EGFRvIII-binding scFv
In some embodiments, the dual car_bite fusion protein comprises an anti-EGFR antibody or antigen-binding fragment. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-EGFR antibody, the anti-EGFR antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 10, top).
In some embodiments, the dual car_bite fusion protein comprises an anti-egfrvlll antibody or antigen binding fragment. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of a HER 2-binding scFv, said HER 2-binding scFv is located at the N-terminus of said CD8 alpha hinge, said CD8 alpha hinge is located at the N-terminus of said CD28 transmembrane domain, said CD28 transmembrane domain is located at the N-terminus of said 4-1BB costimulatory domain, said 4-1BB costimulatory domain is located at the N-terminus of said CD3 zeta domain, said CD3 zeta domain is located at the N-terminus of said self-cleaving T2A peptide, said self-cleaving peptide comprisingThe self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-EGFRvIII antibody, the anti-EGFRvIII antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (FIG. 10, top panel).
GPC 3-binding scFv
In some embodiments, the dual car_bite fusion protein comprises an anti-GPC 3 antibody or antigen-binding fragment. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of a HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the anti-GPC 3 antibody, the anti-GPC 3 antibody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv.
In some embodiments, the anti-EGFR antibody is cetuximab. In some embodiments, the antigen binding fragment is an scFv of cetuximab.
In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence as set forth in SEQ ID NO. 31 or 35 (Table 3).
In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that has at least 60% identity to SEQ ID No. 31 or 35, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 31 or 35, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that is at least 80%,85%,90%,95%,98%, or 99% identical to the amino acid sequence set forth in SEQ ID No. 31 or 35, or a combination thereof.
In some embodiments, the dual car_bite fusion protein comprises at least 1 amino acid substitution relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-400 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-400,2-350,2-300,4-300,4-250,6-250,6-200,8-200,8-150, 10-150, 10-100, 15-100, 15-80, 20-80, 20-60, 25-60, or 25-40 amino acid substitutions relative to SEQ ID NO. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-120 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-110, 2-100, 4-90,6-90,6-80,8-80,8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 31 or 35, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises up to about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 31 or 35, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
b. EGFR or EGFRvIII-binding nanobodies
In some embodiments, the dual car_bite fusion protein comprises one EGFR-binding nanobody. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFR-binding nanobody, the EGFR-binding nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 10, top).
In some embodiments, the dual car_bite fusion protein comprises one egfrvlll-binding nanobody. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of the HER 2-binding scFv, which HER 2-binding scFv is locatedThe CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the egfrvlll-binding nanobody, the egfrvlll-binding nanobody is located at the N-terminus of the linker, and the linker is located at the N-terminus of the CD 3-binding scFv (fig. 10, top).
In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence as set forth in SEQ ID NO. 32 or 36 (Table 3).
In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that has at least 60% identity to SEQ ID No. 32 or 36, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 32 or 36, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that is at least 80%,85%,90%,95%,98%, or 99% identical to the amino acid sequence set forth in SEQ ID No. 32 or 36, or a combination thereof.
In some embodiments, the dual car_bite fusion protein comprises at least 1 amino acid substitution relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, or 400 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-400 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-400,2-350,2-300,4-300,4-250,6-250,6-200,8-200,8-150, 10-150, 10-100, 15-100, 15-80, 20-80, 20-60, 25-60, or 25-40 amino acid substitutions relative to SEQ ID NO. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-120 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-110, 2-100, 4-90,6-90,6-80,8-80,8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 32 or 36, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises up to about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
c. Two EGFR or EGFRvIII-binding nanobodies
In some embodiments, the dual car_bite fusion protein comprises at least two EGFR-binding nanobodies. In some embodiments, the dual car_bite fusion protein comprises two EGFR-binding nanobodies. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of a first EGFR-binding nanobody, the first EGFR-binding nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of a second EGFR-binding nanobody (fig. 10, lower panel).
In some embodiments, the dual car_bite fusion protein comprises at least two egfrvlll-binding nanobodies. In some embodiments, the dual car_bite fusion protein comprises two egfrvlll-binding nanobodies. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of a HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 alpha hinge, the CD8 alpha hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of a first EGFRvIII-binding nanobody, the first EGFRvIII-binding nanobody is located at the N-terminus of the linker, the self-cleaving T2A peptide, the signal peptide is located at the N-terminus of the first EGFRvIII-binding nanobodyThe linker is located at the N-terminus of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the second egfrvlll-binding nanobody (fig. 10, bottom panel).
In some embodiments, the dual car_bite fusion protein comprises at least one EGFR-binding nanobody and at least one egfrvlll-binding nanobody. In some embodiments, the dual car_bite fusion protein comprises one EGFR-binding nanobody and one egfrvlll-binding nanobody.
In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of a HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 alpha hinge, the CD8 alpha hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of the EGFR-binding nanobody, the first EGFRvIII-binding nanobody is located at the N-terminus of the linker, the CD 3-binding scFv is located at the N-terminus of the linker, and the linker is located at the N-terminus of the EGFRvIII-binding nanobody.
In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 N-terminal of linker (GGGGS) 3 The linker is located at the N-terminus of a HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 alpha hinge, the CD8 alpha hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, and the signal peptide is located at the N-terminus of the EGFRvIII-binding nanobodyThe first EGFRvIII-binding nanobody is located at the N-terminal of the linker, the linker is located at the N-terminal of the CD 3-binding scFv, the CD 3-binding scFv is located at the N-terminal of the linker, and the linker is located at the N-terminal of the EGFR-binding nanobody.
Two GPC 3-binding nanobodies
In some embodiments, the dual car_bite fusion protein comprises at least two GPC 3-binding nanobodies. In some embodiments, the dual car_bite fusion protein comprises two GPC 3-binding nanobodies. In some embodiments, the CD8 a signal peptide is located at the N-terminus of an IL13 mutein, the IL13 mutein is located (GGGGS) 3 The N-terminus of the linker, the (GGGGS) )3 The linker is located at the N-terminus of a HER 2-binding scFv, the HER 2-binding scFv is located at the N-terminus of the CD8 a hinge, the CD8 a hinge is located at the N-terminus of the CD28 transmembrane domain, the CD28 transmembrane domain is located at the N-terminus of the 4-1BB costimulatory domain, the 4-1BB costimulatory domain is located at the N-terminus of the CD3 zeta domain, the CD3 zeta domain is located at the N-terminus of the self-cleaving T2A peptide, the self-cleaving T2A peptide is located at the N-terminus of the signal peptide, the signal peptide is located at the N-terminus of a first GPC 3-binding nanobody, the first GPC 3-binding nanobody is located at the N-terminus of the linker, the linker is located at the N-terminus of the CD 3-binding scFv, and the linker is located at the N-terminus of a second GPC 3-binding nanobody.
In some embodiments, the dual CAR_BiTE fusion protein comprises the amino acid sequence as set forth in SEQ ID NO. 33 or 37 (Table 3).
In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that has at least 60% identity to SEQ ID No. 33 or 37, or a combination thereof. Illustratively, the sequence identity to the amino acid sequence set forth in SEQ ID NO. 33 or 37, or a combination thereof, is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the dual car_bite fusion protein comprises an amino acid sequence that is at least 80%,85%,90%,95%,98%, or 99% identical to the amino acid sequence set forth in SEQ ID No. 33 or 37, or a combination thereof.
In some embodiments, the dual car_bite fusion protein comprises at least 1 amino acid substitution relative to SEQ ID No. 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises at least 2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 amino acid substitutions relative to SEQ ID NO 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-450 amino acid substitutions relative to SEQ ID No. 33 or 37, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-400,2-450,2-400,4-400,4-350,6-350,6-300,8-300,8-250, 10-250, 10-200, 15-200, 15-150, 20-150, 20-100, 25-80, 25-60, 30-60, or 30-40 amino acid substitutions relative to SEQ ID NO. 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-120 amino acid substitutions relative to SEQ ID No. 33 or 37, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-110, 2-100, 4-90,6-90,6-80,8-80,8-70, 10-70, 10-60, 15-60, 15-50, 20-50, 20-40, 25-40, or 25-30 amino acid substitutions relative to SEQ ID NO. 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-60 amino acid substitutions relative to SEQ ID No. 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises about 1-25 amino acid substitutions relative to SEQ ID No. 32 or 36, or a combination thereof. In some embodiments, the dual CAR_BiTE fusion protein comprises about 1-24,2-25,2-24,3-24,3-22, 4-20, 5-18, 6-16,7-16,7-14, 8-12, or 10-12 amino acid substitutions relative to SEQ ID NO. 33 or 37, or a combination thereof. In some embodiments, the dual car_bite fusion protein comprises up to about 400, 350, 300, 250, 200, 150, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10,6, or 5 amino acid substitutions relative to SEQ ID No. 33 or 37, or a combination thereof. In some embodiments, the amino acid substitutions comprise at least one conservative substitution. In some embodiments, the amino acid substitutions comprise at least one highly conserved substitution.
In some embodiments, the polynucleotide comprises a nucleotide sequence that is codon optimized for a mammalian (e.g., human) cell.
In another aspect, the invention provides a polynucleotide comprising a sequence encoding an amino acid sequence comprising an amino acid sequence having at least 60% identity to the amino acid sequences set forth in SEQ ID NOs 2-4, SEQ ID NOs 11-13 and 52, SEQ ID NOs 15-17, SEQ ID NOs 21-23, SEQ ID NOs 49 and 50, SEQ ID NOs 53-70, SEQ ID NOs 72-82, SEQ ID NOs 83-104,SEQ ID NOs:120-137,SEQ ID NOs:139-149,SEQ ID NOs:150-171,SEQ ID NOs:188-191,SEQ ID NOs:204 and 206-214,SEQ ID NOs:215-221, or SEQ ID NOs 242-291, or a combination thereof. Illustratively, the sequence identity is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In some embodiments, the dual CAR_BiTE fusion protein comprises an amino acid sequence having at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98% or 99%) identity to the amino acid sequences set forth in SEQ ID NOs:2-4, SEQ ID NOs:11-13 and 52, SEQ ID NOs:15-17, SEQ ID NOs:21-23, SEQ ID NOs:49 and 50, SEQ ID NOs:53-70, SEQ ID NOs:72-82, SEQ ID NOs:83-104,SEQ ID NOs:120-137,SEQ ID NOs:139-149,SEQ ID NOs:150-171,SEQ ID NOs:188-191,SEQ ID NOs:204 and 206-214,SEQ ID NOs:215-221, or SEQ ID NOs:242-291, or a combination thereof. In particular embodiments, the amino acid sequence is identical to the amino acid sequences shown in SEQ ID NOs:2-4,11-13,15-17,21-23,49,50,52-70,72-104,109-111,120-137,139-171,188-191,204,206-221, and 242-291.
Carrier body
In another aspect, the invention provides a vector comprising any one or more of the polynucleotides described herein.
In some embodiments, the vector is a non-viral vector. Non-limiting examples of non-viral vectors include plasmids, bacterial Artificial Chromosomes (BACs), cosmids, linear artificial chromosomes.
In some embodiments, the vector is a viral vector. Non-limiting examples of viral vectors include adeno-associated viral (AAV) vectors, adenovirus vectors, finger ring viral vectors, coronavirus vectors, herpesvirus vectors, lentiviral vectors, polyoma viral vectors, rabies viral vectors, recombinant simian viral 40 vectors, reoviral vectors, retroviral vectors, rhinoviral vectors, sindbis viral vectors, vaccinia viral vectors, vesicular stomatitis viral vectors, semliki forest viral vectors, and yellow fever viral vectors. In certain embodiments, the viral vectors are moloney murine sarcoma virus (MoMSV), haven murine sarcoma virus (hamus v), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline Leukemia Virus (FLV), foamy virus, friend murine leukemia virus, murine Stem Cell Virus (MSCV), and Rous Sarcoma Virus (RSV) and lentivirus. Non-limiting examples of lentiviruses include human immunodeficiency virus (e.g., HIV type 1 and HIV type 2), vessle Ma Di virus (VMV), caprine Arthritis Encephalitis Virus (CAEV), equine Infectious Anemia Virus (EIAV), feline Immunodeficiency Virus (FIV), bovine Immunodeficiency Virus (BIV), or Simian Immunodeficiency Virus (SIV) vectors.
In certain embodiments, the vector (e.g., a viral vector) is a gene therapy vector.
In some embodiments, the vector is an expression vector.
In some embodiments, the vector (e.g., an expression vector) further comprises an expression control polynucleotide sequence operably linked to the polynucleotide, a polynucleotide sequence encoding a selectable marker, or both. In some embodiments, the expression control polynucleotide sequence comprises a promoter sequence, an enhancer sequence, or both. In some embodiments, the expression control polynucleotide sequence comprises an inducible promoter sequence.
In some embodiments, the expression control polynucleotide sequence comprises an EF1 a core promoter sequence, an MNDU3 promoter sequence, or a combination thereof. In some embodiments, the expression control polynucleotide sequence comprises an EF1 a core promoter sequence. In some embodiments, the expression control polynucleotide sequence comprises an MNDU3 promoter sequence.
EF1 alpha core promoter sequence (SEQ ID NO: 39)
GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG
MNDU3 promoter sequence (SEQ ID NO: 40)
TCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAGAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGGATCAAGGTTAGGAACAGAGAGACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGTTGGAACAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGATC
Fusion proteins
In another aspect, the invention provides a fusion protein encoded by any one of the polynucleotides or vectors (e.g., expression vectors) described herein.
In another aspect, the invention provides a fusion protein comprising a bispecific CAR capable of binding to two different antigens expressed on the surface of a cancer cell, and a T cell adapter (TE or BiTE) capable of binding to a T cell (e.g., CD 3) and TAA (e.g., a tumor antigen, such as a glioblastoma tumor antigen).
The fusion proteins of the present invention may be produced recombinantly or synthetically using conventional methods and reagents well known in the art. Illustratively, fusion proteins of the invention may be recombinantly produced in a suitable host cell (e.g., bacteria) according to methods known in the art. See, for example, current Protocols in Molecular Biology, second Edition, ausubel et al eds., john Wiley & Sons,1992; and Molecular Cloning: a Laboratory Manual,2nd edition,Sambrook et al, 1989,Cold Spring Harbor Laboratory Press. Illustratively, a nucleic acid molecule comprising a nucleotide sequence encoding a fusion protein described herein may be introduced into a suitable host cell (e.g., e.coli) and expressed, and the expressed fusion protein (e.g., inclusion bodies) may be isolated/purified from the host cell using conventional methods and ready reagents. Illustratively, DNA fragments encoding DNA fragments of different protein sequences (e.g., light responsive domains, heterologous peptide components) may be joined together in-frame according to conventional techniques. In another embodiment, the fusion gene may be synthesized by conventional techniques, including the use of an automated DNA synthesizer. Alternatively, PCR amplification of nucleic acid fragments may be performed using anchor primers that create complementary overhangs between two consecutive nucleic acid fragments, which may then be annealed and reamplified to create chimeric nucleic acid sequences (see Ausubel et al Current Protocols in Molecular Biology, 1992).
In some embodiments, the fusion protein further comprises a self-cleaving peptide. In certain embodiments, the self-cleaving peptide is a T2A peptide (SEQ ID NO: 28).
Host cells
In another aspect, the invention provides a host cell comprising any one or more of the polynucleotides or expression vectors described herein.
In some embodiments, the host cell may be used to receive, maintain, replicate, and/or amplify the vector.
Non-limiting examples of expression host cells include mammalian cells, such as immune cells (e.g., T lymphocytes, B lymphocytes, NK cells), hybridoma cells, chinese Hamster Ovary (CHO) cells, COS cells, human Embryonic Kidney (HEK), yeast cells, such as Pichia pastoris cells, or bacterial cells such as dh5α, and the like.
T lymphocytes
In another aspect, the invention provides a T lymphocyte comprising any one or more of the polynucleotides, expression vectors or fusion proteins described herein.
In another aspect, the invention provides a T lymphocyte comprising: a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to T cells and a second TAA, or,
A third polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a fusion protein capable of binding to a T cell and a T cell adaptor (TE or BiTE) of a second TAA.
In another aspect, the invention provides a T lymphocyte comprising a first polynucleotide encoding a sequence capable of binding to a T cell adaptor (TE or BiTE) of a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, the first and second polynucleotides are each provided independently herein. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.
In some embodiments, the T cell adaptor is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell adapter is capable of binding CD2, CD3, CD31, CD277. In certain embodiments, the T cell adapter is capable of binding CD3.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on blood cancer cells (e.g., leukemia, lymphoma, myeloma). Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both are expressed on a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.
In some embodiments, the one or more first TAAs are each independently selected from colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphocyte antigen APO-1; cancer antigen B1; B7H3; beta-catenin; ALEB/LEY blood group; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (LEB blood group); CO-514 (LEA blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; GPA33; HER2 antigen (e.g., pi85HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-alpha receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley.
In some embodiments, the one or more first TAAs are each independently selected from interleukin-13 receptor subunit-2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2), epidermal Growth Factor Receptor (EGFR), EGFR variant III (egfrvlll), glucagon-3 (GPC 3), and combinations thereof.
In some embodiments, the second TAA is IL13 ra 2, her2, egfr, egfrvlll or GPC3.
In some embodiments, the invention provides a T lymphocyte comprising:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen); or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen).
In some embodiments, the T lymphocyte comprises a polynucleotide encoding a sequence capable of binding to a bispecific CAR of HER2 and IL13 ra 2, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to CD3 and TAA (e.g., glioblastoma tumor antigen). In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets HER2 and IL13 ra 2 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen).
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding HER2 and IL13 ra 2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen). In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding HER2 and IL13 ra 2.
In some embodiments, the invention provides a T lymphocyte comprising:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide encoding a sequence of a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to CD3 and TAA (e.g., glioblastoma tumor antigen). In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets HER2 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding HER2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding HER2.
In some embodiments, the bispecific CAR is capable of binding to 2 epitopes of 1 HER2. In some embodiments, the bispecific CAR is capable of binding to two HER2.
In some embodiments, the invention provides a T lymphocyte comprising:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll and a fusion protein capable of binding to the T cell adaptor (TE or BiTE) of CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide encoding a sequence capable of binding to a bispecific CAR of EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding to CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets EGFR or egfrvlll described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding EGFR or egfrvlll and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding EGFR or egfrvlll.
In some embodiments, the bispecific CAR is capable of binding to 1 EGFR or 2 epitopes of egfrvlll. In some embodiments, the bispecific CAR is capable of binding to two EGFR or egfrvlll.
In some embodiments, the invention provides a T lymphocyte comprising:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding GPC3 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide encoding a sequence capable of binding to a bispecific CAR of GPC3, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides encoding a bispecific CAR that targets GPC3 described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding GPC3 and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding GPC3.
In some embodiments, the bispecific CAR is capable of binding 2 epitopes of 1 GPC3. In some embodiments, the bispecific CAR is capable of binding two GPCs 3.
The T cell according to the invention may be any T cell, for example a cultured T cell, for example a primary T cell, or a T cell from a cultured T cell line, or a T cell obtained from a mammal. If obtained from a mammal, the T cells may be obtained from a number of sources including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. T cells may also be enriched or purified. T cells are preferably human T cells (e.g., isolated from a human). T cells may be at any stage of development, including but not limited to CD4 + /CD8 + Double positive T cells, CD4 + Helper T cells, e.g. Th and Th 2 Cell, CD8 + T cells (e.g., cytotoxic T cells), tumor infiltrating cells, memory T cells, primordial T cells, and the like. In one embodiment, the T cell is CD8 + T cells or CD4 + T cells. T cell lines are available from, for example, the American type culture Collection (ATCC, manassas, va.), germany microorganisms and cell culture Collection (DSMZ), including, for example, jurkat cells (ATCC TIB-152), sup-T1 cells (ATCC CRL-1942), RPMI 8402 cells (DSMZ ACC-290), karpas 45 cells (DSMZ ACC-545), and derivatives thereof.
The T lymphocytes may be autologous, homologous or allogeneic cells.
The one or more polynucleotides of the invention may be introduced into a cell by using physical or chemical methods, for example by transfection, transformation or transduction. Many transfection techniques are known in the art, including, for example, calcium phosphate DNA co-precipitation (see, e.g., murray e.j. (ed.), methods in Molecular Biology, vol.7, gene Transfer and Expression Protocols, humana Press (1991)); the method comprises the steps of carrying out a first treatment on the surface of the DEAE-dextran; electroporation; cationic liposome-mediated transfection; tungsten particle-promoted microprojectile bombardment (Johnston, nature,346:776-77 (1990)); and strontium phosphate DNA co-precipitation (Brash et al, mol. Cell biol.,7:2031-34 (1987)). After the infectious particles are grown in suitable packaging cells, phage or viral vectors can be introduced into host cells, many of which are commercially available.
In some embodiments, a retrovirus is used to deliver a polynucleotide encoding the bispecific CAR, T cell adapter (TE or BiTE), or both, into the T lymphocytes of the invention. Retroviruses are a common tool for gene delivery (Miller, 2000,Nature 357:455-60). Non-limiting examples of retroviruses suitable for use in particular embodiments include Moloney murine leukemia virus (M-MULV), moloney murine sarcoma virus (MoMSV), harvey murine sarcoma virus (HaMUSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline Leukemia Virus (FLV), foamy virus, friend murine leukemia virus, murine Stem Cell Virus (MSCV) and Roots Sarcoma Virus (RSV), and lentiviruses. Non-limiting examples of lentiviruses include human immunodeficiency virus (e.g., HIV type 1 and HIV type 2), vitamin-kamaidi virus (VMV), caprine arthritis-encephalitis virus (CAEV), equine Infectious Anemia Virus (EIAV), feline Immunodeficiency Virus (FIV), bovine Immunodeficiency Virus (BIV), and Simian Immunodeficiency Virus (SIV).
T lymphocytes of the invention can be maintained by using cytokines such as IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21.
The T lymphocytes of the invention may be contacted with a population of cancer cells (e.g., GBM cells) ex vivo, in vivo, or in vitro. For example, T lymphocytes described herein can be cultured ex vivo under conditions that express a bispecific CAR and a T cell adapter (TE or BiTE) and then transferred directly into a subject (e.g., a mammal such as a human) affected by a cancer (e.g., a solid tumor such as GBM). This cell transfer method is known in the art as "Adoptive Cell Transfer (ACT)", in which immune-derived cells are passively transferred into a new recipient host to transfer the function of the donor immune-derived cells into the new host.
Adoptive cell transfer methods for treating various types of cancers are known in the art and are disclosed in the prior art, for example, gattineni et al, nat. Rev. Immunol,6 (5): 383-93 (2006); june, J.Clin.invest.,117 (6): 1466-76 (2007); rapoport et al, blood,117 (3): 788-97 (2011); and Barber et al, gene Therapy,18:509-16 (2011)).
The T lymphocytes of the present invention can be introduced into a mammal, such as a human, using a variety of techniques and reagents known to those skilled in the art. In some embodiments, T lymphocytes are introduced into a tumor site. In some embodiments, T lymphocytes are modified to accommodate cancer. The number of cells used will depend on the particular circumstances, such as the purpose of the introduction, the lifetime of the T lymphocytes, the number of administrations, etc.
Compositions, pharmaceutical compositions, and kits
In another aspect, the invention provides a composition comprising any one or more of the polynucleotides, vectors, fusion proteins, host cells or T lymphocytes described herein. In some embodiments, the composition comprises any one or more T lymphocytes described herein.
In another aspect, the invention provides a pharmaceutical composition comprising any one or more of the compositions described herein and a pharmaceutically acceptable carrier, excipient, stabilizer, diluent or enhancer.
In certain embodiments, the composition or medicament further comprises a cryopreservation medium comprising about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO), wherein the cryopreservation medium is substantially free of serum.
In some embodiments, the composition or pharmaceutical composition is stored in a vial.
In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA;
Or a third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell adaptor (TE or BiTE) capable of binding to a T cell and a second TAA.
In another aspect, the invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, each of the first and second polynucleotides is provided herein independently. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.
In some embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD2, CD3, CD31, or CD277. In certain embodiments, the T cell adapter (TE or BiTE) is capable of binding CD3.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on blood cancer cells (e.g., leukemia, lymphoma, myeloma). Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both are expressed on a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.
In some embodiments, the one or more first TAAs are each independently selected from colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphocyte antigen APO-1; cancer antigen B1; B7H3; beta-catenin; ALEB/LEY blood group; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (LEB blood group); CO-514 (LEA blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; GPA33; HER2 antigen (e.g., pi85HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-alpha receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley.
In some embodiments, the one or more first TAAs are each independently selected from interleukin-13 receptor subunit-2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2), epidermal Growth Factor Receptor (EGFR), EGFR variant III (egfrvlll), glucagon-3 (GPC 3), and combinations thereof.
In some embodiments, the second TAA is IL13 ra 2, her2, egfr, egfrvlll or GPC3.
In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA;
a third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA; or a combination thereof.
In some embodiments, the TAA is glioblastoma tumor antigen.
In some embodiments, the first polynucleotide is any one of the polynucleotides encoding a HER 2-and IL13 ra 2-targeted bispecific CAR described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA (e.g., glioblastoma tumor antigen). In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or a combination thereof.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and the second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding to CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a HER 2-targeting bispecific CAR. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a fusion protein encoding a bispecific CAR capable of binding HER2, and a sequence of a T cell adapter (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding HER2.
In some embodiments, the bispecific CAR is capable of binding to two epitopes of 1 HER2. In some embodiments, the bispecific CAR is capable of binding 2 HER2.
In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding EGFR or egfrvlll and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or a combination thereof.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and the second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets EGFR or egfrvlll. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a fusion protein encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a sequence of a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding EGFR or egfrvlll.
In some embodiments, the bispecific CAR is capable of binding to 1 EGFR or 2 epitopes of egfrvlll. In some embodiments, the bispecific CAR is capable of binding to two EGFR or egfrvlll.
In another aspect, the invention provides a composition comprising T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding GPC3 and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or a combination thereof.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and the second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR targeting GPC3. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a third polynucleotide comprising a fusion protein encoding a bispecific CAR capable of binding GPC3, and a sequence of a T cell adapter (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the third polynucleotide is any of the polynucleotides encoding the dual CAR and T cell adapter (TE or BiTE) fusion proteins described herein.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding GPC3.
In some embodiments, the bispecific CAR is capable of binding to two epitopes of 1 GPC3. In some embodiments, the bispecific CAR is capable of binding 2 GPCs 3.
Suitable pharmaceutically acceptable carriers, excipients or stabilizers are non-toxic to the recipient at the dosages and concentrations employed (Remington's Pharmaceutical Sciences 16th edition,Osol,A.Ed (1980)). Non-limiting examples of pharmaceutically acceptable carriers, excipients, stabilizers, diluents or enhancers include buffers (e.g., phosphate, citrate, histidine), antioxidants (e.g., ascorbic acid or methionine), preservatives, proteins (e.g., serum albumin, gelatin or immunoglobulins); hydrophilic polymers, amino acids, carbohydrates (e.g., monosaccharides, disaccharides, glucose, mannose, or dextrins); chelating agents (e.g., EDTA), sugars (e.g., sucrose, mannitol, trehalose, or sorbitol), salt-forming counterions (e.g., sodium), metal complexes (e.g., zinc-protein complexes); nonionic surfactants (e.g., tween), PLURONICSTM; and polyethylene glycol (PEG).
In some embodiments, the compositions (e.g., pharmaceutical compositions) described herein are formulated for a suitable dosing regimen and route. Non-limiting examples of routes of administration include oral, rectal, mucosal, intravenous, intramuscular, subcutaneous, topical, and the like. In some embodiments, the compositions (e.g., pharmaceutical compositions) of the present invention are stored in the form of an aqueous solution or a dry formulation (e.g., lyophilized).
In some embodiments, the composition (e.g., a pharmaceutical composition) is formulated for administration by infusion (e.g., intracranial ventricular injection, intracranial infusion, or intravenous infusion).
In some embodiments, the composition (e.g., a pharmaceutical composition) is formulated for combination with a second therapeutic agent.
In another aspect, the invention provides a kit comprising a container and optionally instructions for use, wherein the container comprises any one or more of the compositions or pharmaceutical compositions described herein.
Application method
In another aspect, the invention provides the use of any one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions) or kits described herein in the manufacture of a medicament for treating cancer in a subject in need thereof.
In another aspect, the invention provides the use of any one or more of the T lymphocytes, compositions (e.g., pharmaceutical compositions), or kits described herein in the manufacture of a medicament for treating cancer in a subject in need thereof.
In another aspect, the invention provides any one or more of the polynucleotides, vectors, fusion proteins, host cells, T lymphocytes, compositions (e.g., pharmaceutical compositions), or kits described herein for use in treating cancer in a subject in need thereof.
In another aspect, the invention provides any one or more of the T lymphocytes, compositions (e.g., pharmaceutical compositions), or kits described herein for use in treating cancer in a subject in need thereof.
In another aspect, the invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective dose of any one or more T lymphocytes, compositions or pharmaceutical compositions described herein.
In some embodiments, the cancer is a solid tumor, such as breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, ovarian cancer, kidney cancer, stomach cancer, colon cancer, rectal cancer, testicular cancer, head and/or neck cancer, pancreatic cancer, brain cancer, or skin cancer. Thus, in some embodiments, the cancer is a solid tumor cell selected from the group consisting of breast cancer, lung cancer, prostate cancer, colon cancer, bladder cancer, ovarian cancer, kidney cancer, gastric cancer, rectal cancer, colorectal cancer, testicular cancer, head and neck cancer, pancreatic cancer, brain cancer, and skin cancer.
In some embodiments, the cancer is a hematological cancer, such as leukemia, lymphoma, or myeloma. Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma) and multiple myeloma. Thus, in some embodiments, the cancer is a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.
In certain embodiments, the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer. In some embodiments, the brain tumor is Glioblastoma (GBM). In certain embodiments, the GBM is primary glioblastoma multiforme. In particular embodiments, the GBM is recurrent glioblastoma multiforme. In some embodiments, the brain tumor is a brain metastasis. In certain embodiments, the brain metastasis is non-small cell lung cancer brain metastasis (NSCLCBM), small Cell Lung Cancer Brain Metastasis (SCLCBM), HER 2-positive metastatic breast cancer or Triple Negative Breast Cancer Brain Metastasis (TNBCBM). In some embodiments, the liver cancer is hepatocellular carcinoma (HCC).
In another aspect, the invention provides the use of any one of the compositions (e.g., polynucleotide, T lymphocyte) or pharmaceutical compositions described herein in the manufacture of a medicament for treating a tumor (e.g., a solid tumor such as glioblastoma) in a subject in need thereof.
In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
A first polynucleotide comprising a sequence encoding a CAR capable of binding one or more first TAAs; and a second polynucleotide comprising: a sequence encoding a T cell adapter (TE or BiTE) capable of binding T cells and a second TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell adaptor (TE or BiTE) capable of binding to a T cell and a second TAA.
In another aspect, the invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more of the first TAAs. In some embodiments, the first and second polynucleotides are each provided independently herein. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.
In a particular embodiment, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA. In a particular embodiment, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to T cells and a second TAA, wherein the first and second polynucleotides are isolated.
In some embodiments, the T cell adaptor is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3. In certain embodiments, the T cell adapter is capable of binding to CD2, CD3, CD31, or CD277. In certain embodiments, the T cell adapter is capable of binding CD3.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on blood cancer cells (e.g., leukemia, lymphoma, myeloma). Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both are expressed on a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.
In some embodiments, the one or more first TAAs are each independently selected from colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphocyte antigen APO-1; cancer antigen B1; B7H3; beta-catenin; ALEB/LEY blood group; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (LEB blood group); CO-514 (LEA blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; GPA33; HER2 antigen (e.g., pi85HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-alpha receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley.
In some embodiments, the one or more first TAAs are each independently selected from interleukin-13 receptor subunit-2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2), epidermal Growth Factor Receptor (EGFR), EGFR variant III (egfrvlll), glucagon-3 (GPC 3), and combinations thereof.
In some embodiments, the second TAA is IL13 ra 2, her2, egfr, egfrvlll or GPC3.
In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA; or (b)
A polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding HER2 and IL13 ra 2 and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the bispecific CAR is capable of binding to 2 epitopes of 1 HER2. In some embodiments, the bispecific CAR is capable of binding 2 HER2.
In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a bispecific CAR fusion protein capable of binding EGFR or egfrvlll and a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the bispecific CAR is capable of binding to 1 EGFR or 2 epitopes of egfrvlll. In some embodiments, the bispecific CAR is capable of binding 2 EGFR or egfrvlll.
In another aspect, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding GPC3 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the bispecific CAR is capable of binding 2 epitopes of 1 GPC3. In some embodiments, the bispecific CAR is capable of binding 2 GPCs 3.
In some embodiments, the TAA is glioblastoma tumor antigen.
In some embodiments, the T lymphocytes are allogeneic or allogeneic T lymphocytes.
In some embodiments, the T lymphocyte is an autologous T lymphocyte.
In some embodiments, the human subject is an infant (less than 1 year old). In some embodiments, the human subject is less than 11 years old. In some embodiments, the human subject is 11 years old or older. In some embodiments, the human subject is 12 years old or over 12 years old. In some embodiments, the human subject is 12-17 years old. In some embodiments, the human subject is less than 18 years old. In some embodiments, the human subject is an adult (18 years old or older). In some embodiments, the human subject is 40 years old or older, e.g., at least: 45 50, 55, 60, 65, 70, 75, 80, 85, 90 years old. In some embodiments, the human subject is an elderly person (65 years old or older). In some embodiments, the human subject is 18 years old or older.
The subject treated according to the methods described herein may be a subject that has been diagnosed with a particular disorder, or is at risk of developing such a disorder. Diagnosis may be performed by any method or technique known in the art. Those skilled in the art will appreciate that a subject to be treated according to the present disclosure may have been subjected to standard testing or identified, and may be considered a person at risk without examination due to the presence of one or more risk factors associated with a disease or disorder.
In some embodiments, the mammalian subject has cancer.
In some embodiments, the cancer is a hematologic cancer. In some embodiments, the cancer is hematological cancer and the bispecific CAR is capable of binding (e.g., target) CD19, CD20, CD22, CD30, CD33, CD123, CD138, BCMA, or a combination thereof.
In some embodiments, the hematological cancer is leukemia.
In some embodiments, the leukemia is selected from Acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronic Lymphocytic Leukemia (CLL), chronic Myelogenous Leukemia (CML), hairy Cell Leukemia (HCL), myelodysplastic syndrome (MDS), and combinations thereof.
In some embodiments, the hematological cancer comprises lymphoma.
In some embodiments, the lymphoma comprises hodgkin's lymphoma.
In some embodiments, the hodgkin's lymphoma is selected from the group consisting of nodular sclerosis hodgkin's lymphoma (NSCHL), mixed cell hodgkin's lymphoma (MCCHL), lymphocytic hodgkin's disease (LRCHL), lymphocyte depleted hodgkin's disease (LDHL), and combinations thereof.
In some embodiments, the lymphoma comprises non-hodgkin's lymphoma (NHL).
In some embodiments, the non-hodgkin's lymphoma comprises B-cell lymphoma.
In some embodiments, the B-cell lymphoma is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), primary mediastinal B-cell lymphoma (PMBCL), follicular Lymphoma (FL), small Lymphocytic Lymphoma (SLL), marginal Zone Lymphoma (MZL), mantle Cell Lymphoma (MCL), megaloblastic (WMG), burkitt's Lymphoma (BL), and combinations thereof.
In some embodiments, the non-hodgkin's lymphoma comprises T-cell lymphoma.
In some embodiments, the T cell lymphoma is selected from the group consisting of Peripheral T Cell Lymphoma (PTCL), anaplastic Large Cell Lymphoma (ALCL), angioimmunoblastic T cell lymphoma (AITL), cutaneous T cell lymphoma, and combinations thereof.
In some embodiments, the hematological cancer comprises multiple myeloma.
In some embodiments, the multiple myeloma is selected from the group consisting of Light Chain Multiple Myeloma (LCMM), non-secretory multiple myeloma (NSMM), solitary Plasmacytoma (SP), extramedullary plasmacytoma (EMP), unknown monoclonal disease (MGUS), smoldering Multiple Myeloma (SMM), immunoglobulin D multiple myeloma (igmmm), immunoglobulin E (IGE) multiple myeloma, and combinations thereof.
In some embodiments, the cancer is a solid tumor.
In some embodiments, the solid tumor is a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testis, head and/or neck, pancreas, brain, skin, or a combination thereof.
In some embodiments, the solid tumor is selected from the group consisting of bladder cancer, brain cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, fallopian tube cancer, gastric cancer, genitourinary tract cancer, head and neck cancer, liver cancer, lung cancer, melanoma, nasopharyngeal cancer (NPC), pancreatic cancer, prostate cancer, ovarian cancer, rectal cancer, renal cancer, skin cancer, gastric cancer, testicular cancer, thyroid cancer, urinary tract cancer, and combinations thereof.
In some embodiments, the solid tumor is selected from the group consisting of breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, mesothelioma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma (HCC), castration-resistant prostate cancer, head and neck squamous cell carcinoma, esophageal cancer, gastrointestinal cancer, endometriosis, and combinations thereof. In certain embodiments, the solid tumor is selected from the group consisting of breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, hepatocellular carcinoma (HCC), and combinations thereof. In certain embodiments, the solid tumor is breast cancer. In a specific embodiment, the solid tumor is NSCLC. In certain embodiments, the solid tumor is lung adenocarcinoma. In certain embodiments, the solid tumor is a mesothelioma. In a specific embodiment, the solid tumor is HCC.
In some embodiments, the solid tumor is a metastatic lesion of a cancer.
In some embodiments, the cancer is Glioblastoma (GBM), breast cancer, or lung cancer. In some embodiments, the cancer is GBM. In some embodiments, the subject is newly diagnosed with glioblastoma. In some embodiments, the subject has relapsed from or is resistant to a previous glioblastoma treatment. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is HER 2-positive breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the lung cancer is brain-metastatic lung cancer.
In some embodiments, at least about 10% of the T lymphocytes administered to the subject express the bispecific CAR and T cell engager (TE or BiTE). For example, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the T lymphocytes administered to the subject express the bispecific CAR and T cell engager (TE or BiTE). In some embodiments, about 10-80% of the T lymphocytes express the bispecific CAR and T cell engager (TE or BiTE). For example, about 10-75%,15-75%,15-70%,20-70%,20-65%,25-65%,25-60%,30-60%,30-55%,35-55%,35-50%, or 40-50% of the T lymphocytes express the bispecific CAR and T cell engager (TE or BiTE).
In some embodiments, at least 10% of the T lymphocytes express a bispecific CAR. For example, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the T lymphocytes express the bispecific CAR. In some embodiments, about 10-80% of the T lymphocytes express the bispecific CAR. For example, about: 10-75%,15-75%,15-70%,20-70%,20-65%,25-65%,25-60%,30-60%,30-55%,35-55%,35-50% or 40-50% of the T lymphocytes express a bispecific CAR.
In some embodiments, the T lymphocyte comprises 1-4 copies of a polynucleotide encoding each bispecific CAR and T cell adapter (TE or BiTE) in each T lymphocyte. For example, the T lymphocyte can comprise about 0,1,2,3 or 4 or 1-4,1-3,1-2,2-4 or 2-3 copies of a polynucleotide comprising each of the bispecific CAR and T cell adapter (TE or BiTE).
In some embodiments, the method is for prophylactic treatment. In some embodiments, the method is used as a first line therapy. In some embodiments, the method is used as a two-wire treatment. In some embodiments, the method is used as a three-wire therapy.
In some embodiments, the methods are for treating cancer.
The therapeutic agents described herein may be administered by a variety of routes of administration including, for example, oral, dietary, topical, transdermal, rectal, parenteral (e.g., intra-arterial, intravenous, intramuscular, subcutaneous, intradermal), intravenous infusion and inhalation (e.g., intrabronchial, intranasal or oral inhalation, intranasal instillation) routes of administration, depending on the compound and the particular disease being treated. As noted, administration may be local or systemic. The preferred mode of administration may vary depending on the particular compound selected.
In some embodiments, the T lymphocytes are administered as a single infusion (e.g., a single intracranial ventricle, intracranial, or intravenous infusion). In some embodiments, the T lymphocytes are administered as two or more infusions (e.g., intracranial ventricle, intracranial or intravenous infusions, or a combination thereof).
In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of a second therapeutic agent.
In some embodiments, the method further comprises administering to the subject a treatment (e.g., chemotherapy) prior to, during, or after administration of the T lymphocytes, or a combination thereof. For example, a brief chemotherapy may be administered prior to CAR-T treatment to increase efficacy.
In some embodiments, the method further comprises managing CRS and neurotoxicity associated with CAR-T treatment during or after administration of T lymphocytes.
Administration of two or more therapeutic agents includes co-administration of the therapeutic agents in a substantially simultaneous manner, e.g., in a pharmaceutical combination. Alternatively, such administration includes co-administration in multiple containers, or in separate containers (e.g., capsules, powders, and liquids) for each therapeutic agent. Such administration also includes the use of each type of therapeutic agent at about the same time or at different times in a sequential manner. The compositions and second therapeutic agents described herein may be administered by the same route of administration or by different routes of administration.
In another aspect, the invention provides a method of inducing T cell mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise: a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a CAR capable of binding to one or more first TAAs and a T cell adaptor (TE or BiTE) capable of binding to a T cell and a second TAA.
In another aspect, the invention provides a T lymphocyte comprising a first polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to a T cell and a second TAA epitope. In some embodiments, the T lymphocyte comprises a second polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs. In some embodiments, each of the first and second polynucleotides is provided herein independently. In some embodiments, the first and second polynucleotides are linked. In some embodiments, the first and second polynucleotides are isolated.
In a particular embodiment, the invention provides a method of inducing T cell-mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to T cells and a second TAA. In a particular embodiment, the invention provides a method of treating a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a first polynucleotide comprising a sequence encoding a CAR capable of binding to one or more first TAAs, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to T cells and a second TAA, wherein the first and second polynucleotides are isolated.
In some embodiments, the T cell adaptor is capable of binding CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277 or CXCR3. In certain embodiments, the T cell adapter is capable of binding to CD2, CD3, CD31 or CD277. In certain embodiments, the T cell adapter is capable of binding CD3.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on blood cancer cells (e.g., leukemia, lymphoma, myeloma). Hematological cancers that can be treated according to the methods described herein include leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma. Thus, in some embodiments, the one or more first TAAs, the second TAAs, or both are expressed on a hematological cancer cell selected from leukemia (e.g., acute leukemia, chronic leukemia), lymphoma (e.g., B-cell lymphoma, T-cell lymphoma), and multiple myeloma.
In some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell (e.g., a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin). Thus, in some embodiments, the one or more first TAAs and the second TAAs are each independently expressed on a solid tumor cell selected from breast, lung, prostate, colon, bladder, ovary, kidney, stomach, rectum, colorectal, testis, head and neck, pancreas, brain, and skin cancer cells.
In some embodiments, the one or more first TAAs are each independently selected from colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphocyte antigen APO-1; cancer antigen B1; B7H3; beta-catenin; ALEB/LEY blood group; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (LEB blood group); CO-514 (LEA blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; GPA33; HER2 antigen (e.g., pi85HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-alpha receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley.
In some embodiments, the one or more first TAAs are each independently selected from interleukin-13 receptor subunit-2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2), epidermal Growth Factor Receptor (EGFR), EGFR variant III (egfrvlll), glucagon-3 (GPC 3), and combinations thereof.
In some embodiments, the second TAA is IL13 ra 2, her2, egfr, egfrvlll or GPC3.
In another aspect, the invention provides a method of inducing T cell mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA; or (b)
A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the TAA is glioblastoma tumor antigen.
In some embodiments, the first polynucleotide is any one of the polynucleotides encoding a HER 2-and IL13 ra 2-targeted bispecific CAR described herein. In some embodiments, the second polynucleotide is any one of the polynucleotides described herein encoding a T cell adapter (TE or BiTE) capable of binding CD3 and glioblastoma tumor antigens. In some embodiments, the third polynucleotide is any one of the polynucleotides encoding the dual CAR and T cell conjugate (TE or BIT) fusion proteins described herein.
In another aspect, the invention provides a method of inducing T cell mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to HER2, and a second polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding to CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a HER 2-targeting bispecific CAR. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding HER2.
In some embodiments, the bispecific CAR is capable of binding to 2 epitopes of 1 HER2. In some embodiments, the bispecific CAR is capable of binding 2 HER2.
In another aspect, the invention provides a method of inducing T cell mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll and a fusion protein capable of binding to the T cell adaptor (TE or BiTE) of CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding EGFR or egfrvlll, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR that targets EGFR or egfrvlll. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding EGFR or egfrvlll.
In some embodiments, the bispecific CAR is capable of binding to 1 EGFR or 2 epitopes of egfrvlll. In some embodiments, the bispecific CAR is capable of binding 2 EGFR or egfrvlll.
In another aspect, the invention provides a method of inducing T cell mediated tumor cell lysis comprising contacting glioblastoma cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a first polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA; or (b)
A third polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding GPC3 and a T cell adapter (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocyte comprises a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding GPC3, and a second polynucleotide comprising a sequence encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA. In some embodiments, the polynucleotide is any one of the polynucleotides described herein encoding a bispecific CAR targeting GPC 3. In some embodiments, the second polynucleotide is any of the polynucleotides described herein encoding a T cell adaptor (TE or BiTE) capable of binding CD3 and TAA.
In some embodiments, the T lymphocytes express (e.g., secrete) a bispecific CAR capable of binding GPC3.
In some embodiments, the bispecific CAR is capable of binding 2 epitopes of 1 GPC3. In some embodiments, the bispecific CAR is capable of binding 2 GPCs 3.
In some embodiments, the tumor cell is a solid tumor cell. In some embodiments, the tumor cell is a glioblastoma cell, a breast cancer cell, or a lung cancer cell. In some embodiments, the tumor cell is a glioblastoma cell. In some embodiments, the tumor cell is a breast cancer cell. In some embodiments, the breast cancer cell is a HER 2-positive breast cancer cell. In some embodiments, the tumor cell is a lung cancer cell. In some embodiments, the lung cancer cell is a brain-transferred lung cancer cell.
In some embodiments, the glioblastoma cells are present in any subject described herein, and the contacting of the glioblastoma cells with an effective dose of T lymphocytes is performed by administering an effective dose of T lymphocytes to the subject.
Dual CAR_dual arm BiTE engineered T cells
In another aspect, the invention provides a T lymphocyte, wherein the T lymphocyte comprises a polynucleotide encoding a sequence of a fusion protein capable of binding to two TAAs (e.g., two different antigens expressed on the cell surface) and a T cell adaptor (TE or BiTE) of the T cell (e.g., CD 3) and TAA.
In another aspect, the invention provides a polynucleotide, wherein the polynucleotide comprises a sequence encoding a fusion protein described herein.
In another aspect, the invention provides an expression vector, wherein the expression vector comprises a polynucleotide as described herein.
In another aspect, the invention provides a host cell, wherein the host cell comprises a polynucleotide or expression vector described herein.
In another aspect, the invention provides a composition comprising lymphocytes, wherein at least a portion of said lymphocytes comprise a polynucleotide encoding a bispecific CAR and a sequence capable of binding to a fusion protein of a T cell (e.g., CD 3) and a T cell adapter of TAA (TE or BiTE).
In another aspect, the invention provides a pharmaceutical composition, wherein the pharmaceutical composition comprises a composition described herein and a pharmaceutically acceptable carrier.
In another aspect, the invention provides a kit, wherein the kit comprises a container comprising a pharmaceutical composition as described herein and optionally instructions for use.
In another aspect, the invention provides a method of treating a tumor described herein in a subject in need thereof, comprising administering to the subject a composition or pharmaceutical composition described herein.
In another aspect, the invention provides a method of treating a tumor described herein in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR and a fusion protein of a T cell adapter (TE or BiTE) capable of binding to a T cell (e.g., CD 3) and a TAA (e.g., a tumor antigen, such as a glioblastoma antigen).
In another aspect, the invention provides a method of inducing T cell-mediated lysis of tumor cells, comprising contacting tumor cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR and a fusion protein of a T cell adapter (TE or BiTE) capable of binding to a T cell (e.g., CD 3) and TAA (e.g., a tumor antigen, such as glioblastoma antigen).
In some embodiments, the bispecific CAR comprises an IL13 mutein linked to a HER 2-binding scFv via a linker sequence.
In some embodiments, the bispecific CAR comprises an IL13 mutein linked to a HER 2-binding scFv via a linker sequence. In some embodiments, the IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1. In some embodiments, the IL13 mutant protein comprises an amino acid sequence as set forth in SEQ ID NO. 1.
In some embodiments, the HER 2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 2,3 or 4, or a combination thereof. In some embodiments, the HER 2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 2,3 or 4, or a combination thereof. In some embodiments, the HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 4. In some embodiments, the HER 2-binding scFv comprises an amino acid sequence as set forth in SEQ ID NO. 2,3 or 4. In some embodiments, the HER 2-binding scFv comprises an amino acid sequence as set forth in SEQ ID NO. 4.
In some embodiments, the bispecific CAR further comprises:
a CD8 a signal peptide;
a CD8 a hinge;
a CD28 transmembrane domain;
4-1BB co-stimulatory domain;
a CD3 zeta signaling domain;
or a combination thereof.
In some embodiments:
the linker comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 5;
the CD8 alpha signal peptide comprises an amino acid sequence with at least 90% identity with the amino acid sequence shown in SEQ ID NO. 6;
the CD8 a hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 7;
the CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 8;
the 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 9; or (b)
The CD3 zeta signaling domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
In some embodiments:
the linker comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 5;
the CD8 alpha signal peptide comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 6;
The CD8 alpha hinge comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 7;
the CD28 transmembrane domain comprises about 1-3 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 8;
the 4-1BB costimulatory domain comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 9; or (b)
The CD3 zeta signaling domain comprises about 1-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
In some embodiments:
the linker comprises an amino acid sequence shown as SEQ ID NO. 5;
the CD8 alpha signal peptide comprises an amino acid sequence shown as SEQ ID NO. 6;
the CD8 alpha hinge comprises an amino acid sequence shown as SEQ ID NO. 7;
the CD28 transmembrane domain comprises an amino acid sequence shown as SEQ ID NO. 8;
the 4-1BB co-stimulatory domain comprises an amino acid sequence as shown in SEQ ID NO. 9; or (b)
The CD3 zeta signal domain comprises an amino acid sequence shown as SEQ ID NO. 10;
or a combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) comprises a CD 3-binding scFv. In some embodiments, the CD 3-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 14. In some embodiments, the CD 3-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 14. In some embodiments, the CD 3-binding scFv comprises an amino acid sequence as set forth in SEQ ID NO. 14.
In some embodiments, the TAA is an EGFR antigen. In some embodiments, the TAA is an egfrvlll antigen.
In some embodiments, the T cell adapter (TE or BiTE) comprises:
at least 1 EGFR-binding nanobody linked to a CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 18); or (b)
At least 1 EGFRvIII-binding nanobody linked to a CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 18).
In some embodiments, the T cell adapter (TE or BiTE) comprises:
at least 2 EGFR-binding nanobodies;
at least 2 egfrvlll-binding nanobodies; or (b)
At least 1 EGFR-binding nanobody and at least 1 egfrvlll-binding nanobody.
In some embodiments of the present invention, in some embodiments,
the at least 1 EGFR-binding nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID No. 15,16 or 17, or a combination thereof; or (b)
The at least 1 egfrvlll-binding nanobody comprises an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID No. 15,16 or 17, or a combination thereof.
In some embodiments, the T cell adapter (TE or BiTE) further comprises a signal peptide and a 6 XHis tag sequence (SEQ ID NO: 20). In some embodiments, the signal peptide comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 19. In some embodiments, the signal peptide comprises about 1 or 2 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 19.
In some embodiments, the T cell adapter (TE or BiTE) comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 21,22,23,24,25,26,27,109,110,111,176,177,178 or 292. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-40 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 21,22,23,24,25,26,27,109,110 or 111, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises about 1-55 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 24,25,26,27,176,177,178 or 292, or a combination thereof. In some embodiments, the T cell adapter (TE or BiTE) comprises the amino acid sequence set forth in SEQ ID NO. 21,22,23,24,25,26,27,176,177,178 or 292.
In some embodiments, the T cell adapter (TE or BiTE) comprises:
EGFR antibodies linked to CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 16); or (b)
EGFRvIII antibodies linked to CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 16).
In some embodiments of the present invention, in some embodiments,
the EGFR antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 29; or (b)
The EGFRvIII antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 29.
In some embodiments of the present invention, in some embodiments,
the EGFR antibody comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 29; or (b)
The EGFRvIII antibody comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 29.
In some embodiments of the present invention, in some embodiments,
the EGFR antibody comprises an amino acid sequence as shown in SEQ ID NO. 29; or (b)
The EGFRvIII antibody comprises an amino acid sequence shown as SEQ ID NO. 29.
In some embodiments, the fusion protein further comprises a self-cleaving T2A peptide (SEQ ID NO: 28).
In some embodiments, the fusion protein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 31,32,33,34,35,36,37, or 38, or a combination thereof.
In some embodiments, the fusion protein comprises about 1-100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 31,32,33,34,35,36,37, or 38, or a combination thereof. In some embodiments, the fusion protein comprises about 1-100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 37. In some embodiments, the fusion protein comprises an amino acid sequence as set forth in SEQ ID NO. 31,32,33,34,35,36,37 or 38. In some embodiments, the fusion protein comprises the amino acid sequence set forth in SEQ ID NO. 37.
In another aspect, the invention provides a polypeptide comprising an amino acid sequence having at least 60% identity to the amino acid sequences set forth in SEQ ID NOS.2-4, 15-17 and 242-291. Illustratively, the sequence identity is at least about: 65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60%,65%,70%,75%,80%,85%,90%,91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the sequence identity is about: 60-99%,65-99%,65-95%,70-99%,70-98%,70-95%,70-90%,75-98%,75-97%,75-90%,75-85%,80-97%,80-96%,80-85%,85-96%,85-95% or 90-95%. In particular embodiments, the sequence identity is at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%).
In some embodiments, the polypeptide comprises at least 1 amino acid substitution relative to the amino acid sequences set forth in SEQ ID NOS.2-4, 15-17 and 242-291. In some embodiments, the at least one amino acid substitution is at least: 2,3,4,5,6,7,8,9, 10, 11 or 12 amino acid substitutions. In certain embodiments, the at least one amino acid substitution is about 1-12 amino acid substitutions, illustratively about 1-11, 2-10, 3-9, 4-8, 5-7, or 6-7 amino acid substitutions.
In a particular embodiment, the polypeptide comprises the amino acid sequences shown in SEQ ID NOS.2-4, 15-17 and 242-291.
Unless otherwise defined, all technical, symbolic and other scientific terms or terms used herein are intended to have the meanings commonly understood by one of ordinary skill in the art to which the invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or ease of reference, and such definitions contained herein are not necessarily to be construed as indicating substantial differences from what is commonly understood in the art. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and/or will be defined in addition to the meaning described herein.
In a further aspect, the invention provides a polypeptide that specifically binds GPC3, wherein the polypeptide comprises heavy chain complementarity determining region 1 (HCDR 1), heavy chain complementarity determining region 2 (HCDR 2), and heavy chain complementarity determining region 3 (HCDR 3)), each comprising an amino acid sequence having at least 90% identity to an amino acid sequence of HCDR1, HCDR2, and HCDR3 of a heavy chain variable region (VH) amino acid sequence shown as SEQ ID No. 284,SEQ ID NO:286 or SEQ ID No. 289, respectively. In some embodiments, the sequence identity is at least: 91%,92%,93%,94%,95%,96%,97%,98% or 99%. In some embodiments, the HCDR1, HCDR2, and HCDR3 are identical to HCDR1, HCDR2, and HCDR3, respectively, of the VH amino acid sequence set forth in SEQ ID NO:284, SEQ ID NO:286, or SEQ ID NO: 289.
In certain embodiments, the HCDR1, HCDR2, and HCDR3 each have at least 90% (e.g., 91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence of:
303,SEQ ID NO:304 and 305;
306,SEQ ID NO:307 and 308;
309,SEQ ID NO:310 and 308;
311,SEQ ID NO:312 and 313;
314,SEQ ID NO:315 and 316;
317,SEQ ID NO:318 and 316;
319,SEQ ID NO:320 and 321;
322,SEQ ID NO:323 and 324; or (b)
325,SEQ ID NO:326 and 324.
In some embodiments, the HCDR1, HCDR2 and HCDR3 are each identical in amino acid sequence as follows:
303,SEQ ID NO:304 and 305;
306,SEQ ID NO:307 and 308;
309,SEQ ID NO:310 and 308;
311,SEQ ID NO:312 and 313;
314,SEQ ID NO:315 and 316;
317,SEQ ID NO:318 and 316;
319,SEQ ID NO:320 and 321;
322,SEQ ID NO:323 and 324; or (b)
325,SEQ ID NO:326 and 324.
In certain embodiments, the amino acid sequence of the polypeptide has at least 85% (e.g., at least 86%,87%,88%,89%,90%,91%,92%,93%,94%,95%,96%,97%,98%, or 99%) identity to the amino acid sequence set forth in SEQ ID NO. 284,SEQ ID NO:286 or SEQ ID NO. 289. In a specific embodiment, the amino acid sequence of the polypeptide is identical to the amino acid sequence shown in SEQ ID NO. 284,SEQ ID NO:286 or SEQ ID NO. 289.
In some embodiments, the polypeptide is a nanobody.
Terminology
Certain terminology is used herein for the purpose of describing particular embodiments only and is not limiting.
The terms "a" or "an" herein are to be understood as including the plural form unless the context clearly indicates otherwise.
Unless the context requires otherwise, the term "comprise" and variations such as "comprises" and "comprising" are intended to be inclusive of the stated integer or step or combination of integers or steps, but not to preclude any other integer or step or combination of integers or steps. The term "comprising" may be replaced with the term "comprising" or "including" herein.
The term "consisting of … …" herein excludes any element, step or component not specified in the claim elements. The term "consisting essentially of does not exclude elements or steps that do not materially affect the basic and novel characteristics of the claims. Any of the terms "comprising," "including," "comprising," and "having," whenever used in the context of an aspect or embodiment of the present invention, may be substituted in some embodiments with the term "consisting of … …," or "consisting essentially of … …," to alter the scope of this invention.
The conjunctive term "and/or" between the various recited elements as used herein is understood to include both individual and combined options. For example, when two elements are connected by an "and/or," a first option refers to the scope of applicability where the first element does not have the second element. The second option refers to the scope of applicability of the second element without the first element. The third option refers to the range of applicability that the first and second elements have. Any of these options is understood to fall within this meaning and thus meet the requirements of the term "and/or" as used herein. Simultaneous applicability of multiple options is also understood to fall within this meaning, thus meeting the requirements of the term "and/or".
In one list, each individual element of the list and each combination of the list is to be understood as a separate embodiment unless otherwise indicated. For example, a list of embodiments presented as "a, B, or C" should be interpreted to include embodiments "a", "B", "C", "a or B", "a or C", "B or C" or "a, B, or C".
The term "antigen" as used herein is a substance that can be recognized by antibodies, B cells or T cells. The term "tumor-associated antigen" or "TAA" herein refers to a protein or polypeptide antigen expressed by a cancer cell (e.g., a tumor cell). For example, a TAA may be one or more surface proteins or polypeptides, nucleoproteins or glycoproteins, or fragments thereof, of a cancer cell (e.g., a tumor cell). Exemplary TAAs include, but are not limited to, colon cancer antigen 19.9; gastric cancer mucin; antigen 4.2; glycoprotein a33 (gpA 33); ADAM-9; gastric cancer antigen AH6; ALCAM; malignant human lymphocyte antigen APO-1; cancer antigen B1; B7H3; beta-catenin; ALEB/LEY blood group; burkitt lymphoma antigen-38.13; colon adenocarcinoma antigen C14; ovarian cancer antigen CA125; carboxypeptidase M; CD5; CD19; CD20; CD22; CD23; CD25; CD27; CD30; CD33; CD36; CD45; CD46; CD52; CD79a/CD79b; CD103; CD317; CDK4; carcinoembryonic antigen (CEA); CEACAM5; CEACAM6; C017-iA; CO-43 (LEB blood group); CO-514 (LEA blood group); CTA-1; CTLA4; cytokeratin 8; antigen D1.1; antigen D156-22; DR5; ei series (B blood group); EGFR (epidermal growth factor receptor); adrenergic receptor A2 (EphA 2); erbB1; erbB3; erbB4; GAGE-1; GAGE-2; GD2/GD3/GM2; lung adenocarcinoma antigen F3; antigen FC10.2; g49, ganglioside GD2; ganglioside GD3; ganglioside GM2; ganglioside GM3; GD2; GD3; GICA19-9; GM2; gpOO; glucagon-3 (GPC 3); human leukemia T cell antigen Gp37; melanoma antigen gp75; GPA33; HER2 antigen (e.g., pi85HER 2); human milk fat globule antigen (HMFG); human papilloma virus E6/human papilloma virus-E7; high molecular weight melanoma antigen (HMWMAA); i antigen (differentiation antigen) I (Ma); integrin alpha-V-beta-6 integrin P6 (ITGB 6); interleukin-13; receptor a2 (IL 13 ra 2); JAM-3; KID3; KID31; KS1/4 pan-carcinoma antigen; human lung cancer antigens L6 and L20; LEA; LUCA-2; mi 22:25:8; m18; m39; MAGE-1; MAGE-3; MART; MUC-1; MUM-1; myl; n-acetylglucosaminyl transferase; novel glycoproteins; NS-10; OFA-1; OFA-2; oncostatin M; p15; melanoma-associated antigen P97; polymorphic Epithelial Mucin (PEM); polymorphic Epithelial Mucin Antigen (PEMA); PIPA; prostate Specific Antigen (PSA); prostate Specific Membrane Antigen (PSMA); a phosphate ester of prostanoic acid; r24; RORi; sphingolipids; SSEA-1; SSEA-3; SSEA-4; sTn; t cell receptor-derived peptides; t5A7; TAG-72; TL5 (blood group a); TNF-alpha receptor; TNF-B receptors; TNF-y receptors; TRA-1-85 (blood group H); transferrin receptor; tumor Specific Transplantation Antigen (TSTA), carcinoembryonic antigen-alpha-fetoprotein (AFP); VEGF; VEGFR, VEP8; VEP9; VIM-D5; and Y hapten, ley. In some embodiments, the TAA is CEA, GPC3, MUC-1, epCAM, HER receptor, PEM, caladi 6, cluadi-18.2, mesothelin, A33, G250, carbohydrate antigen Ley, lex, leb, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, erbB2, erbB3, MUC1, LMP2, idiotype, HPVE6& E7, EGFR, EGFRvIII, HER-2/neu, MAGEA3, NY-ESO-1, GD2, PSMA, PCSA, PSA, melana/MART1, CD19, CD20, CD22, CD33, CD5, CD70, or BCMA. In some embodiments, the TAA is on a non-neoplastic cancer cell. In other embodiments, the TAA is on a tumor cell.
The definition of proteins, peptides and polypeptides is well known in the art. The term "protein" as used herein is synonymous with the term "peptide" or "polypeptide"; and is understood to mean amino acid chains which are arranged linearly and are linked together by peptide bonds between the carboxyl groups and the amino groups of adjacent amino acid residues. Thus, the term polypeptide may refer to the full-length amino acid sequence of a protein, or a fragment thereof.
The term "T cell adaptor" or "TE" as used herein refers to a molecule (e.g., an antibody) capable of binding an epitope, such as one, two or more epitopes. In many embodiments, the T cell adapter is capable of binding to a surface antigen and TAA on a T cell. In some embodiments, the T cell adapter is capable of binding to a surface antigen and at least 2 TAA epitopes on a T cell. In certain embodiments, the at least 2 epitopes are on TAA. In some embodiments, the T cell adapter is capable of binding to a surface antigen on a T cell and at least 2 TAAs. Exemplary T cell upper surface antigens may include, without limitation, CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277 or CXCR3. In many cases, the terms "BiTE", "T cell adaptor", and "TE" are used interchangeably.
The term "conservative amino acid substitution" or "conservative substitution" as used herein refers to an amino acid substitution having a value of 0 or greater in BLOSUM 62.
The term "highly conserved amino acid substitution" or "highly conserved substitution" as used herein refers to an amino acid substitution having a value of at least 1 (e.g., at least 2) in BLOSUM 62.
The term "expression vector" as used herein refers to a replicable nucleic acid from which one or more proteins can be expressed when the expression vector is transformed into a suitable expression host cell, and the term "promoter" as used herein refers to a region of DNA from which RNA polymerase binds and initiates transcription of a gene. The term "operably linked" as used herein means that the nucleic acid is positioned in a recombinant polynucleotide, e.g., a vector, in such a way that the nucleic acid can be expressed under the control of the element (e.g., promoter) to which it is linked. The term "selectable marker element" as used herein is an element that imparts characteristics suitable for manual selection. The selectable marker element may be a negative or positive selection marker.
The term "ex vivo" as used herein refers to a process performed within or on a cell or tissue in an artificial environment outside of a organism, with minimal changes to natural conditions. The term "in vivo" as used herein refers to a method that proceeds in its normal, intact state in a living organism. The term "in vitro" method as used herein is carried out using biological components isolated from their usual biological environment.
The term "fusion protein" as used herein refers to a single protein molecule, either synthetic, semisynthetic or recombinant. A fusion protein may comprise all or a portion of two or more different proteins and/or polypeptides linked by covalent bonds (e.g., peptide bonds).
The term "sequence identity" as used herein refers to the degree to which two nucleotide sequences or two amino acid sequences have identical residues at identical positions when aligned to achieve a maximum level of identity, expressed as a percentage. For sequence alignment and comparison, one sequence is typically designated as a reference sequence, and test sequences are compared to the reference sequence. Sequence identity between a reference sequence and a test sequence is expressed as a percentage of positions over the full length of the reference sequence, wherein the reference sequence and the test sequence share the same nucleotide or amino acid when aligned to obtain a maximum level of sequence identity. For example, two sequences are considered to have 70% sequence identity when the test sequence has identical nucleotide or amino acid residues at 70% identical positions over the full length of the reference sequence when the alignment reaches a maximum level of identity.
One of ordinary skill in the art can readily align sequences using appropriate alignment methods or algorithms to achieve maximum identity. In some cases, the alignment may include an introduced gap to provide maximum identity. Examples include the local homology algorithm of Smith & Waterman, adv.appl.Math.2:482 (1981), the homology alignment algorithm of Needleman & Wunsch, J.mol.biol.48:443 (1970), the similarity search method of Pearson & Lipman, proc.Nat' l.Acad.Sci.USA 85:2444 (1988), computerized implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, genetics Computer Group,575Science Dr., madison, wis.) and visual inspection (see generally Ausubel et al Current Protocols in Molecular Biology).
When using a sequence comparison algorithm, test and reference sequences are entered into the computer, subsequent coordinates are specified, if necessary, and algorithm program parameters are specified. The sequence comparison algorithm calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. A common tool for determining percent sequence identity is the Basic Local Alignment Search Tool (BLASTP) for proteins available from national medical libraries of the national center for Biotechnology information of the national institute of health. (Altschul et al, 1990).
The term "subject" or "patient" as used herein refers to a mammal (e.g., a human). In some embodiments, the subject is a mammal. In some embodiments, the subject is a mammal selected from the group consisting of dogs, cats, mice, rats, hamsters, guinea pigs, horses, pigs, sheep, cattle, black horses, macaque, cynomolgus monkeys, and humans. In some embodiments, the subject is a primate. In some embodiments, the subject is a human.
The terms "therapeutically effective amount," "effective amount," or "effective dose" as used herein are effective amounts of dosages and times required to achieve the desired therapeutic effect (e.g., treat, heal, inhibit or ameliorate a physiological response or disorder, etc.). A full therapeutic effect is not necessarily produced by administration of one dose, and is produced only after administration of a series of doses. Thus, a therapeutically effective amount may be administered one or more times. The therapeutically effective amount may vary depending on such factors as the disease state, age, sex and weight of the mammal, the mode of administration and the ability of the therapeutic agent or combination of therapeutic agents to elicit a desired response in the individual.
Using the guidance provided herein and other methods known in the art, one of ordinary skill can determine an effective amount of the agent to be administered. Relevant factors include the given agent, pharmaceutical formulation, route of administration, type of disease or disorder, identity (e.g., age, sex, weight) or host of the subject being treated, etc. For example, a suitable dosage may be about 0.001mg/kg to about 100mg/kg, about 0.01mg/kg to about 10mg/kg, about 0.01mg/kg to about 1mg/kg body weight per treatment. Determining the dosage of a particular agent, subject and disease is well within the ability of those skilled in the art. Preferably, the dosage does not cause or produce minimal side effects.
The desired response or desired outcome includes the effects of cellular levels, tissue levels, or clinical outcomes. Thus, a "therapeutically effective amount" or synonym thereof depends on the context in which it is used. For example, in some embodiments, it is in an amount sufficient to achieve a therapeutic response compared to a response obtained without administration of the composition. In other embodiments, this is an amount that produces a beneficial or desired result in the subject as compared to the control group. As defined herein, a therapeutically effective amount of a composition of the present disclosure can be readily determined by one of ordinary skill in the art by conventional methods known in the art. The dosing regimen and route of administration may be adjusted to provide the optimal therapeutic response.
The term "treatment" as used herein refers to the medical management of a patient for the purpose of improving, ameliorating, stabilizing (i.e., not worsening), preventing or treating a disease, pathological condition or disorder; such as the specific indications illustrated herein. The term includes active therapy (for treatment of an ameliorating disease, pathological condition, or disorder), causal therapy (for treatment of the cause of a related disease, pathological condition, or disorder), palliative therapy (treatment designed to alleviate symptoms), prophylactic therapy (treatment for minimizing or partially or completely inhibiting the development of a related disease, pathological condition, or disorder); and supportive therapy (therapy for supplementing another therapy). Treatment also includes reducing the extent of a disease or disorder; preventing the spread of a disease or disorder; delay or slow the progression of the disease or disorder; improvement or alleviation of a disease or condition; and remission (whether partial or total), whether detectable or undetectable. "treatment" may also refer to prolonged survival compared to the expected survival without treatment. The person in need of treatment includes those already with the disorder or condition, as well as those prone to the disorder or condition or those in need of prophylaxis of the disorder or condition.
The term "ameliorating" or "alleviating" a disease or disorder as used herein refers to a reduction or extension in the extent of the disease, disorder or condition and/or the time course of an undesired clinical manifestation being reduced and/or developed as compared to the extent or course of treatment without treatment.
The term "vector" as used herein refers to a nucleic acid molecule that can be used to introduce a nucleic acid sequence or gene into a cell in vitro, ex vivo or in vivo.
The invention also provides the following embodiments:
embodiment 1 is a T lymphocyte comprising:
a) A polynucleotide comprising a sequence encoding a bispecific CAR capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 2 is the T lymphocyte of embodiment 1, wherein said T lymphocyte comprises a polynucleotide comprising a sequence encoding said bispecific CAR, and a polynucleotide comprising a sequence encoding said BiTE.
Embodiment 3 is the T lymphocyte of embodiment 1, wherein said T lymphocyte comprises a polynucleotide comprising a sequence encoding said bispecific CAR and a sequence of a fusion protein of said BiTE.
Embodiment 4 is the T lymphocyte of any of embodiments 1-3, wherein said bispecific CAR comprises an IL13 mutein linked to a HER 2-binding single chain variable fragment (scFv) by a linker sequence.
Embodiment 5 is the T lymphocyte of embodiment 4, wherein said IL13 mutein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO. 1.
Embodiment 6 is the T lymphocyte of embodiment 4, wherein said IL-13 mutein comprises about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 1.
Embodiment 7 is the T lymphocyte of embodiment 4, wherein said IL13 mutein comprises the amino acid sequence set forth in SEQ ID NO. 1.
Embodiment 8 is the T lymphocyte of any of embodiments 1-7, wherein said HER 2-binding scFv comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID No. 2,3 or 4, or a combination thereof.
Embodiment 9 is the T lymphocyte of embodiment 8, wherein said HER 2-binding scFv comprises an amino acid sequence that has at least 90% identity to the amino acid sequence set forth in SEQ ID No. 4.
Embodiment 10 is the T lymphocyte of any of embodiments 1-7, wherein said HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 2,3 or 4, or a combination thereof.
Embodiment 11 is the T lymphocyte of embodiment 10, wherein said HER 2-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 4.
Embodiment 12 is the T lymphocyte of any of embodiments 1-7, wherein said HER 2-binding scFv comprises the amino acid sequence set forth in SEQ ID No. 2,3 or 4.
Embodiment 13 is the T lymphocyte of embodiment 12, wherein said HER 2-binding scFv comprises the amino acid sequence set forth in SEQ ID No. 4.
Embodiment 14 is the T lymphocyte of embodiment 6, 10 or 11, wherein said amino acid substitution is a conservative substitution.
Embodiment 15 is the T lymphocyte of embodiment 6, 10 or 11, wherein said amino acid substitution is a highly conservative substitution.
Embodiment 16 is the T lymphocyte of any of embodiments 1-15, wherein said bispecific CAR further comprises:
a) A CD8 a signal peptide;
b) A CD8 a hinge;
c) A CD28 transmembrane domain;
d) 4-1BB co-stimulatory domain;
e) A CD3 zeta signaling domain;
or a combination thereof.
Embodiment 17 is the T lymphocyte of embodiment 16, wherein:
a) The linker comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 5;
b) The CD8 alpha signal peptide comprises an amino acid sequence with at least 90% identity with the amino acid sequence shown in SEQ ID NO. 6;
c) The CD8 a hinge comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 7;
d) The CD28 transmembrane domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 8;
e) The 4-1BB costimulatory domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 9; or (b)
f) The CD3 zeta signaling domain comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
Embodiment 18 is the T lymphocyte of embodiment 16, wherein:
a) The linker comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 5;
b) The CD8 alpha signal peptide comprises 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 6;
c) The CD8 alpha hinge comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 7;
d) The CD28 transmembrane domain comprises about 1-3 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 8;
e) The 4-1BB costimulatory domain comprises about 1-5 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 9; or (b)
f) The CD3 zeta signaling domain comprises about 1-12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 10;
or a combination thereof.
Embodiment 18 is the T lymphocyte of embodiment 16, wherein:
a) The linker comprises an amino acid sequence shown as SEQ ID NO. 5;
b) The CD8 alpha signal peptide comprises an amino acid sequence shown as SEQ ID NO. 6;
c) The CD8 alpha hinge comprises an amino acid sequence shown as SEQ ID NO. 7;
d) The CD28 transmembrane domain comprises an amino acid sequence shown as SEQ ID NO. 8;
e) The 4-1BB co-stimulatory domain comprises an amino acid sequence as shown in SEQ ID NO. 9; or (b)
f) The CD3 zeta signal domain comprises an amino acid sequence shown as SEQ ID NO. 10;
or a combination thereof.
Embodiment 20 is the T lymphocyte of any of embodiments 1-19, wherein said bispecific CAR comprises an amino acid sequence having at least 90% identity to the amino acid sequence depicted in SEQ ID No. 11,12 or 13, or a combination thereof.
Embodiment 21 is the T lymphocyte of any of embodiments 1-19, wherein said bispecific CAR comprises about 1-60 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 11,12 or 13, or a combination thereof.
Embodiment 22 is the T lymphocyte of any of embodiments 1-19, wherein said bispecific CAR comprises an amino acid sequence as depicted in SEQ ID No. 11,12 or 13.
Embodiment 23 is the T lymphocyte of any of embodiments 1-22, wherein said T lymphocyte expresses said bispecific CAR.
Embodiment 24 is the T lymphocyte of any of embodiments 1-23, wherein said BiTE comprises a CD 3-binding single-chain variable fragment (scFv).
Embodiment 25 is the T lymphocyte of embodiment 24, wherein said CD 3-binding scFv comprises an amino acid sequence that has at least 90% identity to the amino acid sequence set forth in SEQ ID No. 14.
Embodiment 26 is the T lymphocyte of embodiment 24, wherein said CD 3-binding scFv comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 14.
Embodiment 27 is the T lymphocyte of embodiment 24, wherein said CD 3-binding scFv comprises the amino acid sequence shown in SEQ ID No. 14.
Embodiment 28 is the T lymphocyte of any of embodiments 1-27, wherein said TAA is an Epidermal Growth Factor Receptor (EGFR) antigen.
Embodiment 28 is the T lymphocyte of any of embodiments 1-27, wherein said TAA is an egfrvlll antigen.
Embodiment 30 is the T lymphocyte of embodiment 28 or 29, wherein said BiTE comprises:
a) At least 1 EGFR-binding nanobody linked to a CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 18); or (b)
b) At least 1 EGFRvIII-binding nanobody linked to a CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 18).
Embodiment 31 is the T lymphocyte of embodiment 30, wherein said BiTE comprises:
a) At least 2 EGFR-binding nanobodies;
b) At least 2 egfrvlll-binding nanobodies; or (b)
c) At least 1 EGFR-binding nanobody and at least 1 egfrvlll-binding nanobody.
Embodiment 32 is the T lymphocyte of embodiment 30 or 31, wherein:
a) The at least 1 EGFR-binding nanobody comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID No. 15,16 or 17, or a combination thereof; or (b)
b) The at least 1 egfrvlll-binding nanobody comprises an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID No. 15,16 or 17, or a combination thereof.
Embodiment 33 is the T lymphocyte of embodiment 30 or 31, wherein:
a) The at least 1 EGFR-binding nanobody comprises an amino acid sequence of about 1-12 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 15,16 or 17, or a combination thereof; or (b)
b) The at least 1 egfrvlll-binding nanobody comprises an amino acid sequence of about 1 to 12 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 15,16 or 17, or a combination thereof.
Embodiment 34 is the T lymphocyte of embodiment 30 or 31, wherein:
a) The at least 1 EGFR-binding nanobody comprises an amino acid sequence as set forth in SEQ ID NO. 15,16 or 17;
or (b)
b) The at least 1 EGFRvIII-binding nanobody comprises an amino acid sequence as shown in SEQ ID NO. 15,16 or 17.
Embodiment 35 is the T lymphocyte of any of embodiments 29-34, wherein said BiTE further comprises a signal peptide and a 6 xhis tag sequence (SEQ ID NO: 20).
Embodiment 36 is the T lymphocyte of embodiment 35, wherein said signal peptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID No. 19.
Embodiment 37 is the T lymphocyte of embodiment 35, wherein said signal peptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID No. 19.
Embodiment 38 is the T lymphocyte of embodiment 35, wherein said signal peptide comprises about 1 or 2 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 19.
Embodiment 39 is the T lymphocyte of embodiment 35, wherein said signal peptide comprises the amino acid sequence shown in SEQ ID No. 19.
Embodiment 40 is the T lymphocyte of any of embodiments 29-39, wherein said BiTE comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID No. 21,22,23,24,25,26 or 27.
Embodiment 41 is the T lymphocyte of any of embodiments 29-39, wherein said BiTE comprises about 1-40 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 21,22 or 23, or a combination thereof.
Embodiment 42 is the T lymphocyte of any of embodiments 29-39, wherein said BiTE comprises about 1-55 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 24,25,26 or 27, or a combination thereof.
Embodiment 43 is the T lymphocyte of any of embodiments 29-39, wherein said BiTE comprises the amino acid sequence as set forth in SEQ ID NOs 21,22,23,24,25,26 or 27.
Embodiment 44 is the T lymphocyte of embodiment 29, wherein said BiTE comprises:
a) EGFR antibodies linked to CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 16); or (b)
b) EGFRvIII antibodies linked to CD 3-binding scFv by a linker sequence comprising GGGGS (SEQ ID NO: 16).
Embodiment 45 is the T lymphocyte of embodiment 44, wherein:
a) The EGFR antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 29; or (b)
b) The EGFRvIII antibody comprises an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO. 29.
Embodiment 46 is the T lymphocyte of embodiment 44, wherein:
a) The EGFR antibody comprises about 1-25 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID NO. 29;
or (b)
b) The EGFRvIII antibody comprises about 1-25 amino acid substitutions relative to the amino acid sequence shown in SEQ ID NO. 29.
Embodiment 47 is the T lymphocyte of embodiment 44, wherein:
a) The EGFR antibody comprises an amino acid sequence as shown in SEQ ID NO. 29; or (b)
b) The EGFRvIII antibody comprises an amino acid sequence shown as SEQ ID NO. 29.
Embodiment 48 is the T lymphocyte of any of embodiments 1-47, wherein said T lymphocyte secretes said BiTE.
Embodiment 49 is the T lymphocyte of any of embodiments 3-48, wherein said fusion protein further comprises a self-cleaving T2A peptide (SEQ ID NO: 28).
Embodiment 50 is the T lymphocyte of any of embodiments 3-49, wherein said fusion protein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID No. 31,32,33,34,35,36,37, or 38, or a combination thereof.
Embodiment 51 is the T lymphocyte of any of embodiments 3-49, wherein said fusion protein comprises about 1-100 amino acid substitutions relative to the amino acid sequence set forth in SEQ ID No. 31,32,33,34,35,36,37, or 38, or a combination thereof.
Embodiment 52 is the T lymphocyte of embodiment 51, wherein said fusion protein comprises about 1-100 amino acid substitutions relative to the amino acid sequence shown in SEQ ID No. 37.
Embodiment 53 is the T lymphocyte of any of embodiments 3-49, wherein said fusion protein comprises an amino acid sequence as set forth in SEQ ID NOs 31,32,33,34,35,36,37 or 38.
Embodiment 54 is the T lymphocyte of embodiment 53, wherein said fusion protein comprises the amino acid sequence shown in SEQ ID No. 37.
Embodiment 55 is a fusion protein of a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 56 is a polynucleotide comprising a sequence encoding the fusion protein of embodiment 55.
Embodiment 57 is an expression vector comprising a polynucleotide as set forth in embodiment 56.
Embodiment 58 is a host cell comprising the polynucleotide of embodiment 51 or the expression vector of embodiment 57.
Embodiment 59 is a composition comprising T lymphocytes, wherein at least a portion of the lymphocytes comprise:
a) A polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 60 is the composition of embodiment 59, further comprising a cryopreservation medium comprising about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO) and being substantially free of serum.
Embodiment 61 is a composition as described in embodiment 59 or 60 stored in a vial.
Embodiment 62 is a pharmaceutical composition comprising a composition as described in embodiment 59 or 60 and a pharmaceutically acceptable carrier.
Embodiment 63 is a kit comprising a container and optionally instructions for use, wherein the container comprises a pharmaceutical composition as described in embodiment 62.
Embodiment 64 is the use of a composition as described in embodiment 59 or 60 or a pharmaceutical composition as described in embodiment 57 in the manufacture of a medicament for treating glioblastoma in a subject in need thereof.
Embodiment 65 is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of said T lymphocytes comprise:
a) A polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 66 is a method of treating glioblastoma in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of said T lymphocytes comprise:
a) A polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a BiTE capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 67 is the method of embodiment 65 or 66, wherein the T lymphocytes are allogeneic T lymphocytes.
Embodiment 68 is the method of any one of embodiments 65-67, wherein at least 10% of the T lymphocytes express the bispecific CAR and the BiTE.
Embodiment 69 is the method of embodiment 68, wherein about 15-75% of the T lymphocytes express the bispecific CAR and the BiTE.
Embodiment 70 is the method of any one of embodiments 65-69, wherein the T lymphocytes are administered by a single intravenous infusion.
Embodiment 71 is the method of any one of embodiments 65-69, wherein the T lymphocytes are administered by two or more intravenous infusions.
Embodiment 72 is the method of any one of embodiments 65-71, further comprising administering to the subject chemotherapy prior to administering the T lymphocytes.
Embodiment 73 is the method of any one of embodiments 65-72, wherein the subject is 18 years old or older.
Embodiment 74 is the method of any one of embodiments 65-73, wherein the subject is newly diagnosed with glioblastoma.
Embodiment 75 is the method of any one of embodiments 65-73, wherein the subject has relapsed from or is resistant to a prior glioblastoma treatment.
Embodiment 76 is the method of any one of embodiments 65-75, wherein the subject is a human patient.
Embodiment 77 is a method of inducing T cell-mediated lysis of cancer cells comprising contacting the cancer cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise:
a) A polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 78 is a method of inducing T cell-mediated glioblastoma cell lysis comprising contacting said glioblastoma with an effective dose of T lymphocytes, wherein at least a portion of said T lymphocytes comprise:
a) A polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding HER2 and IL13 ra 2, and a polynucleotide comprising a sequence encoding a T cell adapter (TE or BiTE) capable of binding CD3 and TAA; or (b)
b) A polynucleotide comprising a sequence encoding a fusion protein of a bispecific CAR capable of binding HER2 and IL13 ra 2 and a BiTE capable of binding CD3 and TAA.
Embodiment 79 is the method of embodiment 78, wherein the glioblastoma cells are in a subject and the glioblastoma cells are contacted with an effective dose of T cells by administering an effective dose of T lymphocytes to the subject.
Embodiment 80 is a T lymphocyte comprising a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to two different antigens expressed on the surface of a cancer cell and a fusion protein of BiTE capable of binding to CD3 and TAA.
Embodiment 81 is a fusion protein comprising a bispecific Chimeric Antigen Receptor (CAR) capable of binding to two different antigens expressed on the surface of a cancer cell and a BiTE capable of binding to CD3 and TAA.
Embodiment 82 is a polynucleotide comprising a sequence encoding the fusion protein of embodiment 81.
Embodiment 83 is an expression vector comprising a polynucleotide as set forth in embodiment 82.
Embodiment 84 is a host cell comprising the polynucleotide of embodiment 82 or the expression vector of embodiment 83.
Embodiment 85 is a composition comprising T lymphocytes, wherein at least a portion of said T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific Chimeric Antigen Receptor (CAR) capable of binding to two different antigens expressed on the surface of a cancer cell and a fusion protein of BiTE capable of binding CD3 and TAA.
Embodiment 86 is a pharmaceutical composition comprising the composition of embodiment 85 and a pharmaceutically acceptable carrier.
Embodiment 87 is a kit comprising a container and optionally instructions for use, wherein the container comprises the pharmaceutical composition of embodiment 86.
Embodiment 88 is the use of the composition of embodiment 85 or the pharmaceutical composition of embodiment 86 in the manufacture of a medicament for treating a tumor in a subject in need thereof.
Embodiment 89 is a method of treating a tumor in a subject in need thereof, comprising administering to the subject an effective dose of T lymphocytes, wherein at least a portion of said T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to two different antigens expressed on the surface of a cancer cell and a BiTE capable of binding to CD3 and TAA.
Embodiment 90 is a method of inducing T cell-mediated lysis of tumor cells comprising contacting the tumor cells with an effective dose of T lymphocytes, wherein at least a portion of the T lymphocytes comprise a polynucleotide comprising a sequence encoding a bispecific CAR capable of binding to two different antigens expressed on the surface of a cancer cell and a BiTE capable of binding to CD3 and TAA.
Embodiment 91 is a T lymphocyte as described in embodiment 80, a fusion protein as described in embodiment 81, an expression vector as described in embodiment 82, a host cell as described in embodiment 83, a composition as described in embodiment 85, a pharmaceutical composition as described in embodiment 86, a kit as described in embodiment 87, a use as described in embodiment 88, or a method as described in embodiment 89 or 90, wherein the tumor is a hematological tumor.
Embodiment 92 is the T lymphocyte, fusion protein, polynucleotide, expression vector, host cell, composition, pharmaceutical composition, kit, use or method of embodiment 91, wherein said bispecific CAR targets CD19, CD20, CD22, CD30, CD33, CD123, CD138, BCMA or a combination thereof.
Embodiment 93 is a T lymphocyte as described in embodiment 80, a fusion protein as described in embodiment 81, an expression vector as described in embodiment 82, a host cell as described in embodiment 83, a composition as described in embodiment 85, a pharmaceutical composition as described in embodiment 86, a kit as described in embodiment 87, a use as described in embodiment 88, or a method as described in embodiment 89 or 90, wherein the tumor is a solid tumor.
Embodiment 94 is a T lymphocyte, fusion protein, polynucleotide, expression vector, host cell, composition, pharmaceutical composition, kit, use or method according to embodiment 93, wherein said tumor is glioblastoma, breast cancer or lung cancer.
Embodiment 95 is the T lymphocyte, fusion protein, polynucleotide, expression vector, host cell, composition, pharmaceutical composition, kit, use or method of embodiment 94, wherein said breast cancer is HER 2-positive breast cancer.
Embodiment 96 is a T lymphocyte, fusion protein, polynucleotide, expression vector, host cell, composition, pharmaceutical composition, kit, use or method according to embodiment 94, wherein said lung cancer is brain-transferred lung cancer.
Examples
Example 1 materials and methods
The materials used in the examples are summarized in table 5.
Virus preparation
Polynucleotides comprising the MNDU3 promoter and CAR and BiTE sequences isolated from viral T2A sequences were synthesized by GENEWIZ, inc. (Cambridge, MA). The complete polynucleotide sequence was cloned into the lentiviral vector SBILVTV (third generation internal lentiviral transfer vector synthesized by GENEWIZ, inc.Cambridge, MA). According to the instruction manual using TransIT-Transfection reagents (Mirus Bio, madison, wis., cat#MIR 6700) the CAR vector and packaging vector, SBILVPK1, SBILVPK2 and SBILVPK3 (third generation internal lentiviral transfer vector synthesized by GENEWIZ, inc.Cambridge, MA) were co-transfected into HEK293T cells, resulting in replication-inactive lentiviruses. Virus supernatant was collected 48 hours after transfection, filtered through a 0.45 μm filter (EMD Millipore, burlington, MA, cat#se1M003M 00) and concentrated by centrifugation at 10,000Xg for 4 hours at 4 ℃. The virus particles were resuspended in 1.0ml of 1 XPhosphate buffered saline (PBS), sub-packaged and stored at-80 ℃.
CAR-T cell preparation
From consented healthy blood donors (HemaCare, los a) by negative sorting using EasySep human T cell isolation kit (STEMCELL Technologies, vancouver, BC, canada, cat#17951) The human Pan T cells were isolated from fresh peripheral blood leukocytes obtained from ngeles, CA). Pan T cells were activated with anti-CD 3/CD28 magnetic beads at a 1:1 ratio (Dynabeads, gibco; thermo Fisher Scientific, inc., waltham, cat#11132D) in 12-well plates with 300U/mL IL-2 (PeproTech, inc., rocky Hill, NJ, cat#200-02). After 24 hours of activation, T cells were transduced with lentiviruses. CAR T cell cultures in fresh X-VIVO supplemented with 300U/mL IL-2 TM 15 medium (Lonza Group, basel, switzerland, cat#BE 02-053Q) was amplified using G-Rex plates for 8 days. G-REX plates were used to supplement 300U/ml IL-2 for 8 days in 15 media (Lonza group, basel, switzerland, cat#BE 02-053Q). At day 8 post transduction, CAR expression was analyzed using flow cytometry, CAR-T cells were collected and resuspended in cryopreservation mediumCS10, STEMCELL technologies, vancouver, BC, canada, cat# 7930) were dispensed and stored in liquid nitrogen. />
Cytotoxicity test
Luciferase-expressing GBM cells at a concentration of 20,000 cells/well were plated in 96-well plates. The next day, effector CAR-T cells were added at a ratio of effector to target (E: T) of 1:1,0.5:1,0.25:1, or 0.125:1, or BiTE collected from the supernatant of CAR-T cells was co-added with non-transduced T cells (UN) at an E: T ratio of 1:1 or 0.5:1. Plates were incubated at 37℃for 24 hours. Subsequently, D-firefly luciferin potassium salt (PerkinElmer, inc., waltham, MA, cat# 122799) was added to the wells and fluorescence was measured using a microplate reader (Molecular Devices LLC, san Jose, CA). Target cells incubated without effector cells or BiTE were used to measure spontaneous death and set an assay baseline.
For real-time cytotoxicity assays, GBM cells at 20,000 cells/well were plated in RTCA plates (ACEA Biosciences, san Diego, calif., cat# 6472451001). Cell index was recorded as a measure of cell impedance using a xCELLigence RTCA SP instrument (ACEA Biosciences, san Diego, calif.). The following day, effector CAR-T cells were added at an E:T ratio of 1:1,0.5:1,0.25:1, or 0.125:1, or BiTE and UN T cells collected from the supernatant of CAR-T cells were added at an E:T ratio of 1:1 or 0.5:1. Plates were mounted in an RTCA apparatus and incubated for 1-5 days at 37 ℃.
T cell activation and functional assays
Luciferase-expressing GBM cells at a concentration of 20,000 cells/well were plated in 96-well plates. The following day, jurkat (NFAT-luciferase) reporter cells (BPS Bioscience, inc., san Diego, calif., cat # 60621) and BiTE collected from the supernatant of CAR-T cells were added at an E:T ratio of 1:1 or 0.5:1. After 24 hours, ONE-Step was used TM Luciferase assay System (BPS Bioscience, inc., san Diego, calif., cat # 60690-1) luciferase activity was assayed and fluorescence was assayed in a microplate reader (Molecular Devices LLC, san Jose, calif.).
For cytokine release analysis, supernatants from effector cells or BiTE/UN T cells co-cultured with GBM cell lines were analyzed for IL2 cytokine expression (R & D Systems, minneapolis, MN, cat#d2050) or IFN- γ (R & D Systems, minneapolis, MN, cat#dif50) according to the instruction manual.
Flow cytometry analysis
To assess cell surface expression of Target Associated Antigens (TAAs) in GBM cell lines, the following antibody clones were used: anti-EGFR (BV 711 anti-human EGFR, bioLegend, san Diego, calif., cat# 352919), anti-Her2 (BV 421 anti-human CD340, bioLegend, san Diego, calif., cat# 324420), anti-IL13R2a (APCanti-human CD213a2, bioLegend, san Diego, calif., cat# 354405). For T cells, the following antibodies were used: BV421 anti-human CD3 antibody (BioLegend, san Diego, calif., cat # 317344), APCanti-human CD8 antibody (BioLegend, san Diego, calif., cat # 344722), PEanti-human CD4 antibody (BioLegend, san Diego, calif., cat # 357404). To assess cell surface CAR expression in T cells, the following antigens were used: FITC-labeled human IL-13Rα2 protein and His tag (ACRObiosystems, newark, DE, cat#IL2-HF2H3-25 ug-290). Briefly, cells were washed with 1×pbs supplemented with 1% fbs (Flow Cytometry Staining Buffer (FACS Buffer)) and stained in the dark at room temperature for 30 minutes, then washed in FACS Buffer prior to analysis.
Cytotoxicity test
For real-time cytotoxicity assays, cancer cell lines at 20,000 cells/well were plated in RTCA plates (ACEA Biosciences, san Diego, CA, cat# 6472451001). Cell index was recorded as a measure of cell impedance using a xCELLigence RTCA SP instrument (ACEA Biosciences, san Diego, calif.). The following day, effector CAR-T cells were added at an E:T ratio of 1:1,1:2,1:4,1:8,1:16,1:32, or 1:64, or BiTE or control (UN) T cells collected from the supernatant of CAR-T cells were added at an E:T ratio of 1:1 or 1:2. Plates were mounted in an RTCA apparatus and incubated for 1-5 days at 37 ℃.
Intracranial (IC) tumor xenograft injection and Intratumoral (INT) CAR-T cell infusion
In an in vivo pharmacological efficacy and toxicology study, GBM tumor xenografts were performed according to the protocol of IACUC by the following procedure: (1) 10,000 luciferase-labeled U87 cells were injected intracranially into the right forebrain in 2 μl; (2) Injection coordinates were ML (2.0 mm), AP (0.5 mm) and DV (2.5 mm_1 μl,2.25mm_1 μl); and (3) an injection rate of 1. Mu.l/min.
200,000 CARs in vivo pharmacological efficacy, PK/biodistribution and toxicology studies according to IACUC protocol + SR26 CAR-T cells were infused at 3 μl by IC or INT. The infusion coordinates were ML (2.0 mm), AP (0.5 mm) and DV (2.5 mm_1.5. Mu.l, 2.25 mm_1.5. Mu.l). The injection rate was 1.5. Mu.l/min.
PK study
Sample collection of mouse organs
The heart, liver, spleen, lung, kidney, bone marrow, spinal cord, blood and brain of NSG mice were collected into 1 x PBS solution. Each sample was obtained from three different mice.
Genomic DNA extraction
Using PureLink TM Pro 96 genomic DNA extraction kit (Invitrogen, #K182104A) extracts genomic DNA. Briefly, three small pieces of tissue were randomly excised from each organ and weighed approximately 25 milligrams. Each piece of tissue was then processed according to the instruction manual. The genomic DNA finally obtained was quantified by nanodrop.
Primer design
Using the IDT PrimerQuest tool, the gene sequences of CAR and BiTE were used to design primers and double-labeled probes (5'6-FAM/ZEN/3' IBFQ). The melting temperature of the probes of all the primers is between 62 ℃ and 68 ℃, and the length of the amplicon ranges from 108 bp to 146bp. All other parameters remain default settings. All primers used in this study are listed in table 6.
Real-time quantitative PCR
Real-time quantitative PCR (qPCR) assays were performed using the Quantuo (TM) 7Pro Real-time PCR system (Applied Biosystems, # A43183). Amplification was performed in a 20. Mu.l reaction comprising 5. Mu.l genomic DNA (100 ng), 10. Mu.l 2 XPrimerTime gene expression premix (IDT, # 1055772), 2. Mu.l forward primer (10. Mu.M), 2. Mu.l reverse primer (10. Mu.M), 0.5. Mu.l probe (10. Mu.M) and 0.5. Mu.l water (Table 7). The PCR reaction includes (1) 95 deg.c for 3 min; and (2) 95℃for 15 seconds, 45 cycles and 60℃for 60 seconds (Table 8). Reproducibility was verified by analyzing each sample in triplicate with one set of primers for detecting the CAR region and another set of primers for detecting the BiTE region. PCR efficiency (E) values were calculated from the slope of the standard curve using purified "CAR/BiTE" plasmid. The reference gene (Actb, mouse housekeeping gene, idt#mm. Pt.39a.22214843. G) was evaluated with each sample and run in the same plate with all other primer sets.
Bioluminescence imaging (BLI)
Following the IACUC protocol, mice were anesthetized with 3% isoflurane inhaled with 0.5 liters/min oxygen. After anesthesia, mice were injected with 0.15ml of 30mg/ml fluorescein, IP. After waiting ten minutes, imaging was performed using Spectral Instruments Imaging Ami to capture a backside view. After imaging, animals were weighed and monitored for recovery from anesthesia.
Organ extraction
According to IACUC protocol, mice were first treated with 30-70% chamber volume/min CO in a 2.6 liter chamber 2 The flow rate was euthanized. The maximum blood volume was then collected in EDTA tubes by end cardiac puncture. After heart extraction, lung, brain, spleen, spinal cord, liver, bone marrow and kidney were extracted for analysis.
Example 2 identification of IL13Rα2-HER2 double CAR leader clones SR7, SR8 and SR9
Prior to construction of the dual CAR, a single CAR capable of binding to IL13 ra 2 and HER2 was constructed and screened using a CAR-T cell lysis assay. After identification of the lead clone of the single CAR, a dual CAR was constructed as shown in figure 1. The pilot clone of SR7-9 was identified by a luciferase-based killing assay and an RTCA (real-time cytolytic assay) -based assay (FIGS. 3-5). The relevant killing activity scale is listed in table 9 (based on normalized luciferase assay or RTCA assay, each CAR, biTE or car_bite killing activity scale value of the invention was administered separately). Details of the cell lines used to identify the double CAR pilot clones are listed in figure 2.
Example 3 identification of EGFR-BiTE leader clones SR10-12 and SR15-18
Prior to construction of the dual domain and dual arm BiTE, a single arm BiTE was constructed and screened using a luciferase-based cytolytic assay (fig. 6). After identification of the leader clone of single arm BiTE (fig. 7), dual domain and dual arm BiTE were constructed (fig. 6). The leader clones of dual domain and dual arm BiTE were identified by luciferase-based killing assays and NFAT-based BiTE-mediated T cell activation assays (fig. 8 and 9). The relevant kill activity scales are listed in table 9.
EXAMPLE 4 identification of IL13Rα2-HER2 Dual CAR_EGFR-BiTE lead clones SR20-22 and SR 24-26 Fixing device
After identification of the pilot clones of dual CAR and BiTE, a combined construct of "il13rα2-HER2 dual car_egfr-BiTE" was constructed as shown in fig. 10. To verify the ability of the "dual-car_bite" construct to produce functional bites and to further identify bites with better cytolytic activity, HEK293T cells (fig. 11-14) and primary human T cells (fig. 16) generated bites were used to test cytolytic capacity. The ability of bites produced by HEK293T cells (fig. 15) or primary T cells (fig. 17) to stimulate T cell activation was determined using an NFAT-based luciferase assay.
After confirming the cytolytic activity of the BiTE, the synergistic cytolytic activity of the "dual-car_bite" clones was analyzed using a luciferase-based killing assay (fig. 18 and 19) and an RTCA-based cytolytic assay.
To further evaluate BiTE armed dual CAR-T pilot clones, the cytokine release by CAR-T cells was evaluated by ELISA assay. IL-2 and IFNγ were detected (FIGS. 23 and 24). Through these series of experiments, the pilot clone SR26 of BiTE armed dual CAR-T was determined. The relevant kill activity scales are listed in table 9.
EXAMPLE 5 continuous killing Activity assay of SR26 by one of the lead clones
The ability of the lead clone SR26 CAR-T cells to continuously kill target cancer cells (continuous killing) and expand under target positive cancer cell stimulation was tested using continuous incubation of CAR-T cells and cancer cells. The pilot clone SR26 was found to have strong continuous killing activity and amplification was good (fig. 25 and 26).
Example 6 double arm BiTE CAR-T cells showed cytolytic Activity against different types of cancer cells
The two-arm BiTE CAR-T cells exhibited stronger cytolytic activity against GBM cancer cells than the one-arm reverse BiTE CAR-T cells (see, e.g., fig. 20, 21, and 27-31B). Next, it was investigated whether the stronger cytolytic activity of dual arm BiTE CAR-T cells is applicable to other types of cancer. Real-time cytolytic assay results indicate that the two-arm BiTE CAR-T cells also have stronger cytolytic activity than the single-arm BiTE CAR-T cells in other cancer types, including HER2 positive breast cancer, lung cancer, and brain metastatic cancer lung cancer (fig. 32-39). By conferring cytolytic activity on various cancer types, the two-arm BiTE CAR-T cells can be widely used to treat a variety of different cancers.
Example 7 double arm BiTE CAR-T cells showed therapeutic effectiveness in highly invasive GBM model U87
To evaluate the in vivo pharmacological efficacy of the dual arm BiTE CAR-T cell lead clone SR26, one of the most malignant GBM intracranial GBM models, U87, was used. The results of tumor eradication rate and survival rate, as shown in figures 40A-40C, demonstrate for the first time the level of therapeutic effectiveness in a true U87 GBM model at lower than therapeutic doses. SR26 has unprecedented preclinical therapeutic effects on GBM.
EXAMPLE 8 PK/biodistribution and toxicity studies of SR26
PK studies were performed to assess the in vivo pharmacokinetic/biodistribution of SR 26. Both CAR genes and BiTE genes were detected only in the brain. None was detected in genomic DNA of heart, liver, spleen, lung, kidney, bone marrow, spinal cord or blood. The data indicate that infused CAR-T cells are limited to the brain only. The CAR-T cells can penetrate brain tissue, gradually becoming inactive or re-entering a quiescent state in GBM-free mice due to the lack of stimulation with the relevant tumor antigen (fig. 41 and 42).
Next, toxicology studies were performed to assess the potential in vivo toxicity of SR 26. The results indicate that SR26 can effectively eradicate GBM tumors, and that no abnormal effect was observed in SR26 treated mice under both acute (day 2) and chronic (day 14) conditions (fig. 43-45).
EXAMPLE 9 second generation BiTE armed CAR-T therapy of GBM
After finding that dual arm EGFR BiTE armed Dual Tandem IL13rα2-HER2 CAR-T therapy has unprecedented killing activity against different cancer cells (such as GBM, breast cancer and lung cancer cells), a broader application platform for such BiTE and CAR compositions was explored. To develop new generation (second generation) BiTE and CAR composition CAR-T therapies for GBM, lead clones of nanobody-based HER2 CAR (fig. 46 and 49-62) and EGFR BiTE (fig. 47 and 63-71) were identified by screening internally generated top-level nanobody clone pools, using the concept of BiTE and CAR combination strategy (fig. 47). After identification of these BiTE and CAR leader clones, the most preferred BiTE and CAR combination clone (SR 157-SR 164) was developed using the strategy in fig. 48. The relevant kill activity scales are listed in table 9.
EXAMPLE 10 BiTE armed CAR-T therapy of HER 2-positive breast cancer brain metastasis
To further verify the broad application of BiTE and CAR combination platforms, it was aimed at HER2 + Breast cancer brain metastasis egfr_ BiTE armed dual tandem HER2 CAR-T therapies were developed. Leader cloning of nanobody based on egfr_bite and HER2 CARThe same was identified in the second generation BiTE armed CAR-T method developed for GBM (FIGS. 46, 49-62, 47 and 63-71). Using the strategy of fig. 72, the most preferred BiTE armed CAR combinatorial clone (SR 165-SR 170) was developed. The relevant kill activity scales are listed in table 9.
EXAMPLE 11 BiTE armed CAR-T therapy for brain metastasis of Lung cancer
To generalize the application of the BiTE and CAR combination platform, egfr_ BiTE armed dual tandem EGFR CAR-T therapies for lung cancer brain metastasis were developed. The pilot cloning of egfr_bite based nanobodies was identical to that identified in the development of second generation BiTE armed CAR-T therapies for GBM (fig. 47 and 63-71). The nanobody-based lead clones of egfr_car were identified using the strategy in fig. 73 and the experimental methods in fig. 75-78. Using the strategy in FIG. 74 and detailed experimental screening analysis (FIGS. 79-83), the pilot clone SR129 of double arm EGFR BiTE armed EGFR VHH tandem CAR-T was identified. The CAR-T cells of this lead BiTE and CAR combination have unprecedented killing activity against lung cancer brain metastatic cancer cells. The relevant kill activity scales are listed in table 9.
EXAMPLE 12 GPC3_ VHH BiTE armed CAR-T therapy of HCC
To further expand the application of the BiTE and CAR combination platform, GPC-3_BiTE armed dual tandem GPC-3 CAR-T therapies were developed for hepatocellular carcinoma. First, a lead clone of nanobody-based GPC-3 CAR was identified from the most preferred anti-GPC-3 nanobody clone developed internally (FIGS. 84, 86-88 and 96). By means of the BiTE and CAR combination strategy (fig. 85), a nanobody-based GPC-3 two-arm BiTE pilot clone was identified (fig. 91 and 92), whose ability to induce T cell activation was confirmed by NFAT assay (fig. 93-95). By the same strategy (FIG. 85), a pilot clone of double arm GPC-3 BiTE armed GPC-3VHH tandem CAR-T was also identified (FIGS. 89 and 90). This GPC-3 CAR-T pilot clone of GPC-3 BiTE armed had a stronger killing activity against HCC cancer cells. The relevant kill activity scales are listed in table 9. This suggests that the BiTE and CAR combination platform has very broad application in developing effective CAR-T cancer therapies.
The teachings of all patents, published applications, and references cited herein are incorporated by reference in their entirety.
While example embodiments have been particularly shown and described, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the embodiments encompassed by the appended claims.
/>
/>
/>
/>
/>
/>
/>
TABLE 4 structural components of the constructs used in FIGS. 1-26
Clone #) Details of construction
SR6 IL13 mutein-HER2(FRP5)
SR7 IL13 mutein-HER2(4D5,#2)
SR8 IL13 mutein-HER2(4D5,#5)
SR9 IL13 mutein-HER2(4D5,#8)
SR10 7D12_EGFR.BiTE
SR11 9G8_EGFR.BiTE
SR12 38G7_EGFR.BiTE
SR13 Cetuximab_EGFR.BiTE
SR14 Blinatumomab_CD19.BiTE
SR15 7D12_9G8-CD3_EGFR.BiTE
SR16 7D12_38G7-CD3_EGFR.BiTE
SR17 7D12-CD3-9G8_EGFR.BiTE
SR18 7D12-CD3-38G7_EGFR.BiTE
SR19 Parent vector with GFP
SR20 IL13 mutein-HER2(4D5,#2)-Cetuximab_EGFR.BiTE
SR21 IL13 mutein-HER2(4D5,#2)-7D12_EGFR.BiTE
SR22 IL13 mutein-HER2(4D5,#2)-7D12-CD3-38G7_EGFR.BiTE
SR23 IL13 mutein-HER2(4D5,#2)-Blinatumomab_CD19.BiTE
SR24 IL13 mutein-HER2(4D5,#8)-Cetuximab_EGFR.BiTE
SR25 IL13 mutein-HER2(4D5,#8)-7D12_EGFR.BiTE
SR26 IL13 mutein-HER2(4D5,#8)-7D12-CD3-38G7_EGFR.BiTE
SR27 IL13 mutein-HER2(4D5,#8)-Blinatumomab_CD19.BiTE
TABLE 5 materials
/>
TABLE 6 primer and probe sequences
TABLE 7 qPCR reaction
Composition of the components Final concentration Volume of
PrimeTime gene expression premix (2 x) 1x 10μl
Forward primer 1μM 2μl
Reverse primer 1μM 2μl
Probe with a probe tip 250nM 0.5μl
DNA template ～100ng 5μl
Nuclease-free water Added to 20 μl
TABLE 8 qPCR cycling conditions
Step (a) Cycle number Temperature (temperature) Cycle number
Polymerase activation 1 95℃ 3min
Amplification of 45
Denaturation (denaturation) 95℃ 15sec
Annealing/extension 60℃ 1min
Holding 1 4℃ For 24hr
TABLE 9 killing Activity
The killing activity of T cells each identified by the composition, SEQ ID No. and/or clone number prepared by using the correlation methods disclosed herein was assessed by using correlation assays and summarized herein. For comparison purposes, certain entries are included in the following table.
/>
/>
/>
/>
Killing scale: 0 (lowest) -10 (highest)

Claims (122)

1. A polynucleotide comprising a sequence encoding a Chimeric Antigen Receptor (CAR) and a T cell adapter, wherein the CAR is capable of binding to one or more first Tumor Associated Antigens (TAAs) and the T cell adapter is capable of binding to a T cell and a second TAA.
2. The polynucleotide of claim 1, wherein the CAR is monospecific.
3. The polynucleotide of claim 1, wherein the CAR is bispecific.
4. A polynucleotide according to claim 3, wherein the CAR is capable of binding to two epitopes of the first TAA.
5. A polynucleotide according to claim 3, wherein the CAR is capable of binding to two first TAAs.
6. The polynucleotide of any one of claims 1-5, wherein the one or more first TAAs and second TAAs are each independently expressed on a hematological cancer cell.
7. The polynucleotide of any one of claims 1-5, wherein the one or more first TAAs and second TAAs are each independently expressed on a solid tumor cell.
8. The polynucleotide of claim 7, wherein the solid tumor is brain tumor, breast cancer, lung cancer, or liver cancer.
9. The polynucleotide of claim 8, wherein the brain tumor is Glioblastoma (GBM), optionally wherein the GBM is a recurrent or primary glioblastoma multiforme.
10. The polynucleotide of claim 8, wherein the brain tumor is a brain metastasis, optionally the brain metastasis is non-small cell lung cancer brain metastasis (NSCLCBM), small Cell Lung Cancer Brain Metastasis (SCLCBM), HER 2-positive metastatic breast cancer or Triple Negative Breast Cancer Brain Metastasis (TNBCBM).
11. The polynucleotide of claim 8, wherein the liver cancer is hepatocellular carcinoma (HCC).
12. The polynucleotide of any one of claims 1-11, wherein the one or more first TAAs are each independently selected from interleukin-13 receptor subunit α -2 (IL 13 ra 2), human epidermal growth factor receptor 2 (HER 2), epidermal Growth Factor Receptor (EGFR), EGFR variant III (EGFRvIII), glucagon-3 (GPC 3), or a combination thereof.
13. The polynucleotide of any one of claims 1 to 12, wherein the CAR comprises a mutein, a single chain variable fragment (scFv), a nanobody, or a combination thereof.
14. The polynucleotide of claim 13, wherein the CAR comprises a mutein and a single-chain variable fragment (scFv), two nanobodies, a mutein and two nanobodies, or a scFv and a nanobody.
15. The polynucleotide of claim 13, wherein the CAR comprises:
interleukin-13 (IL 13) muteins;
HER 2-binding scFv;
IL13 muteins and HER 2-binding scFv;
HER 2-binding nanobodies;
two HER 2-binding nanobodies;
IL13 muteins and two HER 2-binding nanobodies;
EGFR or EGFRvIII-binding scFv;
EGFR or egfrvlll-binding nanobody;
two EGFR or egfrvlll-binding nanobodies;
GPC 3-binding nanobodies; or (b)
GPC 3-bound nanobody and GPC 3-bound scFv.
16. The polynucleotide according to claim 15, wherein,
the IL13 muteins each independently comprise a sequence identical to SEQ ID NO:1, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
the HER 2-binding scFv each independently comprises a sequence identical to SEQ ID NO:2-4, wherein at least one of the amino acid sequences shown in figures 2-4 has an amino acid sequence that is at least 90% identical;
the HER 2-binding nanobodies each independently comprise a sequence identical to SEQ ID NO:242-259, at least one of the amino acid sequences having at least 90% identity;
the EGFR-binding nanobodies each independently comprise a sequence identical to SEQ ID NO:15-17 and 260-281, wherein at least one of the amino acid sequences shown in seq id No. s has at least 90% identity;
The egfrvlll-binding nanobodies each independently comprise a sequence identical to SEQ ID NO:15-17 and 260-281, wherein at least one of the amino acid sequences shown in seq id No. s has at least 90% identity; or (b)
The GPC 3-binding nanobodies each independently comprise a sequence identical to SEQ ID NO:282-291, at least one of the amino acid sequences having at least 90% identity,
or a combination thereof.
17. The polynucleotide according to claim 15, wherein,
the IL13 mutein is compared to SEQ ID NO:1 each independently comprises about 1-12 amino acid substitutions;
the HER 2-binding scFv is relative to SEQ ID NO:2-4 each independently comprises about 1-25 amino acid substitutions;
the HER 2-binding nanobody has a sequence corresponding to SEQ ID NO:242-259, each independently comprising about 1-12 amino acid substitutions;
the EGFR-binding nanobody has a sequence that is equal to or greater than SEQ ID NO:15-17 and 260-281 each independently comprising about 1-12 amino acid substitutions;
the egfrvlll-binding nanobody has a specific sequence as compared to SEQ ID NO:15-17 and 260-281 each independently comprising about 1-12 amino acid substitutions; or (b)
The GPC 3-binding nanobody has a sequence corresponding to SEQ ID NO:282-291, each independently comprising about 1-12 amino acid substitutions,
or a combination thereof.
18. The polynucleotide of claim 17, wherein the amino acid substitution is a conservative substitution.
19. The polynucleotide of claim 18, wherein the amino acid substitution is a highly conserved substitution.
20. The polynucleotide according to claim 15, wherein,
the IL13 muteins each independently comprise the amino acid sequence as set forth in SEQ ID NO:1, and a polypeptide sequence shown in 1;
the HER 2-binding scFv independently comprise the amino acid sequence as set forth in SEQ ID NO:2-4, and a polypeptide comprising the amino acid sequence shown in any one of 2-4;
the HER 2-binding nanobodies each independently comprise a polypeptide as set forth in SEQ ID NOs: 242-259;
the EGFR-binding nanobodies each independently comprise an amino acid sequence as set forth in SEQ ID NOs:15-17 and 260-281;
the egfrvlll-binding nanobodies each independently comprise the amino acid sequence as set forth in SEQ ID NOs:15-17 and 260-281; or (b)
The GPC 3-binding nanobodies each independently comprise a sequence as set forth in SEQ ID NOs:282-291,
Or a combination thereof.
21. The polynucleotide of any one of claims 1-20, wherein the CAR comprises:
a linker;
a CD8 a signal peptide;
a CD8 a hinge;
a CD28 transmembrane domain;
4-1BB co-stimulatory domain;
a CD3 zeta signaling domain;
or a combination thereof.
22. The polynucleotide according to claim 21, wherein,
the linker comprises a sequence identical to SEQ ID NO:5, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
the CD8 a signal peptide comprises a sequence identical to SEQ ID NO:6, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
the CD8 a hinge comprises a sequence identical to SEQ ID NO:7, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
the CD28 transmembrane domain comprises a sequence that hybridizes to SEQ ID NO:8, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
the 4-1BB co-stimulatory domain comprises a sequence identical to SEQ ID NO:9, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no; or (b)
The CD3 zeta signaling domain comprises a sequence identical to SEQ ID NO:10, an amino acid sequence having at least 90% identity to the amino acid sequence set forth in seq id no;
or a combination thereof.
23. The polynucleotide according to claim 21, wherein,
The linker is relative to SEQ ID NO:5 comprises 1 or 2 amino acid substitutions;
the CD8 a signal peptide is relative to SEQ ID NO:6 comprises 1 or 2 amino acid substitutions;
the CD8 a hinge is relative to SEQ ID NO:7 comprises about 1-5 amino acid substitutions;
the CD28 transmembrane domain is relative to SEQ ID NO:8 comprises about 1-3 amino acid substitutions;
the 4-1BB co-stimulatory domain is relative to SEQ ID NO:9 comprises about 1-5 amino acid substitutions; or (b)
The CD3 zeta signaling domain is relative to SEQ ID NO:10 comprises about 1-12 amino acid substitutions;
or a combination thereof.
24. The polynucleotide according to claim 21, wherein,
the linker comprises the amino acid sequence as set forth in SEQ ID NO:5, an amino acid sequence shown in the specification;
the CD8 a signal peptide comprises the amino acid sequence as set forth in SEQ ID NO: 6;
the CD8 a hinge comprises the amino acid sequence as set forth in SEQ ID NO: 7;
the CD28 transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8;
the 4-1BB co-stimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 9; or (b)
The CD3 zeta signaling domain comprises the amino acid sequence as set forth in SEQ ID NO:10, an amino acid sequence shown in seq id no;
Or a combination thereof.
25. The polynucleotide of any one of claims 1-24, wherein the T cell adapter is capable of binding to two TAA epitopes.
26. The polynucleotide of claim 25, wherein the T cell adapter is capable of binding to two TAA epitopes of the second TAA.
27. The polynucleotide of claim 25, wherein the T cell adapter is capable of binding two second TAAs.
28. The polynucleotide of any one of claims 1-27, wherein each of the second TAAs is independently interleukin-13 receptor subunit α -2 (IL 13 ra 2), HER2, EGFR, egfrvlll, or GPC3.
29. The polynucleotide of any one of claims 1-28, wherein the T cell adaptor comprises a single chain variable fragment (scFv), nanobody, or combination thereof.
30. The polynucleotide of claim 29, wherein the T cell adapter comprises a CD 3-binding scFv and an EGFR-binding scFv.
31. The polynucleotide of claim 29, wherein the T cell adapter comprises a CD 3-binding scFv and an EGFR-binding nanobody.
32. The polynucleotide of claim 29, wherein the T cell adapter comprises a CD 3-binding scFv and two EGFR-binding nanobodies.
33. The polynucleotide of claim 29, wherein the T cell adaptor comprises a CD 3-binding scFv and two GPC 3-binding nanobodies.
34. The polynucleotide of any one of claims 30-32, wherein the EGFR-binding scFv and EGFR-binding nanobody each independently comprises a sequence that hybridizes to SEQ ID NO:15-17 and 260-281, and at least one of the amino acid sequences having at least 90% identity.
35. The polynucleotide of any one of claims 30-32, 34, wherein the EGFR-binding scFv and EGFR-binding nanobody have a sequence that is substantially identical to the sequence of SEQ ID NO:15-17 and 260-281 each independently comprising about 1-12 amino acid substitutions.
36. The polynucleotide of claim 33, wherein the GPC 3-binding nanobody comprises a sequence corresponding to SEQ ID NO:282-291, at least one of the amino acid sequences having at least 90% identity.
37. The polynucleotide of claim 33 or 36, wherein the GPC 3-binding nanobody has a sequence corresponding to SEQ ID NO:282-291, each independently comprising about 1-12 amino acid substitutions.
38. The polynucleotide of any one of claims 1-37, wherein said T cell adapter comprises a signal peptide.
39. The polynucleotide of claim 38, wherein said signal peptide comprises the sequence set forth in SEQ ID NO:19, and a polypeptide comprising the amino acid sequence shown in seq id no.
40. The polynucleotide of any one of claims 1-39, wherein said T cell adapter comprises a sequence independently selected from the group consisting of SEQ ID NOs: 20-24, 109-111 and 176, and at least one of the amino acid sequences having at least 90% identity.
41. The polynucleotide of any one of claims 1-40, wherein said T cell adapter is positioned relative to a polynucleotide independently selected from the group consisting of SEQ ID NOs: 21-23, 109-111 comprises about 1-40 amino acid substitutions.
42. The polynucleotide of any one of claims 1-40, wherein said T cell adapter is positioned relative to a polynucleotide independently selected from the group consisting of SEQ ID NOs: 24-27, 176-178 and 292 comprises about 1-55 amino acid substitutions.
43. The polynucleotide of any one of claims 1-40, wherein said T cell adapter comprises the sequence set forth in SEQ ID NO:21 An amino acid sequence as set forth in any one of claims 22, 23, 24, 25, 26, 27, 109, 110, 111, 176, 177, 178 or 292.
44. The polynucleotide of claim 1, wherein the polynucleotide encodes an amino acid sequence that is identical to an amino acid sequence independently selected from the group consisting of SEQ ID NOs:31-38, SEQ ID NOs:106-108, SEQ ID NOs:112-119, seq ID NOs:173-175, SEQ ID NOs:179-186, SEQ ID NOs:192-203, SEQ ID NOs:222-237 or SEQ ID NOs:239-241, or a combination thereof, has at least 90% identity.
45. The polynucleotide of claim 1, wherein the polynucleotide encodes an amino acid sequence that is relative to an amino acid sequence independently selected from the group consisting of SEQ ID NOs:31-38, SEQ ID NOs:106-108, SEQ ID NOs:112-119, seq ID NOs:173-175, SEQ ID NOs:179-186, SEQ ID NOs:192-203, SEQ ID NOs:222-237 or SEQ ID NOs:239-241, or a combination thereof, comprises about 1-50 amino acid substitutions.
46. The polynucleotide of claim 1, wherein the amino acid sequences encoded by the polynucleotides are each independently selected from the group consisting of SEQ ID NOs:31-38, SEQ ID NOs:106-108, SEQ ID NOs:112-119, seq ID NOs:173-175, SEQ ID NOs:179-186, SEQ ID NOs:192-203, SEQ ID NOs:222-237 or SEQ ID NOs: 239-241.
47. A polynucleotide comprising a T cell adapter coding sequence, wherein the T cell adapter is capable of binding to a T cell, a first TAA epitope, and a second TAA epitope.
48. The polynucleotide of claim 47, wherein said T cell adapter is capable of binding CD3.
49. The polynucleotide of claim 47 or 48, wherein said first TAA epitope and said second TAA epitope are on a second TAA.
50. The polynucleotide of claim 47 or 48, wherein said first TAA epitope and said second TAA epitope are on two second TAAs.
51. The polynucleotide of claim 49 or 50, wherein each of said second TAAs is independently EGFR, egfrvlll, or GPC3.
52. The polynucleotide of any one of claims 47-51, wherein said T cell adaptor comprises a single chain variable fragment (scFv), nanobody, or combination thereof.
53. A polynucleotide comprising an amino acid sequence coding sequence, wherein said amino acid sequence is identical to a sequence independently selected from the group consisting of SEQ ID NOs:2-4, SEQ ID NOs:11-13and 52,SEQ ID NOs:15-17, SEQ ID NOs:21-23, SEQ ID NOs:109-111, SEQ ID NOs:49and 50,SEQ ID NOs:53-70, SEQ ID NOs:72-82, SEQ ID NOs:83-104, SEQ ID NOs:120-137, SEQ ID NOs:139-149, SEQ ID NOs:150-171, SEQ ID NOs:188-191, SEQ ID NOs:204and 206-214, SEQ ID NOs:215-221, or SEQ ID NOs:242-291, or a combination thereof, has at least 90% identity.
54. The polynucleotide of claim 53, wherein said amino acid sequence is identical to a sequence independently selected from the group consisting of SEQ ID NOs:2-4, 11-13, 15-17, 21-23, 49, 50, 52-70, 72-104, 109-111, 120-137, 139-171, 188-191, 204, 206-221 and 242-291.
55. A vector comprising the polynucleotide of any one of claims 1-54.
56. A fusion protein encoded by the polynucleotide of any one of claims 1-54 or the vector of claim 55.
57. The fusion protein of claim 56, wherein the fusion protein comprises a self-cleaving peptide, optionally, the self-cleaving peptide is a T2A peptide (SEQ ID NO: 28).
58. A host cell comprising the polynucleotide of any one of claims 1-54, or the vector of claim 55, or the fusion protein of claim 56 or 57.
59. A T lymphocyte comprising the polynucleotide of any one of claims 1-54, the vector of claim 55, or the fusion protein of claim 46 or 47, or a combination thereof.
60. A T lymphocyte comprising a polynucleotide of any of claims 47 to 52 and a polynucleotide comprising a CAR coding sequence, said CAR being capable of binding to a first TAA.
61. The T lymphocyte of claim 60, wherein said CAR is monospecific.
62. The T lymphocyte of claim 60, wherein said CAR is bispecific.
63. The T lymphocyte of claim 60, wherein said CAR is capable of binding to two epitopes of a first TAA.
64. The T lymphocyte of claim 60, wherein said CAR is capable of binding to two first TAAs.
65. A composition comprising the T lymphocyte of any of claims 59-64.
66. The composition of claim 65, further comprising a cryopreservation medium comprising about 2%, about 5%, or about 10% dimethyl sulfoxide (DMSO), wherein the cryopreservation medium is substantially free of serum.
67. The composition of claim 65 or 66, wherein it is in a storage vial.
68. A pharmaceutical composition comprising the composition of claim 65 or 66, and a pharmaceutically acceptable carrier.
69. A kit comprising a container and optionally instructions for use, wherein the container comprises the pharmaceutical composition of claim 68.
70. The use of the polynucleotide of any one of claims 1-54, the T lymphocyte of any one of claims 59-64, the composition of any one of claims 65-67, or the pharmaceutical composition of claim 68, for the preparation of a medicament for treating cancer in a subject in need thereof.
71. The T lymphocyte of any of claims 59-64, the composition of any of claims 65-67, or the pharmaceutical composition of claim 68 for use in treating cancer in a subject in need thereof.
72. A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of T lymphocytes according to any of claims 59-64, the composition of any of claims 65-67, or the pharmaceutical composition of claim 68.
73. The method of claim 72, wherein the cancer is hematological cancer.
74. The method of claim 72, wherein the cancer is a solid tumor.
75. The method of claim 74, wherein the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer.
76. The method of claim 75, wherein the brain tumor is Glioblastoma (GBM), optionally the GBM is recurrent or primary glioblastoma multiforme.
77. The method of claim 75, wherein the brain tumor is a brain metastasis, optionally the brain metastasis is non-small cell lung cancer brain metastasis (NSCLCBM), small Cell Lung Cancer Brain Metastasis (SCLCBM), HER 2-positive metastatic breast cancer or Triple Negative Breast Cancer Brain Metastasis (TNBCBM).
78. The method of claim 75, wherein the liver cancer is hepatocellular carcinoma (HCC).
79. The method of any one of claims 72-78, wherein the subject is 18 years old and older.
80. The method of any one of claims 72-79, wherein the subject is newly diagnosed with cancer.
81. The method of any one of claims 72-79, wherein the subject has relapsed from or is resistant to a previous cancer treatment.
82. The method of any one of claims 72-81, wherein the subject is a human patient.
83. The method of any one of claims 72-82, wherein the T lymphocytes are allogeneic or syngeneic T lymphocytes.
84. The method of any one of claims 72-83, wherein the T lymphocytes are autologous T lymphocytes.
85. The method of any one of claims 72-84, wherein at least 10% of the T lymphocytes each express a CAR and a T cell adapter.
86. The method of claim 85, wherein about 15-75% of the T lymphocytes each express a bispecific CAR and a T cell adapter.
87. The method of any one of claims 72-86, wherein the T lymphocytes are administered in a single intravenous infusion.
88. The method of any one of claims 72-86, wherein the T lymphocytes are administered in two or more intravenous infusions.
89. The method of any one of claims 72-88, comprising administering chemotherapy to the subject prior to administering the T lymphocytes.
90. A method of inducing T cell-mediated lysis of cancer cells comprising contacting cancer cells with an effective amount of T lymphocytes according to any of claims 59-64.
91. The method of claim 90, wherein the cancer cell is a cell from a hematologic cancer.
92. The method of claim 90, wherein the cancer cell is a cell from a solid tumor.
93. The method of claim 92, wherein the solid tumor is a brain tumor, breast cancer, lung cancer, or liver cancer.
94. The method of claim 93, wherein said brain tumor is Glioblastoma (GBM).
95. The method of claim 94, wherein the GBM is recurrent or primary glioblastoma multiforme.
96. The method of claim 93, wherein said brain tumor is a brain metastasis.
97. The method of claim 96, wherein the brain metastasis is non-small cell lung cancer brain metastasis (NSCLCBM), small Cell Lung Cancer Brain Metastasis (SCLCBM), HER 2-positive metastatic breast cancer or Triple Negative Breast Cancer Brain Metastasis (TNBCBM).
98. The method of claim 93, wherein the liver cancer is hepatocellular carcinoma (HCC).
99. A polypeptide comprising a polypeptide independently selected from the group consisting of SEQ ID NOs:2-4, 15-17, or 242-291, or an amino acid sequence having at least 90% identity.
100. The polypeptide of claim 99, comprising a sequence independently selected from the group consisting of SEQ ID NOs:2-4, 15-17, or 242-291.
101. A T cell adapter capable of binding to a T cell, a first TAA epitope, and a second TAA epitope, wherein the T cell adapter is produced in situ by a CAR T-cell through an interaction between the CAR and the first TAA.
102. The T cell adapter of claim 101, wherein the T cell adapter is encoded in a polynucleotide comprising a sequence encoding a CAR.
103. The T cell adapter of claim 101 wherein the CAR T-cell comprises a polynucleotide comprising a sequence encoding the T cell adapter.
104. The T cell adapter of claim 103 wherein the CAR T-cell comprises a polynucleotide comprising a sequence encoding the CAR.
105. The T cell adapter of any one of claims 101-104, wherein the CAR is capable of binding to a first TAA.
106. The T cell adapter of claim 105, wherein the first TAA is CEA, GPC3, MUC-1, epcam, her receptor, PEM, caludi 6, cluadi-18.2, mesothelin, a33, G250, carbohydrate antigen lay, lex, leb, PSMA, TAG-72, steap1, cd166, CD24, CD44, E-cadherin, SPARC, erbB2, erbB3, MUC1, LMP2, idiotype, HPV E6& E7, EGFR, EGFRvIII, HER-2/neu, MAGE A3, NY-ESO-1, gd2, PSMA, pcsa, psa, melana/MART1, CD19, CD20, CD22, CD33, CD5, CD70, or bcma.
107. The T cell adapter of claim 105 wherein the first TAA is HER2, GPC3, EGFR, egfrvlll, or GPC3.
108. The T cell adapter of any one of claims 101-107, wherein the T cell adapter is capable of binding to CD2, CD3, VLA-1, CD8, CD4, ccr6, CXCR5, CD25, CD31, CD45ro, CD197, CD127, CD38, CD27, CD196, CD277, or CXCR3.
109. The T cell adapter of any one of claims 101-108, wherein the T cell adapter is capable of binding to CD2, CD3, CD31, or CD277.
110. The T cell adapter of any one of claims 101-109, wherein the T cell adapter is capable of binding CD3.
111. The T cell adapter of any one of claims 101-110, wherein the first TAA epitope and the second TAA epitope are on the second TAA.
112. The T cell adapter of any one of claims 101-110, wherein the first TAA epitope and the second TAA epitope are on two second TAAs.
113. The T cell adapter of claim 111 or 112, wherein each of the second TAAs is independently EGFR, egfrvlll, or GPC-3.
114. The T cell adaptor according to any one of claims 101-113, comprising a single chain variable fragment (scFv), nanobody, or combination thereof.
115. The T cell adapter of any one of claims 101-114, wherein the interaction is an immune synapse.
116. A polypeptide capable of specifically binding to glucagon-3 (GPC 3), comprising heavy chain complementarity determining region 1 (HCDR 1), heavy chain complementarity determining region 2 (HCDR 2) and heavy chain complementarity determining region 3 (HCDR 3), each comprising a sequence as set forth in SEQ ID NO:284, SEQ ID NO:286 or SEQ ID NO:289 (V) H ) The amino acid sequences of HCDR1, HCDR2 and HCDR3 of the amino acid sequence have an amino acid sequence of at least 90% identity.
117. The polypeptide of claim 116, wherein the HCDR1, HCDR2 and HCDR3 are each identical to SEQ ID NO: 284. SEQ ID NO:286 or SEQ ID NO: v shown in 289 H The amino acid sequences are identical for HCDR1, HCDR2 and HCDR 3.
118. The polypeptide of claim 116, wherein the HCDR1, HCDR2 and HCDR3 each have at least 90% identity to the amino acid sequences of:
SEQ ID NO:303, seq ID NO:304 and SEQ ID NO:305;
SEQ ID NO:306, SEQ ID NO:307 and SEQ ID NO: 308.
SEQ ID NO:309, SEQ ID NO:310 and SEQ ID NO: 308.
SEQ ID NO:311, SEQ ID NO:312 and SEQ ID NO:313;
SEQ ID NO:314, SEQ ID NO:315 and SEQ ID NO:316, a step of;
SEQ ID NO:317, SEQ ID NO:318 and SEQ ID NO:316, a step of;
SEQ ID NO:319, SEQ ID NO:320 and SEQ ID NO:321, a base;
SEQ ID NO:322, SEQ ID NO:323 and SEQ ID NO:324, a base; or (b)
SEQ ID NO:325, SEQ ID NO:326 and SEQ ID NO:324.
119. the polypeptide of claim 116, wherein the HCDR1, HCDR2 and HCDR3 are each identical in amino acid sequence with:
SEQ ID NO:303, seq ID NO:304 and SEQ ID NO:305;
SEQ ID NO:306, SEQ ID NO:307 and SEQ ID NO: 308.
SEQ ID NO:309, SEQ ID NO:310 and SEQ ID NO: 308.
SEQ ID NO:311, SEQ ID NO:312 and SEQ ID NO:313;
SEQ ID NO:314, SEQ ID NO:315 and SEQ ID NO:316, a step of;
SEQ ID NO:317, SEQ ID NO:318 and SEQ ID NO:316, a step of;
SEQ ID NO:319, SEQ ID NO:320 and SEQ ID NO:321, a base;
SEQ ID NO:322, SEQ ID NO:323 and SEQ ID NO:324, a base; or (b)
SEQ ID NO:325, SEQ ID NO:326 and SEQ ID NO:324.
120. The polypeptide of claim 116, comprising a sequence that hybridizes to SEQ ID NO:284, SEQ ID NO:286 or SEQ ID NO:289 has an amino acid sequence having at least 85% identity.
121. The polypeptide of claim 120, wherein the amino acid sequence is set forth in SEQ ID NO:284, SEQ ID NO:286 or SEQ ID NO: 289.
122. The polypeptide of any one of claims 116-121, wherein the polypeptide is a nanobody.
CN202180078269.XA 2020-11-20 2021-11-19 Armed Dual CAR-T Compositions and Methods for Cancer Immunotherapy Pending CN116917328A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US63/116,402 2020-11-20
US202163243486P 2021-09-13 2021-09-13
US63/243,486 2021-09-13
PCT/US2021/072533 WO2022109611A1 (en) 2020-11-20 2021-11-19 Armed dual car-t compositions and methods for cancer immunotherapy

Publications (1)

Publication Number Publication Date
CN116917328A true CN116917328A (en) 2023-10-20

Family

ID=88358810

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180078269.XA Pending CN116917328A (en) 2020-11-20 2021-11-19 Armed Dual CAR-T Compositions and Methods for Cancer Immunotherapy

Country Status (1)

Country Link
CN (1) CN116917328A (en)

Similar Documents

Publication Publication Date Title
TWI728309B (en) A chimeric antigen receptor (car) binding to bcma and use thereof
TWI728308B (en) A chimeric antigen receptor (car) binding to bcma and use thereof
JP6420776B2 (en) Engager cells for immunotherapy
ES2857998T3 (en) Chimeric antigen receptors
JP7198670B2 (en) Immunomodulatory IL2R fusion proteins and uses thereof
WO2010030002A1 (en) Cell capable of expressing exogenous gitr ligand
AU2016306209A1 (en) Bispecific CAR T-cells for solid tumor targeting
AU2020207962A1 (en) Methods and compositions to improve the safety and efficacy of cellular therapies
JP2018504104A (en) Inhibitory chimeric antigen receptor expressing non-T cell transduction domain (iCAR or N-CAR)
CN108064252A (en) Chimeric antigen receptor and its application method
AU2017216213A1 (en) Engineered antigen presenting cells and uses thereof
CN113056284A (en) Therapy for treating cancer by intratumoral and/or intravenous administration of recombinant MVA encoding 4-1BBL (CD137L) and/or CD40L
US20210324388A1 (en) A Method to Specifically Stimulate Survival and Expansion of Genetically-Modified Immune Cells
US20210107996A1 (en) Plap-car-effector cells
AU2019236307A1 (en) Anti-GUCY2C chimeric antigen receptor compositions and methods
CN110054698B (en) Construction and application of novel CD19-CAR vector of anti-CD 19 antibody
JP2019206508A (en) Cancer-treating recombinant protein that improves cytotoxic activity of cancer killer cell and use thereof
US20230399402A1 (en) Hla class ii-restricted tcrs against the kras g12>v activating mutation
CN116917328A (en) Armed Dual CAR-T Compositions and Methods for Cancer Immunotherapy
US11617767B2 (en) Armed dual CAR-T compositions and methods for cancer immunotherapy
Shabaneh et al. Safety switch optimization enhances antibody-mediated elimination of CAR T cells
JP2022516710A (en) CAR T cell methods and constructs
EP4079318A1 (en) Combination of car-nk cells with nkg2a blocking agents, pharmaceutical composition comprising the same and use thereof
CN109593137B (en) Construction and application of novel CD20-CAR vector of anti-CD 20 antibody
WO2023093888A1 (en) Preparation and use of immune cells of chimeric antigen receptor constructed on the basis of efna1

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination