CN116891871A - Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof - Google Patents

Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof Download PDF

Info

Publication number
CN116891871A
CN116891871A CN202211627504.7A CN202211627504A CN116891871A CN 116891871 A CN116891871 A CN 116891871A CN 202211627504 A CN202211627504 A CN 202211627504A CN 116891871 A CN116891871 A CN 116891871A
Authority
CN
China
Prior art keywords
cucurbitadienol
synthesizing
gene
tobacco
steps
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211627504.7A
Other languages
Chinese (zh)
Inventor
郭兆宽
杨生超
张广辉
王益娜
舒彦宇
陈庚
李志远
赵玉成
冯晓林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Agricultural University
Original Assignee
Yunnan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Agricultural University filed Critical Yunnan Agricultural University
Priority to CN202211627504.7A priority Critical patent/CN116891871A/en
Publication of CN116891871A publication Critical patent/CN116891871A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
    • C12Y504/99033—Cucurbitadienol synthase (5.4.99.33)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for synthesizing cucurbitadienol by using cucurbitadienol synthase, which is to transfer a cucurbitadienol synthase gene HcOSC6 and a tHMGR gene of Avena sativa into tobacco simultaneously to obtain transgenic tobacco for synthesizing cucurbitadienol. The invention has the advantages that: the obtained transgenic plants can synthesize cucurbitadienol, so that the key intermediates of cucurbitacin are obtained more efficiently and conveniently. The method is simple and easy to operate, is suitable for large-scale production and market popularization and application, and provides a new way for obtaining the cucurbitacin key intermediate.

Description

Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof.
Background
Cucurbitacins (curbstains) are tetracyclic triterpene compounds taking cucurbitane as a framework, are mainly present in cucurbitaceae plants, and have remarkable anticancer activity. Some cucurbitane glycosides (mogrosides) in fructus Siraitiae Grosvenorii (Siraitia grosvenori) of Cucurbitaceae have strong sweet taste, and are potential sugar substitutes for diabetics. The analysis of the biosynthesis pathway of cucurbitacin and cucurbitacin glucoside is of great significance for melon crop breeding and biosynthesis of cucurbitacin monomers and mogrosides.
Cucurbitacin and mogrosides are similar to most plant triterpenes, and are mainly derived from mevalonate metabolic pathways, namely cucurbitadienol formed by cyclizing 2, 3-oxidized squalene from acetyl coenzyme A serving as a raw material through a sequence reaction, and are catalyzed by cucurbitadienol synthase (CBS) of the family of Oxidized Squalene Cyclases (OSCs). Plants often have multiple OSC family members at the same time, e.g., balsam pear (Momordica charantia) has 4 OSC family members, which are cucurbitadienol synthase (CBS), isomultfluorenol synthase (IMS), beta-resinol synthase (BAS) and cycloartenol synthase (CAS), respectively. Similarly, the cucurbitadienol synthase (CBS) gene OSC6 in chinese hemsleya (h. In most cases, the triterpene skeleton formed by OSC is subjected to oxidative modification at a specific site by introducing a hydroxyl group, a carboxyl group or an epoxy group under the catalysis of cytochrome P450 (CYP), thereby producing various triterpenes.
Disclosure of Invention
In view of the above problems, the present invention aims to provide a method for synthesizing cucurbitadienol using cucurbitadienol synthase, which can obtain high content of cucurbitadienol.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
a method for synthesizing cucurbitadienol by using cucurbitadienol synthase comprises the step of simultaneously transferring a cucurbitadienol synthase gene HcOSC6 and a tHMGR gene of Avena sativa L to tobacco to obtain transgenic tobacco for synthesizing cucurbitadienol.
Preferably, the amplification method of the cucurbitadienol synthase gene HcOSC6 comprises the following steps: extracting total RNA from hemsleya root tuber, synthesizing pseudo-ginseng cDNA by reverse transcription, using the synthesized first-strand cDNA as a template, and amplifying the cucurbitadienol synthase CBS homologous gene HcOSC6 gene by PCR.
Preferably, the amplification method of the tHMGR gene of Avena sativa comprises the following steps: extracting total RNA from the root of the Avena sativa, synthesizing pseudo-ginseng cDNA by reverse transcription, and amplifying the gene tHMGR by PCR by taking the synthesized first-strand cDNA as a template.
Preferably, target fragments containing the cucurbit dienol synthase gene HcOSC6 and tHMGR gene of the Avena sativa are respectively connected to a pEAQ-HT-DEST1 plant expression vector, and agrobacterium is transformed, and positive monoclonal is screened out through PCR; infecting tobacco leaves with positive agrobacterium containing a target gene to obtain a transgenic tobacco plant containing two genes of HcOSC6 and tHMGR; extracting total RNA of positive transgenic tobacco, performing reverse transcription to obtain cDNA, and performing RT-PCR to determine whether two genes are expressed; treating tobacco leaves, and measuring the content of cucurbitadienol in the transgenic tobacco leaves.
Preferably, the preparation method of the agrobacterium comprises the following steps: selecting the constructed agrobacterium single colony, and culturing 220 r min < -1 > in an LB liquid culture medium at 28 ℃; 200 a uL a was sucked by a pipette,then adding LB liquid culture medium, and performing subculture until OD is reached 600 At 1.8-2.2, the mixture was collected by centrifugation and suspended in MMA.
Preferably, the Agrobacterium OD 600 One of the recombinant pEAQ-HT-DEST1-GFP Agrobacterium tumefaciens GV3101, EHA105 or LBA4404 strains of 0.8 was infiltrated into the tobacco.
Preferably, the pressure of the tobacco leaf is 40-100 KPa when the tobacco leaf is infiltrated; the infiltration mode is impregnation, and the impregnation time is 1-3 minutes.
Particularly preferably, the pressure at which the tobacco leaves are impregnated is 80 KPa.
Preferably, the method for treating tobacco leaves comprises the following steps: refrigerating fresh tobacco leaves in liquid nitrogen, adding quartz sand into a grinding vessel, grinding into powder, extracting by re-steaming n-hexane, then performing ultrasonic extraction, extracting by using mixed liquid of re-steaming n-hexane and ethyl acetate, and centrifuging the extract; taking supernatant into a liquid phase small bottle, drying by a nitrogen blower, carrying out derivative precipitation by trimethylsilyl cyanide, re-suspending the dried sample after the derivative in normal hexane for re-dissolution, and detecting the cucurbituril content in the transgenic tobacco by using HPLC and GC-MS.
An application of cucurbitadienol synthase gene HcOSC6 and tHMGR gene of Avena sativa in synthesizing cucurbitadienol by simultaneous transfer to tobacco.
The invention has the beneficial effects that:
the invention adopts an agrobacterium infiltration method (Agro-filtration), namely the transient expression mediated by agrobacterium tumefaciens (Agrobacterium tumefaciens), which is a high-efficiency synthetic biological platform for producing plant triterpenes, and is an effective method for rapidly identifying and finding the related genes of triterpene biosynthesis and verifying functions. The invention establishes a high-efficiency agrobacterium infiltration method, and the OSC6 gene of the Chinese hemsleya amabilis and the tHMGR of the black oat are transiently expressed in the leaf of Benshi tobacco to obtain high-content cucurbitadienol, thereby laying a foundation for the heterologous synthesis of cucurbitacin and mogroside.
Based on the characteristics of easy planting and quick growth of tobacco, the invention simultaneously transfers the CBS homologous gene (HcOSC 6) of cucurbitacin synthase and tHMGR gene of herba Avenae Fatuae in tobacco, and obtains transgenic tobacco capable of simultaneously expressing HcOSC6 and tHMGR genes, and experimental results show that the obtained transgenic plant can synthesize cucurbitacin, so that the acquisition of key intermediates of cucurbitacin is more efficient and convenient.
Drawings
FIG. 1 shows the MVA pathway and exogenous lead-in cucurbitacin biosynthesis pathway in Nicotiana benthamiana;
FIG. 2 is an analysis of GFP expression in leaf of Nicotiana benthamiana after infection with recombinant expression vectors, wherein pEAQ-HT-DEST1-GFP is infiltrated into tobacco expression (red indicates no infection, green is leaf of Agrobacterium-mediated pEAQ-HT-DEST1-GFP infection of tobacco);
FIG. 3 is a gel electrophoresis diagram of the amplification of the target gene;
FIG. 4 shows the effect of various factors of Agrobacterium infiltration on the efficiency of transient GFP expression, wherein: a, respectively infiltrating the vector containing pEAQ-HT-DEST1-GFP of the agrobacterium strains GV3101, EHA105 and LBA4404 into the leaf of Nicotiana benthamiana, and then carrying out transient expression efficiency on different days; b, under different concentrations, the transient expression efficiency of OD600 under infiltration of agrobacterium EHA105 which is a carrier bearing pEAQ-HT-DEST 1-GFP; c under different vacuum pressures, the agrobacterium EHA105 mediated transient expression of pEAQ-HT-DEST 1-GFP;
FIG. 5 is a sample of cucurbitadienol synthase (CBS) tobacco products, GC-MS and HPLC analysis, wherein:
gc-MS molecular ion peak: cucurbitadienol reference, hcOSC6 represents cucurbitadienol and control represents blank control; B. HPLC 200 nm absorption peak, cucurbitadienol control, hcOSC6+tHMGR represents cucurbitadienol, control represents blank control; c, standard quality spectrogram of cucurbitadienol; D. tobacco transient expression cucurbituril mass spectrum; E. yield of cucurbitadienol in CBS and cbs+thmgr.
Detailed Description
The technical scheme of the invention is further described in detail below with reference to the attached drawings and the detailed description.
EXAMPLE 1 vector construction
To rapidly determine whether the foreign gene is expressed in Nicotiana benthamiana leaves, and observe the expression site in cells. The invention constructs pEAQ-HT-DEST1 carrying Green Fluorescent Protein (GFP) gene, named pEAQ-HT-DEST1-GFP.
Using primer GFP-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGTGAGCAAGGGCG and GFP-R: GGGGACCACTTTGTACAAGAAAGCTGGGTAGACAGCTCGTCCATGCC, the GFP coding sequence was amplified from pAN-580-GFP; hcOSC6 sequences were analyzed from the hemsleya amabilis transcriptome, and the HcOSC6 gene was amplified from the hemsleya amabilis cDNA using primers HcOSC6-F and HcOSC6-R, respectively. the tHMGR gene has the ability to enhance triterpene production in the Nicotiana benthamiana transient expression system, and therefore, the Umbelliferae oat HMGR (GenBank: HMGR-KY 284573) was downloaded from the NCBI database, and a 417 nucleotide portion of the HMGR gene (tHMGR) was amplified from the cDNA of Umbelliferae Mao Yanmai using primers tHMGR-F and tHMGR-R. Then adopting Q5-High-Fidelity DNA Polymerase (NEB: M0491) to carry out gene amplification, wherein the PCR reaction program is as follows: 98. at the temperature of 3 min; 98. at the temperature of 30S, 58 ℃, 55S, 72 ℃ for 1 min,35 cycles; 72. and (5) at the temperature of 10 min. The recombination operations were performed according to the system of table 1 below:
TABLE 1 PCR reaction System
Reaction system Volume (mu L)
Q5 High-Fidelity DNA/2 xPhanta Taq Master DNA 25
Template F 2
Template R 2
DNA template 1
Deionized water 20
Total 50
Amplified products were cloned into pDONR207 vector using Gateway entry clone kit BP clonase II mix (Invitrogen). The constructs were all sequenced in the Entry vector to verify the integrity of the clone, and the genes in the relevant Entry vector were cloned into pEAQ-HT-DEST1 using LR clonase II according to the manufacturer's instructions. The successfully constructed pEAQ-HT-DEST1-GFP, pEAQ-HT-DEST1-HcOSC6, pEAQ-HT-DEST1-tHMGR recombinant plasmid, empty vector pAN580-GFP and the like are transformed into agrobacterium competent cells by a freeze thawing method.
EXAMPLE 2 Agrobacterium tumefaciens of Benshi infiltration
Single colonies were picked and placed in liquid medium (50 mg mL) -1 Kan+ 50 mg·mL -1 Rif), 220 r min-1 was cultured at 28 ℃. 200. 200 uL was aspirated with a pipette, and then the fresh liquid medium above was added for subculture until an OD600 of about 2.0 was reached, and the Agrobacterium was collected by centrifugation and suspended in the MMA mix. The MMA buffer was prepared as shown in Table 2:
TABLE 2 MMA buffer solution configuration
Composition of the components Volume (mL/L)
Liquid A 30
Liquid B 15
AS 1.5
Ultrapure water 14.55
(solution A: 10 mmol/L MES; solution B: 10 mmol/L MgCl2; AS100mmol/L acetosyringone (pH=5.7 formulated with KOH)
Setting 4 groups of agrobacterium permeate OD with different concentrations 600 0.4, 0.6, 0.8, 1.0, etc., respectively. The agro-infiltration liquid 250 mL with each concentration is placed in an infiltration pond, the agro-infiltration liquid impregnates the whole plant of tobacco, and the tobacco is impregnated for 3 minutes under the vacuum condition of 80 KPa. In addition, vacuum pressure affecting GFP expression was selected, and set to 40 KPa, 60 KPa, 80 KPa, 100 KPa, 4-5 weeks old tobacco as a permeate plant, and at OD 600 Tobacco leaf RNA was collected after 3 min and 4 days of vacuum infiltration for 0.8 and semi-quantitative analysis was performed.
EXAMPLE 3 tobacco leaf semi-quantitative PCR
Total RNA was extracted from 100 mg tobacco leaves, synthesized by reverse transcription, and diluted to 200 ng. Mu.L-1, and semi-quantitative PCR was performed using this as a template to evaluate the effect of various factors on transformation efficiency. Specific primers P-GFP-F and P-GFP-R were used on the gene encoding GFP, as follows:
EF-F CTGGTATTTCTAAGGATGGACAGA
EF-R AACCTTCTTGAGGTAGGAAGAAA
EXAMPLE 4 analysis of the extraction of cucurbitadienol in tobacco
(1) After the agrobacterium permeates into the Nicotiana benthamiana for 4-5 days, the metabolites in the tobacco are measured by using a gas chromatography-mass spectrometry technology. The fresh tobacco leaves of 200 mg are placed in liquid nitrogen for cooling for 10 min, and are ground into powder together with quartz sand added in a grinding dish, and then are repeatedly extracted for 3 times by 10 mL times by steaming n-hexane, are cultivated for 2 h at 37 ℃, and are then extracted by ultrasonic waves for 30 min. The extract was briefly vortexed and centrifuged at 5859 r min-1 for 15 min, 200. Mu.L of the supernatant was dried with a nitrogen blower in a liquid phase vial and the pellet was derivatised with 55. Mu.L of Trimethylsilylcyanide (TMSCN). The sample was placed on a homogenizer with shaking for 12 min and incubated at 40℃for 40 min. The dried samples after derivatization are resuspended in 200 μl of extraction solvent, i.e. redissolved with 1 ml n-hexane, and then 1 μl of each sample is drawn and directly injected into GC ultra-gas chromatograph for detection in combination with ISQ-type mass spectrometry. 1 μL of sample (sample inlet 250 ℃) was injected in a non-split mode (pulse pressure 30 psi), which involved a 2 min column box temperature of 170℃and a 20℃min-1 rise to 300 ℃. At 300℃for 11.5 min. After a solvent delay of 8 min, the detection was performed in scan mode (60-800 mass units), set to 7.2. Data analysis was performed using MassHunter workstation (Agilent) software.
(2) HPLC detection method: quantitative analysis was performed by separately dosing the formulated cucurbituril standard solutions at different concentrations. Eluting with AgilentZORBAXSB-C18 (4.6 mm x 500 mm,3.5 μm) column at constant speed of 5% pure water (A) and 95% acetonitrile (B) for 0-30 min, 95% B; at a wavelength of 200 nm, a sample injection amount of 8 uL, a flow rate of 0.8 mL min-1, a column temperature of 35 ℃. And drawing a standard curve of the standard substances by taking the content of the 5 standard substances as an abscissa and the corresponding peak area as an ordinate.
The method of the invention is to transfer the cloned CBS gene (HcOSC 6) of the Chinese hemsleya amabilis and tHMGR gene of the Avena sativa into tobacco at the same time to obtain transgenic tobacco capable of synthesizing cucurbita pepo glycol.

Claims (10)

1. A method for synthesizing cucurbitadienol by using cucurbitadienol synthase is characterized in that: the cucurbitadienol synthase gene HcOSC6 and tHMGR gene of the Avena sativa are simultaneously transferred into tobacco to obtain transgenic tobacco for synthesizing cucurbitadienol.
2. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 1, wherein the method comprises the following steps: the amplification method of the cucurbitadienol synthase gene HcOSC6 comprises the following steps: extracting total RNA from hemsleya root tuber, synthesizing pseudo-ginseng cDNA by reverse transcription, using the synthesized first-strand cDNA as a template, and amplifying the cucurbitadienol synthase CBS homologous gene HcOSC6 gene by PCR.
3. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 1, wherein the method comprises the following steps: the amplification method of the tHMGR gene of the Avena sativa comprises the following steps: extracting total RNA from the root of the Avena sativa, synthesizing pseudo-ginseng cDNA by reverse transcription, and amplifying the gene tHMGR by PCR by taking the synthesized first-strand cDNA as a template.
4. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 1, wherein the method comprises the following steps: respectively connecting target fragments of tHMGR genes containing the cucurbit dienol synthase gene HcOSC6 and the Avena sativa to a pEAQ-HT-DEST1 plant expression vector, converting agrobacterium tumefaciens, and screening positive monoclonal by PCR; infecting tobacco leaves with positive agrobacterium containing a target gene to obtain a transgenic tobacco plant containing two genes of HcOSC6 and tHMGR; extracting total RNA of positive transgenic tobacco, performing reverse transcription to obtain cDNA, and performing RT-PCR to determine whether two genes are expressed; treating tobacco leaves, and measuring the content of cucurbitadienol in the transgenic tobacco leaves.
5. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 4, wherein the method comprises the following steps: the preparation method of the agrobacterium comprises the following steps: selecting the constructed agrobacterium single colony, and culturing 220 r min < -1 > in an LB liquid culture medium at 28 ℃; sucking 200 uL with a aspirator, adding LB liquid medium, and subculturing to OD 600 At 1.8-2.2, the mixture was collected by centrifugation and suspended in MMA.
6. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 5, wherein the method comprises the following steps: the Agrobacterium OD 600 One of the recombinant pEAQ-HT-DEST1-GFP Agrobacterium tumefaciens GV3101, EHA105 or LBA4404 strains of 0.8 was infiltrated into the tobacco.
7. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 6, wherein the method comprises the following steps: the pressure of the tobacco leaf is 40-100 KPa when the tobacco leaf is infiltrated; the infiltration mode is impregnation, and the impregnation time is 1-3 minutes.
8. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 7, wherein: the pressure during the infiltration of tobacco leaves is 80 KPa.
9. The method for synthesizing cucurbitadienol by using cucurbitadienol synthase according to claim 4, wherein the method comprises the following steps: the method for treating tobacco leaves comprises the following steps: refrigerating fresh tobacco leaves in liquid nitrogen, adding quartz sand into a grinding vessel, grinding into powder, extracting by re-steaming n-hexane, then performing ultrasonic extraction, extracting by using mixed liquid of re-steaming n-hexane and ethyl acetate, and centrifuging the extract; taking supernatant into a liquid phase small bottle, drying by a nitrogen blower, carrying out derivative precipitation by trimethylsilyl cyanide, re-suspending the dried sample after the derivative in normal hexane for re-dissolution, and detecting the cucurbituril content in the transgenic tobacco by using HPLC and GC-MS.
10. An application of cucurbitadienol synthase gene HcOSC6 and tHMGR gene of Avena sativa in synthesizing cucurbitadienol by simultaneous transfer to tobacco.
CN202211627504.7A 2023-09-08 2023-09-08 Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof Pending CN116891871A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211627504.7A CN116891871A (en) 2023-09-08 2023-09-08 Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211627504.7A CN116891871A (en) 2023-09-08 2023-09-08 Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof

Publications (1)

Publication Number Publication Date
CN116891871A true CN116891871A (en) 2023-10-17

Family

ID=88309497

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211627504.7A Pending CN116891871A (en) 2023-09-08 2023-09-08 Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof

Country Status (1)

Country Link
CN (1) CN116891871A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116410989A (en) * 2023-05-12 2023-07-11 云南农业大学 Virus-induced pseudo-ginseng PDS gene silencing system and application

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116410989A (en) * 2023-05-12 2023-07-11 云南农业大学 Virus-induced pseudo-ginseng PDS gene silencing system and application

Similar Documents

Publication Publication Date Title
Park et al. Agrobacterium rhizogenes‐mediated transformation of opium poppy, Papaver somniferum L., and California poppy, Eschscholzia californica Cham., root cultures
CN104152463B (en) Coding sequence of AaMYBL1 protein of artemisia apiacea and application thereof
Tiwari et al. Agrobacterium rhizogenes mediated transformation of Scutellaria baicalensis and production of flavonoids in hairy roots
CN116891871A (en) Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof
CN106497939A (en) A kind of Radix Notoginseng transcription factor gene PnMYB1 and its application
CN113549649B (en) Preparation method of ginsenoside F1
Yukimune et al. Tropane alkaloid production in root cultures of Duboisia myoporoides obtained by repeated selection
Kim et al. Genetic Transformation of Buckwheat ('Fagopyrum esculentum'M.) with'Agrobacterium rhizogenes' and Production of Rutin in Transformed Root Cultures
Park et al. Agrobacterium-mediated genetic transformation of California poppy, Eschscholzia californica Cham., via somatic embryogenesis
Kim et al. Production of triterpenoid sapogenins in hairy root cultures of Silene vulgaris
CN117535316B (en) Ginseng PgJOX4 gene and application thereof in regulating ginsenoside biosynthesis
CN108517323B (en) Salvia miltiorrhiza AP2 transcription factor SmERF128 coding sequence, cloning method and application
CN108070603B (en) Transgenic method for improving oil content of oil peony seeds
CN105907733B (en) A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application
CN112522220B (en) Gene cloning primer, function and application of salvia miltiorrhiza CYP71BE37 participating in tanshinone biosynthesis
CN115927218B (en) CYP450 enzyme protein for catalyzing beta-amyrin 21-position hydroxylation, coding gene and application thereof
CN110819643A (en) Ginseng PgCYP309 gene and application thereof
Bae et al. Agrobacterium rhizogenes-mediated genetic transformation of radish (Raphanus sativus L. cv. Valentine) for accumulation of anthocyanin
CN113956990B (en) Recombinant saccharomyces cerevisiae for producing dihydronilotinib as well as preparation method and application thereof
Kovalenko et al. An effect of transformation by Ri-plasmids and elicitors on licorice cells and secondary metabolites production
CN115927280B (en) Horse chestnut 2, 3-oxidation squalene cyclase and encoding gene and application thereof
CN114774503B (en) Squalene epoxidase and coding gene and application thereof
CN116515872B (en) Cyclocarya paliurus Liu San terpene synthase CpalOSC gene and application thereof in preparation of beta-amyrin
CN112646836B (en) Genetic transformation method of glycyrrhiza uralensis
Nhut et al. AGROBACTERIUM-MEDIATED TRANSFORMATION OF PANAX VIETNAMENSIS HA ET GRUSHV.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination