CN116875696A - Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof - Google Patents

Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof Download PDF

Info

Publication number
CN116875696A
CN116875696A CN202310885549.2A CN202310885549A CN116875696A CN 116875696 A CN116875696 A CN 116875696A CN 202310885549 A CN202310885549 A CN 202310885549A CN 116875696 A CN116875696 A CN 116875696A
Authority
CN
China
Prior art keywords
setd7
ovarian cancer
expression
protein
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310885549.2A
Other languages
Chinese (zh)
Inventor
邵根宝
张紫薇
侯雅楠
张博文
黄婷
李明阳
金洁
黄攀
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu University
Original Assignee
Jiangsu University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu University filed Critical Jiangsu University
Priority to CN202310885549.2A priority Critical patent/CN116875696A/en
Publication of CN116875696A publication Critical patent/CN116875696A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57449—Specifically defined cancers of ovaries
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57496—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91005—Transferases (2.) transferring one-carbon groups (2.1)
    • G01N2333/91011—Methyltransferases (general) (2.1.1.)
    • G01N2333/91017—Methyltransferases (general) (2.1.1.) with definite EC number (2.1.1.-)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an ovarian cancer diagnosis prognosis marker SETD7, an inhibitor and application thereof, and belongs to the field of molecular biology. The invention discovers that SETD7 is highly expressed in tissues and cell lines of human ovarian cancer and is positioned in cell nuclei and cytoplasm; SETD7 expression is related to tumor metastasis and clinical stage of ovarian cancer patients, and in prognosis indexes such as progression-free survival time, total survival time and the like when SETD7 is highly expressed, the ovarian cancer patients show poor prognosis; knocking down the expression of SETD7 obviously inhibits migration of ovarian cancer cells, and predicts that the SETD7 can be used as a marker or target for ovarian cancer treatment and prognosis. The invention provides prognosis for clinical treatment of ovarian cancer, and is hopeful to guide development of novel targeted drugs and diagnosis and treatment schemes.

Description

Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof
Technical Field
The invention relates to an ovarian cancer diagnosis prognosis marker SETD7, an inhibitor and application thereof, and belongs to the technical field of molecular biology.
Background
Ovarian cancer is one of the three major malignant tumors of the female reproductive system, and the death rate is high and the first of the gynecological malignant tumors. Because ovarian cancer is insidious, early symptoms are not obvious, and there is a lack of effective screening methods, about 60% to 70% of patients have progressed to stage III-IV or have developed abdominal metastasis. Because early symptoms of patients are not obvious, symptoms and signs such as abdominal pain, abdominal distension, abdominal mass, tumor compression and the like are usually displayed at late stages, most patients can be diagnosed at middle and late stages of the disease, and prognosis is poor. Therefore, finding molecular markers for the prognosis of ovarian cancer is an extremely important and urgent task.
Since this century, with the development of molecular biology, various diagnostic markers for ovarian cancer have been developed, such as CA125 has been approved by the us Food and Drug Administration (FDA) for detection of ovarian cancer, however, CA125 detection performs poorly in diagnosis of early stage ovarian cancer patients and is greatly affected by factors such as menstruation and pregnancy; in addition, simon et al (Simon I, et al, B7-H4 is over-expressed in early-stage ovarian cancer and is independent of CA expression. Gynecol Oncol.2007Aug;106 (2): 334-41.Doi:10.1016/j. Ygyno.2007.03.035.Epub 2007May 11.PMID:17498784) designed a two-antibody sandwich ELISA method for detecting the level of B7 homologue 4 (B7-H4) in blood, found that B7-H4 levels in blood of ovarian cancer patients were significantly increased, and that B7-H4 combined with CA125 could diagnose ovarian cancer sensitivity and specificity to 65% and 97%, respectively, higher than CA125 alone. In addition, the research reports that the human chitin enzyme protein 40 (YKL-40) is highly expressed in ovarian cancer, prostate cancer and lung cancer and plays an important role in the occurrence and development of tumors; research also shows that miR-21, miR-92 and miR-93 in serum of an ovarian cancer patient are significantly up-regulated before CA125 is increased, which indicates that the 3 microRNAs can be used for early diagnosis of ovarian cancer; in addition, long non-coding RNAs (lncRNA) have been shown to play an important role in ovarian cancer diagnosis, treatment and prognostic marker identification. However, the above-mentioned technology still has technical drawbacks in practical application: in the aspect of diagnosis, the marker has low positive rate in early ovarian cancer, and has the defects of poor tissue specificity, large influence by menopausal state and the like; for therapeutic applications, inhibitors of protein activity and lncRNA may affect the modulation of certain signaling pathways, leading to clinical risks such as inhibiting apoptosis or up-regulating the proliferative capacity of ovarian cancer cells.
Lysine methyltransferase SETD7, also known as SET7/9, KIAA1717 or KMT7, belongs to a family of proteins comprising SET domains capable of methylating H3K4. Studies show that SETD7 can regulate the dimethyl of H3K4, change the binding capacity of cofactor and histone, regulate the state of chromatin and promote the expression of gene. SETD7 also modulates the activity of transcription factors, alters the stability of proteins, activates the promoter region of genes by methylating non-histone proteins. In recent years, SETD7 has been found to play an important role in intestinal regeneration and the occurrence and development of intestinal tumors, and its high expression is significantly associated with poor prognosis of colon cancer and lung cancer. However, no study has been reported to date on SETD7 in relation to gynecological tumor prognosis.
Disclosure of Invention
The invention aims to provide an ovarian cancer diagnosis prognosis marker SETD7 and an inhibitor and application thereof, mainly provides application of SETD7 in diagnosis, auxiliary diagnosis, treatment and prognosis markers of ovarian cancer, and provides the SETD7 inhibitor and application thereof.
In order to achieve the technical purpose, the invention adopts the following technical scheme:
the present invention first provides a prognostic marker for ovarian cancer, the marker comprising: SETD7 gene or SETD7 protein.
The invention also provides application of the SETD7 gene or the SETD7 protein as a marker for diagnosing or treating ovarian cancer.
The invention also provides application of the reagent for detecting the expression level of the SETD7 gene or the SETD7 protein in preparing a product for diagnosing and prognosing ovarian cancer; the product comprises a product for detecting the expression level of SETD7 genes or SETD7 proteins; further, the product comprises a detection reagent or kit.
Further, the product comprises a primer capable of amplifying the SETD7 gene or a substance capable of binding to the SETD7 protein; the primer can detect the expression level of the SETD7 gene, and the substance can detect the expression level of SETD7 protein;
preferably, the primer is shown as SEQ ID No. 1 and SEQ ID No. 2; the substance capable of binding to the SETD7 protein comprises an antibody.
Upstream primer F (SEQ ID No: 1): 5'-TCACCTACTCCTCCACAGAC-3';
downstream primer R (SEQ ID No: 2): 5'-TCATCCACATAATACCCCTCCAG-3'.
Further, the antibody is a polyclonal antibody.
Further, the prognosis includes Progression Free Survival (PFS), total survival (OS), and tumor metastasis, among others.
Further, the use includes detecting the level of expression of the SETD7 gene or the SETD7 protein in a sample of the subject using the product, and diagnosing the subject as an ovarian cancer patient or diagnosing the subject as having a high risk of developing ovarian cancer if the level of expression of the SETD7 gene or the SETD7 protein in the sample of the subject is high as compared to a normal sample.
Furthermore, the high expression refers to that in the read-out sheet after the immunohistochemical detection, the slice is free from impurity contamination, the brown yellow or brown particles appear at the normal coloring part of the antibody as positive cells, and the SETD7 is colored at the cell nucleus and the cytoplasm. Determining immunostaining scores according to the positive rate and staining intensity, counting the percentage of positive cells by referring to IRS (immune-reactive score) scores: 0 point (less than or equal to 5%), 1 point (less than 10%), 2 point (11-50%), 3 point (51-75%), 4 point (more than 75%) 5 grades. The dyeing intensity is divided into: 0 point (no staining), 1 point (pale yellow), 2 points (tan), 3 points (tan). SETD7 immunostaining score = percent positive score x staining intensity score. Score no less than 4 is expressed positive by SETD 7.
The invention also provides an agent for inhibiting or silencing the expression level of SETD7 gene or SETD7 protein, which is characterized in that the agent comprises at least one of shRNA interfering with SETD7 expression, siRNA interfering with SETD7 expression and antisense oligonucleotide chain interfering with SETD7 expression.
Further, the shRNA comprises shSETD7-1, shSETD7-2 or shSETD7-3, and the nucleotide sequence of the shRNA is shown as SEQ ID No. 5-7:
shSETD7-1(SEQ ID No:5)：GGGAGTTTACACTTACGAAGA
shSETD7-2(SEQ ID No:6)：GGACCGCACTTTATGGGAAAT
shSETD7-3(SEQ ID No:7)：GCAAACTGGCTACCCTTATGT。
the invention also provides application of the reagent in preparing medicines for inhibiting or treating ovarian cancer.
Further, the use includes inhibiting proliferation or migration capacity of ovarian cancer cells.
The invention also provides a kit for inhibiting the expression of the SETD7 gene, which comprises the reagent for inhibiting or silencing the expression level of the SETD7 gene or the SETD7 protein.
The invention also provides a medicament for inhibiting or treating ovarian cancer, which comprises the agent for inhibiting or silencing the expression level of the SETD7 gene or the SETD7 protein.
The beneficial effects of the invention are as follows:
the invention discovers that SETD7 is highly expressed in ovarian cancer tissues and is positioned in cell nuclei and cytoplasm; SETD7 expression is inversely related to prognosis in ovarian cancer patients; knocking down the expression of SETD7 significantly inhibited migration of ovarian cancer cells, suggesting that SETD7 is a molecular marker for predicting prognosis of ovarian cancer patients. The discovery of the invention provides prognosis reference for clinical treatment of ovarian cancer, and is hopeful to guide development of novel targeted drugs and diagnosis and treatment schemes. The inhibitor of the invention can target and inhibit the protein level of SETD7, and is far superior to a protein activity inhibition drug of SETD7, and the protein activity inhibition drug can influence the regulation of certain signal paths, thereby interfering with the clinical treatment effect.
Drawings
FIG. 1 shows the expression levels of SETD7 in various human ovarian carcinoma cell lines, wherein, in the graph, FIG. A shows the detection of the expression levels of mRNA of SETD7 in human ovarian granulosa cell lines KGN and ovarian carcinoma cell lines A2780, hey A8, SKOV3 and ES-2 by the Q-PCR method, p <0.05, p <0.01, p <0.001; panel B shows the detection of protein expression levels of SETD7 in human ovarian granulosa cell lines KGN, ovarian cancer cell lines A2780, hey A8, SKOV3, ES-2 by Western blot.
FIG. 2 shows the expression of SETD7 in different clinical stage human ovarian cancer tissues.
FIG. 3 is subcellular localization of SETD7 in human ovarian cancer; in the figure, N is nucleic and C is cytoplasms.
FIG. 4 is a quantitative analysis of FIG. 2.
FIG. 5 shows the expression level of SETD7 in human ovarian cancer tissue and normal human ovarian tissue.
FIG. 6 is a graph of SETD7 expression versus survival of ovarian cancer patients, wherein, panel A is Progression Free Survival (PFS); panel B is the total lifetime (OS).
FIG. 7 shows the effect of Western blot on detecting knockdown of SETD7 in human ovarian carcinoma A2780 cells (SETD 7-KD-A2780).
FIG. 8 shows the migration ability of SETD7-KD-A2780 cells detected by a Transwell method.
FIG. 9 is a graph showing the quantitative analysis results of FIG. 8.
FIG. 10 shows the detection of the migration ability of SETD7-KD-A2780 cells by the scoring method.
FIG. 11 is a graph showing the quantitative analysis results of FIG. 10.
Detailed Description
In order to enable those skilled in the art to better understand the technical scheme of the present invention, preferred embodiments of the present invention are described in detail below, but the following embodiments do not limit the scope of protection of the present invention.
In the examples of the present invention, processes are not described in any more detail by conventional experimental methods, and those skilled in the art can understand and easily implement the processes according to the product specification or the basic knowledge of the art, so that the detailed description will not be given.
The DMEM broth (containing 10% Fetal Bovine Serum (FBS)) formulations referred to in the examples were as follows:
each 500mL DMEM medium (containing 10% Fetal Bovine Serum (FBS)) included:
DMEM high sugar complete medium: 445mL, vison company 319-005-CL;
fetal Bovine Serum (FBS) 50mL, vison company 086-005;
100 x penicillin-streptomycin solution: 5mL, biyundian, C0222.
The DMEM culture solutions with different amounts of the fetal calf serum are prepared by adjusting the dosage of the fetal calf serum.
Example 1: SETD7 is highly expressed in human ovarian cancer cell lines
The cell lines involved in this example:
human ovarian granulosa cell lines KGN and ovarian cancer cell lines A2780, SKOV3, hey A8, ES-2 were purchased from ScienCellResearch Laboratories (Carlsbad, calif., USA).
(1) Real-time fluorescent quantitative polymerase chain reaction (Q-PCR) detection of SETD7 mRNA expression level
Total cell RNA extraction:
pancreatin was digested to prepare suspended cells, which were lysed by adding TRIzol at room temperature for 10min, 0.2mL chloroform was added per 1mL TRIzol lysate, vigorously shaken for 30s, and allowed to stand for 5min. Centrifuging at 4deg.C for 15min at 12,000Xg, sucking supernatant into a new centrifuge tube, adding equal volume of isopropanol, blowing uniformly, standing for 10min, centrifuging at 4deg.C for 5min at 12,000Xg, washing RNA precipitate with DEPC aqueous solution containing 75% ethanol for 3 times, slightly drying, dissolving RNA with DEPC water, and detecting concentration and purity of RNA.
Reverse transcription of total RNA:
mu.g of RNA was taken and reverse transcribed according to the instructions of kit PrimeScript RT Reagent Kit (Takara).
Real-time quantitative PCR:
according to SsoFast EvaGreen Supermix (Bio-Rad, hercules, calif., USA) protocol (primer sequences see Table 1), on the Bio-Rad CFX96 system, 2 was used -ΔΔCt (Ct represents the circulation threshold) and the relative quantitative method was used to calculate the relative mRNA expression level of each target gene, with the reference gene being GAPDH.
TABLE 1 fluorescent quantitative PCR detection of the sequence of Gene primers
(2) Immunoblotting (Western blot) experiment for detecting SETD7 protein expression level
Cell total protein extraction:
lysing the cells with a protease inhibitor-containing protein lysate for 30min; centrifugation was performed at 12,000Xg for 15min at 4℃and the supernatant was a protein sample, followed by determination of protein concentration.
Protein electrophoresis:
protein samples were subjected to 10% SDS PAGE gel separation, first at 80V for 30min, followed by 110V for 100 min.
Transferring:
proteins were transferred to PVDF membrane with a constant current of 300mA for 130 min.
Blocking and antibody incubation:
after the membrane transfer is completed, placing the PVDF membrane into 2% BSA blocking solution, and blocking for 0.5-1h on a shaking table at room temperature; preparing different primary antibody dilutions according to SETD7 antibody (polyclonal antibody, no.24840-1-AP, proteinech company) specifications, completely soaking PVDF membrane in the corresponding antibody dilutions, and placing on a shaking table of a refrigerator at 4 ℃ for overnight incubation; after the primary antibody is recovered the next day, adding 1 XTBE buffer solution, and washing while shaking on a shaking table at room temperature for 7min each time, and repeating for 4 times; preparing goat anti-mouse or goat anti-rabbit secondary antibody according to the dilution ratio in the specification, adding the prepared secondary antibody solution into PVDF after 1 XTBST buffer solution is washed, and incubating for 1-2h on a shaking table at room temperature.
Film exposure:
the PVDF film is placed on a developing table of an exposure machine, the exposure liquid is evenly dripped on the film, and proper exposure time is set to obtain the optimal exposure result.
(3) Statistical analysis: statistical differences between experimental data were analyzed using SPSS 22.0 statistical software, mean±sem was used to represent experimental data, t-test analysis of differences between two samples, and P <0.05 represents differences that are statistically significant.
(4) Results and analysis: as shown in fig. 1, the mRNA and protein expression levels of SETD7 were significantly increased in four ovarian cancer cells relative to human ovarian granulosa cell KGN, with SETD7 expressed in the highest amount in the a2780 cell line.
Example 2: expression of SETD7 in human ovarian cancer tissue
(1) Human ovarian cancer tissue chip
Ovarian cancer tissue chips were purchased from shanghai wei-zhuo biotechnology limited, array number (Cat No.): ZL-OVA961. A total of 96 cases of ovarian cancer and normal ovarian tissue were purchased, each taking 1 core, wherein the ovarian cancer tissue included: serous adenocarcinomas 49, borderline myxomatous tumors with mucosal internal cancer 5, squamous cell carcinoma 1, intimal carcinoma 14, clear cell carcinoma 9, myxoadenocarcinomas 4, gastric cancer ovarian metastasis 3, intestinal cancer ovarian metastasis 3; normal human ovarian tissue 8 cases. The purchased chip comprises pathological data of the ovarian cancer patients and different clinical stage information of the ovarian cancer patients.
(2) Ovarian cancer patient pathology data of purchased tissue chip
TABLE 2 pathological data of ovarian cancer patients
Note: * ,42patients with lymph node involvement cannot be evaluated； # ,17patients with FIGO stagingcannot be evaluated.
(3) Immunohistochemical experiments:
dewaxing and hydration: (1) placing the tissue chip in a constant temperature box at 59 ℃ for baking for 60min before dewaxing; (2) soaking in xylene I for 10min, in xylene II for 10min, and in xylene III for 10min; (3) soaking in absolute ethanol I for 10min, soaking in absolute ethanol II for 10min, and soaking in absolute ethanol III for 10min; (4) soaking in distilled water, and washing with running water for 10-15min.
And (3) inactivation: with 200mL of 3% H 2 O 2 And 1mL NaN 3 Soaking for 10min, and washing with running water for about 10min.
Antigen retrieval: diluting the repairing liquid to 1 time, and preheating with a microwave oven (or autoclave) for 1-2min. Putting the tissue slices, filling the tissue slices with the repairing liquid, putting the tissue slices into a microwave oven, and repairing the tissue slices with medium and high fire for 10min for the first time. And then taking out and cooling to room temperature, repeating the repair for the second time, repairing for 12min with medium and high fire, pouring out repair liquid after cooling to room temperature, and washing with 1 XPBS for 2 times for 15min each time.
Dropwise adding 5% BSA blocking solution, and standing at room temperature for 35min; preparing a primary antibody.
Incubation resistance: a1:100 (SETD 7) diluted primary antibody working solution (diluted with an antibody diluent, i.e., polyclonal antibody, no.24840-1-AP, proteintech) was added dropwise to the sections overnight at 4 ℃.
Washing: tissue pieces were removed and washed with PBS 4 times for 15min each.
Secondary antibody incubation: and (3) dripping a proper amount of goat anti-rabbit secondary antibody on the slice, and incubating for 35min at 37 ℃.
Washing: tissue pieces were removed and washed with PBS 4 times for 15min each.
And developing and observing. The color development liquid was prepared according to the kit instructions. After the color development, washing for 10min with running water, and then counterstaining. Dropping hematoxylin dye solution, dip-dyeing for 2min, washing for 10min, and observing the color.
Dehydrating: rinsing in 1 jar of absolute ethanol, 2 jars of absolute ethanol and 3 jars of xylene for 3min.
Sealing, adding 1 piece of sealing plastic, covering, and taking photos by an imaging system.
Scoring criteria: no contamination was observed in the sections, brown yellow or tan particles were observed at the normal staining sites, and the fields of 5 tumor cells were randomly selected and observed under a 40×10 magnification lens. Determining immunostaining scores according to the positive rate and staining intensity, counting the percentage of positive cells by referring to IRS (immune-reactive score) scores: 0 point (less than or equal to 5%), 1 point (less than 10%), 2 point (11-50%), 3 point (51-75%), 4 point (more than 75%) 5 grades. The dyeing intensity is divided into: 0 point (no staining), 1 point (pale yellow), 2 points (tan), 3 points (tan). SETD7 immunostaining score = percent positive score x staining intensity score. Score no less than 4 is expressed positive by SETD 7.
Experimental reagents used in this example:
(4) Statistical analysis: data analysis was performed using SPSS 22.0 statistical software. By means of average+Standard deviation represents measurement data, and relationship between SETD7 expression level and clinical pathological characteristics is analyzed by using chi-square test and Fisher's exact test; analyzing the inter-group survival data difference by using a Kaplan-Meier method and a Log-rank test; performing prognosis analysis by using a COX proportional risk model; p (P)<0.05 was considered a statistically significant difference.
(5) Detection results and analysis: in the embodiment, the expression level of SETD7 in human ovarian cancer tissues is detected by an immunohistochemical method, and the SETD7 is mainly expressed in cytoplasm and nucleus and is colored brown yellow by combining with clinical collected prognosis information of ovarian cancer patients (figure 2 and figure 3); SETD7 was significantly highly expressed in cancer tissues (P < 0.001), with an expression rate of 83%, (fig. 4, fig. 5, table 4), and associated with tumor metastasis (M category), clinical stage (FIGO stage) (P < 0.05) (table 3). In addition, the Progression Free Survival (PFS) and total survival (OS) of ovarian cancer patients with high SETD7 expression were both lower than those with low SETD7 expression, and the differences were statistically significant (P < 0.05) (fig. 6), suggesting that SETD7 is a molecular marker for predicting ovarian cancer prognosis. The invention provides powerful technical support and molecular biology foundation for prognosis prediction of ovarian cancer, and has important clinical significance and popularization.
TABLE 3 correlation of SETD7 expression levels with clinical pathological parameters
Note: * ,42patients with lymph node involvement cannot be evaluated； # ,17patients with FIGO stagingcannot be evaluated.
TABLE 4 statistics of SETD7 expression in 88 ovarian cancer tissue samples and 8 normal human ovarian tissue samples
Example 3: silencing SETD7 expression inhibits ovarian cancer cell migration
Cell lines involved in this example:
HEK293T cell line and human ovarian carcinoma cell line A2780, purchased from ScienCell Research Laboratories (Carlsbad, calif., USA)
(1) Cell model construction of stable knockdown SETD 7:
SETD 7-targeted short hairpin RNA design:
3 shRNA sequences are designed aiming at the SETD7 gene sequence, at least one most effective shRNA sequence is selected, and the shRNA sequences are named shSETD7-1, shSETD7-2 and shSETD7-3 respectively, and the sequences are as follows:
shSETD7-1(SEQ ID No:5)：GGGAGTTTACACTTACGAAGA
shSETD7-2(SEQ ID No:6)：GGACCGCACTTTATGGGAAAT
shSETD7-3(SEQ ID No:7)：GCAAACTGGCTACCCTTATGT
construction of SETD7 knock-down vector:
the SETD7 shRNA sequence designed above is synthesized into palindromic DNA sequence by Shanghai engineering biotechnology Co., ltd, annealed and cloned to linearized pLKO.1 plasmid vector (AgeI and EcoRI double enzyme digestion), recombinant plasmid vector amplified, extracted and subjected to double enzyme digestion electrophoresis identification and sequencing analysis. 3 vector plasmids pLKO.1-shSETD7-1, pLKO.1-shSETD7-2 and pLKO.1-shSETD7-3 are obtained.
Virus production:
on the first day, HEK293T cells grown to 3-5 passages (80% -90%) were resuspended and plated in 4mL of DMEM medium (10% FBS in 6cm dishes at 37℃in 5% CO 2 Culturing in an incubator.
The next day, transfection was performed when the cell density was as high as about 60% -70%. The transfection mixture was prepared as follows:
on the third day, the original culture solution is discarded, 4mL of DMEM culture solution containing 10% FBS is added, and the culture is continued in an incubator.
On the fourth day, the virus solution was collected into a 15mL centrifuge tube, marked, and stored in a refrigerator at 4 ℃. The virus solution (about 12 mL) collected over the first three days was centrifuged, filtered through a 0.45. Mu.M filter, and the supernatant was dispensed into 1mL EP tubes and frozen at-80 ℃.
Virus infection of cells of interest:
on the first day, the target cells (selected from the SETD 7-highly expressed A2780 cell line) were plated in 4mL of DMEM medium containing 10% FBS to a density of about 30%, 37℃and 5% CO 2 The incubator was left overnight.
The next day, old culture broth was discarded, 2mL of DMEM medium containing 10% FBS and 2mL of the split virus supernatant were added to each well, and 4. Mu.L of polybrene was added. 37 ℃,5% CO 2 The incubator was left overnight.
The procedure above for the second day was repeated on the third day.
On the fourth day, the old broth was discarded and 4mL of DMEM broth containing 10% FBS containing 1. Mu.g/mL puromycin was added to each well. 37 ℃,5% CO 2 The incubator was left overnight.
On the fifth day, the old culture broth was discarded, and 4mL of DMEM medium containing 10% FBS and containing 1. Mu.g/mL puromycin was added to each well for 1 week.
After the medicine sieve is finished, the knocking-down effect is verified by utilizing Q-PCR and Western blot experiments, and an A2780 cell strain (SETD 7-KD-A2780) for stably knocking-down SETD7 is established.
(2) Cell migration ability assay
The migration ability of cells was tested using a Transwell cell model: 200. Mu.L of DMEM medium containing 1% FBS was inoculated into the upper chamber of the Transwell chamber to 1.5X10-th 5 Individual cell suspensions (A2780 and SETD7-KD-A2780 cells were tested separately), 500. Mu.L of DMEM medium containing 20% FBS was added to the lower chamber, and the mixture was incubated at 37℃with 5% CO 2 Incubate in incubator for 24h. The non-migrated cells on the upper surface of the membrane were wiped off with a cotton swab, the cells migrated to the lower surface were fixed with 4% paraformaldehyde for 30min, stained with crystal violet staining solution at room temperature for 15min, and the stained cells were observed with a microscope. Each Transwell chamber was randomized to take 5 views and stained cells were counted for relative mobility = number of transferred cells/total number of cells of the Transwell chamber.
The migration ability of the cells was measured by the scratch method: a2780 and SETD7-KD-A2780 cells were seeded in 6-well plates (each cell differed, ensuring that overnight growth was 100%); the following day, after cells were grown, the wells were scored with a 100 μl gun head, and the cells were washed 3 times with PBS to wash off the scored cells, then DMEM medium containing 10% fbs was added, incubated in a cell incubator for 24h, 48h or 96h, and photographed at various time points as required for the experiment, and finally analyzed for wound closure using Image J software.
(3) Statistical analysis: statistical differences between experimental data were analyzed using SPSS 22.0 statistical software, mean±sem was used to represent experimental data, t-test analysis of differences between two samples, and P <0.05 represents differences that are statistically significant.
(4) Detection results and analysis: as shown in fig. 7-11, shSETD7-1 and shSETD7-2 were able to significantly reduce the level of expression of SETD7 in a2780 ovarian cancer cells (fig. 7); shSETD7-1 and shSETD7-2 were able to significantly inhibit migration of A2780 cells compared to the control group (shNC group in the figure, negative control group: pLKO.1 empty plasmid vector lentivirus-infected A2780 cells) (FIGS. 8-11). The result shows that the SETD7 has a promoting effect on ovarian cancer metastasis, and opens a new direction for research of the SETD7 in tumor metastasis or becomes a new target point.
The foregoing examples are illustrative of the present invention and are not intended to be limiting, and other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principles of the invention are intended to be equivalent arrangements for use within the scope of the present invention.

Claims (10)

  1. Use of setd7 gene or SETD7 protein as diagnostic or prognostic marker for ovarian cancer.
  2. 2. Application of a reagent for detecting SETD7 genes or SETD7 protein expression levels in preparation of products for diagnosis or prognosis of ovarian cancer.
  3. 3. The use according to claim 2, wherein the product comprises a product for detecting the expression level of the SETD7 gene or SETD7 protein; preferably, the product comprises a detection reagent or kit.
  4. 4. The use according to claim 3, wherein the product comprises a primer capable of amplifying the SETD7 gene or a substance capable of binding to the SETD7 protein; the primer can detect the expression level of the SETD7 gene, and the substance can detect the expression level of SETD7 protein;
    preferably, the primer is shown as SEQ ID No. 1 and SEQ ID No. 2; the substance capable of binding to the SETD7 protein comprises an antibody.
  5. 5. An agent that inhibits or silences the expression level of a SETD7 gene or SETD7 protein, comprising at least one of shRNA that interferes with the expression of SETD7, siRNA that interferes with the expression of SETD7, and an antisense oligonucleotide strand that interferes with the expression of SETD 7.
  6. 6. The reagent according to claim 5, wherein the shRNA comprises shSETD7-1, shSETD7-2 or shSETD7-3, and the nucleotide sequence is shown as SEQ ID No. 5-7:
    shSETD7-1(SEQ ID No:5)：GGGAGTTTACACTTACGAAGA
    shSETD7-2(SEQ ID No:6)：GGACCGCACTTTATGGGAAAT
    shSETD7-3(SEQ ID No:7)：GCAAACTGGCTACCCTTATGT。
  7. 7. use of the agent of claim 5 or 6 for the preparation of a medicament for inhibiting or treating ovarian cancer.
  8. 8. The use of claim 7, wherein the use comprises inhibiting proliferation or migration capacity of ovarian cancer cells.
  9. 9. A kit for inhibiting the expression of a SETD7 gene, comprising the agent for inhibiting or silencing the expression level of a SETD7 gene or a SETD7 protein according to claim 5 or 6.
  10. 10. A medicament for inhibiting or treating ovarian cancer comprising an agent that inhibits or silences the level of an SETD7 gene or SETD7 protein expression of claim 5 or 6.
CN202310885549.2A 2023-07-19 2023-07-19 Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof Pending CN116875696A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310885549.2A CN116875696A (en) 2023-07-19 2023-07-19 Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310885549.2A CN116875696A (en) 2023-07-19 2023-07-19 Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof

Publications (1)

Publication Number Publication Date
CN116875696A true CN116875696A (en) 2023-10-13

Family

ID=88256491

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310885549.2A Pending CN116875696A (en) 2023-07-19 2023-07-19 Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof

Country Status (1)

Country Link
CN (1) CN116875696A (en)

Similar Documents

Publication Publication Date Title
WO2019165695A1 (en) Crispr-cas9 system for knocking out grin2d gene and application thereof
CN109423517B (en) Use of exosomes in tumor diagnosis, treatment and prognosis evaluation
CN111518909B (en) Application of METTL2 gene in preparation of kit for detecting treatment sensitivity of colorectal cancer fluorouracil drugs
CN112501299A (en) Method for predicting recurrence and metastasis of liver cancer and application
Hirao et al. Transcription factor homeobox D9 is involved in the malignant phenotype of cervical cancer through direct binding to the human papillomavirus oncogene promoter
CN112831497B (en) Novel lncRNA and inhibitor, diagnostic reagent, medicament and application thereof
WO2021004372A1 (en) Application of metformin in treatment of kras mutant colorectal cancer
CN112824540A (en) SNX5 as biological marker for liver cancer prognosis and application thereof
CN115851947A (en) Application of DAGLA in diagnosis and treatment of liver cancer
CN116875696A (en) Ovarian cancer diagnosis prognosis marker SETD7, inhibitor and application thereof
CN111172161B (en) Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia
CN113293208B (en) Molecular marker related to lung cancer proliferation and metastasis and application thereof
CN113908283A (en) PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer
CN114002431A (en) Application of TNNT1 in preparation of virus-type hepatocellular carcinoma diagnostic kit and preparation or screening of anti-liver cancer drugs
CN109402253B (en) Use of ALDH18A1 in the treatment and diagnosis of colorectal cancer
CN116814792A (en) Application of SETD5 as ovarian cancer diagnosis and treatment marker
CN114410796B (en) Kit for liver cancer auxiliary diagnosis and prognosis evaluation and application
CN114908172B (en) Application of APOBEC3B in diagnosis, prognosis prediction and treatment of prostate cancer
CN115094134B (en) Application of PCSK9 in macrophage M2 type polarization and related diseases thereof
CN114561466B (en) Application of FTO in diagnosis and treatment of osteosarcoma
CN104388541B (en) The purposes of miR 1914* and miR 1915
CN107881240A (en) The diagnosis and treatment mark of osteosarcoma
CN114231625B (en) Application of QSER1 gene and related medicines thereof
US20240093194A1 (en) Mir-7-5p mimic for inhibiting migration and invasion of breast cancer, screening method and application thereof
CN113604568B (en) Application of HPV16 integration target combined with iron death regulatory gene in preparation of cervical cancer early treatment kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination