CN116875664A - Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method - Google Patents

Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method Download PDF

Info

Publication number
CN116875664A
CN116875664A CN202310740901.3A CN202310740901A CN116875664A CN 116875664 A CN116875664 A CN 116875664A CN 202310740901 A CN202310740901 A CN 202310740901A CN 116875664 A CN116875664 A CN 116875664A
Authority
CN
China
Prior art keywords
nucleic acid
primer
amplification
fluorescent
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310740901.3A
Other languages
Chinese (zh)
Inventor
吴坚
陈艳菊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202310740901.3A priority Critical patent/CN116875664A/en
Publication of CN116875664A publication Critical patent/CN116875664A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/42—Salmonella
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/63—Vibrio

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a real-time fluorescence loop-mediated (LAMP) isothermal nucleic acid amplification detection method. Labeling fluorescent groups and quenching groups on one or more of inner primers (FIP/BIP) and loop primers (LF/LB) on the basis of a universal loop-mediated isothermal amplification system; a fluorescent group and a quenching group are marked at any position except the 3' end of the selected primer; and (3) performing nucleic acid amplification by using the primer, and detecting fluorescence generated by interaction between a fluorescent group and a quenching group in the primer to realize nucleic acid amplification detection. The invention can realize single or multiple real-time amplification detection and has the characteristics of simple design, no need of additional enzyme, rapidness and real-time.

Description

Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method
Technical Field
The invention relates to a real-time nucleic acid amplification method, in particular to a real-time, single or multiple specific loop-mediated isothermal nucleic acid amplification primer and an amplification detection method thereof, which can be applied to the fields of gene detection, medical diagnosis, food safety, analytical chemistry and the like.
Background
The nucleic acid amplification detection method achieves the purpose of detection by amplifying target nucleic acid molecules, has the characteristic of high sensitivity, and is widely applied to the fields of food safety, disease diagnosis, environmental monitoring and the like. Common nucleic acid amplification detection methods are the polymerase chain reaction (polymerase chain reaction, PCR) and isothermal amplification reactions. Loop-mediated isothermal amplification (LAMP) is one of the most commonly used isothermal amplification reactions. The LAMP reaction system comprises an outer primer (F3/B3), an inner primer (FIP/BIP) and a loop primer (LF/LB), and the inner primer forms a self loop structure, so that the LAMP reaction system can realize amplification under the constant temperature condition (65 ℃), and can be used for field detection.
The amplified nucleic acid sample needs to be detected by the amplified product to determine whether the amplified nucleic acid sample is a target product, and common detection methods can be classified into an end-point detection method and a real-time detection method.
The end-point detection method detects the amplified product after the amplification is completed, for example, gel electrophoresis, turbidity, etc., and these detection methods are nonspecific and it is difficult to distinguish false positive detection results. The real-time detection method is to add an embedded dye (such as SYBR Green, SYTO 9 and the like) or a sequence specific probe into an amplification system to monitor the amplification process in real time. The real-time amplification detection method based on the embedded dye has poor specificity, and is difficult to realize multiple detection.
The real-time amplification detection method based on the sequence-specific probes has higher specificity, and can realize real-time multiple detection by adding the sequence-specific probes modified with different fluorophores into different LAMP systems. Taking LAMP amplification as an example, researchers introduce a sequence (c-FIP/c-BIP) complementary to the 5' end of an inner primer (FIP/BIP) into the LAMP amplification system, and modify a fluorescent group and a quenching group at the 5' end of the inner primer and at the 3' end of the inner primer complementary pairing sequence, respectively, which are quenched when forming a double-stranded complex, and during the amplification process, the inner primer complementary pairing sequence is replaced, so that a signal amplified in real time is detected, which is called DARQ (detection of amplification by release of quenching, DARQ). The DARQ method can realize real-time LAMP detection, but the introduction of the complementary pairing sequence of the inner primer obviously reduces the LAMP reaction speed, and the inner primer and the complementary pairing sequence of the inner primer need to form a double-chain complex through a high-temperature denaturation-annealing step before LAMP amplification, which complicates the reaction process. There are also researchers to add a specific internal cleavage sequence at the 5' end of the internal primer (FIP/BIP) or the loop primer (LF/LB), and to modify the fluorescent group and the quenching group at both ends of the internal cleavage sequence, so that the LAMP amplification product can be cleaved by a specific endonuclease to achieve the purpose of real-time detection, but this method requires introducing a new enzyme into the amplification system, which increases the complexity of the reaction system.
There are researchers that add a section of molecular beacon to the amplification system, so that the stem-loop structure is opened to generate a fluorescent signal when the sequences on the molecular beacon and the amplified fragment are specifically recognized, but this method requires proper Tm values (melting temperature, temperature of melting, tm) for the molecular beacon sequence and the target binding sequence region, which has certain limitations.
In view of the above, current methods for detecting real-time loop-mediated nucleic acid amplification based on sequence-specific probes still have certain limitations. Therefore, there is an urgent need to develop a method for detecting multiplex loop-mediated isothermal nucleic acid amplification in real time, which is simple in design, and does not require additional enzymes.
Disclosure of Invention
In order to solve the problems and the defects of the background technology, the invention provides a nucleic acid amplification primer, a sequence and a detection method which are simple and convenient to design, can realize single or multiple real-time LAMP amplification detection, and has the characteristics of simple and convenient design, no need of additional enzyme, rapidness and real-time. Etc.
The method of the present invention requires only Bst amplifying enzyme, which is an advantage of the present invention. Other methods may require additional enzymes in addition to the amplification, and therefore the invention has the advantage of being simple and fast, without additional enzymes.
The technical scheme and the situation of the invention are as follows:
firstly, on the basis of a general loop-mediated isothermal amplification system/method, taking one or more of an inner primer (FIP/BIP) and a loop primer (LF/LB) of the loop-mediated isothermal amplification system as a marking primer, marking/modifying a fluorescent group and a quenching group on the marking primer, and marking/modifying the fluorescent group and the quenching group at any position except the 3' end of the marking primer;
and then carrying out loop-mediated isothermal nucleic acid amplification by using the labeled primer, detecting fluorescence emitted by the fluorescent group in real time in the nucleic acid amplification process, and judging the nucleic acid amplification condition in real time according to the obtained fluorescence condition and curve. Or detecting fluorescence emitted by the fluorescent group after the nucleic acid amplification, and judging the nucleic acid amplification result according to the obtained fluorescence condition and curve.
The loop-mediated isothermal amplification system/method does not contain any functional enzyme capable of cutting and breaking the primer containing fluorescent labels and the double chains generated by the primer.
The labeled primer has a 5 'extension, and the fluorescent group and the quenching group are labeled on the 5' extension, respectively or in total.
The 5 'end extension segment refers to a segment formed by extension design of a 5' end sequence according to conventional design.
The 5' extension is selected from any sequence with proper length and contains thymine (T) base, and the extension itself or the extension and the connected primer are not required to form a secondary structure such as a stem loop.
Specifically, the labeling/modification of the fluorescent and quenching groups may be the following:
the fluorescent group and the quenching group are simultaneously modified in the middle of the labeled primer;
or one of the fluorescent group and the quenching group is modified in the middle of the labeled primer, and the other is modified at the 5' end of the labeled primer;
or one of the fluorescent group and the quenching group is modified at the 5' -end extension of the labeled primer, and the other is modified at the middle, 5' -end or 5' -end extension of the labeled primer.
On the selected labeled primer, the distance between the fluorescent group and the quenching group is between 9 and 35 bases.
In the case of loop-mediated isothermal nucleic acid amplification, when a target nucleic acid fragment is present, the labeled primer and its complementary fragment bind and extend along the target nucleic acid fragment to form a stable double strand under the action of a nucleic acid amplification enzyme having only a strand displacement function.
When the loop-mediated isothermal nucleic acid amplification is carried out, when a plurality of target nucleic acid fragments exist, fluorescent groups with different emission wavelengths are marked/modified on amplification primers of different target nucleic acid fragments, so that real-time multiple nucleic acid detection is realized.
Thus, the present invention provides a detection system that can achieve single or multiplex real-time nucleic acid amplification with fluorescent groups and quenching groups modified on one or more primers of the amplification system.
The fluorescent group and the quenching group are simultaneously modified on the sequence of the primer, and the two groups can be modified in the middle of the primer or one of the two groups can be modified at the 5' end of the primer; the 5 'end of the primer may also be extended and one or two groups may be modified in the sequence of the primer extended at the 5' end.
When a plurality of primers exist during nucleic acid amplification, the same or different fluorescent groups and corresponding quenching groups can be modified on the plurality of primers to enhance signals.
In the absence of amplification, the primer is single-stranded DNA, the "coiled" state of single-stranded DNA allows the fluorescent group and the quenching group to be spatially closer, and the fluorescent signal is quenched; after the amplification reaction, the primer modified with the fluorescent group and the quenching group is combined with the target nucleic acid, and the primer is extended according to the target nucleic acid sequence to form double-stranded DNA, and the fluorescent group and the quenching group in the double-stranded DNA are far away and the fluorescence quenching effect is weakened because the rigidity of the double-stranded DNA is larger than that of a single strand, so that the fluorescence signal generated in the system is enhanced.
When the nucleic acid is amplified, after the sequences of the primer modified with the fluorescent group and the quenching group are combined with the target fragment, the primer is extended from the 3' end, the length of the primer marked with the fluorescent group and the quenching group is increased, and the base of the primer and the sequence of the target fragment are mutually complementary, so that a stable double chain can be naturally formed without other means, the possibility that the primer modified with the fluorescent group and the quenching group is replaced due to the amplification of other primers in a system is greatly reduced, the stable double chain can be formed, and the high-efficiency, simple and convenient nucleic acid amplification detection is realized.
Compared with other means in the prior art such as tetrahydrofuran, endonuclease and the like, the method cuts the sequence with the fluorescent group and the quenching group, so that the two are completely separated, and the method only has the advantage that the fluorescent signal enhancement caused by changing a single chain into a double chain is weaker, but the method adopts the current common fluorescent amplification instrument such as a Simer-fly real-time fluorescent quantitative Quantum 3PCR instrument and the like, and the enhancement of the real-time fluorescent signal caused by forming the double chain in the amplification process is clearly visible, so that the method can bring high-efficiency, simple and convenient nucleic acid amplification detection.
When at least one of the fluorescent group and the quenching group is modified to the 5' -end extension section of the acid amplification primer, after the sequences of the primer and the target fragment are combined, the nucleic acid amplification primer becomes a part of a product, so that the target detection is simpler, the fluorescent detection effect is improved, and the detection result is more accurate.
Compared with the prior art, the invention has the following advantages:
1) The practicability is strong. The invention utilizes a universal LAMP amplification system, and only one primer or a plurality of primers are selected on the basis of the existing primers, and the primers are modified with fluorescent groups and quenching groups. No additional optimization of primers and reaction system for specific fluorescence detection is required, nor is additional enzyme added.
2) The sequence dependence is low. The fluorescent group and the quenching group may be modified at the 5 'end and the intermediate region other than the 3' end of the primer.
If the base sequence on the selected primer has an effect on the signal of the fluorophore, the 5' end of the primer can be extended and one or both of the fluorophore and the quencher can be labeled in the extension, thereby avoiding the effect.
If the middle region of the selected primer does not have thymine T, the 5' end of the primer can be prolonged, and T base can be introduced for marking.
The 5' -end extension of the primer is selected from any sequence with proper length and containing thymine (T) base, and the extension itself or the extension and the connected primer are not required to form a secondary structure such as a stem loop.
The random sequence can be selected to avoid the complementation with the detection target sequence and avoid the influence on the amplification reaction.
The method is therefore theoretically applicable to the detection of any amplification system.
3) The operation is simple and convenient: the detection steps of the amplification detection method provided by the invention are the same as the common amplification reaction steps, and no additional operation steps are needed, so that the time is saved.
4) The cost is saved: the amplification detection method provided by the invention does not need the participation of an additional enzyme preparation.
5) The specificity is high: non-specific amplification due to inner and outer primer dimers, etc. can be avoided.
Drawings
FIG. 1 is a schematic diagram of LAMP isothermal amplification fluorescence detection proposed by the present invention;
FIG. 2 shows a single real-time LAMP amplification assay 400 (a), 40 (b), 4 (c), and 0 copies/. Mu.L (d) of Vibrio parahaemolyticus DNA according to the present invention.
FIG. 3 shows the detection of 400 copies/. Mu.L of Vibrio parahaemolyticus DNA by the real-time LAMP reaction proposed by the present invention;
FIG. 4 shows a single real-time LAMP amplification assay 600 (a), 60 (b), 6 (c), 0 copies/. Mu.L (d) of Salmonella DNA according to the present invention;
FIG. 5 shows the real-time LAMP reaction detection of Vibrio parahaemolyticus DNA of 4 (a), 0 copies/. Mu.L (b) according to the present invention;
FIG. 6 is a dual real-time LAMP amplification simultaneous detection of Vibrio parahaemolyticus and Salmonella DNA proposed by the present invention. a) 40 copies/. Mu.L of Vibrio parahaemolyticus DNA; b) 60 copies/. Mu.L of Salmonella DNA; c) 0 copies/. Mu.L Salmonella DNA; d) 0 copies/. Mu.L of Vibrio parahaemolyticus DNA.
Detailed Description
The invention is further explained below with reference to specific embodiments and the attached drawings. The following examples are only for illustration of the present invention and are not intended to limit the scope of the invention.
Specific implementations take LAMP amplification as an example, the system comprises:
1) In a normal LAMP amplification system, one or more primers requiring modification of a fluorescent group and a quenching group are selected for modification.
Primer for modifying fluorescent group and quenching group: the primer may be an inner primer (FIP/BIP) or a loop primer (LB/LF).
The fluorescent groups and the quenching groups may be modified according to the above requirements on one of the inner primer (FIP/BIP)/loop primer (LB/LF), and the fluorescent groups and the quenching groups may also be modified according to the above requirements on two or more of the inner primer (FIP/BIP)/loop primer (LB/LF).
The fluorescent group and the quenching group may be modified at the 5' end and the middle region of the primer. If the middle region has no base T, the 5' end of the primer can be prolonged and doped with the base T;
if the base sequence on the selected primer has an influence on the signal of the fluorescent group, the 5' -end of the primer may be extended, and one or both of the fluorescent group and the quencher group may be labeled in the extension segment, thereby avoiding the influence.
The 5' -end extension of the primer is selected from any sequence with proper length and containing thymine (T) base, and the extension itself or the extension and the connected primer are not required to form a secondary structure such as a stem loop.
The primer and the extension section thereof are all prepared by adopting common dNTPs, and special groups such as locked nucleic acid and the like are not needed to be modified. Although the melting point of the corresponding double strand can be raised by using a modifying group such as a locked nucleic acid, the design of the primer, the subsequent amplification, and the like have some influence. In the invention, the modification of the fluorescent group and the quenching group is only needed for the LAMP primer which is normally designed.
When the distance between the fluorescent group and the quenching group is too large in the process of labeling the primer, the quenching effect of fluorescence is poor, and a larger background signal exists; when the distance between the fluorescent group and the quenching group is too short, the fluorescence signal cannot be enhanced well even if a double strand is formed. The preferred spacing between the two is between 9 and 35 bases.
2) Other primers:
other primers required for the LAMP amplification system, such as outer primer (F3/B3), inner primer (FIP/BIP), and loop primer (LB/LF), may be used as long as they are identical to those used in ordinary LAMP amplification if fluorescent modification is not selected.
In multiplex amplification, the reaction concentration of each primer concentration may be adjusted according to actual need.
The advantages of the present invention are fully exhibited here, that is, other primers requiring modification are labeled with fluorescent and quenching groups, and the amplification reaction is the same as the common LAMP amplification reaction, that is, no additional enzyme is required, no influence is exerted on the established LAMP reaction system, and the problems of inhibition of amplification speed and the like are avoided.
3) Polymerase: polymerase having strand displacement activity, such as Bst DNA polymerase, bst2.0 DNA polymerase, and the like. In the present invention, no additional tool enzyme is required to cleave the fluorescently labeled primer or the double strand generated therefrom.
4) Buffer solution: the appropriate buffer is selected according to the type of polymerase in the system.
5) Magnesium sulfate: the magnesium sulfate content of the system may be 2mM or greater than 2mM.
6) Deoxynucleotides: dNTPs can be selected, and dNTPs/dUTPs can also be selected.
7) Amplification enhancer: amplification enhancers such as betaine, trehalose, etc. may be added to the amplification system.
8) Target molecule: can be RNA or DNA. If the target molecule is RNA, reverse transcriptase may be added to convert it to DNA.
When the target molecule exists in the nucleic acid amplification system solution, normal LAMP amplification occurs, and the primer modifying the fluorescent group and the quenching group is combined with the target fragment. Since the 3 'end is not modified with any group, the primer and the target sequence can be extended from the 3' end after being combined to form double-stranded DNA. The long double strand thus formed contributes to the binding of the primer with fluorescent label to the target strand and prevents the detachment. The double-stranded DNA sequence is more rigid than single-stranded so that the modified fluorescent and quenching groups are far apart from each other, enhancing the fluorescent signal.
Meanwhile, the labeled primer is normally involved in amplification, so that the Bst amplification enzyme in LAMP has strand displacement activity, but the labeled primer is not singly displaced in the subsequent amplification. The effect of the labeled primer on the amplification efficiency is also small.
If multiple amplification detection is performed, the concentration between the concentrations of different target primer sets in the system can be adjusted normally as required, and different fluorescent groups are modified on different primer sets to realize multiple detection.
Thus, real-time fluorescence detection in the amplification process can be realized without using a common embedded fluorescent dye. Multiple detection in a single tube can be achieved by modifying different fluorophores on primers of different targets.
The LAMP amplification detection process under the scheme of the invention is shown in figure 1, and is specifically as follows:
following normal design of the LAMP amplified primers, the detection method of the invention will be illustrated here by taking fluorescent labeling on FIP as an example. In the figure, F is a fluorescent group, Q is a corresponding quenching group, wherein the fluorescent group is marked at the 5' end of the FIP primer, and the quenching group is marked in the middle of the primer. Here, only the FIP is labeled, and in practice, the BIP primer or the loop primer may be labeled.
After the labeled primer is utilized, the specific amplification process of LAMP is the same as that of common LAMP. First, the F2 fragment in FIP binds to and extends F2c in the target nucleic acid. Then, the outer primer F3 is displaced by the strand displacement activity of Bst enzyme. The displaced single strand is amplified using BIP as a template. Thus, a double strand containing a fluorescent labeling group is formed. Compared to a coiled single strand, the double strand is more rigid, thus increasing the distance between the fluorescent group and the quenching group, and the quenching effect is reduced, thus increasing the fluorescent signal.
In the subsequent normal LAMP amplification process, the double strand containing the fluorescent group is formed continuously, so that the detection of the LAMP amplification process can be realized by detecting the fluorescent signal in real time. The fluorescent signal may be detected after the amplification is completed.
Embodiments of the invention are as follows:
example 1
The embodiment provides a real-time single LAMP amplification detection method, wherein a fluorescent group and a quenching group (FQ-VP-LB) are modified on a loop primer LB, the interval is 12 bases, and specific sequence information is shown in table 1.
The LAMP amplification system takes extracted vibrio parahaemolyticus Vibrio parahaemolyticus O3:K6 DNA as a detection object, and comprises: 1.6. Mu.M FIP, 1.6. Mu.M BIP, 0.4. Mu.M LF, 0.4. Mu.M FQ-LB, 0.2. Mu.M F3, 0.2. Mu. M B3, 1X isothermal amplification buffer,0.8M betaine, 1.4mM dNTPs,8U Bst2.0WarmStart DNA polymerase, 2mM magnesium sulfate, target DNA.
Adding a series of concentration nucleic acid samples into the LAMP amplification system, and collecting fluorescence of a TexasRed channel in real time by using a Simer fly real-time fluorescence quantitative Quantum studio3PCR instrument at 65 ℃. As shown in FIG. 2, the reaction can detect target DNA as low as 4 copies/. Mu.L, and the amplification curve of the DNA sample with the lowest concentration can reach the fluorescence plateau within 40 minutes, which indicates that the reaction speed is higher. A sample of 0 copies/. Mu.L had no amplification curve, indicating that the reaction had no non-specific amplification.
In the reaction system, besides marking the fluorescent signal on LB, the fluorescent signal can be further marked on LF, so that the detection system has stronger real-time fluorescent signal, in FIG. 3, the detection object is still vibrio parahaemolyticus, the target concentration is 400 copies/. Mu.L, and besides the fluorescent and quenching groups are modified on LB, the same fluorescent and quenching groups are also modified on LF. Compared with the fluorescent signal of the fluorescent group modified only on LB in FIG. 2, the fluorescent signal of the modified 2-strand loop primer can be seen to be stronger.
TABLE 1 Vibrio parahaemolyticus LAMP amplification sequence
Example 2
The present example provides a real-time single LAMP amplification detection method, wherein the 5' -end of the loop primer LF is prolonged (thickened base is prolonged sequence), and the prolonged LF is modified with a fluorescent group and a quenching group (FQ-St-LF), the interval is 9 bases, and the specific sequence information is shown in Table 2.
The LAMP amplification system comprises, as a detection target, extracted salmonella Salmonella typhimurium DNA: 1.6. Mu.M FIP, 0.4. Mu.M FQ-LF, 0.4. Mu.M LB, 0.2. Mu. M F3, 0.2. Mu. M B3, 1X isothermal amplification buffer,0.8M betaine, 1.4mM dNTPs,8U Bst2.0WarmStart DNA polymerase, 2mM magnesium sulfate, target DNA. Adding a series of nucleic acid samples with a concentration into the LAMP amplification system, and collecting fluorescence curves at 65 ℃ in real time. As shown in FIG. 4 below, the reaction was able to detect target DNA as low as 6 copies/. Mu.L, and the amplification curve of the lowest concentration sample could reach the fluorescence plateau within 35 minutes, indicating a faster reaction rate. A sample of 0 copies/. Mu.L had no amplification curve, indicating that the reaction had no non-specific amplification.
TABLE 2 Salmonella LAMP amplification sequences
Example 3
The present example provides a real-time single LAMP amplification detection method, wherein the 5' -end of the inner primer BIP is prolonged (thickened base is prolonged sequence), and the prolonged BIP is modified with fluorescent group and quenching group (FQ-VP-BIP), the interval is 35 bases, and the specific sequence information is shown in Table 3.
The LAMP amplification system takes extracted vibrio parahaemolyticus Vibrio parahaemolyticus O3:K6 DNA as a detection object, and comprises: 1.6. Mu.M FIP, 1.6. Mu.M FQ-VP-BIP, 0.4. Mu.M LF, 0.4. Mu.M LB, 0.2. Mu. M F3, 0.2. Mu. M B3, 1X isothermal amplification buffer,0.8M betaine, 1.4mM dNTPs,8U Bst2.0WarmStart DNA polymerase, 2mM magnesium sulfate, target DNA.
Adding nucleic acid samples with different concentrations into an LAMP amplification system, and collecting fluorescence of a TexasRed channel in real time by using a Simer fly real-time fluorescence quantitative Quantum studio3PCR instrument at 65 ℃. As shown in FIG. 5, the reaction was able to detect target DNA as low as 4 copies/. Mu.L, and a fluorescence plateau could be reached within 40 minutes, indicating a faster reaction rate. A sample of 0 copies/. Mu.L had no amplification curve, indicating that the reaction had no non-specific amplification.
TABLE 3 LAMP amplification sequences of Vibrio parahaemolyticus
Example 4
This example provides a real-time double LAMP amplification detection method for simultaneously detecting extracted Vibrio parahaemolyticus Vibrio parahaemolyticus O3:K6 DNA and Salmonella Salmonella typhimurium DNA, and the sequences used for both amplification reactions are shown in tables 1 and 2 in the previous examples. The LAMP amplification system comprises: 1X isothermal amplification buffer,0.8M betaine, 1.4mM dNTPs,8U Bst2.0WarmStart DNA polymerase, 2mM magnesium sulfate, two target DNAs. The total primer concentration of the double LAMP amplification system is as follows: 1.6. Mu.M FIP, 1.6. Mu.M BIP, 0.4. Mu.M LF, 0.4. Mu.M LB, 0.2. Mu.M F3, 0.2. Mu. M B3. Wherein the concentration of the LAMP primer group of the vibrio parahaemolyticus is 30 percent, and the concentration of the LAMP primer group of the salmonella is 70 percent. Fluorescence of the TexasRed channel and HEX channel was collected in real time at 65℃using a Simer-fly real-time fluorescence quantitative Quantum studio3PCR instrument. As shown in FIG. 6, the reaction can detect 40 copies/. Mu.L of Vibrio parahaemolyticus O3:K6DNA and 60 copies/. Mu. LSalmonella typhimurium DNA simultaneously, and the detection signals of the two fluorescent channels are not interfered with each other.
The gene sequence related to the invention is as follows:
SEQ ID No.1；
name: VP-F3 primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
ATCGCACCAGCTACTCGA
SEQ ID No.2；
Name: VP-B3 primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
CGGCGAAGAACGTAATGTCT
SEQ ID No.3；
Name: VP-FIP primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
CCACCAGTAGCCGTCAATGGTGAAGATGATCCAGCGACCGAT
SEQ ID No.4；
Name: VP-BIP primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
ACACCAACACGTCGCAAAACGCGTTCTCGTTCGCCAAAT
SEQ ID No.5；
Name: VP-LB primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
TTATCCGTCAGCGTTGTGAAGCA
SEQ ID No.6；
Name: FQ-VP-LB primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
TTATCCGTCAGCGTTGTGAAGCA (5' -end modified TexasRed; middle thickened T base modified BHQ 2)
SEQ ID No.7；
Name: VP-LF primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
TCGTTTTTTGCCCATTCCCA
SEQ ID No.8；
Name: st-F3 primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
CGGCCCGATTTTCTCTGG
SEQ ID No.9；
Name: st-B3 primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
CGGCAATAGCGTCACCTT
SEQ ID No.10；
Name: st-FIP primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
GCGCGGCATCCGCATCAATATGCCCGGTAAACAGATGAGT
SEQ ID No.11；
Name: st-BIP primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
GCGAACGGCGAAGCGTACTGTCGCACCGTCAAAGGAAC
SEQ ID No.12；
Name: FQ-St-LF primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
TGCAATGATATGGCCTTCAAATCGGCATCAAT (HEX modified at the 5' -end; BHQ1 modified with a thick base T in the middle)
SEQ ID No.13；
Name: st-LF primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
GGCCTTCAAATCGGCATCAAT
SEQ ID No.14；
Name: st-LB primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
GAAAGGGAAAGCCAGCTTTACG
SEQ ID No.15；
Name: st-F3 primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
CGGCCCGATTTTCTCTGG
SEQ ID No.16；
Name: FQ-VP-BIP primer gene sequence
Organism origin: artificial sequence (Artificial Sequence)/synthetic construct
TGCAATGACACCAACACGTCGCAAAACGCGTTCTCGTTCGCCAAAT (5' -modified Texas Red, middle bolded base T modified BHQ 2).

Claims (7)

1. A real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method is characterized by comprising the following steps:
firstly, on the basis of a loop-mediated isothermal amplification system, taking one or more of an inner primer and a loop primer as a labeled primer, and carrying out labeling/modification of a fluorescent group and a quenching group on the labeled primer, wherein the fluorescent group and the quenching group are labeled/modified at any position except the 3' end of the labeled primer;
and then carrying out nucleic acid amplification by using the labeled primer, detecting fluorescence emitted by the fluorescent group in real time in the process of nucleic acid amplification, and judging the condition of nucleic acid amplification according to the obtained fluorescence condition.
2. The method for amplifying a nucleic acid according to claim 1, wherein:
the loop-mediated isothermal amplification system does not contain any functional enzyme capable of cutting, breaking and the like on the primer containing the fluorescent label and the double strand generated by the primer.
3. The method for amplifying a nucleic acid according to claim 1, wherein:
the labeled primer has a 5 'extension, and the fluorescent group and the quenching group are labeled on the 5' extension, respectively or in total.
4. The method for amplifying a nucleic acid according to claim 3, wherein:
the 5' extension is selected from any sequence containing thymine (T) base, and the extension itself or the extension and the connected primer are not required to form a secondary structure such as a stem loop.
5. The method for amplifying a nucleic acid according to any one of claims 1 to 4, wherein:
on the selected labeled primer, the distance between the fluorescent group and the quenching group is between 9 and 35 bases.
6. The method for amplifying a nucleic acid according to any one of claims 1 to 4, wherein:
in the case of nucleic acid amplification, when a target nucleic acid fragment is present, the labeled primer and its complementary fragment bind and extend along the target nucleic acid fragment to form a double strand under the action of a nucleic acid amplification enzyme having a strand displacement function.
7. The method for amplifying a nucleic acid according to any one of claims 1 to 4, wherein:
when the nucleic acid amplification is carried out, when a plurality of target nucleic acid fragments exist, fluorescent groups with different emission wavelengths and corresponding quenching groups are marked/modified on amplification primers of different target nucleic acid fragments, so that the real-time multiple nucleic acid detection is realized.
CN202310740901.3A 2023-06-21 2023-06-21 Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method Pending CN116875664A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310740901.3A CN116875664A (en) 2023-06-21 2023-06-21 Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310740901.3A CN116875664A (en) 2023-06-21 2023-06-21 Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method

Publications (1)

Publication Number Publication Date
CN116875664A true CN116875664A (en) 2023-10-13

Family

ID=88270626

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310740901.3A Pending CN116875664A (en) 2023-06-21 2023-06-21 Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method

Country Status (1)

Country Link
CN (1) CN116875664A (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120058481A1 (en) * 2010-08-20 2012-03-08 Life Technologies Corporation Quantitative Real Time PCR Assay Using FRET Dual-Labeled Primers
CN105506121A (en) * 2016-01-10 2016-04-20 中国疾病预防控制中心传染病预防控制所 Nucleotide sequence used for vibrio parahaemolyticus and vibrio vulnificus detection
CN110358815A (en) * 2019-07-18 2019-10-22 江苏宏微特斯医药科技有限公司 Method and its kit a kind of while that detect multiple target nucleic acids
WO2020181947A1 (en) * 2019-03-13 2020-09-17 江苏宏微特斯医药科技有限公司 Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof
WO2023071788A1 (en) * 2021-10-27 2023-05-04 上海翔琼生物技术有限公司 Fluorescence pcr method for detecting nucleic acid
CN116179655A (en) * 2021-11-29 2023-05-30 北京迅识科技有限公司 Real-time fluorescent quantitative detection probe
WO2023106866A1 (en) * 2021-12-10 2023-06-15 주식회사 씨젠 Tagged loop primer comprising single-stranded interactive double labeling system, and isothermal nucleic acid amplification method using same

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120058481A1 (en) * 2010-08-20 2012-03-08 Life Technologies Corporation Quantitative Real Time PCR Assay Using FRET Dual-Labeled Primers
CN105506121A (en) * 2016-01-10 2016-04-20 中国疾病预防控制中心传染病预防控制所 Nucleotide sequence used for vibrio parahaemolyticus and vibrio vulnificus detection
WO2020181947A1 (en) * 2019-03-13 2020-09-17 江苏宏微特斯医药科技有限公司 Method for detecting one or more target nucleic acid sequences to be tested by single tube and kit thereof
CN110358815A (en) * 2019-07-18 2019-10-22 江苏宏微特斯医药科技有限公司 Method and its kit a kind of while that detect multiple target nucleic acids
WO2023071788A1 (en) * 2021-10-27 2023-05-04 上海翔琼生物技术有限公司 Fluorescence pcr method for detecting nucleic acid
CN116179655A (en) * 2021-11-29 2023-05-30 北京迅识科技有限公司 Real-time fluorescent quantitative detection probe
WO2023106866A1 (en) * 2021-12-10 2023-06-15 주식회사 씨젠 Tagged loop primer comprising single-stranded interactive double labeling system, and isothermal nucleic acid amplification method using same

Similar Documents

Publication Publication Date Title
US20210230682A1 (en) Method of Fluorescent Detection of Isothermal Loop-Mediated Amplification (LAMP) of a Target Nucleic Acid, Oligonucleotides and Kits Thereof
JP3999653B2 (en) Specific double-stranded probe for detection of nucleic acid in the same species and application method
CN103014148B (en) Isothermal detection method of RNA (Ribonucleic Acid)
CA2658071C (en) Specialized oligonucleotides and their use in nucleic acid amplification and detection
US20130178378A1 (en) Multiplex digital pcr
CN102071251B (en) PCR (polymerase chain reaction) nucleic acid detection method
US11898201B2 (en) Split-cycle and tape amplification
JP2016537005A (en) Nucleic acid detection by strand-based amplification
US20240011083A1 (en) Looped primer and loop-de-loop method for detecting target nucleic acid
US20210054446A1 (en) Promer for Real-Time Detection of Nucleic Acid or Protein and Method of detecting Nucleic Acid or Protein Using the Same
CN108048533B (en) Molecule detection method based on three-way connection-nucleic acid molecule line transducer
WO2024012467A1 (en) Fluorescent pcr method for nucleic acids detection using the combination of primer-activated polymerization and probes
US20210087607A1 (en) Methods and compositions for nucleic acid detection
Liang et al. A novel fluorescence method based on loop-mediated isothermal amplification and universal molecular beacon in Mycobacterium tuberculosis detection
WO2023071788A1 (en) Fluorescence pcr method for detecting nucleic acid
US20200407794A1 (en) Molecular targets for fetal nucleic acid analysis
CN116875664A (en) Real-time fluorescence loop-mediated isothermal nucleic acid amplification detection method
CN117286230A (en) Real-time single or multiple PCR nucleic acid amplification detection method
Sharma et al. Advancements in visualizing loop-mediated isothermal amplification (LAMP) reactions: A comprehensive review of colorimetric and fluorometric detection strategies for precise diagnosis of infectious diseases
CN117660694A (en) Constant temperature fluorescence detection system for detecting respiratory tract pathogens
CN112921119A (en) Primer group, kit and method for loop-mediated nicking isothermal-CRISPR (clustered regularly interspaced short palindromic repeats) combined detection of rift valley fever virus
CN117625768A (en) Universal digital PCR detection system and application thereof
CN116694816A (en) Isothermal multiplex detection reagent and detection method for SARS-CoV-2, influenza A virus and influenza B virus nucleic acid
WO2023108014A1 (en) Methods and compositions for nucleic acid analysis
CN113337582A (en) Single-tube multiple nucleic acid detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination