CN116869979A

CN116869979A - Application of psoralen in preparation of medicine for treating epidemic encephalitis B virus infection

Info

Publication number: CN116869979A
Application number: CN202310774377.1A
Authority: CN
Inventors: 周斌; 周江飞; 赵炳枢
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2023-06-28
Filing date: 2023-06-28
Publication date: 2023-10-13

Abstract

The invention discloses application of psoralen in preparing a medicament for treating epidemic encephalitis B virus infection, wherein compounds for inhibiting proliferation of epidemic encephalitis B virus are screened from a lipid compound library by a CCK-8 method, the psoralen is found to inhibit replication of epidemic encephalitis B virus in a concentration dependent manner, and a medicament addition test proves that the psoralen mainly acts on encephalitis B virus replication stage to play a role in inhibition, and the psoralen also shows good effect in vivo experiments, and eliminates histopathological changes related to encephalitis B virus infection by reducing viral load in brain tissues of infected mice, so that the mice are protected from lethal attack caused by encephalitis B virus. In a word, psoralen is expected to be an encephalitis B virus inhibitor, and the research provides treatment possibility for infection caused by encephalitis B virus.

Description

Application of psoralen in preparation of medicine for treating epidemic encephalitis B virus infection

Technical Field

The invention belongs to the technical field of antivirus, and in particular relates to application of psoralen in preparation of a medicament for treating epidemic encephalitis B virus infection.

Background

Epidemic Japanese encephalitis virus is also called Japanese encephalitis virus, which is called Japanese Encephalitis Virus (JEV) for short, belongs to the flaviviridae member, uses Culex trilobus as an infection medium, uses pigs and wading birds as amplification hosts, and uses the Culex to infect final hosts such as human beings, horses and the like through biting. Epidemic encephalitis B virus belongs to a type B infectious disease regulated in the infectious disease control method of the people's republic of China, and can cause serious zoonosis.

Japanese encephalitis is mainly popular in summer and in high-temperature and season weather 7 to 9 months, mosquitoes are easy to breed in urban and rural areas with developed water system and dense population, the types and the number of waterfowl are large, meanwhile, the demand for pork is large in the densely populated areas, the breeding industry is developed, the three-belt culex is infected with the encephalitis virus after biting pigs, and the three-belt culex is further bitten by people, so that the risk of human infection of the encephalitis virus is aggravated. The Japanese encephalitis B was first observed in 1871, and the Japanese encephalitis B strain Nakayama was first isolated from the brains of patients in 1935. In the following time, epidemic encephalitis virus infection is reported in China, korea, philippines and the like, and is gradually spread, and there is a possibility that epidemic encephalitis is spread from the border region of the middle Russia in the North to the North Australian in the south, from the western Pacific islets in the east to the Inbus border region in the west, and further. Most of the areas in China, especially the eastern China and the south China, have large population scale, rapid economic development and serious threat of Japanese encephalitis in addition to hot and humid climates in summer. Epidemic encephalitis B is reported to occur in Shandong province in China in the last century, and outbreaks occur in more than 6 and 70 s in the 20 th century, and the epidemic encephalitis B incidence remains in the first place nationally in 2013. Other provinces include Jiangsu province, fujian province, guangdong province, etc., and in recent years, infection cases are reported. These data indicate seasonal, regional, epidemic encephalitis b occurrence.

The epidemic encephalitis B virus can cause obvious clinical symptoms when people or pigs are infected. When a human is infected with the encephalitis B virus, the disease is acute, the symptoms such as high fever, headache and vomit are accompanied, serious patients have the symptoms such as dysphagia and respiratory failure, the signs have the symptoms such as disappearance of shallow reflex, hyperreflexia and tonic paralysis, and according to the statistics of the disease incidence, the disease incidence of children under 10 years of age is highest. According to Yin Zundong, single factor analysis shows that 7 factors such as "profession is farmer" are dangerous factors of epidemic encephalitis B, while multi-factor analysis shows that "pig raising at home or in the neighborhood" is highest among the dangerous factors of epidemic encephalitis B. When pigs are infected by epidemic encephalitis B virus clinically, reproductive disorders are mainly caused, and the problems of testicular enlargement, semen quality reduction and the like caused by boars are mainly reflected in abortion, miscarriage, dead fetus or mummy fetus and the like on pregnant sows, so that continuous economic loss is caused to farms.

The epidemic encephalitis B is used as zoonotic disease, the prevention mode comprises controlling the immunization of mosquitoes and vaccines, and the immunization of pigs with the epidemic encephalitis B attenuated live vaccine can effectively control the disease in the breeding industry at present. However, currently, the dominant genotype of Japanese encephalitis is being changed from GIII type to GI type, and whether the former attenuated live vaccine can continuously exert the preventive effect is to be further researched; in addition, no specific medicine is available at present for treating the epidemic encephalitis B, and rapid research and development of the anti-epidemic encephalitis B medicine is urgently needed in the prevention and control situation.

Disclosure of Invention

This section is intended to outline some aspects of embodiments of the invention and to briefly introduce some preferred embodiments.

As one aspect of the invention, the invention provides the use of psoralen in the treatment of epidemic encephalitis B virus infection.

Wherein, the psoralen can inhibit the biosynthesis of Japanese encephalitis virus nucleic acid and protein, and has concentration dependence.

Wherein, the psoralen can relieve brain pathological changes caused by Japanese encephalitis virus infection.

Wherein, the dosage of psoralen is 2.5 mu M-20 mu M in vitro and 25mg/kg-50mg/kg in vivo.

Wherein the molecular formula of psoralen B is C ₂₀ H ₂₀ O ₄ The structural formula is

Wherein, the psoralen also comprises salt of psoralen.

Wherein, the dosage forms of the medicine for treating epidemic encephalitis B comprise tablets, powder, granules, capsules, oral liquid, injection or sustained release agent.

Compared with the prior art, the invention has the beneficial effects that:

1. psoralen is a compound which is screened from 134 lipid compounds and can inhibit the replication of Japanese encephalitis virus, and at the concentration of 10 mu M, the psoralen can inhibit 90% of nucleic acid synthesis of Japanese encephalitis virus, and the inhibition effect is most obvious.

2. The psoralen can inhibit the proliferation of Japanese encephalitis virus on cells of different species, including murine BHK-21 cells, porcine PK-15 cells and humanized HEK-293T cells, and the drug selection index is more than 10, thus indicating that the psoralen has good market application prospect.

3. The psoralen not only shows remarkable inhibitory activity on Japanese encephalitis virus proliferation in vitro, but also can obviously improve the survival rate of mice after JEV attack from 10% to 80%, and shows that the psoralen can also play an antiviral role in vivo.

4. The psoralen has no inhibition effect on other viruses of flaviviridae, such as duck tembusu virus DTMUV and classical swine fever virus CSFV, which shows that the psoralen can specifically inhibit proliferation of JEV, thereby laying a theoretical foundation for the psoralen as a candidate medicament for only treating JEV.

5. Psoralen is used as a flavonoid compound, is derived from Chinese herbal medicine extract components, is not easy to remain in the body, and has no obvious toxic or side effect on the body.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the description of the embodiments will be briefly described below, which are only some embodiments of the present invention, and from which other drawings can be obtained for a person skilled in the art without inventive effort. Wherein:

FIG. 1 shows the screening of a lipid compound library for a compound inhibiting JEV proliferation by the CCK-8 method.

FIG. 2 is a graph showing that the selected compounds have an inhibitory effect on JEV proliferation.

FIG. 3 shows that psoralen inhibits JEV proliferation in a concentration-dependent manner.

FIG. 4 shows that psoralen inhibits JEV replication by acting on the viral replication phase.

FIG. 5 is a selection index of psoralen inhibiting JEV proliferation on cells of different species origin.

FIG. 6 shows that psoralen inhibits JEV vaccine virus (SA-14-14-2) proliferation and is concentration dependent.

FIG. 7 shows that psoralen does not affect the proliferative activity of DTMUV and CSFV.

FIG. 8 is a graph showing that psoralen protects mice from lethal challenge with JEV.

Detailed Description

In order that the above-recited objects, features and advantages of the present invention will become more apparent, a more particular description of the invention will be rendered by reference to specific embodiments thereof.

Examples:

test materials:

epidemic encephalitis B virus NJ-2008 strain, SA-14-14-2 strain, classical swine fever virus CSFV (Shimen) strain, duck tembusu virus DTMUV, BHK-21 cells, PK-15 cells and HEK-293T cells are stored in the laboratory;

lipid compound library, psoralen b from MedChemExpress (MCE) company;

CCK-8 detection kit was purchased from APEXBIO, inc., USA;

reverse transcription kit (HiScript II Q RT SurperMix), qPCR kit (AceQ Universal SYBR qPCR Master Mix) was purchased from the company nanking nuozan;

the quantitative primer is synthesized by Nanjing Jinsri company;

anti-Japanese encephalitis virus NS5 antibody was given away by the university of agricultural in China Cao Shengbo, anti-beta-action antibody was purchased from Santa Cruz Biotechnology Co., ltd;

c57BL/6 mice were purchased from the university of Yangzhou comparative medical center.

The test method comprises the following steps:

cytotoxicity assays for lipid library compounds

BHK-21 cells well grown were diluted with 10% serum-containing DMEM and seeded in 96-well plates with 1X 10 cells per well ⁴ Cells and 100. Mu.L of medium, 96-well plates were placed at 37℃in 5% CO ₂ Culturing in an incubator. When the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, drugs of lipid compound library (134 total) were added, the drug use concentration was set to 10. Mu.M (lipid compounds were diluted with DMEM containing 2% serum), blank wells were set, and cell control wells were set, and each sample was repeated three times. The 96-well plate was further placed in a 5% CO2 incubator at 37 ℃. After 48 hours, the culture medium in the hole is discarded, the cells are washed for 2 to 3 times by using PBS, CCK-810 mu L is added to each hole, DMEM is 90 mu L, the mixture is gently mixed, the mixture is incubated in an incubator at 37 ℃ in the dark, the values are read at the absorbance of 450nm by using an enzyme-labeled instrument every half an hour, and the reading can be stopped when the cell contrast hole value is between 1.0 and 1.8. Cell viability was calculated according to the following formula, and compounds having significant toxicity to cells were eliminated (cell viability. Ltoreq.70%).

Cell viability= (OD _{450 experiment hole} -OD _{450 blank holes} )/(OD _{450 cell control well} -OD _{450 blank holes} )×100％

Screening of compounds inhibiting JEV proliferation from lipid Compound library

Removing compounds having significant toxicity to BHK-21 cells, and screening the remaining lipid compounds for JEV replication inhibiting compounds. BHK-21 cells well grown were diluted with 10% serum-containing DMEM and seeded in 96-well plates with 1X 10 cells per well ⁴ Cells and 100. Mu.L of medium were incubated in 96-well plates at 37℃in a 5% CO2 incubator. After the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, lipid compounds were added, the drug concentration was set to 10. Mu.M (lipid compounds were diluted with DMEM containing 2% serum), 96-well plates were placed at 37℃in a 5% CO2 incubator for 1 hour, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, and JEV (JEV) was infected at MOI=0.05 (in JEV)Containing lipid compounds) were included, while cell control wells and individual virus-infected wells were set as controls. The 96-well plate is placed in a 37 ℃ and 5% CO2 incubator for 1-2 hours, the in-hole culture medium is discarded, cells are washed 2-3 times by using PBS, lipid compounds are added, the drug use concentration is set to 10 mu M (the lipid compounds are diluted by using DMEM containing 2% serum), the 96-well plate is placed in the 37 ℃ and 5% CO2 incubator for 48 hours, the in-hole culture medium is discarded, the cells are washed 2-3 times by using PBS, CCK-810 mu L is added to each hole, the DMEM is 90 mu L, the mixture is gently mixed, the culture is incubated in the incubator at 37 ℃ in the dark condition, the enzyme-labeled instrument is used for reading at the absorbance of 450nm every half an hour, and the reading can be stopped when the cell contrast hole value is between 1.0 and 1.8. And calculating the virus inhibition rate according to the following formula, and selecting a compound with the virus inhibition rate of more than or equal to 80 percent for the next experiment.

Viral inhibition= (OD _{450 experiment hole} -OD _{450 virus infection hole} )/(OD _{450 cell control well} -OD _{450 virus infection hole} )×100％

Quantitative verification of inhibition of JEV proliferation by the screened Compounds

BHK-21 cells well grown were diluted with 10% serum in DMEM and seeded in 24 well plates with 5X 10 cells per well ⁴ Cells and 500. Mu.L of medium were then incubated in 24-well plates at 37℃in a 5% CO2 incubator. When the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, lipid compound was added, drug use concentration was set to 10 μm (lipid compound was diluted with DMEM containing 2% serum), 24-well plates were placed in a 37 ℃ 5% co2 incubator for 1 hour, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, and JEV (lipid compound was contained in JEV) was infected at moi=0.05, while individual virus-infected wells were set as controls. Culturing 24-well plate at 37deg.C in 5% CO2 incubator for 1-2 hr, discarding in-well culture medium, washing cells with PBS for 2-3 times, adding lipid compound, adjusting drug concentration to 10 μm (using DMEM containing 2% serum to dilute lipid compound), culturing 24-well plate at 37deg.C in 5% CO2 incubator for 48 hr, collecting sample, adding 700 μl TriZOL-lysed cells into each well, standing for 10-15min, blowing and mixingAnd all liquid was blotted off in a 1.5mL EP tube, 200. Mu.L of chloroform was added, vortexed and mixed well, and then allowed to stand for 10min, centrifuged at 4 ℃ (12000 Xg,15 min), the supernatant was transferred to a fresh 1.5mL EP tube, and equal amount of isopropanol was added, mixed well upside down, allowed to stand for 30min or more at-20℃and centrifuged at 4 ℃ (12000 Xg,15 min), the supernatant was discarded, 400. Mu.L of 75% ethanol was added, mixed well upside down, centrifuged at 4 ℃ (12000 Xg,15 min), the supernatant was discarded, centrifuged at 4 ℃ (12000 Xg,15 min), and the liquid in the EP tube was blotted off using a pipette, and 30. Mu.L of enzyme-free water was added to resuspend RNA per well. The extracted RNA was inverted into cDNA using a reverse transcription kit (HiScript II Q RT SurperMix), and the detailed procedure was as follows:

1. preparing first strand cDNA synthesis reaction liquid

5X HiScript II Q RT SurperMix	4μL
		Template RNA	2μL
RNase-free dd H ₂ O	14μL

2. Reverse transcription reaction was performed

50℃，15min；85℃，5s。

After the inversion was completed, a relative quantitative qPCR was performed using a kit (AceQ Universal SYBR qPCR Master Mix), primer sequences were

JEV-F(5′-3′)：AGAGCGGGGAAAAAGGTCAT，

JEV-R(5′-3′)：TTTCACGCTCTTTCTACAGT；

β-Actin-F(5′-3′)：CTCCATCATGAAGTGCGACGT，

β-Actin-R(5′-3′)：GTGATCTCCTTCTGCATCCTGTC；

The specific experimental procedure is as follows:

1. the following mixture was prepared in qPCR tube:

2. the qPCR reaction was performed under the following conditions

Concentration-dependent detection of psoralen in vitro inhibition of JEV proliferation

BHK-21 cells well grown were diluted with 10% serum in DMEM and seeded in 24 well plates with 5X 10 cells per well ⁴ Cells and 500. Mu.L of medium were then incubated in 24-well plates at 37℃in a 5% CO2 incubator. When the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, psoralen was added at different concentrations, the drug use concentration was set to 2.5 μm,5 μm,7.5 μm,10 μm,20 μm (diluted with DMEM containing 2% serum), the 24-well plate was placed in a 37 ℃ 5% co2 incubator for 1h, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, JEV (psoralen at different concentrations in JEV) was infected at moi=0.05, while individual virus infection wells were set as controls, each sample was replicated three times. Culturing the 24-well plate in a 5% CO2 incubator at 37 ℃ for 1-2 hours, discarding the in-well culture medium, washing the cells for 2-3 times by using PBS, adding psoralen with different concentrations, culturing the 24-well plate in the 5% CO2 incubator at 37 ℃ for 48 hours, and collecting samples.

The RT-qPCR sample processing method is operated according to the method in the quantitative verification, and detailed description is omitted.

The WB sample treatment method is as follows: removing supernatant, washing cells 2-3 times with pre-cooled PBS, adding 80 μL of RIPA lysate into each well, placing on a shaking table at 4deg.C for incubation for 20-30min, placing a 24-well plate on an ice box, blowing and sucking liquid with a pipetting gun to completely lyse and fall off the cells, sucking the liquid into a 1.5mLEP tube, centrifuging at 4deg.C (5000 xg,10 min), transferring supernatant into a new 1.5mLEP tube, adding 5xSDS Loading buffer 20 μL, vortex mixing, separating, boiling for 15min, and performing SDS-PAGE electrophoresis directly or storing at-20deg.C as required.

After electrophoresis, protein on SDS-PAGE gel is transferred onto NC membrane by using transfer tank, after transfer is completed, NC membrane is sealed by using 10% skim milk, after sealing for 1-2h at room temperature, PBST is used for washing 3 times, each time for 5-10min, after the last washing is completed, liquid is discarded, target primary antibody is added, shaking table at 4 ℃ is incubated overnight, PBST is used for washing 3 times, each time for 5-10min, secondary antibody with the same species source is added, incubation is performed for 1-2h at room temperature, PBST is used for washing 3 times, each time for 5-10min, and ECL color development liquid is used for exposure.

The indirect immunofluorescence sample treatment method comprises the following steps: removing supernatant, washing cells 2-3 times by using precooled PBS, sucking liquid in holes, adding 300 mu L of 4% paraformaldehyde, incubating for 20min at room temperature, washing cells 2-3 times by using precooled PBS, adding target primary antibody, incubating overnight by using a shaker at 4 ℃, washing 3 times by using PBS, each time for 3-5min, adding fluorescent secondary antibodies with the same species of origin in a dark place, incubating for 1-2h at room temperature in a dark place, washing 3 times by using PBS, each time for 3-5min, staining cell nuclei by using DAPI staining solution, incubating for 5-10min at room temperature in a dark place, washing 3 times by using PBS, each time for 3-5min, adding 200 mu LPBS in each hole, and observing fluorescence by using an inverted fluorescent microscope.

Psoralen inhibits JEV replication by acting on viral replication stages

The period of psoralen inhibition of JEV infection was detected by a drug addition time assay. The tests were divided into four groups, a pre-drug-receiving group, a mid-drug-receiving group, and a post-drug-receiving group. The administration groups are divided into two groups after the inoculation, wherein one group is that after the inoculation, the incubation is carried out for 1h at 4 ℃, the supernatant is discarded, then the administration is carried out, the incubation is carried out for 1h at 37 ℃, and then the liquid is changed; one group is to incubate for 1h at 37 ℃ after the inoculation, discard supernatant, then administer, the drug action time is maintained for 24h. BHK-21 cells with good growth state were diluted with DMEM containing 10% serum and inoculatedIn a 12-well plate, each well contains 1×10 ⁵ Cells and 1mL of medium were then incubated in a 5% CO2 incubator at 37℃in a 12-well plate. When the cell density reaches 80% -90%, discarding the culture medium in the hole, washing the cells for 2-3 times by using PBS, sequentially taking the medicines according to different adding times for taking the medicines or taking the medicines for taking the medicines, collecting samples 24 hours after taking the medicines, detecting the content of JEV NS5 in each group by WB, and using beta-Actin as a control. The WB procedure was as described above.

Securinegatin has a Selective Index (SI) for inhibiting JEV proliferation

Determination of CC of psoralen on milk hamster kidney cell BHK-21, porcine kidney cell PK-15, human kidney epithelial cell 293T Using CCK-8 method ₅₀ . Cells well grown were diluted with DMEM containing 10% serum and seeded in 96-well plates, each containing 1×10 ⁴ Cells and 100. Mu.L of medium were incubated in 96-well plates at 37℃in a 5% CO2 incubator. When the cell density reached 80% -90%, the in-well medium was discarded and the cells were washed 2-3 times with PBS, psoralen (5. Mu.M, 10. Mu.M, 20. Mu.M, 40. Mu.M, 80. Mu.M) was added at different concentrations, while blank wells, and cell control wells were set, and each sample was replicated three times. The 96-well plate was further placed in a 5% CO2 incubator at 37 ℃. After 48 hours, the culture medium in the hole is discarded, the cells are washed for 2 to 3 times by using PBS, CCK-810 mu L is added to each hole, DMEM is 90 mu L, the mixture is gently mixed, the mixture is incubated in an incubator at 37 ℃ in the dark, the values are read at the absorbance of 450nm by using an enzyme-labeled instrument every half an hour, and the reading can be stopped when the cell contrast hole value is between 1.0 and 1.8. Cell viability was calculated according to the formula and CC was fitted using Graph Prism ₅₀ 。

Determination of IC of psoralen inhibiting JEV proliferation on milk hamster kidney cell BHK-21, pig kidney cell PK-15, human kidney epithelial cell 293T Using CCK-8 method ₅₀ . Cells well grown were diluted with DMEM containing 10% serum and seeded in 96-well plates, each containing 1×10 ⁴ Cells and 100. Mu.L of medium were incubated in 96-well plates at 37℃in a 5% CO2 incubator. Discarding the medium in the hole when the cell density reaches 80% -90%, washing the cells for 2-3 times by using PBS, inoculating the cells according to MOl =0.05, placing the 96-well plate at 37 ℃ after inoculating the cells, and culturing with 5% CO2The culture was carried out in the incubator for 1-2 hours, and then the supernatant was discarded, and psoralen was added at various concentrations (psoralen was diluted to 5. Mu.M, 10. Mu.M, 20. Mu.M, 40. Mu.M, 80. Mu.M using DMEM containing 2% serum), while setting individual virus-infected wells, and cell control wells, each sample was repeated three times. The 96-well plate was further placed in a 5% CO2 incubator at 37 ℃. After 48 hours, the culture medium in the hole is discarded, the cells are washed for 2 to 3 times by using PBS, CCK-810 mu L is added to each hole, DMEM is 90 mu L, the mixture is gently mixed, the mixture is incubated in an incubator at 37 ℃ in the dark, the values are read at the absorbance of 450nm by using an enzyme-labeled instrument every half an hour, and the reading can be stopped when the cell contrast hole value is between 1.0 and 1.8. Viral inhibition was calculated according to the formula and IC50 was fitted using Graph Prism.

Calculating a selection index according to SI=CC50/IC 50, wherein the judgment standard is SI < 1, and the tested sample is invalid; 1 < Sl < 2, and the medicine is low-efficiency and toxic; SI < 2 < 10, and the medicine is low in toxicity and effective; SI is more than 10, and the medicine has low toxicity and high efficiency. The medicine has good application prospect under the condition that SI is generally more than 10.

Detection of proliferation activity of psoralen in inhibiting JEV vaccine virus (SA-14-14-2)

BHK-21 cells well grown were diluted with 10% serum in DMEM and seeded in 24 well plates with 5X 10 cells per well ⁴ Cells and 500. Mu.L of medium were then incubated in 24-well plates at 37℃in a 5% CO2 incubator. When the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, psoralen was added at different concentrations, the drug use concentration was set to 2.5 μm,5 μm,7.5 μm,10 μm,20 μm (diluted with DMEM containing 2% serum), the 24-well plate was placed in a 37 ℃ 5% co2 incubator for 1h, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, JEV vaccine virus SA-14-14-2 (containing psoralen at different concentrations in JEV) was infected at moi=0.05, while a single virus infection well was set as a control, and each sample was repeated three times. Culturing the 24-well plate in a 5% CO2 incubator at 37 ℃ for 1-2 hours, discarding the in-well culture medium, washing the cells for 2-3 times by using PBS, adding psoralen with different concentrations, culturing the 24-well plate in the 5% CO2 incubator at 37 ℃ for 48 hours, and collecting samples.

JEV nucleic acid content was detected using RT-qPCR, JEV protein level was detected using WB, and detailed procedure was as described above.

Effect of psoralen on proliferation activity of other flaviviruses (CSFV and DTMUV)

PK-15 cells or BHK-21 cells in good growth state were diluted with DMEM containing 10% serum and inoculated in 24-well plates, each containing 5X 10 ⁴ Cells and 500. Mu.L of medium were then incubated in 24-well plates at 37℃in a 5% CO2 incubator. When the cell density reached 80% -90%, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, psoralen was added at different concentrations, the drug was used at concentrations of 2.5 μm,5 μm,10 μm,20 μm (diluted with DMEM containing 2% serum), the 24-well plate was placed in a 37 ℃ 5% co2 incubator for 1h, the in-well medium was discarded, and the cells were washed 2-3 times with PBS, JEV vaccine virus SA-14-14-2 (JEV containing psoralen at different concentrations) was infected at moi=0.05, while a separate virus infection well was set as a control, and each sample was repeated three times. Culturing the 24-well plate in a 5% CO2 incubator at 37 ℃ for 1-2 hours, discarding the in-well culture medium, washing the cells for 2-3 times by using PBS, adding psoralen with different concentrations, culturing the 24-well plate in the 5% CO2 incubator at 37 ℃ for 48 hours, and collecting samples.

Viral nucleic acid content was detected using RT-qPCR, viral protein levels were detected using WB, and detailed procedures were as described above.

Quantitative primer sequence is

CSFV-F(5′-3′)：CCTGAGGACCAAACACATGTTG，

CSFV-R(5′-3′)：TGGTGGAAGTTGGTTGTGTCTG；

DTMUV-F(5′-3′)：TGTCTTATGCAGGTACCGATG，

DTMUV-R(5′-3′)：CGTATGGGTTGACTGTTATCA；

Detection of anti-JEV activity in psoralen body

Animal challenge therapy trials were performed using C57BL/6 mice. Animal experiments were divided into 4 groups of 10 female mice of three weeks of age, each group being untreated (Blank), a single vaccinated group (JEV), a post-vaccinated low-dose treated group (JEV+IBC-L),and high dose treatment groups (JEV+IBC-H) following challenge. In addition to the Blank group, each mouse of the other groups was intraperitoneally injected with 10LD ₅₀ JEV (NJ 2008) starts treatment after 24 hours of toxin attack, the low-dose treatment group is given 25mg/kg of psoralen every day, and the high-dose treatment group is given 50mg/kg of psoralen every day, so that the mice can eat drinking water freely. The body weight of each group of mice is recorded every day, the death condition of each group of mice is recorded, and brain tissues of the mice are collected, one part of the mice is used for detecting virus nucleic acid by RT-qPCR, and the other part of the mice is made into HE sections, so that pathological changes of brains are observed. HE section entrusts the completion of the wuhan seville biotechnology company.

Test results:

1. screening from lipid Compound library (134) to 6 drugs inhibiting proliferation of JEV on BHK-21 cells

The screening protocol is shown in FIG. 1A, and was carried out by first detecting cytotoxicity of 134 lipid compounds by CCK-8 method, and 7 compounds were found to have serious cytotoxicity at 10. Mu.M concentration. After the 7 drugs were removed, the remaining 127 compounds were tested for their viral inhibition by CCK-8 method, and as a result, it was found that the inhibition of JEV by 6 compounds was more than 80% at a concentration of 10. Mu.M (FIG. 1B). The 6 compounds are respectively: balsam sterone (Guggulsterone), lupeol (Lupeol), pregnenolone (Pregnenolone), 20S-Protopanaxatriol (20S) -Protopanaxatriol, fursultiamine (Fursultiamine) and psoralen b (isoparaffin IBC).

The inhibition of psoralen B (IBC) among 2.6 lipid compounds is most obvious

Since CCK-8 was calculated to indirectly reflect the amount of virus by the degree of cytopathic effect, no direct quantification of the virus was performed. We therefore performed a third screening of the 6 compounds screened and detected changes in viral mRNA following treatment with each compound by RT-qPCR. As shown in FIG. 2, these 6 lipid compound treatments were effective in reducing the mRNA level of JEV, but the reduction was different from the control. Wherein, the inhibition effect of lupeol and 20S-protopanaxatriol is the worst, and the mRNA content of the two groups accounts for about 0.55-0.65 times of that of the control group; the effects of the balsam sterone and the furathiamine are slightly better than those of lupeol and 20S-protopanaxatriol, and the mRNA content of the two groups is reduced by half compared with that of a control group; pregnenolone inhibits 75% of viral mRNA production; the effect of psoralen is most remarkable, and the content of JEV mRNA can be effectively reduced at the concentration of 10 mu M, which is only 10% of that of a control group. These results demonstrate that, of these 6 lipid compounds, psoralen has the most significant inhibition rate to JEV, and is expected to be a candidate drug for JEV inhibitors.

3. Concentration dependence of psoralen in inhibiting JEV proliferation

The inhibition of viruses by drugs requires a dose-dependent manner, i.e. the efficacy can be controlled to a certain extent by adjusting the dose, which is necessary for drugs. To examine whether psoralen inhibits JEV proliferation in a concentration-dependent manner, psoralen at different concentrations was used, mRNA of JEV was detected by RT-qPCR, protein expression level was detected by WB, and intracellular viral titer was detected by IFA. As a result, as shown in FIG. 3, as the concentration of psoralen increases, less mRNA was detected, and at a concentration of 10. Mu.M, the mRNA content was only about 10% of that of the control group, and at a concentration of 20. Mu.M, mRNA was not substantially detected; the protein content was also consistent with that expected, and at a concentration of 20. Mu.M, the NS5 protein of JEV could not be observed; and as the concentration of the drug increases, the number of fluorescent plaques in the cells becomes smaller and only single-digit fluorescent plaques are observed at concentrations of 10 μm and 20 μm. These results indicate that psoralen inhibits JEV proliferation in BHK-21 with concentration dependence.

4. Psoralen inhibits JEV proliferation primarily by acting on viral replication stages

Most viruses invade host cells through a series of special processes, and the life cycle is generally as follows: adsorption, intrusion, replication, assembly, release. In order to detect the period of action of psoralen, we carried out a drug addition time experiment, the drug and the virus inoculation time are shown in fig. 4A, JEV protein and mRNA are detected after 24h of virus inoculation, and the result is shown in fig. 4B, and the production of virus nucleic acid and protein can not be inhibited by the administration of psoralen before virus inoculation; JEV incubated with psoralen at 4℃also failed to reduce viral nucleic acid and protein levels; the mRNA and protein levels of JEV can be reduced by post-virus administration, however JEV is preferentially incubated with cells for 1h at 4deg.C, psoralen is added, the reduction is small in magnitude although JEV mRNA levels are reduced by maintaining the group for 1h at 37deg.C, no statistical difference exists, and only after virus adsorption invasion is completed, the treatment of psoralen is further carried out, and the treatment is maintained for 24h, so that the significant reduction in mRNA levels and protein levels is shown. These results demonstrate that psoralen does not kill the virus directly nor inhibit JEV proliferation by interfering with viral adsorption and invasion, but rather inhibits JEV proliferation on BHK-21 cells by acting on the viral replication phase.

5. Drug selection index assay for inhibition of JEV replication by psoralen

Drug Selection Index (SI) is a safety margin for evaluating drug effect, selection index si=cc ₅₀ /IC ₅₀ The larger the drug selection index, the better. The medicine has good application prospect under the condition that the selection index is more than 10. CCK-8 method was used to evaluate the CC of psoralen on cells of different species origin ₅₀ And IC ₅₀ As a result, as shown in FIG. 5, psoralen had a selection index of 10.13 on murine BHK-21 cells, 11.47 on swine PK-15 cells, and 16.25 on human HEK-293T cells. These data indicate that the selection index of psoralen on the selected three cells is greater than 10, which proves that psoralen has excellent application prospect.

6. Psoralen inhibits proliferation of JEV vaccine virus SA-14-14-2 and has concentration dependence

The above test is that psoralen inhibits JEV virulence (NJ 2008), then psoralen has inhibitory effect on JEV virulence? Here we selected JEV vaccine SA-14-14-2 as the subject, and detected nucleic acid and protein levels of vaccine by WB and RT-qPCR, and as shown in FIG. 6, psoralen could inhibit JEV mRNA and protein production, and with increasing psoralen concentration, inhibition was gradually enhanced, and at 10. Mu.M concentration, 80% mRNA production could be inhibited, thus effectively reducing JEV protein biosynthesis.

7. Effect of psoralen on proliferation Activity of DTMUV and CSFV

The effect of psoralen on other flaviviridae proliferation activity was detected by WB and RT-qPCR for nucleic acid and protein levels of DTMUV and CSFV, and the results are shown in fig. 7, in which psoralen did not show significant anti-DTMUV and CSFV proliferation activity at both nucleic acid and protein levels; even though the concentration of psoralen is increased, the activity is not obviously inhibited. These results indicate that psoralen cannot inhibit the replication of DTMUV and CSFV, and that it may be specific for inhibition of JEV, which also lays a theoretical foundation for psoralen as a candidate for the treatment of JEV infection.

8. Psoralen protects mice from lethal challenge with JEV

Many drugs have antiviral effects in vitro, but do not exhibit corresponding antiviral activity in vivo, and thus cannot be clinically used. In order to investigate whether psoralen can have the activity of inhibiting JEV proliferation in vivo, mice are challenged with lethal doses, then psoralen treatment is given, the body weight of the mice is detected every day, the mortality is recorded, the brain tissue of the mice is collected to detect the viral load, and brain HE sections are prepared to observe pathological changes. Daily weight measurement results are shown in fig. 8A, mice begin to lose weight on the third day after challenge, mice in the alone infected group continue to lose weight, only 80% of the initial weight by day 8 after challenge, and the weight in the drug treated group begins to rise back after continuing to lose weight for 1-2 days, and by day 8, the average weight of the low dose treated group is about 1.1 times the initial weight, and the weight of mice in the high dose treated group is 1.2 times the initial weight, which data indicate that psoralen b can effectively lose weight loss due to JEV infection, even with weight gain.

Survival of mice in each group as shown in fig. 8B, mice in JEV-alone infected groups began to die on day 4, reaching a peak of death on day 6, and survival was only 10% at the end of the trial; the psoralen low-dose treatment group starts to die at the 5 th day after toxin attack, the death peak is reached at the 6 th day, and the survival rate is 40% when the test is finished; the psoralen high dose treatment group started to die at day 6 after challenge and did not die after that, and at the end of the trial, the survival rate of the group was 80%. These data indicate that psoralen can effectively improve survival rate of mice under JEV lethal challenge.

As shown in FIG. 8C, the viral load of the brain of each group of mice can reach 7.5lg in the brain of the individual JEV-infected group, the viral load of the psoralen low-dose treatment group is about 4.5lg, the viral load of the psoralen high-dose treatment group is reduced by 3lg, and the viral load of the psoralen high-dose treatment group is only 2lg, which is extremely obviously lower than that of the individual JEV-infected group, thus indicating that the psoralen can effectively reduce the viral titer of the brain of the JEV-infected mice.

To investigate whether there is a change in brain pathology caused by virus infection when the virus titer is decreased, pathological sections were made using brain tissue of mice, and as a result, as shown in fig. 8D, JEV-infected groups increased vascular inflammatory cells, forming a typical vascular sheath phenomenon. The nerve cell peripheral gap is enlarged, the cytoplasm becomes loose and vacuolated, and the nucleus becomes concentrated, resulting in nerve cell necrosis. In contrast, the low dose drug treated group still showed cavitation, but was less severe than the JEV group. The high-dose drug treatment group is similar to the blank group, and basically has no obvious lesions, which indicates that the psoralen can not only reduce the brain virus titer caused by JEV attack, but also obviously improve the brain lesions caused by JEV infection.

In summary, in this study, we evaluated the inhibition of JEV proliferation by 134 lipid compounds, and found that psoralen strongly inhibited JEV proliferation on cells, was concentration-dependent, and acted primarily by acting on the viral replication phase. In addition, in vivo experiments have also demonstrated that psoralen protects mice from lethal challenge with JEV infection by reducing viral load in the brain and eliminating histopathological changes associated with JEV infection.

It should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted without departing from the spirit and scope of the technical solution of the present invention, which is intended to be covered in the scope of the claims of the present invention.

Claims

1. Application of psoralen in preparing medicine for treating epidemic encephalitis B virus infection is provided.

2. The use according to claim 1, characterized in that: the psoralen can inhibit biosynthesis of Japanese encephalitis virus nucleic acid and protein, and has concentration dependence.

3. Use according to claim 1 or 2, characterized in that: the psoralen can relieve brain pathological changes caused by Japanese encephalitis virus infection.

4. Use according to claim 1 or 2, characterized in that: the dosage of psoralen is 25mg/kg-50mg/kg.

5. Use according to claim 1 or 2, characterized in that: the molecular formula of psoralen B is C ₂₀ H ₂₀ O ₄ The structural formula is

6. Use according to claim 1 or 2, characterized in that: the psoralen also comprises salt of psoralen.

7. Use according to claim 1 or 2, characterized in that: the preparation forms of the medicine for treating epidemic encephalitis B virus infection comprise tablets, powder, granules, capsules, oral liquid, injection or sustained release agent.