CN116854801A

CN116854801A - HAND1 recombinant protein, preparation method thereof and application thereof in medicaments for treating dilated cardiomyopathy

Info

Publication number: CN116854801A
Application number: CN202311057253.8A
Authority: CN
Inventors: 蒋磊
Original assignee: Guangdong General Hospital
Current assignee: Guangdong General Hospital
Priority date: 2023-08-21
Filing date: 2023-08-21
Publication date: 2023-10-10
Also published as: CN117843759A

Abstract

The application provides a HAND1 recombinant protein, a preparation method thereof and application thereof in medicaments for treating dilated cardiomyopathy. The amino acid sequence of the HAND1 recombinant protein is shown as SEQ_1 or SEQ_2. The application also specifically provides a polyclonal antibody, which is obtained by immunizing experimental animals with the HAND1 recombinant protein shown in SEQ_1 or SEQ_2 as an antigen. The application designs and synthesizes the HAND1 recombinant protein by utilizing the characteristic that the HAND1 protein is over-expressed in mature myocardial cells and can obviously reduce the expression quantity of HAND1mRNA and protein, and the inhibition effect is quite obvious and is obviously superior to other siRNA, so the HAND1 recombinant protein can be developed into a micromolecule drug or a research and development reagent for researching the pathology mechanism of the heart disease.

Description

HAND1 recombinant protein, preparation method thereof and application thereof in medicaments for treating dilated cardiomyopathy

Technical Field

The application relates to a HAND1 recombinant protein, a preparation method thereof and application thereof in medicaments for treating dilated cardiomyopathy.

Background

Dilated cardiomyopathy (hereinafter referred to as dilated cardiomyopathy, DCM) is a cardiomyopathy characterized by a dysfunction of contraction and relaxation, caused by impaired ventricular function, left ventricular dilatation and an increase in end-diastole filling pressure. Mainly manifested as heart failure (heart failure), arrhythmia, embolism, etc. The heart disease is hereditary, often occurs in young patients who are not accompanied by other diseases, and has high death rate and poor prognosis. It is therefore very important to find biomarkers that can be used to treat heart disease.

Common causes of pathological changes in the heart disease are idiopathic inflammation, viral infections, alcohol and the like. Currently common treatments for these causes include non-drug therapies (patient training, reduced salt and water intake, moderate physical exercise) and drug therapies (e.g., angiotensin converting enzyme inhibitors (ACE-I)/angiotensin receptor Antagonists (ARBs), beta blockers, mineralocorticoid (MR) antagonists). Along with the progress of the disease, when the dosage of the medicine of a patient reaches the maximum tolerance value but the LVEF is still less than or equal to 35 percent, the medicine is shown in Chinese dilated cardiomyopathy diagnosis and treatment guidelines: CRT implantation and in situ heart transplantation are now the mainstay treatments. Unfortunately, however, despite conclusive evidence, the major hurdles remain in the lack of CRT use and the continued shortage of donor organs. There is an urgent need to find new therapeutic approaches. It is notable that of all cases of DCM, 35% of cases of DCM recognized the gene mutation. This suggests that gene therapy may be a new direction for healing heart disease.

The basic element nucleosome of chromatin is formed by winding DNA and histone, different sites of the histone can play different roles on gene expression after being modified, and H3K27ac is a common active histone modification, which loosens the structure of the DNA and is beneficial to transcription. Recent studies by the applicant have found that the H3K27ac ring anchor structure enriched in DCM shows a strong enrichment for HAND 1. HAND1, an important member of the basic helix-loop-helix transcription factor family, has been shown to be necessary for embryogenesis and postnatal ventricular structure remodeling in mice, and is generally stopped in mature mice if HAND1 is abnormally expressed at this time, instead resulting in DCM.

The research result shows that the HAND1 can be used as a potential therapeutic target of the heart disease. However, no inhibitors of HAND1 were found by screening Selleck chemical library, and the method commonly used in the prior art for inhibiting HAND1 was siRNA-HAND1, but the knockdown effect of siRNA-HAND1 on HAND1 was general. In view of the foregoing, there is currently no report of the use of HAND1 protease inhibitors in the treatment of heart disease and the potential of HAND1 in the treatment of heart disease, it is necessary to develop intensive research into these questions.

Disclosure of Invention

The application aims to provide a HAND1 recombinant protein, a preparation method thereof and application thereof in medicaments for treating dilated cardiomyopathy.

In order to achieve the technical purpose, the application adopts the following technical scheme:

in a first aspect, the present application provides a recombinant protein of HAND1, the amino acid sequence of which is shown in seq_1 or seq_2.

In a second aspect, the present application provides a method for preparing a HAND1 recombinant protein shown in seq_1, comprising:

step 1, selecting a coding nucleic acid sequence of an 18-102aa interval protein fragment in a HAND1 gene, designing a primer to clone the nucleic acid sequence, and constructing a recombinant prokaryotic expression vector;

and 2, transforming the recombinant prokaryotic expression vector obtained in the step 1 into an expression cell for protein expression, and purifying to obtain the HAND1 recombinant protein shown in SEQ_1.

Preferably, the recombinant prokaryotic expression vector is pGEX4T-AB1 or pET-28a-SUMO.

Preferably, the primer pair for the recombinant prokaryotic expression vector pGEX4T-AB1 is: WG-03542D-E-4T-AB1-F shown in SEQ_3, WG-03542D-X-4T-AB1-R shown in SEQ_4; the primer pair for the recombinant prokaryotic expression vector pET-28a-SUMO is as follows: WG-03542D-B-SUMO-F shown in SEQ_5, WG-03542D-H-SUMO-R shown in SEQ_6.

In a third aspect, the present application provides a method for preparing a recombinant protein of HAND1 shown in seq_2, comprising:

step 1, selecting 182-197aa interval protein synthetic polypeptide C-QQHEGFPPALGPVEKR in the HAND1 gene;

and 2, coupling the polypeptide to hemocyanin to obtain the HAND1 recombinant protein shown in SEQ_2.

In a fourth aspect, the present application provides a polyclonal antibody obtained by immunizing an experimental animal with the recombinant protein of HAND1 shown in seq_1 or seq_2 as an antigen.

Preferably, the method for preparing the polyclonal antibody comprises the following steps:

and (3) taking the HAND1 recombinant protein shown in SEQ_1 or SEQ_2 as an antigen to generate an animal immunity induction antibody, and purifying the obtained antibody to obtain the antibody.

Preferably, the process of using the HAND1 recombinant protein as an antigen for animal immunity-induced antibody production comprises: the experimental animals are immunized on the 1 st day, the 12 th day, the 26 th day, the 40 th day and the 54 th day respectively, the immunization dose on the 1 st day is 0.3mg, and the immunization doses on the rest time points are 0.15mg; the immunized animals were bled on day 66.

In a fifth aspect, the present application provides an application of the above-mentioned HAND1 recombinant protein or the above-mentioned polyclonal antibody in preparing a medicament for treating coronary heart disease.

In a sixth aspect, the application provides a medicament for treating heart disease, comprising the recombinant protein of HAND1 or the polyclonal antibody, and a pharmaceutically acceptable carrier.

Compared with the prior art, the application has the following beneficial effects: the application designs and synthesizes the HAND1 recombinant protein by utilizing the characteristic that the overexpression of the HAND1 protein in mature myocardial cells can cause myocardial hypertrophy, and the recombinant protein comprises the following components:

1. can obviously reduce the expression quantity of HAND1mRNA and protein, has obvious inhibition effect and is obviously superior to other siRNA, so the HAND1mRNA and protein can be developed into a micromolecular drug or a research and development reagent for researching the pathology mechanism of the heart disease.

2. Compared with the mode of inhibiting the expression of the HAND1 by the HAND1-siRNA commonly used in the previous experiment, the HAND1 recombinant protein synthesized by the application has more efficient inhibition effect, and avoids the invasion of a lentiviral vector to a subject, thereby making the clinical application of the HAND1 to treat the heart disease possible.

Drawings

FIG. 1 shows the result of the PCR amplification product identification of the gene of HAND1 (18-102 aa) in example 1.

FIG. 2 is a photograph of a PAGE gel after expression of E.coli strain of HAND1 of example 1, the size of the gel is 30KD, wherein 1 indicates that the expression of hat-28 a-SUMO-HAND1 (18-102 aa) is not induced; 2 represents the inducible expression of Pet-28 a-SUMO-band 1 (18-102 aa); 3 represents the Pet-28a-SUMO-HAND1 (18-102 aa) induced expression, in parallel assay; 4 represents Marker. FIG. 3 is a view showing a PAGE gel of a supernatant after the expression of E.coli strain of HAND1 in example 1, wherein the A-chart shows the distribution of HAND1 protein in the supernatant and inclusion bodies, wherein 1 shows 0.4mg/mL BSA,2 shows Marker,3 shows supernatant, 4 shows supernatant 2 (2M urea-solubilized inclusion bodies), 5 shows 2-fold dilution of inclusion bodies (8M urea-solubilized inclusion bodies), and 6 shows 10-fold dilution of inclusion bodies (8M urea-solubilized inclusion bodies); panel B shows the distribution of HAND1 after bead purification, wherein 1 represents supernatant, 2 represents flow-through, 3 represents 2-fold dilution of 250mM imidazole eluting protein, 4 represents 2-fold dilution of 500mM imidazole eluting protein, 5 represents supernatant 2,6 represents flow-through, 7 represents 2-fold dilution of 250mM imidazole eluting protein, 8 represents 2-fold dilution of 500mM imidazole eluting protein, 9 represents 0.4mg/mL BSA, and 10 represents Marker.

FIG. 4 shows the results of the ELISA test for antisera in example 1.

FIG. 5 shows the DB test results of the effect of test antibody WG041054 in example 2 using two rabbit sera (E11750 penta-rabbit serum and E11751 penta-rabbit serum).

FIG. 6 is an in vitro and in vivo experiment result in example 3, wherein, graph A shows intracellular HAND1 expression of three experimental groups, and graph B shows quantification result of graph A; panel C shows representative images of CMs isolated from hearts observed under light and fluorescence microscopy, panel D shows Mann-Whitney U test analysis results, panel E shows the expression of HAND1 after injection of HAND1 inhibitor, and panel F shows Null and HAND1 ^IN Cardiac cell morphology, G plot shows the ratio of heart to body weight of mice and cardiomyocyte size.

FIG. 7 is a diagram showing a pET-28a-SUMO-HAND1 protein PAGE gel for affinity purification in example 2, wherein 1 represents Marker;2 represents 0.4mg/mL BSA;3 represents a 5-fold dilution of the Pet-28 a-SUMO-band 1 protein; 4 represents a 10-fold dilution of the Pet-28 a-SUMO-band 1 protein.

FIG. 8 is a diagram showing the detection of antigen WB or endogenous WB of example 2, wherein each lane is 10ng,5ng,1ng,500pg antigen; the dilution ratio of the antibody is 1:1000; wherein, FIG. 8-1 shows the WB detection result of WG-03542D-E11775; FIG. 8-2 shows the WB detection result of WG-03542D-E11776; FIG. 8-3 shows the WB detection result of WG-03542D-E11777; FIGS. 8-4 show the WB detection result of WG-03542D-E11778.

FIG. 9 is an echocardiogram of a heart-expanded mouse in example 3, wherein Panel A shows the Western blot detecting the protein level of HAND1 of three groups of cells, panel B shows the qRT-PCR detecting the mRNA level of HAND1 of three groups of cells, panel C shows a representative image of CMs isolated from the heart observed under a microscope and fluorescence microscope, panel D shows that WB detects HAND1 protein at HAND1 ^IN And Null heart expression, E-chart represents HAND1 ^IN After treatment, the heart expressed HAND1, with F-chart showing heart morphology and staining results, G-chart showing heart to body weight ratio, and H-chart showing cardiomyocyte size.

FIG. 10 is Null and Hand1 of example 3 ^IN The cardiac function of the mice was echocardiographically, wherein graph a represents representative images of M-type and long axis two-dimensional views, graph B represents left ventricular ejection fraction (LV) Ejection Fraction (EF), graph C represents Fractional Shortening (FS), graph D represents LV end diastole diameter (LVDd), and graph E represents LV end systole diameter (LVDs).

FIG. 11 is the result of knocking down HAND1 using siRNA in example 3.

Detailed Description

In the description of the present application, it is to be noted that the specific conditions are not specified in the examples, and the description is performed under the conventional conditions or the conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The application will now be described in further detail with reference to the drawings and to specific examples, which are given by way of illustration and not limitation.

Example 1

Synthesis of HAND1 recombinant protein shown in SEQ_1 and corresponding antibody preparation

The experimental method for synthesis of the HAND1 recombinant protein is specifically as follows:

(1) Synthesis of HAND1 Gene fragment

The target fragment: the coding nucleic acid sequence of the 18-102aa interval protein fragment in the HAND1 gene is selected by using the HAND1 gene sequence in the NCBI website GenBank database, and a primer is designed by using sanpgene software and synthesized at Ji Ma company.

1) The primer sequences were as follows:

WG-03542D-E-4T-AB1-F：SEQ_3

5’-CCGCGTGGATCCCCGGAATTCGAgAACCTaTAcTTcCAAGGaCCTGCGCACCCCATGCTCCACGAAC-3’

WG-03542D-X-4T-AB1-R：SEQ_4

5’-ATGATGCGGCCGCTCGAGCTTCTTGGGTCCTGAGCCTTTCCGTTACTTCTTGGGTCCTGA-3’

WG-03542D-B-SUMO-F：SEQ_5

5’-GAACAGATTGGTGGATCCCCTGCGCACCCCATGCTCCACGAAC-3’

WG-03542D-H-SUMO-R：SEQ_6

5’-TGCGGCCGCAAGCTTTTACTTCTTGGGTCCTGA-3’

2) Dilution of primers:

the primers were diluted to 10uM with double distilled water, covered with a tube cap, shaken up and down for 30 seconds and centrifuged for 30 seconds.

3) Amplification reaction system:

the following ingredients were added to a 0.2ml centrifuge tube, see table 1:

TABLE 1 reverse transcription reagent components and amounts thereof

Reaction conditions: the first step: 94℃for 4min. And a second step of: 94 ℃ for 40s;67℃for 40s.35 cycles.

After the reaction, 2ul of the PCR product was subjected to 1% agarose gel electrophoresis, and 6ul of DNA Marker (DL 2000) was used as a control.

4) Enzyme cutting of a target product:

the following ingredients were added to a 1.5mL centrifuge tube, see Table 2:

TABLE 2 cleavage reagent Components and amounts of the target product

Shaking, mixing, and centrifuging briefly.

Vector cleavage (vector in use middle drawer plasmid kit, radicle (DP 108)), see table 3:

TABLE 3 vector cleavage reagent Components and amounts

The vector plasmid is pGEX4T-AB1 or pET-28a-SUMO.

Shaking, mixing, and centrifuging briefly.

Connecting at 16 ℃ overnight; inactivating at 65deg.C for 10min.

5) Conversion: 100mL of E.coli competent cells (Rosetta) (manufacturer: chengdu Kang Borui) were transformed in two tubes, and the specific procedure was followed according to the competent transformation instructions.

6) Selecting bacteria to identify positive clones: three single clones were selected for each plate, and cultured in a test tube containing 2mL of LB medium, 150rpm overnight or in a test tube containing 1mL of LB medium, 180rpm for 4 to 5 hours, respectively, and PCR identification was performed (Nuo Wei 2X Rapid Taq Master Mix, P222-01) as follows:

the following ingredients were added to a 0.2ml centrifuge tube, see table 4:

TABLE 4 PCR reagent compositions and amounts

Reaction conditions: the first step: 94℃for 4min.

And a second step of: 94 ℃ for 40s;67℃for 40s.35 cycles.

After the reaction, 2ul of the PCR product was subjected to 1% agarose gel electrophoresis, and 6ul of DNA Marker (DL 2000) was used as a control. After electrophoresis for 20min under a constant pressure of 120V, whether the target band is contained or not was observed under a gel imaging system, and the result is shown in FIG. 1. One positive clone (200 ul) was selected for sequencing.

Analysis of results: panel A in FIG. 1 shows that the size of the HAND1 (18-102 aa) PCR product was correctly identified by electrophoresis, successfully cloned into the pET-28a-SUMO vector, and sequenced to identify correct, and transferred to expression. Panel B in FIG. 1 shows that the correct size was identified by electrophoresis of the HAND1 (18-102 aa) PCR product, successfully cloned into pGEX-4T-AB1 vector and sequenced to identify correct, and transferred to expression.

(2) Antigen protein preparation

Small amount of protein expression (pET-28 a-SUMO as vector):

1) Competent cell suspensions (Rosetta) carrying the recombinant plasmid pET-28a-SUMO were removed from the-80℃freezer and immediately thawed on ice. 50ul of competent cells was added to 2ul of plasmid DNA solution and gently shaken well and left on ice for 30min.

2) The mixture was heat-shocked in a water bath at 42℃for 60s, and after heat-shocking, the mixture was rapidly cooled on ice for 5min.

3) The bacterial liquid is evenly shaken, taken out, coated on a solid culture medium (containing kanamycin) by using a burned triangular glass rod, and cultured in a culture box at 37 ℃.

4) 1 single colony of the transformed flat plate is selected in a small test tube (2 mL of LB culture medium containing kanamycin) filled with a culture medium, the culture is carried out for 3 to 4 hours, 1mL of bacterial liquid is taken out in a sterilized centrifuge tube for bacterial preservation, and the remaining 1mL of bacterial liquid is added with IPTG (final concentration is 0.8M) for induction expression.

5) After induction for 2 hours, the culture was centrifuged at 12000 rpm for 2 minutes, and the supernatant was discarded.

6) The pellet was suspended in 100ul of 1 XPBS, 50ul of 3 XPDS, and heated at 95℃for 30min before SDS-PAGE.

7) The running gel identification result is shown in fig. 2, 3 groups of samples are adopted in fig. 2, wherein the sample with the serial number of 1 is not subjected to IPTG induction expression, and the samples with the serial numbers of 2 and 3 are parallel experimental samples, so that the target protein is expressed, and the size is about 30KD.

High protein expression:

taking out sterilized 300LB culture medium, adding kanamycin antibiotic, adding small amount of expressed bacterial liquid into LB culture medium, measuring OD value at 37 deg.C for 3-4 hr, and adding IPTG for induction (final concentration of 0.8M) for 3-4 hr when OD value reaches 0.5-0.6.

The bacterial liquid is poured into a centrifugal bottle for centrifugation (3900 r/min 10 min), and the supernatant is discarded.

(3) Bacteria breaking

1) 50ml of 1 XPBS was used to suspend the cells. 50 μl mercaptoethanol was added.

2) Proper amplitude transformer is selected, the power is 400W, the bacteria breaking time is 3S, the interval time is 3S, the total time is 10min, and the bacteria breaking is carried out by ultrasonic (bacteria liquid is placed in ice cubes). Centrifuging (9000 rpm) for 10min to obtain supernatant (1) and precipitate, and placing the supernatant (1) into a 50ml centrifuge tube, and temporarily storing at 4deg.C.

3) Washing the precipitate with deionized water for 2 times, centrifuging to remove supernatant, suspending with 8M urea, selecting proper amplitude transformer again, sterilizing at 400W for 3S at a time interval of 3S for 5min, centrifuging (9000 rpm) for 10min to obtain supernatant (2) and inclusion body, loading supernatant (1) into 50ml centrifuge tube, and temporarily storing at 4deg.C.

4) The pellet was carefully washed with deionized water for 2 passes including the vessel wall, inclusion bodies were added with 6ml ddH ₂ O, after suspension, the mixture was split into 4 tubes, centrifuged (12000 rpm) for 2min, and the supernatant was discarded. One of the tubes was selected, 1.5ml of 8M urea was added, and the supernatant was dissolved, centrifuged (12000 rpm) for 1min and transferred to a new 2ml centrifuge tube.

5) Supernatant (1), supernatant (2) and inclusion body protein were subjected to 2-fold dilution and 10-fold dilution electrophoresis, and the results were shown in FIG. 3, and the protein expression position was determined after staining and decolorization, and the purified protein was stored at-20deg.C.

6) The experimental results show that: pET-28a-SUMO-HAND1 (18-102 aa) is expressed in the supernatant, the supernatant is purified by magnetic beads, and then the protein is eluted by eluent to obtain the protein with the concentration of 1.6mg/ml, the purity meets the immunization requirement, and the immunization is transferred.

The amino acid sequence of the HAND1 recombinant protein obtained in the embodiment is shown in SEQ_1 after sequencing.

The HAND1 recombinant protein is subjected to antibody preparation, and the specific steps are as follows:

the obtained HAND1 recombinant protein is used as an antigen to generate animal immunity induction antibodies, and specifically comprises the following steps: tail vein injection of HAND1 recombinant protein into mice (C57 BL/6 mice, 6-8 week male mice, purchased from velocin) was performed on day 1, day 12, day 26, day 40, and day 54, and experimental animals were immunized with 0.3mg on day 1, and 0.15mg on the remaining time points; the immunized animals were bled on day 66. And purifying the obtained antibody to obtain the HAND1 protein antibody, and performing anti-serum ELISA detection, wherein the result is shown in figure 4 (parallel samples of 4C 57BL/6 mice of E11775, E11776, E11777 and E11778 in figure 4), which shows that the antibody preparation is successful.

Example 2

Synthesis of HAND1 recombinant protein shown in SEQ_2 and corresponding antibody preparation

The experimental method for synthesis of the HAND1 recombinant protein shown in SEQ_2 is specifically as follows:

(1) Immunogen preparation

1) KLH was added to sterilized 1 XPBS and spun on a rotator until KLH was sufficiently dissolved at a final concentration of 3mg/ml and mixed well.

2) And adding a proper volume of SMCC according to the mass of KLH, and rotating and uniformly mixing at room temperature for 1h.

3) And (3) dialysis: dialysis was performed in 1 XPBS PH=8.0 (300 ml) for 1h.

4) Selecting 182-197aa interval protein in HAND1 gene to synthesize polypeptide C-QQHEGFPPALGPVEKR, weighing a certain mass of naked peptide, dissolving with 100ul 1 XPBS, detecting whether sulfhydryl is opened or not by DNTB after complete dissolution, adding polypeptide solution into activated KLH for a plurality of times after detecting opening, placing into a rotator for stirring, and rotating at room temperature for 4h or overnight at 4 ℃ after complete addition to obtain HAND1 antigen polypeptide (WG-04154).

The preparation process of the antibody specifically comprises the following steps:

(1) Antiserum/antibody preparation and DB detection

1) Preparation of the film: the Dot blot detection uses NC film, and the NC film is drawn into a strip of 1cm×6 cm.

2) Antigen dilution: the antigen polypeptide was diluted to a final concentration of 50 ng/. Mu.L using 1 XPBS as the diluent.

3) Antigen coating: the blue protective paper on the film is uncovered, and a 2.5 mu L pipettor is used for taking 2 mu L of corresponding polypeptide diluent with the concentration of 50 ng/mu L per square by using a reverse pipetting mode, and the solution is spotted on the center of a square cell with the concentration of 1cm multiplied by 1cm on the film (white), namely the coating quantity of the polypeptide is 100ng. After spotting was completed, NC film and blue protective paper under the film were put together into an oven at 37 ℃ for incubation for 30min.

4) Closing: and (3) using TBST as a buffer system to prepare skimmed milk with a mass-volume ratio of 3%, namely a sealing liquid and a primary anti-dilution liquid. Adding the prepared sealing liquid into small squares matched with the NC film, and sealing for 1h at room temperature.

5) Incubation resistance: the primary anti-dilution is prepared after the closing operation is completed. Primary antibodies were subjected to gradient dilution (1:1000, 1:5000,1:10000,1:50000,1:100000, 1:200000) with blocking solution. After the completion of the blocking, the blocking solution was poured out and the corresponding primary anti-dilution was added to each well and incubated at room temperature for 1h or overnight at 4 ℃.

6) Secondary antibody incubation: after the incubation of the primary antibody is completed, the primary antibody is poured into a waste liquid cylinder, and TBST 2mL of washing film is added into each hole for 5min each time. The washing of the membrane was repeated 5 times. After the membrane washing is completed, the secondary antibody which is from the same species source as the primary antibody is diluted into a secondary antibody working solution in a ratio of 1:8000 by using TBST, and the secondary antibody working solution is added into each hole and incubated for 1h at room temperature.

7) Exposure: after the secondary antibody is incubated, TBST is used for washing the membrane for 5 times multiplied by 2 minutes, and ECL developer is added for exposure after the membrane is washed.

Serum DB test results (as shown in FIGS. 5 and 6) showed that the utility of antibody WG041054 was tested with two kinds of rabbit (purchased from Beijing Vetong Lihua) serum (E11750 pentarabbit serum and E11751 pentarabbit serum), and antibody WG04154 was able to react with antigen-antibody with rabbit serum of different concentrations (1:1000, 1:5000,1:10000,1:50000,1:100000, 1:500000), wherein the amount of serum protein input was 3ug and the concentration of antibody mother liquor was 1ug/ul, indicating that the antibody preparation was successful.

(2) And (3) purifying antisera:

1) Protein detection for affinity purification

The protein before purification was subjected to band identification, and the results are shown in FIG. 7, which show that: for affinity purification

The concentration of pET-28a-SUMO-HAND1 protein is 1mg/ml, and the concentration and purity of the pET-28a-SUMO-HAND1 protein are not greatly different from those of the pET-28a-SUMO-HAND1 protein after purification of the bacteria, so that antigen affinity purification can be carried out.

2) The appropriate volume was taken according to the protein concentration, the total content was about 4mg, and dissolved with 2ml of coupling Buffer.

3) 2ml Sulfolink couping gel is placed in a chromatographic column, and the antigen is added to the column and spun on a spin incubator for 2-3 hours.

4) The chromatographic column is kept stand on the chromatographic rack for 30 minutes and is connected with a constant flow pump.

5) Balance. 40ml 1 x PBS flow rate 2.0, 30ml 1 x Gly, 30ml 1 x PBS column internal environment balance to neutral.

6) And (5) loading. Adding 1/20M sodium chloride with flow rate of 1.3-1.6 into the sample, washing the column twice, and adding 40ml Wash buffer

7) And (5) collecting samples. 1 XGly flow rate 0.5-0.7 was added and 8 tubes were collected, 2ml per tube and 16ml total.

8) After collection, the antibody was eluted clean with excess acid and equilibrated to neutrality with 1 XPBS.

9) Dialyzing the collected antibody in a dialysis bag for 2 days, concentrating to a certain volume, adding 50% glycerol, mixing, measuring concentration, and preserving at-20deg.C.

(3) Antigen WB detection

1) Sample preparation: antigen proteins were diluted to a final concentration of 1mg/ml in PBS and diluted 4 gradients in loading buffer: 10ng,5ng,1ng,500 pg.

2) And (5) preparing glue. The concentration of the separation gel of 10% is prepared according to the molecular weight of the antigen protein, a small vertical electrophoresis tank, a 1mm glass plate is used, 4.5ml of the separation gel is filled, isopropanol sealing gel is added, after about 30min, the separation gel is solidified, isopropanol is removed, 1ml (5%) of concentrated gel is filled, and a comb is inserted. After 1-2 h of solidification, loading (4 gradient loading amounts).

3) Electrophoresis: and (3) adopting a constant pressure mode for electrophoresis, concentrating gel 80v, entering a separation gel after about 25min, adjusting to 120v, and stopping electrophoresis when bromophenol blue runs to the bottom of the separation gel. As a result, as shown in FIG. 8, E11775 to E11778 correspond to 4 samples in example 1.

4) And (5) transferring films. After fixing the gel using NC film, a constant current (maximum voltage, 300mA current) was used for transfer in an ice water bath. The current and the transfer time are determined according to the molecular weight of the target protein.

5) Immune response. Closing: after successful transfer, clear marker bands should be observed on the membrane, which was placed in 5% skim milk/TBST, at room temperature, and shaking for 45min. An antibody: primary antibody was diluted with blocking solution, 1: and (5) diluting by 1000. After removing the blocking solution, a primary anti-dilution solution was added, and the mixture was shaken for 1h (or 4 ℃ overnight) at room temperature. And (2) secondary antibody: after the incubation of the primary antibody, the membrane was washed with TBST for 4 times, each for 5min. The secondary antibody was diluted with TBST at a dilution ratio of 1:5000. and (3) shaking table for 30min at room temperature. After the secondary antibody is finished, PBST is washed for 5min multiplied by 4 times.

6) And (5) exposing. And adding ECL developer, and exposing.

Example 3

Experiment of HAND1 recombinant protein against mice model of heart disease

hiPSC-CM cell culture

Human pluripotent stem cells (hPSCs) were seeded in E8+ROCKi (Y-27632, tocres # 1254) at 160-175,000 cells/24 wells for 24 hours. Cells were then induced for 36h-40h with CDM medium (Menjan et al, 2014) containing FGF2 (30 ng/ml, university of Cambridge), LY294002 (5. Mu.M, tocris, # 1130), activin A (50 ng/ml, university of Cambridge), BMP4 (10 ng/ml, R & D Systems RD-314-BP-050) and CHIR99021 (5-6. Mu.M), R & D Systems RD-4423/50). Insulin (rogowski, # 11376497001) was optionally added at this stage at 1 μg/ml to increase cell viability. This medium is called FLyABCH (Ins). After 36h-40h, medium was replaced daily with CDM medium containing BMP4 (10 ng/ml), FGF2 (8 ng/ml), insulin (10. Mu.g/ml), IWP2 (5. Mu.M, tocris, # 3533) (alternatively with IWR-1 (1. Mu.M, # 3532/10) or XAVS-939 (5. Mu.M, # S1180) and retinoic acid (0.5. Mu.M, sigma Aldrich, # R2625) for 4 days, this medium was termed BFII WPRa. Then, medium was changed to medium containing BMP4 (10 ng/ml), FGF2 (8 ng/ml) and insulin (10. Mu.g/ml), for 2 days, this medium was termed BFI. To maintain the obtained CMs, medium was replaced daily with CDM medium containing insulin (10. Mu.g/ml), medium was termed CDM-I medium was replaced daily, and medium was termed as a medium for half of CDM-I, and after the establishment of a medium was termed "CDM-I" Cm ". Was used" and was transferred to a 35% of a well plate (35% of 35 days, 35 g/ml) was removed by shaking plates (35 g/ml) and shaking plates (35% of 35.35.35 days after 37.g/ml) were removed for analysis of the medium, and well plates were removed for 2 days.

2. Acute isolation of individual ventricular muscles in mice

Injecting heparin 2500U into the abdominal cavity of a rat, injecting 45mg/kg of pentobarbital sodium into the abdominal cavity after 0.5h, opening the chest cavity quickly, taking the heart of the rat, placing the heart into dry precooled calcium-free Tai's liquid, fixing the heart of the rat into a dry Langerdorff perfusion system, and carrying out retrograde perfusion on the calcium-free Tai's liquid containing 30mmo/L ethylene glycol bis (2-aminoethyl ether) tetraacetic acid (EGTA) for 5min (8 ml/min) through an aorta; then, the above enzyme-containing liquid was washed by repeatedly and circularly perfusing 30ml of a calcium-free Table-type liquid containing 12mg of collagenase II for 20 minutes until the heart was soft, and washing the heart with the calcium-free Table-type liquid for 5 minutes. Cutting left ventricle, cutting into pieces in 10ml KB, vibrating for 10min, filtering cells with nylon net, standing at room temperature for 1h, dividing three-stage calcium recovery to reach final concentration of 18mmolL, and storing the cells in normal calcium Tai's solution, continuously administering 100% oxygen to the perfusion solution in the experimental process, and keeping the temperature of the perfusion solution at (36+/-1) °c. Both KB and Taishi solutions were prepared in the laboratory.

HAND1 knockout cell line

HAND1 and NKX2.5 were knocked out in H9 cells using CRISPR/Cas 9. Target sgrnas were determined using the sanger institute genome editing (WGE) website and Benchling sgRNA design tool. (HAND 1-sgRNA 1: GAGCATTAACAGCGCATTCG; NKX2.5-sgRNA 1: GACGCACACTTGGCCGGTGA; NKX2.5-sgRNA 2: ACTTGGCCGGTGAAGGCGCG). sgRNA was cloned into pSpCas9 (BB) -2A-Puro (PX 459) V2.0 (Feng Zhang Lab; addge plasma #62988; http:// Addge. Org/62988;

RRID Addgene_ 62988) according to the Zhang Lab general cloning protocol (Ran et al, 2013) cell transfection was performed using the P3 primary cell 4D-nuclear stain X kit S (Lonza-BioResearch, cat#: V4 XP-3032) and Amaxa 4D-nuclear stain (Lonza-BioResearch). Following nuclear infection, cells were cultured in E8 supplemented with 10. Mu. M Y-27632 (Cat # 72302) for 24 hours. After this, cells were selected with puromycin (concentration 0.2 ng/. Mu.L; (Sigma-Aldrich, cat#P8833)) for 48 hours after this treatment, cell culture medium was changed back to E8, supplemented with 10. Mu.M Y-27632 (Cat# 72302) to promote regrowth once the cells had formed colonies, they were picked out and transferred to 96w plates (Corning, cat#CLS3370.) first pool-level evaluations were performed for successful edits, then, two independent genotyping were performed on individual colonies to confirm successful knockouts.

5. Construction of mice model for heart disease

The animals used in this study were reared mice at the university of washington, medical college (other species of mice can be used for the construction of the model of heart disease mice as well, the application uses nearby materials), and all experimental procedures were performed according to guidelines of the european meeting on the instruction 2010/63/EU for protecting scientific animals. The mouse strain used was Tnnt2 ^{Delta type K210} . The construction method comprises the following steps: the mice were thoracotomy layer by layer exposing the aortic arch, the innominate artery, and the bifurcation of the left common carotid artery. Aortic arch was cannulated with a self-made L-shaped 26G padding using a 5-0 silk braid wire that passed through the bifurcation between the innominate artery and the left common carotid artery. After knotting, the pad needle is withdrawn gently, the extra wire head beside the knot is cut off, the aortic arch constriction operation is completed, and then the chest is closed to induce the expansionAnd (5) a heart disease model.

6. In vitro experiments

The iPSC-CM cells were divided into three groups, the first group of HAND1 inhibitor (the antibodies prepared from the recombinant protein obtained in example 1 were the HAND1 inhibitors of this experiment), i.e., the HAND1 inhibitors were added to the iPSC-CM cells; the second group is a blank group, i.e., PBS was added to the iPSC-CM cells; the third group is the HAND1 knockout (HAND 1 KO) hPSC cell line. Three groups of intracellular HAND1 expression were examined by WB and qPCR and immunofluorescence (see FIG. 9, A, B), which showed that both the HAND1 inhibitor group and the HAND1 KO group were able to down-regulate HAND1 expression. The iPSC-CM cells are then divided into two groups, the first group being the siRNA group, i.e., the HAND1-siRNA is transferred into the iPSC-CM cells using RNA imax transfection reagent; the second group was a band 1 inhibitor group (recombinant protein obtained in example 1), i.e., the band 1 inhibitor was added to iPSC-CM cells, and the effect of knocking down band 1 was compared with that of the two groups (see fig. 11), and the protein inhibition efficiency of the band 1 inhibitor group was significantly reduced, and P < 0.05, compared with the siRNA method. Experiments were repeated 3 times. Cell volume changes were observed.

7. In vivo experiments

Two groups of mice were set. A first group of heart disease-expanding mice model, and a second group of heart disease-expanding mice infused with a 18-102aa targeted HAND1 inhibitor. The same number of male and female mice was included in all experiments, 6 per group.

The heart-dilating mice are the bifurcation parts of the aortic arch, the innominate artery and the left common carotid artery exposed by opening the chest of the mice layer by layer. Aortic arch was cannulated with a self-made L-shaped 26G padding using a 5-0 silk braid wire that passed through the bifurcation between the innominate artery and the left common carotid artery. After knotting, the pad needle is withdrawn gently, the extra wire head beside the knot is cut off, the aortic arch constriction operation is completed, and then the chest is closed to induce the heart disease expanding model.

The experimental process is specifically as follows: the expanded heart disease was treated by dissolving 1mg of the HAND1 protease inhibitor in 10ml of PBS, administering intraperitoneally injected physiological saline (equal volume to the experimental group) to a first group of mice daily, and administering intraperitoneally injected HAND1 protease inhibitor (1 mg/kg) to a second group of Tnnt2 delta type K210 mice, starting from 6 weeks of age. B ultrasonic detection of heart volume change of mouse, P < 0.05. Experimental repeat3 times (2 mice. Times.3 mode). Mice that received an injection of the HAND1 protease inhibitor were designated HAND1 ^IN Mice receiving saline injection were designated as Null. A representative image of CMs isolated from the heart was observed under a microscope (see FIG. 9C), HAND1 ^IN The cardiomyocyte length of (a) becomes shorter. WB detection of the HAND1 protein in HAND1 ^IN And Null heart expression. Data were analyzed by Mann-Whitney U test to see HAND1 ^IN The protein level of group had 1 decreased (see fig. 9D). FIG. 9E is HAND1 ^IN After treatment, the heart expressed HAND1, and it was seen that the mRNA level of HAND1 was decreased. FIG. 9F is a schematic representation of heart morphology (first row), masson trichromatism staining of the general morphology (second row), masson trichromatism staining of cardiomyocytes (third row) and pair Null and Hand1 ^IN Staining of Wheat Germ Agglutinin (WGA) of cardiac cells (fourth row). As a result, HAND1 was found ^IN The volume of the heart after treatment is reduced and the degree of fibrosis is reduced. FIG. 9G is a ratio of heart to body weight (upper panel), HAND1 ^IN The heart decreased compared to body weight after treatment.

FIG. 10 is a view of the pair Null and Hand1 by echocardiography ^IN The heart function of the mice was analyzed. Representative image (10. A) of M-type and long axis two-dimensional views. Left ventricular ejection fraction (LV) Ejection Fraction (EF) (10. B), fractional Shortening (FS) (10. C), LV end diastole diameter (LVDd) (10. D) and LV end systole diameter (LVDs) (10. E). The data analysis was performed using the Mann-Whitney U test. After the use of the HAND1 inhibitor, both the left ventricular ejection fraction and the shortening fraction of the mouse heart improved, and the LV end diastole diameter and the LV end systole diameter of the heart shortened, indicating improved new function.

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims.

Claims

1. A recombinant protein of HAND1, characterized in that: the amino acid sequence of the polypeptide is shown as SEQ_1 or SEQ_2.

The preparation method of the HAND1 recombinant protein shown in SEQ_1 is characterized by comprising the following steps: comprising the following steps:

step 1, selecting a coding nucleic acid sequence of an 18-102aa interval protein fragment in a HAND1 gene, designing a primer to clone the protein fragment, and constructing a recombinant prokaryotic expression vector;

and 2, transforming the recombinant prokaryotic expression vector obtained in the step 1 into an expression cell for protein expression, and purifying to obtain the HAND1 recombinant protein.

3. The method for producing a HAND1 recombinant protein according to claim 2, wherein: the recombinant prokaryotic expression vector is pGEX4T-AB1 or pET-28a-SUMO.

4. A method of preparing a HAND1 recombinant protein according to claim 3, wherein: the primer pair for the recombinant prokaryotic expression vector pGEX4T-AB1 is as follows: WG-03542D-E-4T-AB1-F shown in SEQ_3, WG-03542D-X-4T-AB1-R shown in SEQ_4; the primer pair for the recombinant prokaryotic expression vector pET-28a-SUMO is as follows: WG-03542D-B-SUMO-F shown in SEQ_5, WG-03542D-H-SUMO-R shown in SEQ_6.

The preparation method of the HAND1 recombinant protein shown in SEQ_2 is characterized by comprising the following steps: comprising the following steps:

6. A polyclonal antibody, characterized in that: the antibody is obtained by immunizing experimental animals with the HAND1 recombinant protein shown in SEQ_1 or SEQ_2 as an antigen.

7. The polyclonal antibody of claim 6, wherein: the preparation method comprises the following steps:

8. The polyclonal antibody of claim 7, wherein: the process of using the HAND1 recombinant protein as an antigen for animal immunity induction antibody production comprises the following steps: the experimental animals are immunized on the 1 st day, the 12 th day, the 26 th day, the 40 th day and the 54 th day respectively, the immunization dose on the 1 st day is 0.3mg, and the immunization doses on the rest time points are 0.15mg; the immunized animals were bled on day 66.

9. Use of a recombinant protein of hat 1 according to claim 1 or a polyclonal antibody according to any one of claims 6 to 8 in the manufacture of a medicament for the treatment of heart disease.

10.A medicine for treating coronary heart disease, which is characterized in that: comprising the HAND1 recombinant protein of claim 1 or the polyclonal antibody of any one of claims 6 to 8, and a pharmaceutically acceptable carrier.