CN116849097A

CN116849097A - Flue-cured tobacco variety and fertilizer application method beneficial to growth of flue-cured tobacco and microorganism in rhizosphere soil

Info

Publication number: CN116849097A
Application number: CN202310893013.5A
Authority: CN
Inventors: 周桂夙; 李峰; 唐潇; 曹宇星; 王海英; 刘彦中; 熊茜; 林云红
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2023-07-20
Filing date: 2023-07-20
Publication date: 2023-10-10

Abstract

The invention belongs to the technical field of flue-cured tobacco planting, and discloses a flue-cured tobacco variety and fertilizer allocation method which is beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganisms, and a test site and time are determined; determining the property of the biomass charcoal and the microbial fertilizer to be tested; selecting flue-cured tobacco K326 and safflower Dajinyuan as test varieties, and carrying out split area test design; collecting samples, and respectively carrying out nutrient determination, flue-cured tobacco agronomic trait determination, enzyme activity determination, bacterial wilt disease determination, solanaceae Ralstonia fluorescent quantitative qPCR and rhizosphere soil microorganism determination; the experimental data statistics were statistically analyzed using SPSS26.0 and plotted using Origin 2022. Experimental results show that for two varieties of K326 and safflower Dajinyuan, under SF treatment, the agronomic characters, the physical and chemical properties of the tobacco plants, the nutrient content of the plants, the soil enzyme activity and the plant enzyme activity of the tobacco plants are improved, the soil microbial environment is improved, and the tobacco plants are suitable for overall growth.

Description

Flue-cured tobacco variety and fertilizer application method beneficial to growth of flue-cured tobacco and microorganism in rhizosphere soil

Technical Field

The invention belongs to the technical field of flue-cured tobacco planting, and particularly relates to a flue-cured tobacco variety and fertilizer allocation method which are beneficial to growth of flue-cured tobacco and rhizosphere soil microorganisms.

Background

At present, the biological fertilizer is a fertilizer which is rich in a large amount of beneficial bacteria, improves soil quality and increases soil nutrition by utilizing the biological function of the beneficial bacteria in the soil, thereby improving the growth of crops, and comprises bacterial fertilizer and microbial agent. Wherein, the bacterial fertilizer comprises a compound microorganism fertilizer and a biological organic fertilizer. The compound microbial fertilizer is a novel fertilizer, and the action mechanism is to combine organic and inorganic nutrients with specific functional bacteria. The bio-organic fertilizer is a bio-fertilizer, and various beneficial microorganisms are combined with fully decomposed and fermented organic fertilizer. The compound microbial fertilizer is a novel fertilizer combining specific functional bacteria with inorganic and organic nutritional ingredients, has the advantages of comprehensive nutritional ingredients, high organic matter content and microorganisms, and also has the long-acting effect of the organic fertilizer, the quick acting effect of the inorganic fertilizer and the synergistic effect of the microorganisms; the compound microbial fertilizer can not only generate more favorable microbial growth conditions, but also improve the chemical fertilizer efficiency by 1.5-5 times.

Biomass char (Biochar) is a solid material that carbonizes highly aromatic refractory materials by oxygen pyrolysis produced by biomass in whole or in part, has high thermal stability and adsorption properties, and has the advantage of no environmental pollution. According to the prior data review, the biomass charcoal can improve the soil environment, improve the soil microbial environment, improve the soil fertility, improve the utilization rate of fertilizer and is environment-friendly. Meanwhile, the improvement of the biomass charcoal on the soil and the incidence of tobacco bacterial wilt show a certain correlation. At present, in tobacco planting production, the biomass charcoal has a certain research and application in the aspects of restoring tobacco planting soil and promoting the growth of flue-cured tobacco, not only enhances the resistance of tobacco, but also accords with the development direction of environmental protection and tobacco production.

Tobacco is an important tax pillar in Yunnan province and even in the whole country, and is necessary for stable yield and increase in yield. Tobacco bacterial wilt is a worldwide epidemic soil-borne disease, frequently occurs in tobacco growth, and is a large destructive disease threatening the world tobacco production, and the infection of the pathogen has diversity and composivity. In the south China, serious losses are caused all the year round, the disease occurrence trend is gradually expanded in recent years, and the damage of the Yunnan tobacco region is serious. Therefore, the onset condition of the bacterial wilt of the tobacco in Yunnan is known, and the soil is improved by researching the related relation between biomass charcoal and the bacterial wilt, so that the economic loss caused by the bacterial wilt is reduced, the production favorable condition of high-quality tobacco is created, the improvement of the quality of the tobacco is realized, a new direction for guiding prediction and comprehensive prevention and control of the disease can be explored, and a certain theoretical basis is provided for reasonable fertilization in a tobacco region.

In order to reduce the serious loss caused by tobacco bacterial wilt, the main prevention measures at present are disease resistance research, chemical prevention, biological prevention and control and agricultural prevention and control, and disease resistance breeding, biological agent application and the like have become one of the most important measures. However, the tobacco diseases are various, the disease time is long, and the pathogens are complex and various, so that the prevention and control effects are difficult to control. Among them, disease-resistant breeding is a relatively economical and feasible preventive measure, emphasizing that effective preventive effect is achieved by combining molecular biology, introducing disease-resistant genes into hosts, breeding disease-resistant varieties, utilizing interaction of plants and pathogenic bacteria, and the like. However, the disease resistance of the currently selected disease-resistant varieties is not very good, most of the chemical control drugs produced at present are used for delaying the peak period of plant diseases and insect pests, reducing the occurrence of plant diseases and insect pests, no effective drugs are used for preventing the occurrence of tobacco wilt, and the use of chemical preparations is easy to pollute the environment and generate harmful substances; biological control is mainly realized by antagonizing bacterial wilt such as bacillus, XC4 strain and the like, and by reducing the total number of pathogenic bacteria, the diversity of beneficial bacteria is increased or autoimmune response bacterial wilt of plants is induced, but antagonizing bacteria have the defects of low field planting rate, high cost, difficult protection and the like. The focus of agricultural control is to strengthen field management and prevention work, such as proper rotation, timely removal of disease plant residues and standardization of agricultural production tools, and is an environment-friendly agricultural preventive technology. For bacterial wilt, especially the problem of comprehensive prevention and control of tobacco leaf bacterial wilt, the need of exploring an economic, efficient and environment-friendly overall comprehensive safety prevention and control path is urgent, the prevention and control strategy in the aspect of agricultural technology should emphasize that the prevention measures are first, overall comprehensive safety prevention and control, and focus on applying the prevention measures of the agricultural cultivation method, and through selecting proper drugs to control disease transmission, the economic loss caused by the bacterial wilt is reduced as much as possible.

With the discovery of the Brazilian Amazon river basin "black soil" (Terra Preta), biomass char has been the focus of attention focusing on biomass char. In recent years, excessive use of fertilizers and improper utilization of fertilizers lead to soil fertility degradation and ecological environment pollution of soil in farmlands, and also the ecological environment is gradually lowered due to unreasonable application of various fertilizers and pesticides, so that a part of fertilizers for developing biological fertilizers are increasingly spotlighted. Therefore, biomass charcoal and biofertilizer are the key points of current research, and many researches on biomass charcoal and biofertilizer are performed at present, but few aspects of combined application of biomass charcoal and biofertilizer are included. Meanwhile, the tobacco varieties planted at present have a plurality of different tobacco varieties, and the growth conditions and disease resistance of the different tobacco varieties are different.

Through the above analysis, the problems and defects existing in the prior art are as follows: long-term agronomic operation and human intervention lead to the reduction of tobacco planting soil quality in the current flue-cured tobacco production practice, the reduction of the utilization efficiency of tobacco plants to nutrients, the improvement of field disease prevention effect, the continuous investment of tobacco growers production cost and the reduction of production benefit increase. Therefore, in the current production practice, how to improve the utilization rate of the tobacco plants to the fertilizer, enhance the resistance of the tobacco plants to diseases, reduce the investment of production cost, increase the income of tobacco growers and stabilize the confidence of tobacco planting of the tobacco growers is a problem to be solved in the current production. The biomass charcoal and the biological fertilizer adopted in the project have the advantages of improving the quality of tobacco planting soil and being environment-friendly.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention provides a flue-cured tobacco variety and fertilizer allocation method which are beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganisms.

The invention is realized in this way, a flue-cured tobacco variety and fertilizer distributing method which is beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganism, comprising: determining the test site and time, wherein the soil to be tested is red soil; determining the charcoal to be tested, the compound microbial fertilizer and the bacillus amyloliquefaciens; selecting flue-cured tobacco K326 and safflower Dajinyuan as test varieties, and carrying out split area test design; collecting samples, and respectively carrying out nutrient determination, flue-cured tobacco agronomic trait determination, enzyme activity determination, bacterial wilt disease determination, solanaceae Ralstonia fluorescent quantitative qPCR and rhizosphere soil microorganism determination; the experimental data statistics were statistically analyzed using SPSS 26.0 and plotted using Origin 2022.

Further, the flue-cured tobacco variety and fertilizer application method which is beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganisms comprises the following steps:

step one, determining the properties of the biomass charcoal to be tested and the microbial fertilizer;

step two, determining a test variety and carrying out split area test design;

Step three, sample collection and measurement are carried out;

and step four, carrying out data statistics and analysis.

Further, the determination of the properties of the tested biomass charcoal and the microbial fertilizer in the first step comprises the following steps:

biochar pH 9.32, organic carbon 169.94g/kg, N10.42 g/kg, P1.93 g/kg, K33.2g/kg, C/N16.4; the effective viable count of beneficial bacteria of the composite microbial fertilizer is more than or equal to 2 multiplied by 10 ⁷ cfu/g, total nutrient N+P ₂ O ₅ +K ₂ O is more than or equal to 8 percent, and the effective organic matters are more than or equal to 60 percent; bacillus amyloliquefaciens 2×10 ¹⁰ cfu/g。

Further, the tested varieties in the second step are flue-cured tobacco K326 and safflower Dajinyuan.

Adopting a split area test design, wherein the main factor is variety K326 and safflower Dajinyuan; the auxiliary factors are fertilizer allocation, namely conventional fertilization CK, tobacco stalk biomass charcoal S, tobacco stalk biomass charcoal, bacillus amyloliquefaciens SJ, tobacco stalk biomass charcoal, compound microbial fertilizer SF, tobacco stalk biomass charcoal, bacillus amyloliquefaciens and compound microbial fertilizer SJF, and the steps are repeated for 3 times for 30 treatments; each treatment was set up with 15 bowls, each bowl being 10kg of soil.

Wherein, conventionally fertilize CK: no addition is made; tobacco stem biomass charcoal S: 100 g/plant of biomass charcoal; tobacco stem biomass charcoal+bacillus amyloliquefaciens SJ: 100 g/strain of biomass charcoal and 0.5 g/strain of bacillus amyloliquefaciens; tobacco stem biomass charcoal+compound microbial fertilizer SF: 100 g/strain of biomass charcoal and 60 g/strain of composite microbial fertilizer; tobacco stem biomass charcoal, bacillus amyloliquefaciens and compound microbial fertilizer SJF: 100 g/strain of biomass charcoal, 60 g/strain of composite microbial fertilizer and 0.5 g/strain of bacillus amyloliquefaciens. K326 is applied with pure N amount of 7 g/plant, safflower is applied with pure N amount of 5 g/plant, and the ratio of the additional fertilizer is 4:6, preparing a base material; the rest management measures are carried out according to the production standard of local high-quality flue-cured tobacco, transplanting is carried out at the end of 4 months, and 47d grafting is carried out after transplanting Ralstonia solanaceae 1×10 ⁷ cfu/mL。

Further, the sample collection and measurement in step three includes:

(1) Nutrient determination

And after 84d and 100d and 115d of transplanting, collecting soil samples by a 5-point method, removing plant dead and falling matters, crushed stones and the like, naturally air-drying, sieving by 0.25mm and 0.15mm, and storing in a sealed bag to measure soil pH, soil organic matters, soil alkaline hydrolysis nitrogen, soil quick-acting potassium and soil effective phosphorus.

Repeatedly collecting 3 plants of cigarettes respectively at 47d, 84d, 100d and 115d after transplanting, washing the root systems of potted tobacco plants, deactivating enzymes for 30min in a 105 ℃ oven after sampling, and drying at 85 ℃ to constant weight; and crushing and sieving the tobacco plants, wherein the sieved tobacco powder is used for measuring the total nitrogen, total phosphorus and total potassium content of the plants.

(2) Flue-cured tobacco agronomic trait determination

And selecting 3-5 representative plants from 47d, 74d, 99d and 115d after transplanting, and measuring agronomic characters.

(3) Enzyme Activity assay

Soil enzyme activity was measured at 47d post-transplant, 84d post-transplant, 100d post-transplant and 115d post-transplant.

1) Soil urease: indophenol blue colorimetry;

2) Soil acid phosphatase: disodium phosphate colorimetry;

3) Soil sucrase: titration with sodium thiosulfate;

4) Soil catalase: potassium permanganate titration.

The enzyme activity of the plants was measured at 84d after transplanting, 100d after transplanting and 122d after transplanting.

1) MDA: thiobarbituric acid colorimetry;

2) POD: guaiacol process.

(4) Determination of bacterial wilt disease condition

The disease condition is recorded once every 14d after the tobacco plants are transplanted in different fertilization treatments, the total time is 3 after the tobacco plants are transplanted, and the disease incidence, the disease index and the prevention and treatment effect are calculated.

Calculated according to the following formula:

morbidity (%) = (number of diseased plants/total number of plants) ×100;

disease index = Σ [ disease progression x number of disease plants (leaves) of the stage ]/highest disease progression x total number of investigation (leaves) x 100;

control effect = [ (control group disease index-treatment group disease index)/control group disease index ] ×100%.

(5) Fluorescent quantitative qPCR of Ralstonia solanaceae

And taking a soil sample in liquid nitrogen after transplanting for determining fluorescent quantification of Ralstonia solanacearum in 115 d.

1) DNA extraction: extracting DNA by using a soil DNA extraction kit Kjeldahl DNeasy PowerSoil Kit 10012888-100, operating according to a kit instruction, and freezing and storing the DNA at-20 ℃;

2) Establishment of a fluorescent quantitative qPCR standard curve: taking a standard substance diluted 10 times by sterile water as a template, taking the logarithmic value of the copy number of each gradient diluted plasmid as an abscissa, and taking the instrument reading Ct corresponding to each gradient diluted plasmid as an ordinate to manufacture a standard curve;

3) Fluorescent quantitative on-machine detection: diluting the extracted DNA sample with a proper amount, and then using the diluted DNA sample as a qPCR template, and amplifying the DNA sample with 2×T5 Fast qPCR Mix SYBR Green I of the family Prinsepiae; wherein, the fluorescence quantitative qPCR reaction system is as follows: 2×T5 Fast qPCR Mix SYBR Green I μL,10 μM Primer F1 μL,10 μM PrimerF 1 μL, template gDNA 1 μL, ddH ₂ O7. Mu.L, 20. Mu.L in total.

(6) Determination of rhizosphere soil microorganisms

Soil samples were taken in liquid nitrogen 115d after transplanting for determination of soil microbial diversity 16SrRNA.

Use kitThe soil DNA kit extracts the total DNA of the microbial community, and after the extraction of the genomic DNA, the extracted genomic DNA is detected by 1% agarose gel electrophoresis, and the concentration and purity of the DNA are determined by using a Nanodrop 2000.

Using 338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT PCR amplification was performed on the V3 to V4 region of the 16SrRNA gene.

Mixing the PCR products of the same sample, and recovering the PCR products by using 2% agarose gel; recovered product was purified using a kit AxyPrep DNA Gel Extraction Kit, detected by 2% agarose gel electrophoresis, using QuantiFluor ^TM ST to detect and quantify the recovered product.

The pool was built using the NEXTFLEX Rapid DNA-Seq Kit.

Further, the data statistics and analysis in the fourth step includes: experimental data statistics were performed using Microsoft Excel 365, statistical analysis using SPSS 26.0, and plotting using Origin 2022.

In combination with the technical scheme and the technical problems to be solved, the technical scheme to be protected has the following advantages and positive effects:

first, tobacco is an important cash crop in China, and biomass charcoal and biofertilizer are widely used in agricultural production at present. In order to ascertain the influence of adding biomass charcoal and biofertilizer on the growth of flue-cured tobacco and rhizosphere soil microorganisms, the invention takes Yunnan main cultivated flue-cured tobacco variety as a main research object, takes variety and fertilizer as two factors for matching and designing a splitting area test, wherein the main factors are variety, namely K326 and safflower Dajinyuan; the side factors are fertilizer application, which comprises conventional fertilization (CK), biomass charcoal (S), biomass charcoal and bacillus amyloliquefaciens (SJ), biomass charcoal and compound microbial fertilizer (SF), biomass charcoal, bacillus amyloliquefaciens and compound microbial fertilizer, and 10 treatments, which are repeated for 3 times. The influence of variety and fertilizer application on the growth and development of flue-cured tobacco and rhizosphere soil microorganisms is explored. The main results of the invention are as follows:

(1) In the whole tobacco plant growing process, the difference of different flue-cured tobacco varieties under the fertilizer distributing and applying conditions is obvious. For the K326 variety, the SF indexes of each agronomic trait under the main growth period are obviously superior to those of other treatments. For the safflower Dajinyuan, different fertilizer formulations have different promotion effects on the plant height, the stem circumference, the pitch and the maximum leaf area of the safflower Dajinyuan, SJ can obviously improve the pitch, and SF can obviously improve the maximum leaf area.

(2) As can be seen from the analysis and measurement results of the nutrient content of the tobacco planting soil in the main growth period of the flue-cured tobacco, the content of organic matters, alkaline hydrolysis nitrogen, quick-acting potassium and effective phosphorus in the tobacco planting soil treated by adding biomass charcoal and compound microbial fertilizer (SF) is obviously superior to other treatments for the K326 variety. For the safflower Dajinyuan, the soil organic matters, soil alkaline hydrolysis nitrogen, soil quick-acting potassium and soil effective phosphorus contents under SF and SJF are all obviously superior to those of other treatments.

(3) SF treatment can significantly increase soil urease and soil sucrase activity for K326 variety throughout the whole plant growth process. For safflower Dajinyuan, SF and SJF treatments can significantly increase soil urease and soil acid phosphatase activity.

(4) During the whole tobacco plant growth process, for the K326 variety, the S and SF treatments can significantly increase plant nutrient content. For the safflower Dajinyuan, the SJ and SF treatment can obviously improve the nutrient content of plants, and the SJF treatment can obviously improve the total nitrogen and potassium content of plants.

(5) In the whole tobacco plant growth process, for K326 variety, SJF treatment can remarkably improve POD activity and simultaneously remarkably reduce MDA content. For safflower brothers, S treatment can significantly reduce MDA content while significantly increasing POD activity.

(6) In the whole tobacco plant growth process, for the K326 variety, the fertilizer application has no obvious influence on the bacterial wilt disease. For the safflower Dajinyuan, the disease index of SJ treatment is the lowest, the control effect is the best, and S, SF and SJF have better control effects.

(7) According to the correlation analysis of various indexes in different periods, the soil organic matters, the soil alkaline hydrolysis nitrogen, the soil available phosphorus, the soil available potassium and the soil urease activity and the soil acid phosphatase activity are obviously or extremely obviously positively correlated after the transplanting, and the soil pH and the soil urease activity and the soil sucrase activity are obviously or extremely obviously negatively correlated after the transplanting in 115d, and the soil organic matters, the soil alkaline hydrolysis nitrogen, the soil available phosphorus, the soil available potassium and the soil urease activity, the soil sucrase activity and the soil catalase activity are obviously or extremely obviously positively correlated.

(8) Through analysis of rhizosphere soil microorganisms, the richness and uniformity of soil bacterial species of K326 and safflower Dajinyuan can be improved by adding biomass charcoal and a compound microbial fertilizer; for K326, the addition of biomass charcoal and the compound microbial fertilizer can remarkably reduce the abundance of actionobacteria (actinomycota) and gemmation adota (blastomonad), and remarkably improve the abundance of bacterioidota (bacteroides) and Firmicutes (Firmicutes); biomass charcoal and bacillus amyloliquefaciens are added to the safflower metasedge or biomass charcoal and compound microbial fertilizer are added, so that the abundance of Proteobacteria can be obviously reduced, and the abundance of Firmics can be obviously improved.

In conclusion, for two varieties of K326 and safflower Dajinyuan, SF treatment is beneficial to improving agronomic characters, soil physicochemical properties, plant nutrient content, soil enzyme activity and plant enzyme activity of tobacco plants, and simultaneously improves the soil microbial environment, so that the method is suitable for the whole growth of tobacco plants.

Secondly, the technical scheme is regarded as a whole or from the perspective of products, and the technical scheme to be protected has the following technical effects and advantages:

according to the invention, on the basis of the existing production and fertilization, biomass carbon and biological fertilizer are applied, the growth and development of different types of flue-cured tobacco and the microbial status of rhizosphere soil are discussed, and by adding the biomass carbon and the biological fertilizer, the growth and development of tobacco plants are improved, the occurrence of tobacco bacterial wilt is prevented, a green tobacco production environment is created, and a theoretical basis is provided for the flue-cured tobacco production in the future.

Thirdly, whether the technical scheme of the invention overcomes the technical bias:

the invention aims at providing a compound fertilization technology aiming at the technical prejudice that fertilizer application is singly emphasized in the existing production. For a long time, tobacco growers always consider the application amount of fertilizer as a main factor for determining the yield and the later production income of flue-cured tobacco, which greatly influences the production of high-quality flue-cured tobacco. The single fertilization technology has no obvious negative effect on the yield and the output value of the flue-cured tobacco to a certain extent, but long-term fertilizer application leads to the reduction of the quality of tobacco planting soil and the aggravation of field diseases, thereby increasing the production cost in the flue-cured tobacco production process. According to the invention, biomass carbon and fertilizer are applied, so that the quality of tobacco planting soil is improved, the occurrence of field bacterial wilt is reduced, the input amount of pesticides is reduced, the production cost of flue-cured tobacco is controlled, and a certain theoretical basis is provided for building environment-friendly flue-cured tobacco production environment.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a flow chart of a flue-cured tobacco fertilizer dispensing method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to an embodiment of the invention;

FIG. 2 is a schematic diagram showing the effect of variety and fertilizer formulation provided by the embodiment of the invention on agronomic traits of flue-cured tobacco in different periods;

FIG. 3 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the pH of tobacco planting soil at different periods of flue-cured tobacco;

FIG. 4 is a schematic diagram showing the effect of different varieties and fertilizer application provided by the embodiment of the invention on the organic matter content of tobacco planting soil in different periods of flue-cured tobacco;

FIG. 5 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the alkaline hydrolysis nitrogen content of soil in different periods of flue-cured tobacco;

FIG. 6 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the effective phosphorus content of soil at different periods of flue-cured tobacco;

FIG. 7 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the quick-acting potassium content of soil in different periods of flue-cured tobacco;

FIG. 8 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the urease activity of soil at different periods of flue-cured tobacco;

FIG. 9 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the activity of soil sucrase in different periods of flue-cured tobacco;

FIG. 10 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the acid phosphatase activity of soil at different periods of flue-cured tobacco;

FIG. 11 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on soil catalase activity of flue-cured tobacco in different periods;

FIG. 12 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on the nutrient content of plants in different periods of flue-cured tobacco;

FIG. 13 is a schematic diagram showing the effect of different varieties and fertilizer formulations provided by the embodiment of the invention on tobacco leaf membrane lipid peroxidation related protective enzymes in different periods of flue-cured tobacco;

FIG. 14 is a standard curve, an amplification spectrum and a dissolution curve of the fluorescence quantitative qPCR of the ralstonia solanacearum provided by the embodiment of the invention;

FIG. 15 is a graph showing the copy number of the ROSL gene provided by an embodiment of the present invention;

FIG. 16 is a graph of the composition of rhizosphere soil bacterial communities provided by an embodiment of the present invention;

FIG. 17 is a graph of the colony Heatmap at the rhizosphere soil bacteria colony gate level provided by an embodiment of the present invention;

FIG. 18 is a schematic diagram showing a significance analysis of the differences between rhizosphere soil bacterial communities at the portal level provided by the examples of the present invention;

FIG. 19 is a principal coordinate analysis of differences in microbial communities of rhizosphere soil provided by an embodiment of the present invention;

FIG. 20 is a schematic diagram of a rhizosphere soil microbial bacterial community and soil nutrient correlation analysis provided by an embodiment of the invention;

FIG. 21 is a schematic diagram showing the analysis of the relationship between rhizosphere soil microbial bacterial community and soil enzyme activity according to the embodiment of the invention.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

Aiming at the problems existing in the prior art, the invention provides a flue-cured tobacco variety and fertilizer dispensing method which are beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganisms, and the invention is described in detail below with reference to the accompanying drawings.

As shown in fig. 1, the flue-cured tobacco variety and fertilizer dispensing method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms provided by the embodiment of the invention comprises the following steps:

s101, determining a test place and time; determining the property of the biomass charcoal and the microbial fertilizer to be tested; selecting flue-cured tobacco K326 and safflower Dajinyuan as test varieties, and carrying out split area test design;

s102, collecting a sample and carrying out nutrient determination, flue-cured tobacco agronomic trait determination, enzyme activity determination, bacterial wilt disease determination, solanaceae Ralstonia fluorescent quantitative qPCR and rhizosphere soil microorganism determination;

S103, data statistics and analysis: experimental data statistics were performed using Microsoft Excel 365, statistical analysis using SPSS 26.0, and plotting using Origin 2022.

The biochar provided by the embodiment of the invention (pH 9.32, organic carbon 169.94g/kg, N10.42 g/kg, P1.93 g/kg, K33.2 g/kg and C/N16.4) is provided by Anhui Bayer Biotech company, and the composite microbial fertilizer (the effective viable count of beneficial bacteria is more than or equal to 2 multiplied by 10) ⁷ cfu/g, total nutrient N+P ₂ O ₅ +K ₂ O is more than or equal to 8 percent, effective organic matters are more than or equal to 60 percent), and bacillus amyloliquefaciens (2 multiplied by 10) ¹⁰ cfu/g) is provided by Guangdong Bowalt Biotechnology Co.

The test provided by the embodiment of the invention is a split area test design, and main factors are varieties, namely: k326, safflower dajinyuan; the side factors are fertilizer allocation, namely conventional fertilization (CK), tobacco stalk biomass charcoal (S), tobacco stalk biomass charcoal+bacillus amyloliquefaciens (SJ), tobacco stalk biomass charcoal+compound microbial fertilizer (SF), tobacco stalk biomass charcoal+bacillus amyloliquefaciens+compound microbial fertilizer (SJF), and the three treatments are repeated for 3 times. Each treatment was set up with 15 bowls, each bowl being 10kg of soil.

Conventional fertilization (CK): no addition is made;

tobacco stem biomass charcoal (S): biomass charcoal (100 g/strain);

tobacco stem biomass charcoal+bacillus amyloliquefaciens (SJ): biomass charcoal (100 g/strain) +bacillus amyloliquefaciens (0.5 g/strain);

Tobacco stem biomass charcoal+compound microbial fertilizer (SF): biomass charcoal (100 g/strain) +composite microbial fertilizer (60 g/strain);

tobacco stem biomass charcoal, bacillus amyloliquefaciens and compound microbial fertilizer (SJF): biomass charcoal (100 g/strain) +composite microbial fertilizer (60 g/strain) +bacillus amyloliquefaciens (0.5 g/strain).

K326 is applied with pure N amount of 7 g/plant, and safflower is applied with pure N amount of 5 g/plant, and the ratio of the base fertilizer to the additional fertilizer is 4:6. The other management measures are carried out according to the local production standard of high-quality flue-cured tobacco, transplanting is carried out at the age of 2021 and 4 months and then the solanaceae Ralstonia (1 multiplied by 10) is inoculated 47 days after the transplanting ⁷ cfu/mL), ralstonia solanacearum was supplied by the university of agriculture, yunnan, bacterial laboratory.

The sample collection and measurement provided by the embodiment of the invention comprises the following steps:

(1) Nutrient determination

And after 84d and 100d and 115d of transplanting, collecting soil samples by a 5-point method, removing plant dead and falling matters, crushed stones and the like, naturally airing, sieving by 0.25mm and 0.15mm sieves, and storing in a sealed bag, and measuring the pH value, organic matters, alkaline hydrolysis nitrogen, quick-acting potassium and available phosphorus of the soil, wherein the measuring method is carried out according to soil agrochemical analysis Bao Shidan.

3 plants of cigarettes are repeatedly collected after 47d, 84d, 100d and 115d are transplanted, roots of potted plants are washed clean, the whole plants are placed in a 105 ℃ oven for enzyme deactivation for 30min after sampling, the whole plants are dried to constant weight at 85 ℃, the plants are crushed and sieved, and the sieved smoke powder is used for measuring the total nitrogen, total phosphorus and total potassium content of the plants, and the measurement method is carried out according to Li Chunli and the like.

(2) Flue-cured tobacco agronomic trait determination

And selecting 3-5 representative plants from 47d, 74d, 99d and 115d after transplanting, and measuring agronomic traits by referring to a standard tobacco agronomic trait investigation measuring method (YC-T/42-2010) of the tobacco industry.

(3) Enzyme Activity assay

1) Soil urease: indophenol blue colorimetry;

2) Soil acid phosphatase: disodium phosphate colorimetry;

3) Soil sucrase: titration with sodium thiosulfate;

4) Soil catalase: potassium permanganate titration.

The measurement method was carried out with reference to "soil enzyme and research method" Guan Songyin.

1) MDA: thiobarbituric acid colorimetry;

2) POD: guaiacol process.

The determination method is carried out according to the principle and technology of plant physiology and biochemistry Li Gesheng.

(4) Determination of bacterial wilt disease condition

The different fertilization treatments are carried out after the tobacco plants are transplanted for 74d, and then the disease conditions are recorded every 14d, namely 88d and 102d after the tobacco plants are transplanted for 3 times, and the disease incidence, disease index and prevention and treatment effect of the diseases are calculated. The grading investigation of the disease index is carried out according to GB/T23222-2008 tobacco plant diseases and insect pests grading and investigation method.

Calculated according to the following formula:

morbidity (%) = (number of diseased plants/total number of plants) ×100;

(5) Fluorescent quantitative qPCR of Ralstonia solanaceae

1) DNA extraction: extracting DNA by using a soil DNA extraction kit Kjeldahl DNeasy PowerSoil Kit (100) 12888-100, operating according to a kit instruction, and freezing and storing the DNA at-20 ℃;

2) Establishment of a fluorescent quantitative qPCR standard curve: taking a standard substance diluted 10 times by sterile water as a template, taking the logarithmic value of the copy number of each gradient diluted plasmid as an abscissa, and taking the instrument reading Ct (Threshold cycle) corresponding to each gradient diluted plasmid as an ordinate to manufacture a standard curve;

3) Fluorescent quantitative on-machine detection: the extracted DNA sample is diluted with a proper amount and is used as a qPCR template, and is amplified by a 2×T5Fast qPCR Mix (SYBR Green I) of the Optimaceae; wherein, the fluorescence quantitative qPCR reaction system is as follows: 2×T5 Fast qPCR Mix SYBR Green I μL,10 μM Primer F1 μL, template gDNA 1 μL, ddH ₂ O7. Mu.L, 20. Mu.L in total.

(6) Determination of rhizosphere soil microorganisms

Use kitThe total DNA of the microbial community was extracted by the oil DNA kit (Omega Bio-tek, norcross, GA, U.S.), and after the extraction of the genomic DNA was completed, the extracted genomic DNA was detected by 1% agarose gel electrophoresis, and the DNA concentration and purity were determined by using the Nanodrop 2000.

Using 338F (ACTCCTACGGGAGGCAGCAG)

806R(GGACTACHVGGGTWTCTAAT)

PCR amplification was performed on the V3 to V4 region of the 16SrRNA gene.

After mixing the PCR products of the same sample, 2% agarose is used for the gelThe PCR products were recovered by gel purification using a kit AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, union City, calif., USA), 2% agarose gel electrophoresis detection, and purified by QuantiFluor ^TM ST (Promega, USA) to detect and quantify the recovered product.

The pool was built using the NEXTFLEX Rapid DNA-Seq Kit.

Sequencing work was done by Shanghai Meiji biomedical technologies Inc. using the MiseqPE300 platform of Illumina Inc.

2. Application example. In order to prove the inventive and technical value of the technical solution of the present invention, this section is an application example on specific products or related technologies of the claim technical solution.

According to the invention, in the meridian town of Chuxiong and Yi nationality in Yunnan province, local conventional planting varieties of safflower Dajinyuan and flue-cured tobacco K326 are taken as research objects, a split area test design is adopted, main factors are varieties, auxiliary factors are fertilizer application, and a field test of biomass charcoal and biological fertilizer application is carried out, so that the influence of varieties and fertilizer application on the growth and development of flue-cured tobacco and rhizosphere soil microorganisms is explored.

The embodiment of the invention has a great advantage in the research and development or use process, and has the following description in combination with data, charts and the like of the test process.

1. Materials and methods

1.1 test sites and time

Table 1 basic soil nutrient content

Potted plant tests were carried out in the meridian town of Chuxiong City of Yunnan, 4-10 months in 2021, and the test soil was red soil with basic nutrient conditions shown in Table 1.

2.2 tested Biomass charcoal Properties and microbial fertilizers

Biochar (pH 9.32, organic carbon 169.94g/kg, N10.42 g/kg, P1.93 g/kg, K33.2)g/kg, C/N16.4) provided by Anhui Bayer Fu biotechnology company, and the compound microorganism fertilizer (beneficial bacteria effective viable count is more than or equal to 2 multiplied by 10) ⁷ cfu/g, total nutrient N+P ₂ O ₅ +K ₂ O is more than or equal to 8 percent, effective organic matters are more than or equal to 60 percent), and bacillus amyloliquefaciens (2 multiplied by 10) ¹⁰ cfu/g) is provided by Guangdong Bowalt Biotechnology Co.

1.3 test varieties

The test varieties are flue-cured tobacco K326 and safflower Dajinyuan.

1.4 design of experiments

The test is designed for the crack area test, and the main factors are varieties, namely: k326, safflower dajinyuan; the side factors are fertilizer allocation, namely conventional fertilization (CK), tobacco stalk biomass charcoal (S), tobacco stalk biomass charcoal+bacillus amyloliquefaciens (SJ), tobacco stalk biomass charcoal+compound microbial fertilizer (SF), tobacco stalk biomass charcoal+bacillus amyloliquefaciens+compound microbial fertilizer (SJF), and the three treatments are repeated for 3 times. Each treatment was set up with 15 bowls, each bowl being 10kg of soil.

Conventional fertilization (CK): no addition is made;

tobacco stem biomass charcoal (S): biomass charcoal (100 g/strain);

1.5 sample collection and measurement

1.5.1 nutrient determination

1.5.2 determination of agronomic traits of flue-cured tobacco

1.5.3 measurement of enzyme Activity

(1) Soil urease: indophenol blue colorimetry;

(2) Soil acid phosphatase: disodium phosphate colorimetry;

(3) Soil sucrase: titration with sodium thiosulfate;

(4) Soil catalase: potassium permanganate titration.

(1) MDA: thiobarbituric acid colorimetry;

(2) POD: guaiacol process.

1.5.4 determination of bacterial wilt disease condition

Calculated according to the following formula:

morbidity (%) = (number of diseased plants/total number of plants) ×100;

1.5.5 fluorescent quantitative qPCR of Ralstonia solanaceae

(1) DNA extraction: extracting DNA by using a soil DNA extraction kit Kjeldahl DNeasy PowerSoil Kit (100) 12888-100, operating according to a kit instruction, and freezing and storing the DNA at-20 ℃;

(2) Establishment of a fluorescent quantitative qPCR standard curve: taking a standard substance diluted 10 times by sterile water as a template, taking the logarithmic value of the copy number of each gradient diluted plasmid as an abscissa, and taking the instrument reading Ct (Threshold cycle) corresponding to each gradient diluted plasmid as an ordinate to manufacture a standard curve;

(3) Fluorescent quantitative on-machine detection: the extracted DNA sample is diluted with a proper amount and used as a qPCR template, and is amplified by a 2×T5Fast qPCR Mix (SYBR Green I) of the Optimaceae, and each component of the amplification system is shown in Table 2.

TABLE 2 fluorescent quantitative qPCR reaction System

Determination of 1.5.6 rhizosphere soil microorganisms

Using 338F (ACTCCTACGGGAGGCAGCAG)

806R(GGACTACHVGGGTWTCTAAT)

PCR amplification was performed on the V3 to V4 region of the 16SrRNA gene.

Mixing PCR products of the same sample, recovering PCR products with 2% agarose gel, purifying the recovered products with kit AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, union City, calif., USA), detecting with 2% agarose gel electrophoresis, detecting with QuantiFluor ^TM ST (Promega, USA) to detect and quantify the recovered product.

The pool was built using the NEXTFLEX Rapid DNA-Seq Kit.

1.6 data statistics and analysis

Experimental data statistics were performed using Microsoft Excel 365, statistical analysis using SPSS 26.0, and plotting using Origin 2022.

2. Results and analysis

2.1 Effect of variety and Fertilizer formulation on agronomic traits of flue-cured tobacco in the Main growth period

FIG. 2 is the effect of different flue-cured tobacco varieties on the agronomic traits of tobacco plants in the main growth period under different fertilizer formulations. From the figure, the effect of different fertilizer formulations on different flue-cured tobacco varieties is different. For flue-cured tobacco K326 variety, the effect of fertilizer application on the plant height of tobacco plants is mainly concentrated on 47d and 74d after transplanting, but the effect in the later growth period of tobacco plants is not obvious. As in 47d after transplanting, the plant height under CK was significantly increased by 39% over that under SJ treatment, but the difference in plant height between CK and SF was not significant. For stem circumference, the primary effects are 47d, 74d and 115d after transplanting, where the stem circumference at 115d, SF is significantly higher than other treatments. There is a significant impact on both pitch and maximum leaf area. As can be seen from fig. 2, the index of SF on each agronomic trait under the main growth period of K326 is significantly better than other treatments.

For safflower size Jin Yuanlai, the effect of fertilizer application on tobacco plant height persists until the flue-cured tobacco is harvested. The effect of fertilizer application on the stem circumference, pitch and maximum leaf area of tobacco plants continues until the flue-cured tobacco is harvested. The plant height at 47d after transplanting was significantly increased by 84% compared to SF treatment, but the difference in plant height between S, SJ and SJF was not significant. For stem circumference, the stem circumference under 47d, S after transplanting is significantly higher than other treatments, and is significantly improved by 27% compared with SF. For pitch, the pitch at 99d and 115d after transplanting, sj is significantly higher than other treatments, with the pitch at 115d, sj being significantly improved by 18% over the S treatment. For the maximum leaf area, the maximum leaf area at 47d and 74d, s and SJ after transplanting was significantly higher than other treatments, and the maximum leaf area at 115d, sf after transplanting was significantly higher than other treatments, which was a 49% improvement over SJF treatment. After the biomass charcoal and the biofertilizer are added, the plant height, the stem circumference, the pitch and the maximum leaf area of the safflower Dajinyuan are promoted to different degrees.

Table 3 shows the effect of interactions between different varieties and different fertilizer formulations on agronomic traits of flue-cured tobacco in the main growth period. As can be seen from the table, the stem circumference of 47d after transplanting and the maximum leaf surface of 74d after transplanting are removed

The stem circumference is greater than K326. For pitch, the pitch under CK of the K326 variety was significantly higher than other treatments after transplanting, while the pitch of all treatments of K326 was greater than that of the safflower macroprimordium, the S, SJ treatment of the safflower macroprimordium variety was significantly higher than each treatment of K326 after transplanting 74d, and the SJ treatment of the safflower macroprimordium variety was significantly higher than each treatment of K326 after 99d and 115 d. For the agronomic character index of the maximum leaf area, the CK and SF treatments of the safflower Dajinyuan variety are obviously higher than the K326 treatments after 99d and 115d transplanting.

2.2 Effect of variety and Fertilizer formulation on tobacco soil nutrient for different periods of flue-cured tobacco

2.2.1 Effect of variety and Fertilizer formulation on tobacco soil pH for different growth periods of flue-cured tobacco

A large number of test results show that bacterial wilt is easy to occur in the slightly acidic soil. FIG. 3 is the effect of different varieties and fertilizer formulations on the pH of tobacco planting soil during the main growth period of flue-cured tobacco. As can be seen from fig. 3, the effect of the fertilizer after being applied on the pH value of the flue-cured tobacco K326 rhizosphere soil is mainly concentrated in 100d after transplanting, and at 100d after transplanting, the pH value of the tobacco planting soil under SJ treatment is significantly higher than that of SJF treatment, but the difference from other treatments is not significant. For safflower big Jin Yuanlai, different fertilizer application treatments have a significant effect on the pH value of the tobacco planting soil at 84d after transplanting and 100d after transplanting, for example, at 100d transplanting, the pH value of the soil under SJ, SF, SJF treatment is significantly higher than that under S and CK treatment.

2.2.2 influence of variety and Fertilizer application on organic matter content of tobacco planting soil in different growth periods of flue-cured tobacco

The organic matters in the soil are substances except for the mineral matters in the soil, are the most active parts in the soil, are the basis of the soil fertility, and are one of important indexes for measuring the soil fertility. As can be seen from fig. 4, for the K326 variety, the soil organic matter content under sjf was significantly higher than other treatments at 84d after transplanting, and was significantly 28% higher than CK treatments at 100d after transplanting, and the soil organic matter content under sf was significantly higher than CK and SJ treatments. For the safflower Dajinyuan, the soil organic matter content under SF is obviously higher than other treatments after transplanting 84d, is obviously improved by 63% compared with SJ treatment, the soil organic matter content under SJF is obviously higher than CK, S and SF treatments after transplanting 100d, and the soil organic matter content under SJ, SF and SJF is obviously higher than CK and S treatments after transplanting 115 d.

2.2.3 Effect of variety and Fertilizer formulation on alkaline hydrolysis Nitrogen content of soil at different times of flue-cured tobacco

The alkaline hydrolysis nitrogen in the soil contains inorganic nitrogen, organic nitrogen which has a simple structure and can be directly absorbed and utilized by crops, and the like, the content in the soil is unstable and is easy to change due to the influence of soil hydrothermal conditions and biological activities, but the alkaline hydrolysis nitrogen can reflect the dynamic state and the nitrogen supply level of the soil nitrogen relatively sensitively, and is an important index of the fertility of the soil nitrogen. As can be seen from fig. 5, for the K326 variety, the alkaline hydrolysis nitrogen content of the soil treated with 84d, s after transplanting was highest, significantly higher than that of CK, SF and SJF treatments, and the alkaline hydrolysis nitrogen content of the soil under 100d, SF and SJF after transplanting was significantly higher than that of CK and SJ treatments. For Honghuadajinyuan, the alkaline hydrolysis nitrogen content of the soil under SF is obviously higher than that of other treatments after transplanting 84d, is obviously improved by 114% compared with CK treatment, and the alkaline hydrolysis nitrogen content of the soil under SJF is obviously higher than that of CK and S treatments after transplanting 115 d.

2.2.4 Effect of variety and Fertilizer formulation on the available phosphorus content of soil at different times of flue-cured tobacco

Phosphorus is an important component of soil elements and is also one of the essential elements for plant growth. As can be seen from fig. 6, for the K326 variety, the effective phosphorus content of the soil under s and 84d after transplanting was significantly higher than that of other treatments, 27% higher than that of CK treatment, 100d after transplanting, 61% higher than that of SJ treatment, and 90% higher than that of SJ treatment. For the safflower Dajinyuan, the effective phosphorus content of the soil under SJ is obviously higher than that of other treatments after 84d and SJ after transplanting, and is obviously higher than that of other treatments under 115d, SF and SJF after transplanting, and is obviously higher than that of other treatments, so that the effect of simply adding biomass charcoal on improving the effective phosphorus content of the soil is not obvious as shown by the SJF.

2.2.5 Effect of variety and Fertilizer formulation on quick-acting Potassium content of soil at different times of flue-cured tobacco

Potassium is one of essential elements for plant growth, is an important index for measuring soil fertility, quick-acting potassium can be directly absorbed and utilized by plant bodies, the content of the quick-acting potassium can directly reflect the absorption and utilization conditions of plants on soil nutrients, and simultaneously, potassium is an important quality nutrition element of flue-cured tobacco, and a proper amount of potassium can effectively improve the quality of flue-cured tobacco. As can be seen from FIG. 7, for K326 variety, the soil quick-acting potassium content after transplanting 84d, S and SJ was significantly higher than that of other treatments, SJ was significantly higher than that of CK treatment by 37%, the soil quick-acting potassium content after transplanting 100d, SJF was significantly higher than that of other treatments, and the soil quick-acting potassium content after transplanting 115d, SF was significantly higher than that of CK, SJ and SJF treatments by 42%, and than that of SJ treatment

The organic matter and the effective phosphorus content of the soil under the condition of safflower Dajinyuan X SF are obviously higher than those of other treatments. After 100d transplanting, the soil organic matter content under K326×SF and SJF is obviously higher than that of other treatments. After transplanting 115d, the soil available phosphorus content at K326×SF is significantly higher than other treatments. The method shows that under the condition of local conventional fertilization, the addition of proper biomass and the compound biological fertilizer thereof has a certain effect of improving the nutrient and the pH value of tobacco planting soil in the main growth period of flue-cured tobacco.

2.3 Effect of variety and Fertilizer formulation on soil enzyme Activity at different times of flue-cured tobacco

2.3.1 Effect of variety and Fertilizer formulation on soil urease Activity in different times of flue-cured tobacco

Urease is an important hydrolase participating in soil nitrogen circulation, and has the main function of catalyzing hydrolysis of urea in soil, and can characterize the soil nitrogen supply intensity. As can be seen from fig. 8, for the K326 variety, the soil urease activity at 47d, S, SJ, SF and SJF after transplanting was significantly higher than that of CK treatment, but there was no significant difference between S, SJ, SF and SJF treatments, the soil urease activity at 84d, SJ, SF and SJF treatments was significantly higher than that of other treatments, there was no significant difference between SJ, SF and SJF treatments, the soil urease activity at 100d, CK, SF and SJF after transplanting was significantly higher than that of other treatments, the soil urease activity at 115d, SF was significantly higher than that of other treatments, 43% higher than that of SJ treatment, and the soil urease activity at SJF was significantly higher than that of CK, S and SJ treatments, 35% higher than that of SJ treatment. For safflower Dajinyuan, the soil urease activity under SF is significantly higher than other treatments after 84d, under SJF is significantly higher than CK, S and SJ treatments, the soil urease activity under SJF is significantly higher than other treatments after 100d, over CK is significantly higher by 128%, under SF is significantly higher than CK, S and SJ treatments, over CK is significantly higher by 100%, under SJ is significantly higher than CK and S treatments, and under SJF is significantly higher than other treatments, over CK is significantly higher by 64%, under SF is significantly higher than CK, S and SJ treatments, over CK is significantly higher by 30% than CK is significantly higher than CK and S treatments at 115 days after transplanting. From the above, it can be seen that the simple application of biomass charcoal under the condition of local conventional fertilization has little effect on improving the urease activity of the soil.

2.3.2 Effect of variety and Fertilizer formulation on soil sucrase Activity at different times of flue-cured tobacco

The sucrase can promote the hydrolysis of saccharides, hydrolyze sucrose in soil into glucose and fructose, provide energy for organisms in the soil, accelerate the carbon circulation of the soil, and reflect the utilization degree of microorganisms on soluble substances in the soil and the accumulation and conversion conditions of organic matters in the soil. As can be seen from fig. 9, for the K326 variety, the soil sucrase activity at SF was significantly higher than other treatments at 47d after transplanting, the soil sucrase activity at SF was significantly higher than other treatments at 84d after transplanting, 97% higher than CK, and the soil sucrase activity at 100d, s and SF was significantly higher than other treatments at 100d after transplanting, and 45% higher than CK. For the safflower Dajinyuan, the soil sucrase activity under CK was significantly higher than other treatments at 47d after transplanting, the soil sucrase activity under cjf was significantly higher than S and SJ treatments at 84d after transplanting, the soil sucrase activity under sjf was significantly higher than other treatments at 100d after transplanting, 245% higher than S, the soil sucrase activity under CK was significantly higher than S, SJ and SF treatments, 169% higher than S, and the soil sucrase activity under sjf was significantly higher than other treatments at 115d after transplanting, 450% higher than S.

2.3.3 Effect of variety and Fertilizer formulation on soil acid phosphatase Activity at different times of flue-cured tobacco

Soil phosphatase is an enzyme for catalyzing mineralization of organic phosphorus compounds in soil into inorganic phosphorus, the activity of the enzyme directly influences the decomposition and conversion of the organic phosphorus in the soil and the bioavailability of the organic phosphorus, and the phosphatase activity is an index for evaluating the bioconversion direction and strength of the soil phosphorus. As can be seen from fig. 10, for the K326 variety, the soil acid phosphatase activity at sj was significantly higher than other treatments by 37% after transplanting, 37% higher than CK, 23% higher than CK for CK, 100d after transplanting, 100% higher than other treatments, 100% higher than S, and 43% higher than S for S, SJ and SJF treatments. For safflower Dajinyuan, the soil acid phosphatase activity under CK and SJ is significantly higher than other treatments after transplantation, 84d, SJF is significantly higher than other treatments, 37% higher than SJ, 29% higher than CK, S and SJ treatments, S is significantly higher than CK and SJ treatments, 100d, SF is significantly higher than other treatments, 76% higher than S, SJ and SJF is significantly higher than CK and S treatments, CK is significantly higher than S is treated, 115d is significantly higher than S is significantly higher than other treatments, and S is significantly higher than CK and SJF.

2.3.4 Effect of variety and Fertilizer formulation on soil catalase Activity at different times of flue-cured tobacco

Catalase is an oxidation-reduction enzyme in soil, and the main function of the catalase is to decompose hydrogen peroxide in the soil, and is an important characterization of the metabolism level and the accumulation degree of organic matters in the soil. As can be seen from fig. 11, for the K326 variety, the soil catalase activity at SJF was significantly higher than CK and S treatments, the soil catalase activity at CK was significantly higher than other treatments by 89% after transplanting 84d, compared to SF, the soil catalase activity at 100d, S was significantly higher than CK, SJ and SF treatments, but not significantly different from SJF treatments, the soil catalase activity at SJF was significantly higher than other treatments by 22% after transplanting 115d, compared to CK, S and SJ treatments, and the soil catalase activity at S was significantly higher than CK and SJ treatments. For safflower Dajinyuan, the soil catalase activity under SF is significantly higher than CK and S treatments after transplanting, the difference from SJ and SJF is not significant, the soil catalase activity under SJF is significantly higher than other treatments after transplanting 84d, 147% higher than SJ, the soil catalase activity under CK and SF is significantly higher than S and SJ treatments, the soil catalase activity under SJF is significantly higher than other treatments after transplanting 100d and 115d, and the soil catalase activity under SJ is significantly higher than CK, S and SF treatments.

Table 5 shows the effect of interactions between different varieties and fertilizer formulations on the enzymatic activity of soil at different times during flue-cured tobacco. It can be seen from Table 5 that the interaction between variety and fertilizer formulation has a significant effect on the soil enzyme activity at different stages of flue-cured tobacco, except for the soil urease and soil catalase activity at 47d after transplanting. If 84d after transplanting, the soil sucrase activity under K326×SF is significantly higher than that under other treatments, the soil acid phosphatase activity under K326×SJ is significantly higher than that under other treatments, and if 115d after transplanting, the soil urease activity under K326×SF is significantly higher than that under other treatments, the soil catalase activity under K326×SJF is significantly higher than that under other treatments.

The total nitrogen content of the plants under the transplanting is obviously higher than that of the plants under the treatments of CK, SF and SJF, and the total nitrogen content of the plants under the treatments of CK and SJ after the transplanting is 115d is obviously higher than that of other treatments. In terms of plant total phosphorus, the plant total phosphorus content at 47d and 100d after transplanting, s, is significantly higher than other treatments. In terms of total potassium, the total potassium content of the plants at 84d and 100d after transplanting, S, is significantly higher than other treatments. As can be seen from the figure, under the nutrient indexes of each plant of the K326 variety, the nutrient content under 100d and S after transplanting is obviously higher than that of other treatments, and the change trend of each index after transplanting is similar to that of each index after transplanting of 84d, 100d and 115 d.

TABLE 6 Effect of interactions between different varieties and fertilizer formulations on plant nutrient content at different times of flue-cured tobacco

For the safflower Dajinyuan, in the aspect of plant total nitrogen, the plant total nitrogen content under 84d and SJ after transplanting is obviously higher than that of other treatments, and is obviously improved by 49% compared with S, and the plant total nitrogen content under 115d and S after transplanting is obviously higher than that of other treatments. In the aspect of plant total phosphorus, the content of the plant total phosphorus under SJ and SF is obviously higher than that of other treatments after transplanting 84d, and SF is obviously improved by 131% compared with that of S treatment. In the aspect of plant total potassium, the content of the plant total potassium under SJF after transplanting is obviously higher than that of other treatments, and is obviously improved by 49% compared with S. From the graph, under the nutrient indexes of each plant of the safflower Dajinyuan, the nutrient content under 84d and 100d and S after transplanting is obviously lower than that of other treatments.

Table 6 shows the effect of interactions between different varieties and fertilizer formulations on plant nutrient content at different times of flue-cured tobacco. It can be seen from the table that the interaction between variety and fertilizer formulation has a significant effect on plant nutrient content at each stage. The total nitrogen and total potassium content of plants under K326×SF are significantly higher than those of other treatments after 47d, and the total nitrogen content of plants under safflower Dajinyuan×S is significantly higher than those of other treatments after 115d after transplanting, and the total potassium content of plants under safflower Dajinyuan×SJF is significantly higher than those of other treatments.

2.5 Effect of variety and Fertilizer formulation on tobacco leaf film lipid peroxidation-related protective enzymes in different periods of flue-cured tobacco

When the tobacco plant is stressed, peroxy ions, hydrogen peroxide and the like can start membrane lipid peroxidation, so that the membrane structure is damaged. The content of Malondialdehyde (MDA) is the final product of peroxidation of cell membrane lipid, and the level of the content indirectly reflects the stress degree of the tobacco strain and the integrity degree of cell membrane structure. Peroxidase (POD) is one of important enzymes constituting an antioxidant defensive enzyme system, and plays a role in protecting active oxygen. As can be seen from fig. 13, in the case of the K326 variety, the POD activity at 100d, s after transplanting was significantly higher for the treatment with the siren SF and SJF, and the POD activity at 122d, sj and SJF after transplanting was significantly higher than for the other treatments. In terms of MDA activity, MDA activity at 84d, s was significantly lower than other treatments after transplanting, and MDA activity at 122d, sjf was significantly lower than other treatments after transplanting.

TABLE 7 Effect between different varieties and fertilizer formulations on tobacco leaf film lipid peroxidation related protective enzymes at different periods of flue-cured tobacco

For safflower Dajinyuan, the POD activity at 100d, CK and S after transplanting is significantly higher than other treatments, and the POD activity at 122d, S after transplanting is significantly higher than other treatments. In terms of MDA activity, 100d after transplanting, MDA activity at sf was significantly lower than other treatments, and MDA activity at 122d, s was significantly lower than other treatments.

Table 7 shows the effect of different varieties and fertilizer formulations on tobacco leaf film lipid peroxidation related protective enzymes in different periods of flue-cured tobacco, and the interaction between the varieties and fertilizer formulations has a significant effect on tobacco leaf film lipid peroxidation related protective enzyme activity in different periods of flue-cured tobacco except for the POD activity of 84d after transplanting. 100d after transplanting, POD activity under safflower Dajinyuan X CK and S is significantly higher than other treatments, and MDA activity under safflower Dajinyuan X CK, S, SJ and SJF is significantly higher than other treatments.

2.6 influence of variety and fertilizer application on bacterial wilt disease

2.6.1 Effect of different varieties and Fertilizer application on the occurrence of bacterial wilt disease

TABLE 8 influence of different varieties and fertilizer formulations on bacterial wilt disease index and relative control effect

Table 8 shows the effect of different varieties and fertilizer formulations on bacterial wilt disease index and relative control effect. As can be seen from the table, the incidence rate and the disease index of the tobacco K326 are obviously lower than those of the Honghuadajinyuan variety in each growth period, and the susceptibility of the Honghuadajinyuan variety to the bacterial wilt is also proved relative to the K326. In the K326 variety, only after transplanting 74d, the SJF treatment has the disease condition, and other treatments have no disease condition. For the safflower Dajinyuan, the disease index of CK is obviously higher than that of the treatment with the addition of biomass charcoal (S) at 74d after transplanting, but the disease index is not obvious from the other three treatments. The biomass charcoal is added at 74d after transplanting, so that the severity of bacterial wilt can be reduced. At 88d post-transplantation, the disease index of bacterial wilt under CK and SF treatment was significantly higher than the other three treatments (S, SJ and SJF), indicating that the addition of biomass charcoal and appropriate biological agents reduced the severity of disease occurrence. The bacterial wilt disease incidence index at 102d after transplanting is consistent with the trend at 88d after transplanting. Taken together, it can be found that for safflower big Jin Yuanlai, the bacterial wilt disease index of the local conventional fertilization (CK) is obviously higher than that of the treated biomass charcoal after transplanting at 74d, 88d and 102d, which means that the bacterial wilt disease index can be obviously reduced by properly adding the biomass charcoal and the biofertilizer thereof after transplanting the great golden element of the safflower.

2.6.2 fluorescent quantitative qPCR Standard Curve for ralstonia solanacearum

The standard curve, amplification spectrum and dissolution curve of the ralstonia solanacearum fluorescent quantitative qPCR are shown in figure 14, and the standard curve R ² The fluorescent quantitative PCR amplification method is greater than 0.99 and is 0.9989, the amplification curve is smooth and stable, the peak value of the dissolution curve is single, and the fluorescent quantitative PCR amplification method is stable and reliable and has strong specificity and meets the quantitative detection requirement.

Effects of different varieties of 2.6.3 and fertilizer application on ralstonia solanacearum in soil

As can be seen from fig. 15, for variety K326, the copy number of the solanacearum gene under SJF treatment was significantly higher than that of the other treatments, SF treatment was significantly higher than CK, S and SJ treatments, and the difference in the copy number of the gene between CK, S and SJ treatments was not significant. For the safflower Dajinyuan, the copy number of the gene of the Solanaceae Ralstonia under SF treatment is obviously higher than that of other treatments, and CK treatment is obviously lower than that of other treatments.

2.7 Effect of variety, fertilizer formulation on rhizosphere soil microorganisms

2.7.1 rhizosphere soil microorganism Alpha diversity

All samples were sequenced this time to obtain 1252358 high quality sequences, yielding 5431 operable taxons (operational taxonomic unit, OTU) in total, based on 97% sequence similarity cluster analysis. Alpha diversity refers to the diversity of species within a particular habitat or ecosystem. As can be seen from table 9, the difference between the Chao index under S, SJ and SJF treatment was not significant and the performance was stable at the bacterial diversity level; s, SJ under the condition of great golden element of safflower and the Chao index difference of SF treatment are not obvious, the performance is stable, and the correct and reliable sequencing result can be illustrated. Coverage represents the OTU abundance Coverage of the samples, with the index being greater than 96% for all 10 samples, indicating that the sequencing depth was sufficient to reflect the true soil bacterial community structure, satisfying the subsequent analysis. The Chao index can reflect the abundance of species in the sample, and the larger the index, the greater the abundance of species contained in the bacterial community, indicating that the greater the abundance of the bacterial community. Wherein the Chao index under SF treatment is significantly higher than CK for variety K326; for safflower macrogold, the Chao index under SJF treatment is significantly higher than CK. Shannon and Simpson indices indicate species richness and uniformity. The greater Shannon index indicates greater species abundance, more uniform distribution of species, and the smaller Simpson index indicates greater species uniformity. Wherein Shannon index under SF treatment is the largest and Simpson index is the smallest for variety K326; for the safflower Dajinyuan, shannon index under SF treatment is the largest, simpson index is smaller, and the SF treatment is only larger than SJ treatment, so that the species richness is the highest, and meanwhile, the uniformity is the highest.

TABLE 9 rhizosphere soil bacterial community Alpha diversity index Table

2.7.2 analysis of microbial bacterial community composition of rhizosphere soil

The current sequencing of 10 samples resulted in 5431 OTUs in total, and as can be seen from fig. 16, the method mainly comprises: proteobacteria (Proteobacteria), actinobacillus (Actinobacillus), chloroflexi (Chlorella), acidobacteria (Acidobacteria), bacterioides (Bacteroides), gemmatimonades (Acidobacteria), myxoccota (Myxococcus), patescibacterium (Patella), firmics (Thick wall bacteria), desulfobacteria (Desulfobacteria) and the like. Wherein Proteobacteria, actinobacteria is highest in each sample and accounts for 27.94% -37.43% and 18.50% -30.14% of the total sequence respectively. Wherein for the K326 variety, the abundance of Proteobacteria under SF is highest and 4.3% higher than that of S, and the abundance of Actinobacteria under SF is lowest and 6.05% lower than that of CK; for the large golden element of safflower, the abundance of Proteobacteria is highest under SJF treatment and 9.49% higher than SF, while the abundance of Actinobacteria under SJF treatment is lowest and 4.27% lower than SF.

Colony Heatmap cluster analysis of each sample bacterial colony at portal level is shown in FIG. 17, where S and SJ treatments under K326 variety are clustered together, indicating that S and SJ treated bacterial colonies are close, then clustered together with CK treatment, indicating that CK, S and SJ treated bacterial colonies are close, and further SF and SJF treatments are clustered together, indicating that SF and SJF treated bacterial colonies are similar; for safflower bronzes, CK and S treatments were pooled together, indicating that the CK and S treated bacterial communities were close, and then pooled together with SJF treatments, indicating that the CK, S and SJF treated bacterial communities were close.

Differential test between 2.7.3 rhizosphere soil microbiome

As shown in fig. 18, which is an inter-group variability test of the dominance gates of the samples, the results demonstrate that Actinobacteriota, bacteroidota, gemmatimonadota, myxococcota, firmicutes, nitrospirota, armatimonadota, methylomirabilota has significant or very significant differences between treatments for the K326 variety, where SF treatment can significantly reduce actioniota and gemmationadata abundances and SF and SJF can significantly increase bacterioidota and firmies abundances. For safflower brothers, proteobacteria, myxococcota, patescibacteria, firmicutes, desulfobacterota, bdellovibrionota had significant or very significant differences between treatments, where SJ and SF treatments could significantly reduce Proteobacteria abundance and SJ, SF and SJF could significantly increase Firmicutes abundance.

2.7.4 rhizosphere soil microorganism bacterial community Beta diversity analysis

The principal coordinate analysis (PCoA) can analyze the overall difference condition of bacterial communities among samples, and the results are displayed on a two-dimensional coordinate graph, so that the difference of the bacterial compositions of different fertilization treatments can be visually represented. As can be seen from fig. 19, for the K326 variety, CK, S and SJ treatment distances were close, SF and SJF treatment distances were close, and CK, S, SJ and SF, SJF were far apart, indicating that the bacterial colonies between CK, S and SJ treatments were close, and SF and SJF treated bacterial colonies were close, whereas CK, S, SJ and SF, SJF bacterial colonies were significantly different. For the safflower Dajinyuan, the treatment distances of CK, S and SJF are close, the treatment distances of SJ and SF are close, and the distances among CK, S, SJF, SJ and SF are far, which means that the bacterial communities among CK, S and SJF are close, the bacterial communities among SJ and SF are close, and the differences among CK, S, SJF, SJ and SF are obvious.

2.7.5 rhizosphere soil microbial bacterial community and environmental factor correlation analysis

2.7.5.1 rhizosphere soil microbial bacterial community and soil nutrient correlation analysis

As shown in fig. 20, which shows the analysis results of the association of the soil microbial bacterial community and the soil nutrients, for the K326 variety, the other soil nutrient indexes are positively correlated except that the soil pH and the quick-acting potassium are not correlated; the longest length of the soil quick-acting potassium arrow indicates that the soil quick-acting potassium has the greatest influence on the soil bacterial community, and the shortest length of the soil organic arrow indicates that the soil organic has the least influence on the soil bacterial community; in addition, CK, S and SJ treatments are all in the arrow direction, which indicates that the indexes of the soil nutrients are positively correlated to the distribution of soil bacterial communities treated by CK, S and SJ, SJF treatments are in the arrow opposite direction, which indicates that the indexes of the soil nutrients are negatively correlated to the distribution of soil bacterial communities treated by SJF, the pH of the soil under SF treatment and the organic matters are positively correlated to the distribution of soil bacterial communities, and the alkaline hydrolysis nitrogen, the available phosphorus and the quick-acting potassium of the soil are negatively correlated. For the safflower Dajinyuan, the pH of the soil is inversely related to other soil nutrients; the organic matters in the soil are in negative correlation with pH, and are in positive correlation with alkaline hydrolysis nitrogen, available phosphorus and quick-acting potassium in the soil; the alkaline hydrolysis nitrogen and the available phosphorus of the soil are in negative correlation with the pH value and the quick-acting potassium, and are in positive correlation with soil organic matters and the available phosphorus of the soil; wherein the longest arrow of soil organic matter indicates that the soil organic matter has the greatest influence on soil bacterial communities; in addition, soil organic matters and quick-acting potassium are positively correlated to soil bacterial community distribution under CK and S treatment, soil pH, alkaline hydrolysis nitrogen and effective phosphorus are negatively correlated, soil pH, organic matters and quick-acting potassium are positively correlated to soil bacterial community distribution under SJ treatment, soil alkaline hydrolysis nitrogen and effective phosphorus are negatively correlated, soil pH, alkaline hydrolysis nitrogen and effective phosphorus are positively correlated to soil bacterial community distribution under SF treatment, soil organic matters and quick-acting potassium are negatively correlated, soil organic matters, alkaline hydrolysis nitrogen and effective phosphorus are positively correlated to soil bacterial community distribution under SJF treatment, and soil pH and quick-acting potassium are negatively correlated.

2.7.5.2 rhizosphere soil microbial bacterial community and soil enzyme activity correlation analysis

As shown in fig. 21, which shows the analysis results of the relationship between the soil microbial bacterial community and the soil enzyme activity, the soil urease and the soil catalase are positively correlated, the soil sucrase and the soil acid phosphatase are positively correlated, and the soil urease and the soil acid phosphatase are uncorrelated for the K326 variety; wherein the longest soil catalase arrow indicates that soil catalase has the greatest effect on the soil bacterial community, and the shortest soil sucrase arrow indicates that soil sucrase has the least effect on the soil bacterial community; in addition, the S and SJ treatments are in the arrow direction, which indicates that the activities of four soil enzymes are positively correlated with the distribution of soil bacterial communities in the S and SJ treatments, the SJF treatments are in the opposite arrow direction, which indicates that the activities of four soil enzymes are negatively correlated with the distribution of soil bacterial communities in the SJF treatments, the soil urease and the soil catalase are positively correlated with the distribution of soil bacterial communities in the CK treatment, the soil sucrase and the soil acid phosphatase are negatively correlated, the soil sucrase and the soil acid phosphatase are positively correlated with the distribution of soil bacterial communities in the SF treatment, and the soil urease and the soil catalase are negatively correlated. For the safflower Dajinyuan, the soil urease and the soil sucrase are positively correlated, and the soil acid phosphatase and the soil catalase are positively correlated; wherein the longest soil sucrase arrow indicates that the soil sucrase has the greatest effect on the soil bacterial community, and the shortest soil acid phosphatase arrow indicates that the soil acid phosphatase has the least effect on the soil bacterial community; in addition, soil acid phosphatase and soil catalase under CK treatment are positively correlated with soil bacterial community distribution, soil urease and soil sucrase are negatively correlated, soil urease, sucrase and catalase under S and SJF treatment are positively correlated with soil bacterial community distribution, soil acid phosphatase is negatively correlated with soil acid phosphatase, soil acid phosphatase and catalase under SF treatment are positively correlated with soil bacterial community distribution, soil urease and sucrase under SF treatment are positively correlated with soil bacterial community distribution, and soil acid phosphatase and catalase are negatively correlated with each other.

2.7 correlation analysis of various indicators of flue-cured tobacco in different periods

2.7.1 analysis of the correlation of agronomic traits and soil nutrients in different periods of flue-cured tobacco

Table 10 shows the results of the correlation analysis of agronomic traits and soil nutrients in different periods of flue-cured tobacco. It can be seen from the table that the pH of the soil is significantly positively correlated with plant height, stem circumference and pitch after transplanting 74d, while the soil organic matter, soil available phosphorus, soil available potassium and plant height, stem circumference, pitch and maximum leaf area are significantly or significantly negatively correlated, which means that the increase of the pH of the soil in this period is beneficial to the growth and development of tobacco plants, while the increase of the soil organic matter, soil available phosphorus and soil available potassium is unfavorable to the growth and development of tobacco plants. After 99d transplanting, the soil organic matters and plant height are obviously positively correlated, the soil available phosphorus and the pitch are obviously negatively correlated, the soil available potassium and the pitch are obviously negatively correlated, and the maximum leaf area is obviously positively correlated, and other indexes have no obvious correlation, so that the tobacco plant growth condition is influenced by the soil organic matters, the soil available phosphorus and the soil available potassium in the period. After the transplanting, 115d, the soil organic matter and the stem circumference are obviously and negatively correlated, the soil alkaline hydrolysis nitrogen and the plant height are obviously and positively correlated, and the stem circumference is obviously and negatively correlated, so that the plant height is influenced by the soil alkaline hydrolysis nitrogen and the soil effective phosphorus in the period, and the stem circumference is influenced by the soil organic matter and the soil alkaline hydrolysis nitrogen.

Table 10 analysis of the correlation of agronomic traits and soil nutrients in different stages of flue-cured tobacco

2.7.2 analysis of the correlation of soil nutrient and soil enzyme Activity at different periods of flue-cured tobacco

Table 11 is an analysis of the correlation of soil nutrients and soil enzyme activity at different times of flue-cured tobacco. From the table, after 84d transplanting, the soil pH and the soil urease activity are obviously and positively correlated, and the soil organic matters, the soil alkaline hydrolysis nitrogen, the soil available phosphorus, the soil available potassium and the soil urease activity and the soil acid phosphatase activity are obviously or very obviously positively correlated, so that the increase of the soil organic matters, the soil alkaline hydrolysis nitrogen, the soil available phosphorus and the soil available potassium content in the period is beneficial to improving the soil urease activity and the soil acid phosphatase activity.

TABLE 11 analysis of the correlation of soil nutrients and soil enzyme Activity at different times of flue-cured tobacco

The soil pH and the soil sucrase activity are obviously and inversely related after 100 days of transplanting, and the soil organic matter and the soil urease activity, the soil sucrase activity and the soil catalase activity are obviously and positively related, so that the increase of the soil organic matter content in the period is favorable for improving the soil urease activity, the soil sucrase activity and the soil catalase activity. The soil pH is obviously or extremely obviously and inversely related to soil urease activity and soil sucrase activity after transplanting for 115d, and the soil organic matters, soil alkaline hydrolysis nitrogen, soil available phosphorus, soil quick-acting potassium and soil urease activity, soil sucrase activity and soil catalase activity are obviously or extremely obviously and positively related to each other, so that the improvement of the soil organic matters, soil alkaline hydrolysis nitrogen, soil available phosphorus and soil quick-acting potassium content in the period is favorable for the improvement of soil urease activity, soil sucrase activity and soil catalase activity.

3. Discussion of the invention

3.1 Effect of variety and Fertilizer formulation on agronomic traits of flue-cured tobacco at different times

The test result shows that the plant height and pitch of the K326 variety CK are obviously higher than those of other treatments after the transplanting of 47d and 74d, and the SF treatment can obviously improve the pitch and the maximum leaf area of the plant after the transplanting of 99d and 115 d. For safflower brothers, the maximum leaf area of the 47d and 74d, s and SJ treatments after transplanting was significantly higher than the other treatments consistent with the results of the Yan Haitao et al study.

3.2 influence of variety and fertilizer formulation on physicochemical properties of soil at different periods of flue-cured tobacco

The test result shows that after 84d transplanting, the application of different fertilizers has a promoting effect on the organic matter content of the soil of the K326 variety, wherein the organic matter content of the soil treated by SJF is obviously higher than that of other treatments; for the safflower Dajinyuan variety, the organic matter content of SF treated soil is obviously higher than that of other treatments. After 100d and 115d of transplanting, the K326 variety SF is treated with the highest organic matter content of the soil; for the safflower Dajinyuan variety, the SJF treatment soil has the highest organic matter content. Deng Zi et al research shows that the addition of biomass charcoal and biofertilizer can improve the organic matter content of soil, and the result accords with the test result.

After transplanting, 84d, the alkaline hydrolysis nitrogen content of the K326 variety S treated soil is obviously higher than that of other treatments; for the safflower Dajinyuan variety, the S, SJ, SF, SJF treatment has a promoting effect on the increase of the alkaline hydrolysis nitrogen content of the soil, wherein the alkaline hydrolysis nitrogen content of the soil treated by SF is obviously higher than that of other treatments. The addition of biomass charcoal can promote the accumulation of alkaline hydrolysis nitrogen in K326 variety soil; different fertilizer formulations can promote the accumulation of alkaline hydrolysis nitrogen in safflower Dajinyuan soil, but the promotion effect of adding biomass charcoal and compound microbial fertilizer is most remarkable.

After transplanting, 84d, the effective phosphorus content of the soil treated by the K326 variety S is obviously higher than that of other treatments, and the SJ treatment is obviously higher than that of CK and SF treatments; for safflower Dajinyuan varieties, SF treatment is significantly higher than other treatments and SJF treatment is significantly higher than CK, S and SJ treatments. The method has the advantages that the addition of biomass charcoal and bacillus amyloliquefaciens can promote the accumulation of effective phosphorus in K326 soil; the biomass charcoal and the compound microbial fertilizer are added, and the biomass charcoal, the bacillus amyloliquefaciens and the compound microbial fertilizer are added, so that the accumulation of effective phosphorus in the safflower Dajinyuan soil can be promoted.

After transplanting, 84d, the quick-acting potassium content of the soil treated by the K326 varieties S and SJ is obviously higher than that of other treatments; for safflower macrogold, SF treatment is significantly higher than other treatments and SJF treatment is significantly higher than CK, S and SJ treatments. The method has the advantages that the addition of biomass charcoal and bacillus amyloliquefaciens can promote the accumulation of quick-acting potassium in K326 soil; the addition of the biomass charcoal and the compound microbial fertilizer and the addition of the biomass charcoal, the bacillus amyloliquefaciens and the compound microbial fertilizer can promote the accumulation of quick-acting potassium in the safflower Dajinyuan soil, and is consistent with the research results of the former.

3.3 Effect of variety and Fertilizer formulation on soil enzyme Activity at different times of flue-cured tobacco

The test result shows that the soil urease has a gradual rising trend in the growth period of tobacco plants under the condition of different fertilizer application. The K326 varieties S and SJ treated with soil urease activity was significantly lower than other treatments at 100d and 115d post-transplanting, SF treated with soil urease activity was significantly higher than other treatments at 115d post-transplanting, and SJF treated with significantly higher CK, S and SJ treatments. For safflower Dajinyuan varieties, SJF treatment of soil has significantly higher urease activity than other treatments, SF treatment is significantly higher than CK, S and SJ treatments, and SJ treatment is significantly higher than CK and S treatments. The method shows that the addition of the biomass charcoal and the compound microbial fertilizer and the addition of the biomass charcoal, the bacillus amyloliquefaciens and the compound microbial fertilizer can improve the urease activity of K326 and safflower Dajinyuan soil, and the addition of the biomass charcoal and the bacillus amyloliquefaciens can improve the urease activity of safflower Danyuan soil, which is consistent with the research results of the former people.

Soil sucrase under K326 variety SF was significantly higher than other treatments at 47d and 84d after transplanting, and soil sucrase under 100d, S and SF after transplanting was significantly higher than other treatments. For safflower Dajinyuan, the soil sucrase at SJF was significantly higher than other treatments at 100d and 115d after transplanting, consistent with previous study results.

After transplanting, the K326 varieties SJ and SF can be treated to remarkably improve the activity of the soil acid phosphatase. For the safflower Dajinyuan, the SF treatment can obviously improve the activity of soil acid phosphatase after the transplanting for 84d, 100d and 115d, and the enzyme activity is obviously higher than other treatments, which is consistent with the previous research results.

After 100d and 115d transplanting, K326 varieties S, SF and SJF treatments can significantly improve soil catalase activity. For safflower Dajinyuan, the SJF treatment can obviously improve the soil catalase activity after the transplanting of 84d, 100d and 115d and is obviously higher than other treatments, which are consistent with the previous study results.

3.4 influence of variety and fertilizer application on nutrient content of plants in different periods of flue-cured tobacco

The test result shows that for K326 variety, S, SJ and SF treatment can obviously improve plant nutrient content, and the addition of biomass charcoal, biomass charcoal and bacillus amyloliquefaciens, biomass charcoal and compound microbial fertilizer can improve plant nutrient content. For the safflower Dajinyuan, SJ and SF treatment can obviously improve the plant nutrient content, which shows that the addition of biomass charcoal and bacillus amyloliquefaciens and the addition of biomass charcoal and compound microbial fertilizer can improve the plant nutrient content, and is consistent with the research results of Dong Yan and the like.

3.5 Effect of variety and Fertilizer formulation on tobacco leaf film lipid peroxidation-related protective enzymes in different periods of flue-cured tobacco

The test result shows that for K326 variety, SJ and SJF treatment can obviously improve POD activity, SJF treatment can obviously reduce MDA content, and the addition of biomass charcoal, bacillus amyloliquefaciens and composite microorganism can improve POD activity and simultaneously reduce MDA content. For safflower Dajinyuan, the S treatment can obviously improve POD activity and can obviously reduce MDA content, and the research results of Han Yi and the like show that the addition of biomass charcoal can improve POD activity and simultaneously reduce MDA content.

3.6 influence of variety and fertilizer application on bacterial wilt disease

The test result shows that for the K326 variety, the fertilizer is not obviously affected on the bacterial wilt disease, and the K326 variety has better disease resistance on the bacterial wilt disease and is related to the alkalescence comprehensive effect of the tested soil. For the safflower Dajinyuan, the incidence rate and the disease index of SJ treatment are the lowest, the control effect is the highest of 66%, and the S and SJF treatment also have good control effect, which is consistent with the research results of Zhang Anyu and the like.

3.7 Effect of variety, fertilizer formulation on rhizosphere soil microorganisms

3.7.1 microbial Alpha diversity of rhizosphere soil

The test result shows that the Shannon index under the SF treatment of the K326 variety is the largest and the Simpson index is the smallest; the Shannon index is the largest under the treatment of the safflower Dajinyuan SF, the Simpson index is smaller, and the two varieties show consistency, which shows that the enrichment degree and the uniformity degree of the bacterial species in the soil can be improved by adding the biomass charcoal and the compound microbial fertilizer.

3.7.2 analysis of microbial bacterial community composition of rhizosphere soil

The test result shows that for the K326 variety, the addition of the biomass charcoal and the compound microbial fertilizer can improve the abundance of Proteobacteria in the soil and reduce the abundance of actinomycetes in the soil; for the safflower metasedge, the biomass charcoal, the bacillus amyloliquefaciens and the compound microbial fertilizer are added to improve the abundance of Proteobalia in soil and reduce the abundance of Actinobacillus in soil, but the biomass charcoal and the compound microbial fertilizer are added to reduce the abundance of Proteobalia in soil.

Differential test between 3.7.3 rhizosphere soil microbiome

The test result shows that for the K326 variety, the addition of the biomass charcoal and the compound microbial fertilizer can obviously reduce the abundance of actionobacteria and Gemmatimonadata and increase the abundance of Bactoidota and Firmics; for the safflower Dajinyuan, the biomass charcoal and the compound microbial fertilizer can be added to obviously reduce the abundance of Proteobacteria and increase the abundance of Myxoccota and Firmics. Wherein both varieties can increase Firmics abundance and both varieties exhibit identity.

3.7.4 analysis of Beta diversity of microbial bacterial communities in rhizosphere soil

The test result shows that for the K326 variety, the addition of biomass charcoal and bacillus amyloliquefaciens has little influence on the composition of soil bacterial communities, the addition of biomass charcoal and the compound microbial fertilizer has obvious influence on the soil bacterial communities, and for the safflower brothers, the addition of biomass charcoal has little influence on the composition of soil bacterial communities, and the addition of biomass charcoal and the compound microbial fertilizer has obvious influence on the soil bacterial communities. The addition of biomass charcoal and the compound microbial fertilizer has obvious influence on the soil bacterial community, and the consistency of the two varieties is shown.

4. Conclusion(s)

1. In the whole tobacco plant growth process, for the K326 variety, the SF has better indexes for each agronomic character under the main growth period of the K326 than other treatments. For the safflower Dajinyuan, different fertilizer formulations have different promotion effects on the plant height, the stem circumference, the pitch and the maximum leaf area of the safflower Dajinyuan, SJ can obviously improve the pitch, and SF can obviously improve the maximum leaf area.

2. In the whole tobacco plant growth process, for K326 variety, soil organic matters, soil alkaline hydrolysis nitrogen, soil quick-acting potassium and soil effective phosphorus content under SF are superior to those of other treatments. For the safflower Dajinyuan, the soil organic matters, soil alkaline hydrolysis nitrogen, soil quick-acting potassium and soil effective phosphorus content under SF and SJF are all superior to other treatments.

3. SF treatment can significantly increase soil enzyme activity for K326 variety throughout the plant growth process. For safflower Dajinyuan, SF and SJF treatments can significantly increase soil enzyme activity.

4. During the whole tobacco plant growth process, for the K326 variety, the S and SF treatments can significantly increase plant nutrient content. For the safflower Dajinyuan, the SJ and SF treatment can obviously improve the nutrient content of plants, and the SJF treatment can obviously improve the total nitrogen and potassium content of plants.

5. In the whole tobacco plant growth process, for K326 variety, SJF treatment can remarkably improve POD activity and simultaneously remarkably reduce MDA content. For safflower brothers, S treatment can significantly reduce MDA content while significantly increasing POD activity.

6. In the whole tobacco plant growth process, for the K326 variety, the fertilizer application has no obvious influence on the bacterial wilt disease. For the safflower Dajinyuan, the disease index of SJ treatment is the lowest, the control effect is the best, and S, SF and SJF have better control effects.

7. Through the correlation analysis of various indexes of flue-cured tobacco in different periods, the indexes of the agricultural property and the soil nutrient are mainly in obvious negative correlation, and the indexes of the soil nutrient and the indexes of the agricultural property are in obvious positive correlation or very obvious positive correlation between the soil nutrient and the soil enzyme activity, and the soil organic matters, the soil alkaline hydrolysis nitrogen, the soil available phosphorus, the soil quick-acting potassium and the soil urease activity, the soil sucrase activity and the soil catalase activity.

8. Through analysis of rhizosphere soil microorganisms, the biomass charcoal and the compound microbial fertilizer are added to improve the richness and uniformity of soil bacterial species of K326 and safflower Dajinyuan, and simultaneously, the Firmics abundance can be obviously increased.

In conclusion, for two varieties of K326 and safflower Dajinyuan, under SF treatment, the agronomic characters, the physical and chemical properties of soil, the nutrient content of plants, the soil enzyme activity and the plant enzyme activity of the tobacco plants are improved, the soil microbial environment is improved, and the tobacco plants are suitable for overall growth.

The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.

Claims

1. A flue-cured tobacco variety and fertilizer dispensing method which is beneficial to the growth of flue-cured tobacco and rhizosphere soil microorganisms is characterized by comprising the following steps: determining the test site and time, wherein the soil to be tested is red soil; determining the charcoal to be tested, the compound microbial fertilizer and the bacillus amyloliquefaciens; selecting flue-cured tobacco K326 and safflower Dajinyuan as test varieties, and carrying out split area test design; collecting samples, and respectively carrying out nutrient determination, flue-cured tobacco agronomic trait determination, enzyme activity determination, bacterial wilt disease determination, solanaceae Ralstonia fluorescent quantitative qPCR and rhizosphere soil microorganism determination; the experimental data statistics were statistically analyzed using SPSS26.0 and plotted using Origin 2022.

2. The method for preparing a flue-cured tobacco variety and fertilizer for use in benefiting flue-cured tobacco growth and rhizosphere soil microorganisms according to claim 1, wherein the method for preparing a flue-cured tobacco variety and fertilizer for use in benefiting flue-cured tobacco growth and rhizosphere soil microorganisms comprises the steps of:

step two, determining a test variety and carrying out split area test design;

step three, sample collection and measurement are carried out;

and step four, carrying out data statistics and analysis.

3. The flue-cured tobacco variety and fertilizer formulation method for facilitating the growth of flue-cured tobacco and microorganisms in rhizosphere soil of claim 2, wherein the determination of the nature of the biomass char and microbial fertilizer tested in step one comprises:

biochar pH9.32, organic carbon 169.94g/kg, N10.42g/kg, P1.93g/kg, K33.2g/kg, C/N16.4; the effective viable count of beneficial bacteria of the composite microbial fertilizer is more than or equal to 2 multiplied by 10 ⁷ cfu/g, total nutrient N+P ₂ O ₅ +K ₂ O is more than or equal to 8 percent, and the effective organic matters are more than or equal to 60 percent; bacillus amyloliquefaciens 2×10 ¹⁰ cfu/g。

4. The method for preparing flue-cured tobacco variety and fertilizer for facilitating the growth of flue-cured tobacco and microorganism in rhizosphere soil according to claim 2, wherein the test varieties in the second step are flue-cured tobacco K326 and safflower Dajinyuan;

5. The flue-cured tobacco variety and fertilizer application method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 4, wherein the conventional fertilization CK: no addition is made; tobacco stem biomass charcoal S: 100 g/plant of biomass charcoal; tobacco stem biomass charcoal+bacillus amyloliquefaciens SJ: 100 g/strain of biomass charcoal and 0.5 g/strain of bacillus amyloliquefaciens; tobacco stem biomass charcoal+compound microbial fertilizer SF: 100 g/strain of biomass charcoal and 60 g/strain of composite microbial fertilizer; tobacco stem biomass charcoal, bacillus amyloliquefaciens and compound microbial fertilizer SJF: 100 g/strain of biomass charcoal, 60 g/strain of composite microbial fertilizer and 0.5 g/strain of bacillus amyloliquefaciens; k326 is applied with pure N amount of 7 g/plant, safflower is applied with pure N amount of 5 g/plant, and the ratio of the additional fertilizer is 4:6, preparing a base material; the rest management measures are carried out according to the production standard of local high-quality flue-cured tobacco, transplanting is carried out at the end of 4 months, and 1X 10 of Ralstonia solanacearum is inoculated 47d after transplanting ⁷ cfu/mL。

6. The flue-cured tobacco variety and fertilizer dispensing method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 2, wherein the sample collection and measurement in step three comprises:

(1) Nutrient determination

Collecting soil samples after 84d, 100d and 115d of transplanting by a 5-point method, removing plant dead and falling matters, crushed stones and the like, naturally airing, sieving with a sieve of 0.25mm and 0.15mm, and storing in a sealed bag to determine soil pH, soil organic matters, soil alkaline hydrolysis nitrogen, soil quick-acting potassium and soil effective phosphorus;

repeatedly collecting 3 plants of cigarettes respectively at 47d, 84d, 100d and 115d after transplanting, washing the root systems of potted tobacco plants, deactivating enzymes for 30min in a 105 ℃ oven after sampling, and drying at 85 ℃ to constant weight; crushing and sieving the tobacco plants, wherein the sieved tobacco powder is used for measuring the total nitrogen, total phosphorus and total potassium content of the plants;

(2) Flue-cured tobacco agronomic trait determination

Selecting 3-5 representative plants from 47d, 74d, 99d and 115d after transplanting, and measuring agronomic characters;

(3) Enzyme Activity assay

Determining soil enzyme activity at 47d after transplanting, 84d after transplanting, 100d after transplanting and 115d after transplanting;

After 84d of transplanting, 100d of transplanting, 122d of transplanting, and measuring the enzyme activity of the plant;

(4) Determination of bacterial wilt disease condition

The different fertilization treatments record the disease conditions at intervals of 14d after the tobacco plants are transplanted for 74d, and the disease incidence, disease index and prevention and treatment effect of the diseases are calculated for 3 times after the tobacco plants are transplanted for 88d and 102 d;

(5) Fluorescent quantitative qPCR of Ralstonia solanaceae

Taking a soil sample in liquid nitrogen after transplanting for determining fluorescent quantification of Ralstonia solanacearum in 115 d;

(6) Determination of rhizosphere soil microorganisms

Taking a soil sample in liquid nitrogen after transplanting for measuring the soil microbial diversity 16SrRNA;

kit e.z.n.a was used.The method comprises the steps of extracting microbial community total DNA from a soil DNA kit, detecting the extracted genomic DNA by using 1% agarose gel electrophoresis after the genomic DNA extraction is completed, and measuring the concentration and purity of the DNA by using a Nanodrop 2000;

using 338F: ACTCCTACGGGAGGCAGCAG and is provided with

806R: GGACTACHVGGGTWTCTAAT PCR amplification is carried out on the V3-V4 region of the 16SrRNA gene;

mixing the PCR products of the same sample, and recovering the PCR products by using 2% agarose gel; recovered product was purified using a kit AxyPrep DNA Gel Extraction Kit, detected by 2% agarose gel electrophoresis, using QuantiFluor ^TM ST detection and quantification of recovered products;

the pool was built using the NEXTFLEX Rapid DNA-Seq Kit.

7. The flue-cured tobacco variety and fertilizer distribution method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 6, wherein determining soil enzyme activity in step (3) at 47d after transplanting, 84d after transplanting, 100d after transplanting and 115d after transplanting comprises:

1) Soil urease: indophenol blue colorimetry;

2) Soil acid phosphatase: disodium phosphate colorimetry;

3) Soil sucrase: titration with sodium thiosulfate;

4) Soil catalase: potassium permanganate titration;

1) MDA: thiobarbituric acid colorimetry;

2) POD: guaiacol process.

8. The flue-cured tobacco variety and fertilizer dispensing method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 6, wherein the bacterial wilt disease condition in step (4) is calculated according to the following formula:

morbidity (%) = (number of diseased plants/total number of plants) ×100;

9. The flue-cured tobacco variety and fertilizer dispensing method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 6, wherein the fluorescent quantitative qPCR of solanacearum in step (5) comprises:

1) DNA extraction: selecting a soil DNA extraction kit, namely Kaiji DNeasy PowerSoilkit10012888-100, extracting DNA, operating according to the specification of the kit, and freezing and storing the DNA at-20 ℃;

3) Fluorescent quantitative on-machine detection: the extracted DNA sample is diluted with a proper amount and then used as a qPCR template, and is amplified by using 2 XT 5FastqPCRMixSYBRGreenI of the family of the Practidae; wherein, the fluorescence quantitative qPCR reaction system is as follows: 2×T5 FastPCRMixSYBRGreenI 10. Mu.L, 10. Mu.MPrimerF 1. Mu.L, templetegDNA 1. Mu.L, ddH ₂ O7. Mu.L, 20. Mu.L in total.

10. The flue-cured tobacco variety and fertilizer distribution method for facilitating the growth of flue-cured tobacco and rhizosphere soil microorganisms according to claim 2, wherein the data statistics and analysis in step four comprises: experimental data statistics were performed using microsoft excel365, statistical analysis using SPSS26.0, and plotting using Origin 2022.