CN116836269A

CN116836269A - Monoclonal antibody for resisting respiratory syncytial virus and application thereof

Info

Publication number: CN116836269A
Application number: CN202310250286.8A
Authority: CN
Inventors: 高福; 仝舟; 侯亚利; 崔庆为; 仝剑宇
Original assignee: Shanxi Institute Of Higher Innovation
Current assignee: Shanxi Institute Of Higher Innovation
Priority date: 2023-03-15
Filing date: 2023-03-15
Publication date: 2023-10-03

Abstract

The present application relates to the fields of immunology and molecular virology, in particular to the fields of diagnosis, prevention and treatment of respiratory syncytial virus. The present application relates to monoclonal antibodies against respiratory syncytial virus, as well as kits and uses comprising the antibodies. The antibody comprises complementarity determining regions 1-3 of heavy chain variable regions with amino acid sequences shown as SEQ ID NO. 1-3 respectively and complementarity determining regions 1-3 of light chain variable regions with amino acid sequences shown as SEQ ID NO. 4-6 respectively. The antibodies of the application are useful in the diagnosis, prevention and treatment of infection by respiratory syncytial virus or diseases caused by such infection (e.g., bronchiolitis, croup).

Description

Monoclonal antibody for resisting respiratory syncytial virus and application thereof

Technical Field

The present application relates to the fields of immunology and molecular virology, to the diagnosis, prevention and treatment of respiratory syncytial virus, more particularly to monoclonal antibodies against respiratory syncytial virus, and to kits and uses comprising said antibodies.

Background

Although RSV is a serious threat to global health, there are few means to prevent and treat RSV infection and vaccine development is hindered by exacerbation of the disease caused by formalin inactivated vaccines. Antibodies in the mother are delivered to the infant via the placenta during the last weeks of gestation, providing protective immunity, but this protection is twice as long as the date of each month is declined and has poor persistence. At present, no vaccine and specific treatment means exist, the only preventive measure is palivizumab obtained in batch in 1998, although the hospitalization rate and the death rate of infants can be reduced to a certain extent, the use frequency is high, premature infants with congenital respiratory circulatory system disorders need to be immunized five times in the whole epidemic season, the high cost and inconvenience make the palivizumab unsuitable for all infants, and the prevention of infants at high risk is limited. Thus, there is an urgent need for the development of vaccines and antibody therapeutic drugs.

Respiratory syncytial virus belongs to Paramyxoviridae, pneumovirus, a single-stranded negative strand RNA virus, and has A, B two types of antigens. The only two antigens that the adsorption protein (G) and fusion protein (F) on the RSV surface are capable of inducing a neutralizing antibody response. The G protein is a protein responsible for viral adhesion to cell membrane surfaces, but it has antigenic variability and is difficult to produce a broad spectrum of protective drugs. The F protein is responsible for the fusion of viruses and cells, presents more neutralizing antibody targeting epitopes, is an important target point of most vaccines and immunotherapeutic drugs in the current research and development, and is also a target point for preventing RSV diseases through palivizumab and motavizumab clinically at present. The F protein has two conformations, pre-fusion and post-fusion, most of the strong neutralizing epitopes are concentrated in the F protein in the pre-fusion conformation, so antibodies capable of neutralizing the F protein in the pre-fusion conformation are currently in urgent need.

Neutralizing antibodies have been demonstrated to be effective methods of treating viral diseases to date. Currently marketed drugs for the treatment and prophylaxis of viral infections are palivizumab (Synagis) for the prophylaxis of pediatric Respiratory Syncytial Virus (RSV) infections, ai Bali bead mab (Trogarzo) for the treatment of HIV infections, and Rabishield for prophylaxis after rabies virus exposure. In addition, there are a number of monoclonal antibodies against different viruses at different stages of clinical studies (https:// clinicaltrias /). Antibodies function primarily through two aspects. In one aspect, antibodies with neutralizing activity can block viral infection by binding to viral envelope proteins, blocking binding of the virus to cellular receptors. On the other hand, antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) recruit immune cells and molecules such as macrophages or complement to eliminate free virus and infected cells.

Therefore, there is a need to develop neutralizing antibodies against respiratory syncytial virus to provide an effective means of preventing and treating respiratory syncytial virus infection.

Disclosure of Invention

In the present application, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Moreover, the cell culture, molecular genetics, nucleic acid chemistry, immunological laboratory procedures used herein are all conventional procedures widely used in the corresponding field. Meanwhile, in order to better understand the present application, definitions and explanations of related terms are provided below.

As used herein, the term "antibody" refers to an immunoglobulin molecule that is typically composed of two pairs of polypeptide chains, each pair having one "light" (L) chain and one "heavy" (H) chain. Antibody light chains can be classified as kappa and lambda light chains. Heavy chains can be classified as μ, δ, γ, α or ε, and the isotypes of antibodies are defined as IgM, igD, igG, igA and IgE, respectively. Within the light and heavy chains, the variable and constant regions are linked by a "J" region of about 12 or more amino acids, and the heavy chain also comprises a "D" region of about 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of 3 domains (CH 1, CH2 and CH 3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain CL. The constant region of an antibody may mediate the binding of an immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1 q). VH and VL regions can also be subdivided into regions of high variability, termed Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, termed Framework Regions (FR). Each VH and VL is prepared from the following sequence: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 consist of 3 CDRs and 4 FRs arranged from amino-terminus to carboxy-terminus. The variable regions (VH and VL) of each heavy/light chain pair form the antibody binding sites, respectively. The assignment of amino acids to regions or domains follows Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, bethesda, md. (1987 and 1991)), or Chothia & Lesk (1987) J.mol.biol.196:901-917; definition of Chothia et al (1989) Nature 342:878-883. The term "antibody" is not limited by any particular method of producing an antibody. For example, it includes recombinant antibodies, monoclonal antibodies and polyclonal antibodies. The antibodies may be of different isotypes, for example, igG (e.g., igG1, igG2, igG3, or IgG4 subclasses), igA1, igA2, igD, igE, or IgM antibodies.

As used herein, the term "antigen-binding fragment" of an antibody refers to a polypeptide comprising a fragment of a full-length antibody that retains the ability to specifically bind to the same antigen to which the full-length antibody binds, and competes with the full-length antibody for specific binding to an antigen, also referred to as an "antigen-binding portion. In general, see, fundamental Immunology, ch.7 (Paul, W., ed., 2 nd edition, raven Press, N.Y. (1989), which is incorporated herein by reference in its entirety for all purposes, antigen binding fragments of antibodies may be generated by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.

In some cases, the antigen-binding fragment of an antibody is a single chain antibody (e.g., an scFv), wherein the VL and VH domains form a monovalent molecule by pairing to enable production of a linker that is a single polypeptide chain (see, e.g., bird et al, science242:423 426 (1988) and hunton et al, proc. Natl. Acad. Sci. USA 85:5879 5883 (1988)). Such scFv molecules may have the general structure: NH 2-VL-linker-VH-COOH or NH 2-VH-linker-VL-COOH. Suitable prior art linkers consist of repeated GGGGS amino acid sequences or variants thereof. For example, a linker having the amino acid sequence (GGGGS) 4 may be used, but variants thereof may also be used (Holliger et al (1993), proc.Natl. Acad. Sci. USA 90:6444-6448). Other linkers useful in the present application are described by Alfthan et al (1995), protein Eng.8:725-731, choi et al (2001), eur.J.Immunol.31:94-106, hu et al (1996), cancer Res.56:3055-3061, kipriyanov et al (1999), J.mol.biol.293:41-56 and Roovers et al (2001), cancer Immunol.

In some cases, the antigen-binding fragment of an antibody is a diabody, i.e., a diabody, in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow pairing between two domains of the same chain, forcing the domains to pair with complementary domains of the other chain and creating two antigen-binding sites (see, e.g., holliger p. Et al, proc. Natl. Acad. Sci. Usa 90:6444 6448 (1993), and Poljak r. J. Et al, structure2:1121 1123 (1994)).

The antigen-binding fragment of an antibody (e.g., the antibody fragment described above) can be obtained from a given antibody (e.g., monoclonal antibody SAARI009 provided herein) using conventional techniques known to those skilled in the art (e.g., recombinant DNA techniques or enzymatic or chemical cleavage methods), and specifically screened in the same manner as used for intact antibodies.

In this context, unless the context clearly indicates otherwise, when referring to the term "antibody" it includes not only whole antibodies, but also antigen-binding fragments of antibodies.

As used herein, the term "monoclonal antibody" refers to an antibody or a fragment of an antibody from a population of highly homologous antibody molecules, i.e., a population of identical antibody molecules except for natural mutations that may occur spontaneously. Monoclonal antibodies have a high specificity for a single epitope on an antigen. Polyclonal antibodies are relative to monoclonal antibodies, which typically comprise at least 2 or more different antibodies, which typically recognize different epitopes on an antigen. Monoclonal antibodies are generally obtainable by the hybridoma technique first reported by Kohler et al (Nature, 256:495, 1975), but also by recombinant DNA techniques (see, e.g., journal of virological methods,2009,158 (1-2): 171-179).

As used herein, a "neutralizing antibody" refers to an antibody or antibody fragment that is capable of clearing or significantly reducing the virulence (e.g., the ability to infect a cell) of a virus of interest.

As used herein, the term "escherichia coli expression system" refers to an expression system consisting of escherichia coli (strain) and a vector, wherein the escherichia coli (strain) is derived from commercially available strains such as, but not limited to: GI698, ER2566, BL21 (DE 3), B834 (DE 3), BLR (DE 3).

As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide may be inserted. When a vector enables expression of a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; artificial chromosomes, such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC), or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. Animal viruses that may be used as vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (e.g., herpes simplex virus), poxvirus, baculovirus, papilloma virus, papilloma vacuolation virus (e.g., SV 40). A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication origin.

As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, including, but not limited to, a prokaryotic cell such as e.g. e.coli or bacillus subtilis, a fungal cell such as e.g. yeast cells or aspergillus, an insect cell such as e.g. S2 drosophila cells or Sf9, or an animal cell such as e.g. fibroblasts, CHO cells, COS cells, NSO cells, heLa cells, BHK cells, HEK293 cells or human cells.

As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as a reaction between an antibody and an antigen against which it is directed. In certain embodiments, an antibody that specifically binds to (or has specificity for) an antigen means that the antibody binds to or has specificity for an antigen in an amount of less than about 10 ^-5 M, e.g. less than about 10 ^-6 M、10 ^-7 M、10 ^-8 M、10 ^-9 M or 10 ^-10 M or less affinity (KD) binds the antigen.

As used herein, the term "KD" refers to the dissociation equilibrium constant of a particular antibody-antigen interaction, which is used to describe the binding affinity between an antibody and an antigen. The smaller the equilibrium dissociation constant, the tighter the antibody-antigen binding, and the higher the affinity between the antibody and antigen. Typically, the antibodies (e.g., monoclonal antibodies RV8, RV11 of the application) are less than about 10 ^- ⁵ M, e.g. less than about 10 ^-6 M、10 ^-7 M、10 ^-8 M、10 ^-9 M or 10 ^-10 M or less, and an dissociation equilibrium constant (KD) binds to an antigen (e.g., respiratory syncytial virus F protein), e.g., as determined in a BIACORE instrument using Surface Plasmon Resonance (SPR).

In the present application, amino acids are generally indicated by single-letter and three-letter abbreviations well known in the art. For example, alanine can be represented by A or Ala.

As used herein, the term "neutralizing activity" refers to the functional activity of an antibody or antibody fragment that binds to an antigenic protein on a virus, thereby preventing the maturation of virus-infected cells and/or virus progeny and/or the release of virus progeny, and an antibody or antibody fragment having neutralizing activity may prevent the amplification of a virus, thereby inhibiting or eliminating the infection by a virus.

As used herein, the terms "respiratory syncytial virus" and "RSV" have the same meaning and are used interchangeably.

The inventor finds an antibody SAARI009 after a great deal of experimental research, can specifically identify and target the F protein of respiratory syncytial virus, particularly the F protein in a pre-fusion conformation, and shows the capability of efficiently neutralizing the virus. Thus, the antibodies of the application are particularly suitable for use in the diagnosis, prevention and treatment of respiratory syncytial virus infection or diseases associated with respiratory syncytial virus infection (e.g. bronchiolitis, croup).

In a first aspect of the present application there is provided a monoclonal antibody (SAARI 009), or an antigen binding fragment thereof, comprising, heavy chain variable region (VH) complementarity determining regions 1-3 (CDR 1-3) of SAARI009 amino acid sequences as shown in SEQ ID NOS 1-3, respectively; SAARI009 amino acid sequence is shown in SEQ ID NO. 4-6 as light chain variable region (VL) complementarity determining regions 1-3 (CDR 1-3), respectively.

(CDR of variable region)

In certain preferred embodiments, the monoclonal antibody SAARI009 comprises a heavy chain variable region (VH) as shown in SEQ ID NO. 7and a light chain variable region (VL), (variable region) as shown in SEQ ID NO. 8

In certain preferred embodiments, the monoclonal antibody further has a leader sequence at the N-terminus of the heavy chain variable region. In certain preferred embodiments, the SAARI009 leader sequence has the amino acid sequence shown in SEQ ID NO. 11. (leader sequence)

In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof is selected from the group consisting of Fab, fab ', F (ab') ₂ Fd, fv, dAb, each otherA complement-determining region fragment, a single chain antibody (e.g., scFv), a human antibody, a chimeric antibody, or a bispecific or multispecific antibody.

In certain preferred embodiments, the monoclonal antibody SAARI009 further comprises the amino acid sequence of the heavy chain constant region (CH) shown in SEQ ID NO. 9 and the amino acid sequence of the light chain constant region (CL) shown in SEQ ID NO. 10.

In certain preferred embodiments, the light chain of the monoclonal antibody is kappa-type.

In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof is capable of specifically binding to the pre-fusion conformation (pre-fusion) of the respiratory syncytial virus fusion protein (F protein). In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof is capable of targeting the post-fusion conformation (post-fusion) of a fusion protein (F protein) of respiratory syncytial virus. In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof is capable of inhibiting F protein-mediated membrane fusion processes, inhibiting viral infection of cells.

In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof has neutralizing capacity (e.g., is capable of neutralizing respiratory syncytial virus). In certain preferred embodiments, the monoclonal antibody or antigen binding fragment thereof is capable of inhibiting respiratory syncytial virus infection or entry into a host cell. Thus, the monoclonal antibody or antigen binding fragment thereof is capable of neutralizing respiratory syncytial virus and thereby preventing and treating respiratory syncytial virus infection.

The application also provides isolated nucleic acid molecules encoding the monoclonal antibodies or antigen binding fragments thereof of the application. Such nucleic acid molecules are not limited to the method by which they are produced, and may be obtained using genetic engineering recombinant techniques or chemical synthetic methods.

Accordingly, in another aspect, the application provides an isolated nucleic acid molecule comprising a nucleotide sequence capable of encoding an antibody heavy chain variable region (VH), wherein the antibody sairi 009 heavy chain variable region has the nucleotide sequence set out in SEQ ID No. 12.

In another aspect, the application provides an isolated nucleic acid molecule comprising a nucleotide sequence capable of encoding an antibody light chain variable region (VL), wherein the antibody sairi 009 light chain variable region has the nucleotide sequence set forth in SEQ ID No. 13.

In a preferred embodiment, the nucleic acid molecule further comprises a nucleotide sequence encoding a leader sequence located 5' to the nucleotide sequence capable of encoding the heavy chain variable region of the antibody. In certain preferred embodiments, the antibody SAARI009 leader sequence has the nucleotide sequence set forth in SEQ ID NO. 16.

In certain preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide comprising a nucleotide sequence encoding a leader sequence and a nucleotide sequence capable of encoding a heavy chain variable region of an antibody; and a second polynucleotide comprising a nucleotide sequence encoding a leader sequence and a nucleotide sequence capable of encoding an antibody light chain variable region.

In certain preferred embodiments, the isolated nucleic acid molecule of SAARI009 comprises a first polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO. 16 and the nucleotide sequence set forth in SEQ ID NO. 12; and a second polynucleotide comprising the nucleotide sequence shown as SEQ ID NO. 16 and the nucleotide sequence shown as SEQ ID NO. 13.

In certain preferred embodiments, the isolated nucleic acid molecule further comprises a nucleotide sequence capable of encoding a heavy chain constant region of an antibody. In certain preferred embodiments, the nucleotide sequence capable of encoding the antibody heavy chain constant region in SAARI009 has the nucleotide sequence set forth in SEQ ID NO. 14.

In certain preferred embodiments, the isolated nucleic acid molecule further comprises a nucleotide sequence capable of encoding an antibody light chain constant region. In certain preferred embodiments, the nucleotide sequence capable of encoding an antibody light chain constant region in SAARI009 has the nucleotide sequence set forth in SEQ ID NO. 15.

In certain preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide comprising a nucleotide sequence encoding a leader sequence, a nucleotide sequence capable of encoding a heavy chain variable region of an antibody, and a nucleotide sequence capable of encoding a heavy chain constant region of an antibody; and a second polynucleotide comprising a nucleotide sequence encoding a leader sequence, a nucleotide sequence capable of encoding an antibody light chain variable region, and a nucleotide sequence capable of encoding an antibody light chain constant region.

In certain preferred embodiments, the isolated nucleic acid molecule comprises a first polynucleotide, wherein the first polynucleotide in SAARI009 comprises the nucleotide sequence set forth in SEQ ID NO. 16, SEQ ID NO. 12 and SEQ ID NO. 14; and, a second polynucleotide, the second polynucleotide in SAARI009 comprising the nucleotide sequence set forth in SEQ ID NO. 16, SEQ ID NO. 13 and SEQ ID NO. 15.

In certain preferred embodiments, the monoclonal antibody sairi 009 is a pharmaceutical comprising: the amino acid sequences are shown as VH CDR1-3 shown as SEQ ID NO 1-3, VL CDR1-3 shown as SEQ ID NO 4-6, VH shown as SEQ ID NO 7, VL shown as SEQ ID NO 8, CH shown as SEQ ID NO 9 and CL shown as SEQ ID NO 10, respectively. Wherein the VH CDR1 amino acid sequence is: ADTFTNYW (SEQ ID NO: 1), IYPGDSDT (SEQ ID NO: 2) as the amino acid sequence of VH CDR2, ARQVGGVVTTEDNNYLYGMDV (SEQ ID NO: 3) as the amino acid sequence of VH CDR 3; the amino acid sequence of VL CDR1 is QSISTF (SEQ ID NO: 4), the amino acid sequence of VL CDR2 is DTD (SEQ ID NO: 5), and the amino acid sequence of VL CDR3 is QQSRFIPII (SEQ ID NO: 6).

In another aspect, the application provides a vector comprising an isolated nucleic acid molecule as defined above. The vector of the present application may be a cloning vector or an expression vector. In certain preferred embodiments, the vectors of the present application are, for example, plasmids, cosmids, phages and the like.

In another aspect, there is also provided a host cell comprising an isolated nucleic acid molecule or vector of the application. Such host cells include, but are not limited to, prokaryotic cells, such as E.coli cells, and eukaryotic cells, such as yeast cells, insect cells, plant cells, and animal cells (e.g., mammalian cells, e.g., mouse cells, human cells, etc.). The cells of the application may also be cell lines, such as 293T cells.

In another aspect, there is also provided a method of producing a monoclonal antibody or antigen-binding fragment thereof of the application, comprising culturing a host cell of the application under suitable conditions, and recovering the monoclonal antibody or antigen-binding fragment thereof of the application from the cell culture.

In another aspect, the application provides a kit comprising a monoclonal antibody of the application or an antigen-binding fragment thereof. In certain preferred embodiments, the monoclonal antibodies or antigen binding fragments thereof of the application further comprise a detectable label. In certain preferred embodiments, the kit further comprises a second antibody that specifically recognizes the monoclonal antibody of the application or antigen-binding fragment thereof. Preferably, the second antibody further comprises a detectable label. Such detectable labels are well known to those skilled in the art and include, but are not limited to, radioisotopes, fluorescent materials, luminescent materials, colored materials, enzymes (e.g., horseradish peroxidase), and the like.

In another aspect, the application provides a method of detecting the presence or level of respiratory syncytial virus or F protein thereof in a sample, comprising using a monoclonal antibody or antigen-binding fragment thereof of the application. In certain preferred embodiments, the monoclonal antibodies or antigen binding fragments thereof of the application further comprise a detectable label. In another preferred embodiment, the method further comprises detecting the monoclonal antibody of the application or antigen-binding fragment thereof using a second antibody carrying a detectable label. The method may be used for diagnostic purposes (e.g., the sample is a sample from a patient) or for non-diagnostic purposes (e.g., the sample is a cell sample, not a sample from a patient).

In another aspect, the application provides a method of diagnosing whether a subject is infected with respiratory syncytial virus, comprising: the monoclonal antibodies or antigen binding fragments thereof of the application are used to detect the presence of respiratory syncytial virus or F protein thereof in a sample from the subject. In certain preferred embodiments, the monoclonal antibodies or antigen binding fragments thereof of the application further comprise a detectable label. In another preferred embodiment, the method further comprises detecting the monoclonal antibody or antigen-binding fragment thereof or anti-idiotype antibody of the application using a second antibody carrying a detectable label.

In another aspect, there is provided the use of a monoclonal antibody or antigen binding fragment thereof or an anti-idiotype antibody of the application in the preparation of a kit for detecting the presence or level of respiratory syncytial virus or its F protein in a sample, or for diagnosing whether a subject is infected with respiratory syncytial virus.

In certain preferred embodiments, the sample includes, but is not limited to, fecal matter from a subject (e.g., mammal, preferably human), oral or nasal secretions, alveolar lavage, and the like.

General methods for detecting the presence or level of a virus or antigen of interest (e.g., respiratory syncytial virus or F protein thereof) in a sample using antibodies or antigen binding fragments thereof are well known to those skilled in the art. In certain preferred embodiments, the detection method may use enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay, chemiluminescent immunoassay, radioimmunoassay, fluorescent immunoassay, immunochromatography, competition method, and the like.

In another aspect, the application provides a pharmaceutical composition comprising a monoclonal antibody or antigen-binding fragment thereof of the application, and a pharmaceutically acceptable carrier and/or excipient.

In another aspect, the application provides a method for neutralizing respiratory syncytial virus virulence in a sample comprising contacting a sample comprising respiratory syncytial virus with a monoclonal antibody or antigen binding fragment thereof of the application. Such methods may be used for therapeutic purposes, or for non-therapeutic purposes (e.g., the sample is a cell sample, not a patient or a sample from a patient).

In another aspect, there is provided the use of a monoclonal antibody or antigen binding fragment thereof of the application for the manufacture of a medicament for neutralising respiratory syncytial virus virulence in a sample.

In another aspect, there is provided the use of a monoclonal antibody or antigen-binding fragment thereof or an anti-idiotype antibody of the application in the manufacture of a pharmaceutical composition for the prevention or treatment of respiratory syncytial virus infection or a disease associated with respiratory syncytial virus infection (e.g. bronchiolitis, croup) in a subject.

In another aspect, the application provides a method for preventing or treating respiratory syncytial virus infection or a disease associated with respiratory syncytial virus infection (e.g. bronchiolitis, croup) in a subject, comprising administering to a subject in need thereof a prophylactically or therapeutically effective amount of a monoclonal antibody of the application, or an antigen-binding fragment thereof, or a pharmaceutical composition of the application.

The monoclonal antibodies of the application or antigen-binding fragments thereof or the pharmaceutical compositions of the application may be administered to a subject by any suitable route of administration. Such routes of administration include, but are not limited to, oral, buccal, sublingual, topical, parenteral, rectal, intrathecal, or nasal routes.

The medicaments and pharmaceutical compositions provided by the application can be used singly or in combination, and can also be used in combination with other pharmaceutically active agents (such as antiviral medicaments). In certain preferred embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

The information of the partial sequences according to the present application is shown in table 1 below.

TABLE 1 information on partial sequences

Advantageous effects

The monoclonal antibody provided by the application can be combined with the F protein of the respiratory syncytial virus with high affinity, and has strong neutralizing activity on the respiratory syncytial virus. For example, SAARI009 antibodies of the application have an affinity of 0.0032nM or less for the F protein in the pre-fusion conformation of the A2 strain, do not bind to the F protein in the post-fusion conformation, and have a neutralizing titer against respiratory syncytial virus (half inhibitory concentration, IC) ₅₀ ) 0.02ng/mL. Therefore, the monoclonal antibody SAARI009 provided by the application has clinical application value for preventing and treating respiratory syncytial virus infection.

Drawings

FIG. 1 shows the results of molecular sieve analysis and SDS-PAGE detection of the conformation F protein before fusion of respiratory syncytial virus.

FIG. 2 shows the molecular sieve analysis result and SDS-PAGE detection result of the recombinant expressed SAARI009 antibody, wherein "-DTT" on the gel chart indicates that no DTT was added (non-reducing SDS-PAGE); "+DTT" means that DTT (reducing SDS-PAGE) was added.

FIG. 3 shows the results of the kinetics of SAARI009 antibodies binding to the F protein.

FIG. 4 shows the neutralizing activity of SAARI009 antibodies at various concentrations against the RSV live virus.

Detailed Description

The application will now be described with reference to the following examples, which are intended to illustrate the application, but not to limit it.

In order to obtain a neutralizing antibody having a protective effect, the present inventors first screened memory B cells capable of specifically binding to F protein DS-Cav1 from healthy adult Peripheral Blood Mononuclear Cells (PBMCs) by flow sorting using F protein DS-Cav1 transiently expressing RSV 293F as an antigen, and then performed RT-PCR on the single B cells obtained by the screening to obtain a sequence encoding an antibody variable region. Further, a sequence encoding the variable region of the antibody and the constant region gene were ligated into an expression vector, and expressed and purified in mammalian cells, thereby obtaining antibody SAARI009. A series of functional tests are carried out on the antibody SAARI009, and the results show that the antibody SAARI009 can specifically bind to F protein in a pre-fusion conformation, inhibit infection of human cells by RSV and have neutralizing activity against RSV infection.

In the examples below, unless otherwise indicated, the molecular biology experimental methods and immunoassays used in the present application are basically described with reference to J.Sambrook et al, molecular cloning: laboratory Manual, 2 nd edition, cold spring harbor laboratory Press, 1989, and F.M. Ausubel et al, fine-compiled guidelines for molecular biology experiments, 3 rd edition, john Wiley & Sons, inc., 1995; the use of restriction enzymes was in accordance with the conditions recommended by the manufacturer of the product. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention. Those skilled in the art will appreciate that the examples describe the application by way of example and are not intended to limit the scope of the application as claimed.

Example 1: expression and purification of RSV F protein

DNA fragments encoding DS-Cav1 (the amino acid sequence of which is shown in SEQ ID NO: 17) of the RSV strain F protein were ligated to pCAGGS vector using NdeI and XhoI enzymes, and the DNA fragments were further ligated to nucleotide sequence encoding 6-histidine tag (6-His tag) and stop codon at the 3' -end of the coding region. The ligation products were transformed into DH 5. Alpha. E.coli competent cells. Then, selecting a monoclonal, inoculating the monoclonal into 5mL of LB culture medium, and culturing for 6-8 hours; then transferring and inoculating to 300mL of LB culture medium, culturing for 12-16 hours, collecting thalli, extracting DS-Cav1 plasmid by using a large endotoxin-free plasmid kit (TIANGEN), and transfecting 293F cells with the extracted plasmid to express F protein. Subsequently, the F protein was purified by affinity chromatography and molecular sieve chromatography using AKTA-purifier (GE), histrap ^TM HP, superdex200 Hiload 10/300 column (GE) and buffers A (20mM Tris,150mM NaCl,pH 8.0), B (20mM Tris,150mM NaCl,1MIminazole,pH 8.0) and the UV absorbance at 280nm were monitored simultaneously during purification to collect fractions containing the protein of interest. After purification, the purity of the target protein (DS-Cav 1) was identified by SDS-PAGE. The results are shown in FIG. 1.The results in FIG. 1 show that high purity F protein (DS-Cav 1) was obtained, with a monomer size of 50kDa.

Example 2: isolation of memory B cells specifically recognizing F protein

20mL of blood was collected and PBMCs were isolated with informed consent from healthy volunteers. Isolated PBMCs at 1X 10 ⁷ Density/mL and final concentration of 400nM DS-Cav1 protein (prepared in example 1) were incubated on ice for half an hour; then washed 2 times with PBS (containing 2% fbs) and incubated with the following antibodies (all purchased from BD): anti-human CD3/PE-Cy5, anti-human CD16/PE-Cy5, anti-human CD235a/PE-Cy5, anti-human CD19/APC-Cy7, anti-human CD27/Pacific Blue, anti-human CD38/APC, anti-human IgG/FITC, and anti-His/PE. After half an hour incubation on ice, the PBMCs were washed 2 times with PBS (containing 2% FBS). Subsequently, PBMCs were sorted with FACSAria III and PE was collected ^- Cy5 ^- APC ^- APC ^- Cy7 ⁺ Pacific Blue ⁺ FITC ⁺ PE ⁺ I.e., B cells) were collected directly into 96-well plates, 1 cell/well.

Example 3: isolation and identification of SAARI009 antibodies

The B cells obtained in example 2 were reverse transcribed (at 55 ℃ for 60 minutes) using Superscript III reverse transcriptase (Invitrogen), wherein the reverse transcription primers used are shown in table 2.

TABLE 2 sequence information of reverse transcription primers used

Primer(s)	5'-3' sequence
		IgM-RT(SEQ)	ATGGAGTCGGGAAGGAAGTC
IgD-RT	TCACGGACGTTGGGTGGTA
		IgE-RT	TCACGGAGGTGGCATTGGA
IgA1-RT	CAGGCGATGACCACGTTCC
		IgA2-RT	CATGCGACGACCACGTTCC
IgG-RT	AGGTGTGCACGCCGCTGGTC
		Cκ-new RT	GCAGGCACACAACAGAGGCA
Cλ-new-ext	AGGCCACTGTCACAGCT

First round PCR (PCRa) was performed using the reverse transcription product as a template and the HotStar Tap Plus enzyme (QIAgen), and the sequence of the antibody variable region was amplified; wherein the primers used are shown in Table 3; the reaction conditions used were as follows: 95 ℃ for 5min;35 cycles (95 ℃ 30s,55 ℃ (heavy chain/kappa chain) 30s,72 ℃ 90 s); 72℃for 7min. Subsequently, a second round of PCR (PCRb) was performed using the amplified product as a template; wherein the primers used are shown in Table 4; the reaction conditions used were as follows: 95 ℃ for 5min;35 cycles (95 ℃ 30s,58 ℃ (heavy chain)/60 ℃ (kappa chain)/64 ℃ (lambda chain) 30s,72 ℃ 90 s); 72℃for 7min.

The PCR products were separated by 1% agarose gel electrophoresis. The PCR product with the band size of 400-500bp was recovered and sent to sequencing company for sequencing. Sequencing results were analyzed using NCBI online software.

By sequencing, the sequence of an antibody was obtained and designated SAARI009. The amino acid sequence of the heavy chain variable region of SAARI009 antibody is shown as SEQ ID NO. 7 (the coding gene is shown as SEQ ID NO. 12), and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 8 (the coding gene is shown as SEQ ID NO. 13). Sequence identity of SAARI009 antibodies to germline genes is shown in tables 5-6 below.

TABLE 3 primers used in the first round of PCR (PCRa)

Primer name	5’-3’
		VH1-Ext	CCATGGACTGGACCTGGAGG
VH2-Ext	ATGGACATACTTTGTTCCA
		VH3-Ext	CCATGGAGTTTGGGCTGAGC
VH4-Ext	ATGAAACACCTGTGGTTCTT
		VH5-Ext	ATGGGGTCAACCGCCATCCT
VH6-Ext	ATGTCTGTCTCCTTCCTCAT
		IgG-Ext	CGCCTGAGTTCCACGACACC
Vκ1-2-Ext	GCTCAGCTCCTGGGGCT
		Vκ3-Ext	GGAARCCCCAGCDCAGC
Vκ4-5-Ext	CTSTTSCTYTGGATCTCTG
		Vκ6-7-Ext	CTSCTGCTCTGGGYTCC
Cκ-Ext	GAGGCAGTTCCAGATTTCAA
		Vλ1-Ext	CCTGGGCCCAGTCTGTG
Vλ2-Ext	CTCCTCASYCTCCTCACT
		Vλ3-Ext	GGCCTCCTATGWGCTGAC
Vλ31-Ext	GTTCTGTGGTTTCTTCTGAGCTG
		Vλ4ab-Ext	ACAGGGTCTCTCTCCCAG
Vλ4c-Ext	ACAGGTCTCTGTGCTCTGC
		Vλ5-9-Ext	CCCTCTCSCAGSCTGTG
Vλ6-Ext	TCTTGGGCCAATTTTATGC
		Vλ7-8-Ext	ATTCYCAGRCTGTGGTGAC
Vλ10-Ext	CAGTGGTCCAGGCAGGG
		Cλ-new-Ext	AGGCCACTGTCACAGCT

TABLE 4 primers used in the second round PCR (PCRb)

TABLE 5 comparison of SAARI009 antibody heavy chain to germline Gene

	V-H alleles	D-H allelesGene	J-H alleles	Consistency (V-H)
					SAARI009	5-51*01	3-3*01	6*04	93.2％

TABLE 6 comparison of SAARI009 antibody light chain to germline Gene

	V-L alleles	J-L alleles	Consistency (V-L)
				SAARI009	1-39*01	5*01	92.60％

The nucleotide sequences encoding the heavy chain/light chain variable regions obtained by analysis are respectively connected with the corresponding nucleotide sequences encoding the heavy chain/kappa chain constant regions by bypass PCR, and then are respectively cloned into an expression vector pCAGGS (purchased from Addgene), so that recombinant expression vectors respectively encoding the heavy chain and the light chain of the antibody are obtained. The construction scheme for constructs expressing heavy and light chains is as follows:

heavy chain coding sequence (5 '-3'): CMV promoter-EcoR I cleavage site-leader sequence gene-VH gene-CH gene-Xho I cleavage site;

light chain (kappa) coding sequence (5 '-3'): CMV promoter-Sac I cleavage site-leader sequence gene-VL gene-CL (kappa) gene-Xho I cleavage site;

wherein the amino acid sequence of the leader sequence is shown as SED ID NO. 11 (the coding gene is shown as SEQ ID NO. 16), the amino acid sequence of CH is shown as SED ID NO. 9 (the coding gene is shown as SEQ ID NO. 14), and the amino acid sequence of CL is shown as SED ID NO. 10 (the coding gene is shown as SEQ ID NO. 15).

Example 4: expression purification of SAARI009 antibodies

293F cells were used. 293F cells were co-transfected with the recombinant expression vectors encoding the heavy and light chains of the antibody, respectively, obtained in example 3. The feed solution was fed at 24 and 72 hours, cultured for 6 days, and the supernatant was collected.

The collected supernatant was centrifuged at 8000rpm for 120min, and then mixed with an equal volume of buffer containing 20mM sodium phosphate (pH 7.0), followed by filtration through a 0.22 μm filter, and then loaded onto a protein A pre-cartridge (5mL,GE Healthcare). Proteins bound to the pre-cartridge were eluted with 100mM glycine (pH 3.0). The eluted protein is concentrated and then purified by molecular sieve chromatography. Subsequently, the purified target protein was detected by SDS-PAGE (reducing and non-reducing), in which the antibody exhibited a single band, and in which the Fc region disulfide bond of the antibody was opened under reducing conditions, thereby showing two bands, and the purity of the antibody exceeded 95%, as shown in FIG. 2.

Example 5: assessment of ability of SAARI009 antibody to bind to F protein

In this example, molecular interaction analysis was performed using BLI (BioFort Octet). The method comprises the following specific steps:

first, DS-Cav1 was immobilized on NTA-Ni Sensors, 50ug/mL. The purified SAARI009 antibody was then bound by means of antibody capture. In addition, PBST (0.05% added to spit)Warm-20) serial multiple dilutions of sairi 009 antibody. Serial dilutions of antibodies were then added sequentially to each well of the 96-well plate (one-by-one loading from low concentrations). The kinetics of SAARI009 antibody binding to DS-Cav1 protein was recorded (FIG. 3), and the kinetics constants were calculated using BLI data software to give a KD of 6.175E-11, (R) ² 0.9999). The results show that SAARI009 antibodies were able to bind with higher affinity to the F protein of RSV.

Example 6: assessment of ability of SAARI009 antibody to neutralize RSV live virus

SAARI009 antibody purified from example 4 was diluted to a 11 th gradient (0.0098. Mu.g/mL) at a beginning doubling ratio of 25. Mu.g/mL, and then separately combined with half the Tissue Culture Infectious Dose (TCID) ₅₀ ) BetaCoV/Szhen/SZTH-003/2020 virus (GISAID No. EPI_ISL_406594, available from Shenzhen third people's Hospital, shenzhen) was mixed and incubated at 37℃for 1 hour. After incubation, the virus was added to 96-well plates pre-inoculated with Hep-2 cells and incubated for 3 hours, DMEM (2% fbs) medium was added and incubated at 37 degrees celsius, 5% co ₂ Cultured in an incubator for 4 days, cytopathic effect (CPE) was observed, and the neutralization titer of the sairi 009 antibody was calculated. The results are shown in FIG. 4. FIG. 4 shows the neutralization activity of SAARI009 antibodies at various concentrations compared to the palivizumab/Nirsevelimab anti-RSV live virus. The results showed that SAARI009 antibody had a neutralizing titer (semi-inhibitory concentration, IC ₅₀ ) 20ng/mL, 120ng/mL.

Claims

1. A monoclonal antibody or antigen binding fragment thereof comprising complementarity determining regions 1-3 of heavy chain variable regions having amino acid sequences shown in SEQ ID NOS 1-3, respectively; and/or, the amino acid sequences are respectively shown as complementarity determining regions 1-3 of the light chain variable regions shown as SEQ ID NOS 4-6;

preferably, the monoclonal antibody comprises a heavy chain variable region as shown in SEQ ID NO. 7 and/or a light chain variable region as shown in SEQ ID NO. 8;

preferably, the monoclonal antibody further has a leader sequence at the N-terminus of the heavy chain variable region, and/or the monoclonal antibody further has a leader sequence at the N-terminus of the light chain variable region;

preferably, the leader sequence of the monoclonal antibody has an amino acid sequence as shown in SEQ ID NO. 11;

preferably, the monoclonal antibody or antigen binding fragment thereof is selected from the group consisting of Fab, fab ', F (ab') ₂ Fd, fv, dAb, complementarity determining region fragments, single chain antibodies (e.g., scFv), human antibodies, chimeric antibodies, or bispecific or multispecific antibodies;

preferably, the monoclonal antibody further comprises a heavy chain constant region; preferably, the amino acid sequence of the heavy chain constant region of SAARI009 is shown in SEQ ID NO. 9;

preferably, the monoclonal antibody further comprises a light chain constant region; preferably, the amino acid sequence of the light chain constant region of SAARI009 is shown in SEQ ID NO. 10.

2. An isolated nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof of claim 1.

3. The isolated nucleic acid molecule of claim 2 comprising a nucleic acid sequence capable of encoding a heavy chain variable region of an antibody, wherein the heavy chain variable region of the antibody comprises complementarity determining regions 1-3 of the heavy chain variable regions having amino acid sequences set forth in SEQ ID NOs 1-3, respectively;

preferably, the antibody heavy chain variable region has an amino acid sequence as shown in SEQ ID NO. 7;

more preferably, the nucleic acid molecule has the nucleotide sequence shown as SEQ ID NO. 12.

4. The isolated nucleic acid molecule of claim 2 comprising a nucleic acid sequence capable of encoding an antibody light chain variable region, wherein said antibody light chain variable region comprises complementarity determining regions 1-3 of the light chain variable region having amino acid sequences of SEQ ID NOs 4-6;

preferably, the antibody light chain variable region has an amino acid sequence as set forth in SEQ ID NO. 8;

more preferably, the nucleic acid molecule has the nucleotide sequence shown as SEQ ID NO. 13.

5. A vector comprising the isolated nucleic acid molecule of any one of claims 2-4.

6. A host cell comprising the isolated nucleic acid molecule of any one of claims 2-4 or the vector of claim 5.

7. A kit comprising the monoclonal antibody or antigen-binding fragment thereof of claim 1;

preferably, the monoclonal antibody or antigen binding fragment thereof further comprises a detectable label, such as a radioisotope, a fluorescent substance, a luminescent substance, a colored substance, and an enzyme;

more preferably, the kit further comprises a second antibody that specifically recognizes the monoclonal antibody or antigen-binding fragment thereof or an anti-idiotype antibody; optionally, the secondary antibodies further comprise detectable labels, such as radioisotopes, fluorescent substances, luminescent substances, colored substances and enzymes.

8. A method for detecting the presence or level of respiratory syncytial virus or F protein thereof in a sample for non-diagnostic purposes comprising detecting using the monoclonal antibody or antigen-binding fragment thereof of claim 1;

for example, the monoclonal antibody or antigen binding fragment thereof further includes a detectable label, such as a radioisotope, a fluorescent substance, a chemiluminescent substance, a colored substance, and an enzyme;

for example, the method further comprises detecting the monoclonal antibody or antigen-binding fragment thereof or anti-idiotype antibody using a second antibody carrying a detectable label (e.g., radioisotope, fluorescent substance, luminescent substance, colored substance, and enzyme);

preferably, the sample is an excreta, oral or nasal secretion, or alveolar lavage from an environment such as a mammal, preferably a human; the sample is a cell sample not from a patient;

the detection method uses enzyme-linked immunosorbent assay, enzyme immunoassay, chemiluminescent immunoassay, radioimmunoassay, fluorescent immunoassay, immunochromatography and competition method.

9. A pharmaceutical composition comprising the monoclonal antibody or antigen-binding fragment thereof of claim 1, and a pharmaceutically acceptable carrier and/or excipient;

preferably, the pharmaceutical composition further comprises other pharmaceutically active agents, such as famprivir, adefovir, interferon, and the like.

10. Use of the monoclonal antibody or antigen binding fragment thereof according to claim 1 for the preparation of a medicament for neutralising respiratory syncytial virus virulence in a sample, or for preventing or treating respiratory syncytial virus infection or a disease associated with respiratory syncytial virus infection (e.g. bronchiolitis, croup) in a subject;

preferably, the subject is a mammal, such as a human;

preferably, the medicament is used alone or in combination with other pharmaceutically active agents (e.g., fampirvir, rituximab, interferon, etc.);

such routes of administration include, but are not limited to, oral, buccal, sublingual, topical, parenteral, rectal, intrathecal, or nasal routes.