CN116814637A

CN116814637A - Nucleic acid aptamer combined with CSF-1R protein and application thereof

Info

Publication number: CN116814637A
Application number: CN202310758837.1A
Authority: CN
Inventors: 华允芬; 刁寒; 吕少康; 罗昭锋; 张峥; 姜蒙; 卜德吁
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2023-06-26
Filing date: 2023-06-26
Publication date: 2023-09-29

Abstract

The invention discloses a nucleic acid aptamer binding to a CSF-1R protein and application thereof, wherein the nucleic acid aptamer has a nucleotide sequence which has at least 60% homology with any one of SEQ ID NO. 1-SEQ ID NO.4 and binds to the CSF-1R protein. The aptamer has the advantages of small molecular weight, stable structure and chemical property, easy preservation and marking, easy modification and artificial synthesis in a short period, and can still keep high affinity and high specificity with CSF-1R protein after being truncated. The nucleic acid aptamer obtained by the invention can be used for detecting, purifying or imaging the CSF-1R protein, can be used for preparing medicaments for diagnosing or treating abnormal expression of the CSF-1R protein, and the like, and can be used for purifying and obtaining the CSF-1R protein with high sensitivity and high specificity, thereby having wide application prospect.

Description

Nucleic acid aptamer combined with CSF-1R protein and application thereof

Field of the art

The invention belongs to the technical field of biology, and particularly relates to a nucleic acid aptamer combined with CSF-1R protein and application thereof.

(II) background art

Colony stimulating factor-1 receptor (csf-1R) is a single-chain transmembrane glycoprotein consisting of 972 amino acid residues encoded by the c-fms protooncogene, belonging to the type III protein tyrosine kinase receptor family (RTK) and having the main functions of regulating macrophage homeostasis, osteoclast formation, microglial development and maintenance, etc. CSF-1R has 5 immunoglobulin-like domains in the extracellular ligand-binding portion and a single transmembrane domain and split kinase domain in the intracellular portion. Binding of CSF-1R to CSF-1 induces receptor dimerization, which results in conformational changes leading to phosphorylation of tyrosine residues in the intracellular domain. Most of these phosphorylated residues attract effector molecules, activating a series of signaling pathways necessary for macrophage survival, proliferation, differentiation, and motility.

CSF-1R is expressed predominantly in the monocyte lineage, as well as in several other cell types, such as endothelial cells, trophoblast cells, neural progenitor cells, and epithelial cells, with the inherent specificity of tyrosine protein kinases. Several studies have now demonstrated that CSF-1R is significantly highly expressed in various tumor tissues such as lung cancer, breast cancer, ovarian cancer, etc., and is closely related to tumor progression. Several preclinical studies have shown that CSF-1R plays an important regulatory role in the immune system, and can promote proliferation, differentiation, invasion and metastasis of tumor cells by inducing the production of inflammatory cytokines.

The relationship of various components in the tumor microenvironment (tumor microenvironment, TME) to the nature of the tumor is of great interest, where differentiation and polarization of macrophages has a direct effect on the tumor nature, and previous studies have demonstrated that CSF-1R can alter macrophage polarity in the tumor. CSF-1R inhibitors against the tumor immune microenvironment can reduce immune escape, enhance the effectiveness of immunotherapy and traditional cytotoxic therapy, and have been experimentally confirmed in lung cancer, advanced pancreatic cancer, hepatocellular carcinoma and other diseases at present. The FDA has approved the first CSF-1R small molecule inhibitor to be marketed for the treatment of tenosynovial giant cell tumors. There is growing evidence that CSF-1R may be involved, directly or indirectly, in the occurrence of part of the neurological disease.

At present, the specific mechanism of the CSF-1R/CSF-1 axis in malignant tumors and the related research of clinical diagnosis are not perfected, and more deep exploration and clinical verification are still needed, so that the targeting drugs and comprehensive treatment effects are improved, and meanwhile, the novel prediction markers are also helpful to find in the malignant tumors to help clinical early diagnosis and postoperative prediction, and basis is provided for more accurately selecting CSF-1R targeting treatment objects, so that the purposes of individuation treatment and accurate medicine are achieved, and new hopes of regaining treatment are brought to malignant tumor patients.

Aptamer refers to DNA or RNA molecules obtained by screening and separating by an exponential enrichment ligand system evolution (SELEX) technology, and can be combined with other targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has wide prospects in biochemical analysis, environmental monitoring, basic medicine, new drug synthesis and the like. Compared with an antibody, the nucleic acid aptamer has the advantages of small molecular weight, better stability, easy transformation and modification, no immunogenicity, short preparation period, capability of being synthesized artificially and the like, and is free of a series of processes of animal immunization, feeding, protein extraction, purification and the like. Therefore, if nucleic acid aptamer with higher affinity with CSF-1R protein and high specificity can be found, the detection of CSF-1R protein with high sensitivity and high specificity can be realized, and the drug development of CSF-1R protein targeting can be facilitated.

Currently, no aptamer aiming at the CSF-1R protein exists, so that a aptamer aiming at the CSF-1R protein needs to be found, which has high binding affinity, good specificity, high binding affinity still remained after accurate truncation, easy modification and artificial synthesis, good stability and convenient use.

(III) summary of the invention

The invention aims to provide a nucleic acid aptamer capable of binding CSF-1R protein with small molecular weight, stable chemical property, easy preservation and marking, and high affinity and high specificity binding with CSF-1R protein can be still maintained after shortening to 56 nucleotide length, and the nucleic acid aptamer can be used for detection, diagnosis, imaging, treatment and other aspects and has wide application prospect.

The technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides a nucleic acid aptamer that binds CSF-1R protein, the nucleic acid aptamer having a nucleotide sequence that is at least 60% homologous to any one of SEQ ID No.1 to SEQ ID No.4 and binds CSF-1R protein; or an RNA sequence transcribed from the nucleotide sequence shown in any one of SEQ ID NO.1 to SEQ ID NO. 4.

Preferably, the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO. 4.

Preferably, the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.2 and SEQ ID NO. 4.

The invention designs and synthesizes a random single-stranded DNA library and a corresponding primer based on a SELEX technology, which are used for screening nucleic acid aptamers which have small molecular weight, stable chemical property and easy preservation and marking, can bind with CSF-1R protein with high affinity, thereby screening and obtaining nucleic acid aptamers which bind with the CSF-1R protein with high affinity, namely DH04 (SEQ ID NO. 1), DH0401 (SEQ ID NO. 2), DH80 (SEQ ID NO. 3) and DH8001 (SEQ ID NO. 4) respectively, wherein the nucleic acid aptamers have higher affinity with the CSF-1R protein and higher specificity. Wherein DH0401 and DH8001 are obtained by truncating DH04 and DH80 respectively to a nucleic acid aptamer containing 56 nucleotides.

After the nucleic acid aptamer is truncated, a plurality of new nucleic acid aptamers can be obtained, and the truncated mode is various, but the affinity of most nucleic acid aptamers to CSF-1R protein is reduced; after comparison, DH0401 is found to be the nucleic acid aptamer with optimal affinity after DH04 is truncated; DH8001 is a nucleic acid aptamer with optimal affinity after DH80 truncation, and the affinity of both truncated nucleic acid aptamers to CSF-1R protein is improved compared to the original nucleic acid aptamer. The nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.2 has 56 nucleotide bases and is obtained by cutting the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO. 1; the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.4 has 56 nucleotide bases and is obtained by cutting the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO. 3; the two intercepted nucleic acid aptamers with smaller molecular weight still have very high affinity with CSF-1R protein, have very high specificity and stable performance, are easy to modify and artificially synthesize, are easy to store and mark, and have higher clinical application value.

Due to the specificity of the nucleotide sequence, a position on the nucleotide sequence of the above-mentioned nucleic acid aptamer may be modified, e.g., phosphorylated, methylated, aminated, thiolated, substituted with sulfur, substituted with selenium, or isotopically, etc., provided that the nucleic acid aptamer sequence thus modified has desirable properties, e.g., may have an affinity for binding CSF-1R protein equal to or higher than the parent nucleic acid aptamer sequence before modification, or may have higher stability although the affinity is not significantly improved. It will be appreciated that nucleotide sequences which have at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology to the nucleic acid aptamers provided herein and which bind to CSF-1R proteins, e.g. a portion of the nucleotide sequence shown in any of the above nucleic acid aptamers may be deleted or added, still have a high affinity for CSF-1R proteins, and remain within the scope of the present invention.

In other words, the above nucleic acid aptamer, whether partially substituted or modified, has substantially the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamer, and can be used for binding with CSF-1R protein.

In a second aspect, the present invention provides a conjugate or derivative of a nucleic acid aptamer having a nucleotide sequence as shown in any one of SEQ ID No.1 to SEQ ID No. 4; the conjugate of the nucleic acid aptamer comprises a fluorescent label; derivatives of the nucleic acid aptamer include phosphorothioate backbones or peptide nucleic acids that bind CSF-1R proteins engineered from the nucleotide sequence backbones of the nucleic acid aptamer or conjugates of the nucleic acid aptamer.

The conjugate of the aptamer according to the invention means that other groups, such as fluorescent markers with a labeling effect, for example FAM, radioactive substances, therapeutic substances, biotin, digoxin, nano luminescent materials, small peptides, siRNA or enzyme labels, can be attached to the aptamer, so that the modified aptamer sequence has desirable properties, for example, can have an affinity for binding CSF-1R protein equal to or higher than that of the parent aptamer sequence before modification, or has higher stability although the affinity is not significantly improved.

The nucleic acid aptamer derivative is obtained by modifying the skeleton of the nucleotide sequence of the nucleic acid aptamer into a phosphorothioate skeleton combined with CSF-1R protein, or is peptide nucleic acid combined with CSF-1R protein and modified by the nucleic acid aptamer or the conjugate of the nucleic acid aptamer in any one of the previous technical schemes. Provided that the derivatives all have substantially the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamer and all bind to CSF-1R protein.

The term "phosphorothioate backbone" as used herein has the meaning generally understood by those of ordinary skill in the art and refers to a phosphodiester backbone of RNA and DNA nucleic acid aptamers in which the non-bridging oxygen atoms may be replaced with one or two sulfur atoms, resulting in a phosphorothioate backbone having phosphorothioate or phosphorodithioate linkages, respectively. Such phosphorothioate backbones are known to have increased binding affinity for their targets, as well as increased resistance to nuclease degradation.

The term "peptide nucleic acid" as used herein has a meaning generally understood by those of ordinary skill in the art and refers to an analogue of an artificially synthesized DNA molecule, which was first reported by Nielsen et al in 1991. An oligonucleotide mimetic linked by peptide bonds, called a peptide nucleic acid, was synthesized by replacing the sugar-phosphate backbone with an N-2- (aminoethyl) -glycine (N- (2-aminoethyl) -glycine) unit as a repeating structural unit. Since Peptide Nucleic Acids (PNAs) do not have a phosphate group as on DNA or RNA, the phenomenon of electrical repulsion between PNAs and DNA is lacking, resulting in a greater binding strength between the two than between DNA and DNA.

In a third aspect, the invention provides the use of said nucleic acid aptamer in the preparation of a CSF-1R protein detection, purification or imaging reagent.

In a fourth aspect, the invention provides an application of the nucleic acid aptamer in preparing a medicament for targeting CSF-1R protein.

In a fifth aspect, the invention provides an application of the nucleic acid aptamer in preparing a medicament for treating abnormal CSF-1R protein expression.

In a sixth aspect, the invention provides a CSF-1R protein assay product prepared using said nucleic acid aptamer, said product comprising said nucleic acid aptamer, or a conjugate or derivative of said nucleic acid aptamer.

Preferably, the product is a kit, and the kit further comprises a detection chip which is matched with the chromatographic detection device for use.

The invention relates to a screening method of nucleic acid aptamer binding to CSF-1R protein, which comprises the following steps:

(1) Synthesizing a random single-stranded DNA library and primers;

(2) Magnetic bead method screening: at least 5 rounds of counter-screening and screening were performed.

The usual conditions for aptamer screening are in ionic buffers.

The nucleic acid aptamer, the conjugate or the derivative thereof provided by the invention has the application of any one of the following:

1) Quantitative or qualitative detection of CSF-1R protein;

2) Purifying the CSF-1R protein;

3) Imaging of CSF-1R protein;

4) As inhibitors of CSF-1R protein;

5) Preparing a drug targeting CSF-1R protein;

6) Agents or medicaments useful for diagnosing and treating abnormal CSF-1R expression are prepared.

Compared with the prior art, the nucleic acid aptamer for binding the CSF-1R protein has the beneficial effects that:

1. by improving the screening conditions, screening to obtain a nucleic acid aptamer which has small molecular weight, stable chemical property, easy preservation and marking and can bind with high affinity and high specificity to CSF-1R protein;

2. after the nucleic acid aptamer is truncated, screening shorter nucleic acid aptamer which can still keep high affinity and high specificity binding with CSF-1R protein;

3. the nucleic acid aptamer has the advantages of relatively stable and simple structure, easy modification, capability of being artificially synthesized in a short period, stable chemical property, easy preservation and marking;

4. the nucleic acid aptamer obtained by the invention can be used for detecting, purifying or imaging the CSF-1R protein, and can also be used for preparing medicaments for diagnosing or treating abnormal expression of the CSF-1R protein, and the like, for example, the nucleic acid aptamer can be used for purifying and obtaining the CSF-1R protein with high sensitivity and high specificity; can be used for preparing medicines targeting CSF-1R protein; can be used for preparing reagents or medicines for diagnosing or treating CSF-1R expression abnormality, and the like, and has wide application prospect.

(IV) description of the drawings

FIG. 1 shows Cq value (A) and molecular retention (B) of positive and negative screen solutions obtained in 5 rounds of screening using QPCR (real-time fluorescent quantitative PCR) detection in example 1.

FIG. 2 is a schematic diagram showing the binding ability of the enriched library obtained by screening rounds 1, 3 and 5 to the control His small peptide and target protein in example 1 by flow cytometry.

FIG. 3 is a graph showing affinity detection data of nucleic acid aptamer DH04 and CSF-1R protein using SPR (surface plasmon resonance) in example 2.

FIG. 4 is a graph showing affinity detection data for detecting nucleic acid aptamer DH80 and CSF-1R protein using SPR (surface plasmon resonance) in example 2.

FIG. 5 is a graph showing affinity detection data for detecting nucleic acid aptamer DH0401 and CSF-1R protein by SPR (surface plasmon resonance) in example 3.

FIG. 6 is a graph showing affinity detection data for detecting aptamer DH8001 to CSF-1R protein using SPR (surface plasmon resonance) in example 3.

FIG. 7 is a graph showing the affinity detection data of the aptamer DH04 of example 4 with five other proteins.

FIG. 8 is a graph showing the affinity detection data of the aptamer DH0401 of example 4 with five other proteins.

FIG. 9 is a graph showing the affinity detection data of the aptamer DH80 of example 4 with five other proteins.

FIG. 10 is a graph showing the affinity detection data of the aptamer DH8001 of example 4 with five other proteins.

FIG. 11 is a schematic representation of the results of detection of CSF-1R protein and control protein in example 5 based on a spot hybridization experiment with the nucleic acid aptamer DH 04.

FIG. 12 is a schematic representation of the results of a spot hybridization assay based on the aptamer DH80 of example 5 with CSF-1R protein and a control protein.

FIG. 13 is a graphical representation of the results of detection of CSF-1R protein at various concentrations based on a spot hybridization experiment with the aptamer DH04 of example 5.

FIG. 14 is a graphical representation of the results of detection of CSF-1R protein at various concentrations based on a spot hybridization experiment with the aptamer DH80 of example 5.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

the reagents not specifically mentioned in this example are all known products and are obtained by purchasing commercially available products.

Example 1: screening of ssDNA nucleic acid aptamers that bind to CSF-1R protein

The method of this example for screening ssDNA nucleic acid aptamers that bind to CSF-1R protein comprises the steps of:

1. random single stranded DNA libraries and primers shown in the following sequences were synthesized:

based on SELEX technology, a random single-stranded DNA library-Lib 18 library was designed and synthesized:

5'-TCCAGCACTCCACGCATAAC (36N) GTTATGCGTGCTACCGTGAA-3'; wherein "36N" represents a sequence of 36 arbitrary nucleotide bases joined together. The library was synthesized by the division of bioengineering (Shanghai) Inc. (hereinafter referred to as "bioengineering" for short).

Primer information is shown in Table 1 and is synthesized by Nanjing Jinsri Biotechnology Co.

TABLE 1 primers and sequences thereof

Primer name	Sequence (5 '-3')
		Lib18S1(SEQ ID NO.5)	TCCAGCACTCCACGCATAAC
Lib18-FAM-S1(SEQ ID NO.6)	FAM-TCCAGCACTCCACGCATAAC
		Lib18-Biotin-A2(SEQ ID NO.7)	Biotin-TTCACGGTAGCACGCATAAC
Lib18A2(SEQ ID NO.8)	TTCACGGTAGCACGCATAAC

Wherein S in the primer name represents the forward primer and A represents the reverse primer.

The primers were ddH ₂ O is prepared into a storage solution with the concentration of 100 mu M, and the storage solution is preserved at the temperature of minus 20 ℃ for standby.

2. Magnetic bead method screening

The CSF-1R protein aptamer was screened by the magnetic bead method for a total of 5 rounds of screening, each round of screening having the flow chart shown in Table 2.

TABLE 2 nucleic acid aptamer screening procedure for CSF-1R protein

Number of wheels	Positive screen	Reverse screen	Buffer solution
				First wheel	Conjugated CSF-1R proteins	Coupling His small peptides	DPBS buffer
Second wheel	Conjugated CSF-1R proteins	Coupling His small peptides	DPBS buffer
				Third wheel	Conjugated CSF-1R proteins	Coupling His small peptides	DPBS bufferingFlushing liquid
Fourth wheel	Conjugated CSF-1R proteins	Coupling His small peptides	DPBS buffer
				Fifth wheel	Conjugated CSF-1R proteins	Coupling His small peptides	DPBS buffer

DPBS buffer: potassium chloride 0.2g/L, potassium dihydrogen phosphate 0.2g/L, sodium chloride 8g/L, disodium hydrogen phosphate dodecahydrate 2.8975g/L, water as solvent, pH7.4, and storing at 25deg.C.

The specific screening process is as follows:

1) Carboxyl magnetic bead coupled with CSF-1R protein (magnetic bead of positive sieve)

150. Mu.L of CSF-1R protein (purchased from Jing Jie organism, uniport ID: P07333, 1mg/mL concentration) was added to 850. Mu.L of 10mM sodium acetate buffer pH4.5 and mixed well to give diluted CSF-1R protein, which was placed on ice for use.

500. Mu.L of carboxyl magnetic beads (Jiangsu Biotechnology Co., ltd., product number: FM 2221) were washed once with 500. Mu.L of 20mM NaOH aqueous solution, washed 2 times with 500. Mu.L of ultrapure water, and the magnetic beads were magnet-fished to remove the supernatant. Prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) were mixed in equal volumes at 500. Mu.L each, and added to magnetic beads, and incubated at 25℃for 20 minutes to activate carboxyl groups on the surfaces of the magnetic beads. After the incubation was completed, the supernatant was removed, and immediately washed 1 time with 500. Mu.L of ultrapure water to reduce protein self-coupling. 1000. Mu.L of CSF-1R protein diluted in the above sodium acetate buffer was added, and incubated at 25℃on a vertical mixer for 60 minutes, and CSF-1R protein was coupled to the surface of the magnetic beads through the amino groups on the surface of the protein.

After the coupling, the coupling tube was placed on a magnetic rack, the supernatant was removed, 500. Mu.L of pH8.5, 1M ethanolamine buffer was added to the beads, incubated on a vertical mixer at 25℃for 10 minutes, and unreacted activation sites on the surface of the beads were blocked. Placing on a magnetic rack, and absorbing and discarding the sealing liquid. 500. Mu.L of the magnetic beads containing 5mM Mg ²⁺ After 4 times of washing with 0.02% of DPBS buffer solution of Tween20, the mixture is resuspended to obtain magnetic beads coupled with CSF-1R protein, marked MB-CSF-1R and stored at 4 ℃.

2) Carboxyl magnetic bead coupled with His small peptide (anti-sieve magnetic bead)

The same procedure as in step 1) was followed except that the CSF-1R protein was replaced with 5. Mu.L of His small peptide (20 mg/ml concentration), the volume of sodium acetate buffer was changed to 995. Mu.L, and the other procedures were the same, and the His small peptide-coupled magnetic beads were labeled MB-His. His small peptides were 10 consecutive histidines, synthesized by Kirsrui Biotechnology Co.

3) Library solubilization and renaturation treatment

Taking an engineered Lib18 random single-stranded nucleotide library (1 OD), centrifuging at 12000rpm for 10 minutes, centrifuging the library to the bottom of a tube, dissolving to 5 mu M with DPBS buffer, mixing uniformly, and split charging into PCR tubes for renaturation treatment. The treatment process is as follows: the PCR instrument was programmed to hold at 95 ℃ for 10 minutes, the purpose of this step was to unwind the folded strand, then at 4 ℃ for 5 minutes, and then equilibrated to room temperature. Mg was then added to the library ²⁺ (final concentration of 5 mM), BSA (final concentration of 0.5 mg/mL) and HSDNA (final concentration of 0.05 mg/mL) were mixed uniformly to provide the ionic environment required for single-stranded DNA and to reduce non-specific binding and increase competitiveness, which is a library after the variofing renaturation treatment.

4) Reverse screen

mu.L of MB-His was removed and the supernatant was magnetically removed and 200. Mu.L of 5mM Mg ²⁺ The library after the renaturation treatment of step 3) was added to 100. Mu.L, and the mixture was incubated in a vertical mixer at room temperature for 40 minutes. The mixture was placed on a magnetic rack, and the supernatant, labeled Pool-, was collected as a single-stranded nucleic acid library. The remaining beads were washed 4 times with 200 μl DPBS buffer. Finally, adding 100 mu L of ultrapure water into the cleaned magnetic beads, carrying out boiling water bath for 10 minutes,the supernatant was collected (i.e., the reverse-screened supernatant) and labeled as elion-His.

5) Positive screen

mu.L of MB-CSF-1R was removed and the supernatant was magnetically removed and 200. Mu.L of the supernatant containing 5mM Mg ²⁺ The DPBS buffer of 0.02% Tween20 was washed twice and the supernatant was added to 100. Mu.L of the reverse-screened supernatant collected in step 4) and mixed therewith, and incubated at 25℃for 40 minutes on a vertical mixer. The beads were placed on a magnetic rack, the supernatant was removed, the beads were retained, and the beads were washed 4 times with 200 μLDPBS buffer. Finally, 100. Mu.L of ultrapure water was added to the washed beads, and the resultant was bathed in boiling water for 10 minutes, and the supernatant was collected and labeled as resolution-CSF-1R.

6) Preparation of secondary libraries

10 μL of step 5) of the solution-CSF-1R and the solution-His in the reverse screening process were quantified by QPCR, respectively, and the screening process was monitored by counting the number of molecules retained in each round, and the results are shown in FIG. 1.

Amplification was performed by conventional PCR using the nucleic acid molecule of step 5) solution-CSF-1R as a template. The method comprises the following steps: mu.L of template gel-CSF-1R was added to 900. Mu.L of PCR mix, mixed well, supplemented with 10. Mu.L of ultrapure water, and the template and PCR mix mixture was divided into 100. Mu.L/tube and added to the PCR tube under the following amplification conditions: pre-denaturation at 95℃for 2min, denaturation at 95℃for 30 sec, annealing at 58℃for 30 sec, extension at 72℃for 30 sec, 25 cycles total and storage at 4 ℃. PCR starting materials in PCR mix were formulated from dNTPs purchased from Northenzan (P031-02) and rtaq enzyme purchased from Takara Shuzo (R500Z).

The amplified products were purified using commercially available world and SA magnetic beads (SM 017010) to prepare a secondary library for the next round of screening. 80. Mu.L of SA beads were prepared, 500. Mu.L of the beads containing 5mM Mg ²⁺ Washing with 0.02% Tween20 DPBS buffer solution twice, magnetically removing supernatant, adding 1000 μl of the PCR product of step 6), adding 1/5 volume of 4M sodium chloride aqueous solution of the PCR product, and incubating at room temperature for 30min. The beads were washed three times with DPBS buffer, and after removing the supernatant, 100. Mu.L of 40mM aqueous sodium hydroxide solution was added, and after incubation for three minutes at room temperature, the beads were magnetically removed. Then adding 4 mu L of 1M hydrochloric acid into the supernatant to neutralize the single chain, then adding 104 mu L of 2-x DPBS buffer solution to dilute and neutralize the salt concentration, and finallyA208. Mu.L secondary library was obtained dissolved in 1 XDPBS buffer and used as the library for the next round of screening.

The bead method was repeated for 5 rounds of screening, each run using the secondary library obtained in the previous run as the starting nucleic acid library, according to steps 3), 4), 5) and 6).

7) Library affinity assay

Judging the enrichment condition of the library according to the QPCR Cq value of the resolution in the forward and reverse screening process of each round, and stopping screening if the number of templates eluted by each round of forward screening increases (Cq advances) along with the increase of the screening rounds and the number of templates eluted by the last round is more than 100 times of the number of templates eluted by the first round. FIG. 1 shows that the retention of each round of molecules calculated from the positive and negative screen values shows a gradual increase in positive screen retention, indicating that the library is effectively enriched. After screening, the recognition capacity of the DNA single-stranded library with MB-CSF-1R and MB-His was examined by flow cytometry, and the following procedures were followed:

selecting single-chain libraries obtained by screening round 1, round 3 and round 5 for variofying and renaturation treatment: 40. Mu.L of 400nM single-stranded library was taken, and Mg was added thereto ²⁺ (final concentration 5 mM) and BSA (final concentration 0.5 mg/mL) were mixed, 2. Mu.L of MB-CSF-1R was added, and incubated in a vertical mixer at 25℃for 1 hour in the absence of light. Placing on a magnetic rack, removing supernatant, retaining magnetic beads, and adding 500 μl of 5mM Mg ²⁺ DPBS buffer of 0.02% Tween20 was used for 4 washes and resuspended, labeled CSF-1R Pool1, CSF-1R Pool3, CSF-1R Pool5.

Under the same conditions, step 1) MB-CSF-1R was replaced with step 2) MB-His as a control, and the products were labeled CSF1R-HIS Pool1, CSF1R-HIS Pool3, and CSF1R-HIS Pool5.

2. Mu.L of carboxyl magnetic beads were prepared, the supernatant was magnetically removed, and 600. Mu.L of DPBS buffer was added to resuspend as a blank, labeled NC.

The 7 samples were then examined using a flow cytometer, the flow cytometer is shown in FIG. 2.

In FIG. 2, samples CSF-1R Pool1, CSF-1R Pool3 and CSF-1R Pool5 show that the larger the shift, the stronger the recognition of the target by the library, i.e., the higher the affinity, with increasing number of screening rounds. CSF-1R Pool5 was much higher than CSF-1R Pool1, CSF-1R Pool3, satisfying sequencing requirements, and the resulting library was analyzed by high throughput sequencing. Meanwhile, CSF1R-HIS Pool1, CSF1R-HIS Pool3, CSF1R-HIS Pool5, it can be seen that there is no apparent shift, indicating that the library has no affinity for the reverse-screened targets.

3. Analyzing and identifying the aptamer obtained after screening: after high throughput sequencing analysis of the enriched library product, several sequences were selected and synthesized by Jin Weizhi biological (Jiangsu) technologies, inc., and affinity was detected.

In the subsequent detection, from the sequences obtained in the final round 5, 2 sequences having the strongest binding ability were determined as nucleic acid aptamers having the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.3, respectively, and they were named DH04 and DH80, respectively.

SEQ ID NO.1(DH04)

TCCAGCACTCCACGCATAACGGGCGATCAGGGTCGATAGCTTCGGGGTCCACTTGCGTTAT GCGTGCTACCGTGAA。

SEQ ID NO.2(DH0401)

CACGCATAACGGGCGATCAGGGTCGATAGCTTCGGGGTCCACTTGCGTTATGCGTG。

Example 2: surface Plasmon Resonance (SPR) detection of binding affinity of nucleic acid aptamer of CSF-1R protein to CSF-1R protein

Nucleic acid aptamers DH04 (SEQ ID NO. 1) and DH80 (SEQ ID NO. 3) were synthesized by the company responsible for the intellectual biosciences of Suzhou gold, and were each prepared with DPBS buffer (5 mM Mg) ²⁺ ) Diluted to 400nM, 200nM, 100nM, 50nM, 25nM.

1. The 2 nd channel of the CM5 chip surface of a surface plasmon resonance (GE Healthcare, model: biacore 8K) coupled with CSF-1R protein was used as an experimental channel, and the specific method was as follows: the chip was first washed with 50mM NaOH aqueous solution, 20. Mu.L was injected at a flow rate of 10. Mu.L/min, and then an equal volume of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) were mixed together and 105. Mu.L of activated chip was injected at a flow rate of 10. Mu.L/min. CSF-1R protein (purchased from Jing Jie organism, uniport ID: P07333, 1 mg/mL) was diluted with 10mM sodium acetate buffer pH4.5 to a final concentration of 50. Mu.g/mL and injected at a volume of 190. Mu.L, flow rate of 10. Mu.L/min, and CSF-1R protein coupling at about 3100 Ru. After the sample injection was completed, the chip was blocked with ethanolamine at a flow rate of 10. Mu.L/min and 129. Mu.L of sample was injected.

The CSF-1R protein was replaced with His protein in the same manner as in channel 2 (as in example 1), and His protein was coupled to channel 1 to serve as a control channel in the same manner as in example 1).

2. And (3) detection: the diluted aptamer DH04 samples sequentially flow through channels 1 and 2, and the procedure of each channel is as follows: sample introduction of the aptamer is 30 mu L/min for 3 min; DPBS buffer (5 mM Mg) ²⁺ ) Dissociation is carried out by injecting 30 mu L/min for 3 min; regeneration was performed by injecting 30. Mu.L/min of 2M aqueous NaCl for 45 seconds. The results are shown in FIG. 3.

Under the same conditions, the sample of nucleic acid aptamer DH04 was replaced with nucleic acid aptamer DH80, and the results are shown in FIG. 4.

The affinity KD values of the nucleic acid aptamer DH04 and DH80 of the CSF-1R protein and the CSF-1R protein are shown in Table 3.

Example 3: surface Plasmon Resonance (SPR) detection of the affinity of a truncated sequence of a nucleic acid aptamer of a CSF-1R protein for a CSF-1R protein

Because 2 nucleic acid aptamers DH04 and DH80 with the strongest binding capacity obtained by original screening are longer, the subsequent application and development are not facilitated, and therefore, the nucleic acid aptamers are truncated: truncating DH04 to obtain DH0401; DH80 was truncated to give DH8001. Thus two truncated sequences based on the core region after the original long sequence is truncated are obtained, and the sequences still have high affinity and high specificity.

Truncated aptamer DH0401 (SEQ ID NO. 2) and DH8001 (SEQ ID NO. 4) were synthesized by Suzhou gold intellectual Biotechnology Co., ltd, and were each used in DPBS buffer (5 mM Mg-containing) ²⁺ ) Diluted to 500nM, 250nM, 125nM, 62.5nM, 31.25nM, 15.625nM.

SEQ ID NO.3(DH80)

TCCAGCACTCCACGCATAACGCTTGTCGGAGGTTCTAGTACTTCCGAGGCGATCTCGTTATG CGTGCTACCGTGAA。

SEQ ID NO.4(DH8001)

CACGCATAACGCTTGTCGGAGGTTCTAGTACTTCCGAGGCGATCTCGTTATGCGTG。

1. The 2 nd channel of the CM5 chip surface of a surface plasmon resonance (GE Healthcare, model: biacore 8K) coupled with CSF-1R protein was used as an experimental channel, and the specific method was as follows: the chip was first washed with 50mM NaOH aqueous solution, 20. Mu.L was injected at a flow rate of 10. Mu.L/min, and then an equal volume of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) were mixed together and 105. Mu.L of activated chip was injected at a flow rate of 10. Mu.L/min. CSF-1R protein (as in example 1) was diluted with 10mM sodium acetate buffer pH4.5 to a final concentration of 50. Mu.g/mL and injected at a volume of 190. Mu.L at a flow rate of 10. Mu.L/min and a CSF-1R protein coupling of 2348RU. After the sample injection was completed, the chip was blocked with ethanolamine at a flow rate of 10. Mu.L/min and 129. Mu.L of sample was injected.

The CSF-1R protein was replaced with His protein in the same manner as in channel 2, and His protein was coupled to channel 1 to serve as a control channel.

2. And (3) detection: the diluted aptamer DH0401 sample sequentially flows through channels 1 and 2, and the procedure of each channel is as follows: the nucleic acid aptamer DH0401 is injected for 2 minutes at 20 mu L/min; DPBS buffer (5 mM Mg) ²⁺ ) Dissociation is carried out by injecting 20 mu L/min for 2 min; regeneration was performed by injecting 30. Mu.L/min of a 2M NaCl+5mM NaOH aqueous solution for 30 seconds. The results are shown in FIG. 5.

Under the same conditions, the nucleic acid aptamer DH0401 was replaced with the nucleic acid aptamer DH8001, and the results are shown in FIG. 6.

The affinity KD values of the nucleic acid aptamers DH0401 and DH8001 to the CSF-1R protein are shown in the following table 3, and the binding capacity of the corresponding nucleic acid aptamers to the target protein CSF-1R protein is demonstrated.

TABLE 3 affinity of nucleic acid aptamer to CSF-1R protein

Nucleic acid aptamer	Length of	Affinity KD (nM)
			DH04(SEQ ID NO.1)	76	2.33
DH0401(SEQ ID NO.2)	56	0.00254
			DH80(SEQ ID NO.3)	76	38.5
DH8001(SEQ ID NO.4)	56	5.72

As can be seen from Table 3, the affinities of DH04, DH0401, DH80 and DH8001 provided by the invention with the CSF-1R protein are obviously high (the smaller the KD value, the greater the affinity). The nucleotide length of the nucleic acid aptamer DH04 and DH80 before truncation is 76, the affinities of the 2 nucleic acid aptamers obtained after truncation are greatly different from that of the nucleic acid aptamer before truncation, the length of the nucleic acid aptamer is 56 nucleotides, the affinities of the nucleic acid aptamer are greatly improved, and particularly the affinity of DH0401 after truncation and CSF-1R is highest, and the affinity index KD is 2.54pM.

The data in Table 3, FIGS. 3 through 6 demonstrate that these nucleic acid aptamers were strongly bound to CSF-1R protein using SPR.

Example 4: specificity study of nucleic acid aptamer

ROR1 protein (cat No. 13968-H08H, available from yi zhushen), CXCL5 protein (cat No. P0013, available from Jing Jie organisms), COL1A1 protein (cat No. P0010, available from Jing Jie organisms), RENIN protein (cat No. P0077, available from Jing Jie organisms), AXL protein (cat No. P003, available from Jing Jie organisms).

In this example, ROR1 protein, CXCL5 protein, COL1A1 protein, RENIN protein and AXL protein were used in place of CSF-1R protein, respectively, and the ROR1 protein, CXCL5 protein, COL1A1 protein, RENIN protein and AXL protein were coupled to the 2 nd channels of six channels on the surface of the CM5 chip in the same manner as in the test by fixing CSF-1R protein to the SPR chip in example 2, the coupling amounts being 5070RU, 2307RU, 4311RU, 9617RU and 3392RU, respectively. 4 nucleic acid aptamers of DH04, DH0401, DH80 and DH8001 diluted to 500nM were sequentially injected.

The affinity detection data of the nucleic acid aptamer DH04 and the five proteins are shown in FIG. 7; the affinity detection data of the nucleic acid aptamer DH0401 and the five proteins are shown in FIG. 8; the affinity detection data of the nucleic acid aptamer DH80 and the five proteins are shown in FIG. 9; the affinity detection data of the aptamer DH8001 with the above five proteins are shown in FIG. 10. As can be seen from fig. 7 to 10, none of the nucleic acid aptamers DH04, DH0401, DH80, DH8001 can bind to five proteins, ROR1, CXCL5, COL1A1, RENIN, AXL, and thus the binding between the nucleic acid aptamers of CSF-1R obtained by screening and optimizing and the target has very high specificity.

Example 5: detection of CSF-1R protein based on nucleic acid aptamer-based spot hybridization experiments

Biotin-modified nucleic acid aptamers DH04, DH80 were synthesized by Suzhou gold intellectual biosciences, inc.

Spot hybridization experiments were performed on biotin-modified aptamer DH04, DH80, respectively, as follows:

1. nucleic acid aptamer DH04 and DH80 spot hybridization experiment for detecting specificity of CSF-1R protein

(1) Dissolving CSF-1R protein into 0.500mg/mL by using DPBS buffer solution to be used as a sample to be detected; control proteins His small peptide, ROR1, LOX1, PTK7 were all dissolved to 0.500mg/mL with DPBS buffer as controls. 1 test strip (nitrocellulose membrane, 0.2 μm, GE Amersham, cat. No. 10600001) of 8 cm. Times.2 cm was taken, and the sample to be measured and the control sample were spotted onto the nitrocellulose membrane with 4. Mu.L each, and naturally air-dried for 40 minutes.

(2) The test strips were then placed in 50mL centrifuge tubes, immersed in 6mL of 10% BSA in DPBS buffer, shake-packed at room temperature for 1h, and after the completion of the shaking-up, the test strips were subjected to a shaking-up with DPBS (5 mM Mg) ²⁺ 0.02% Tween 20) for 5min, repeatedly washing for 3 times, and sucking.

(3) The strip was then transferred to a new 50mL centrifuge tube and 6mL of DPBS buffer (5 mM Mg in ²⁺ ) The dissolved 500nM biotin-modified aptamer DH04 was infiltrated, incubated at room temperature for 30min with DPBS (5 mM Mg in the presence of ²⁺ 0.02% Tween 20) for 2min, repeatedly washing for 3 times, and sucking.

(4) The strip was then transferred to a new 50mL centrifuge tube and 6mL of HRP-strepitavidin (from Beyotime Biotech 1 mg/mL) was added: DPBS buffer = 1:2000 was allowed to soak in the diluent and incubated for 30min on a shaker at room temperature. After the incubation, DPBS (containing 5mM Mg) ²⁺ 0.02% Tween 20) for 2min, repeatedly washing for 3 times, and sucking.

(5) The test strip was transferred to clean PE glove and ECL chromogenic kit (purchased from Beyotime Biotech) was taken, 100. Mu.L of solution A and 100. Mu.L of solution B were mixed well, the surface of the test strip was soaked, and incubated in the dark for 5min.

(6) And (3) observing and photographing by an imaging system: imageQuant from GE medical life sciences ^TM The LAS 4000 digital imaging system takes a photograph and the results are shown in FIG. 11.

Under the same conditions, 500nM biotin-modified nucleic acid aptamer DH04 was replaced with 500nM biotin-modified nucleic acid aptamer DH80, and the results are shown in FIG. 12.

As can be seen from FIGS. 11 and 12, the CSF-1R protein was apparent compared with the spots of the control proteins His small peptide, ROR1, LOX1, PTK 7. This demonstrates that both the biotin-modified nucleic acid aptamers DH04 and DH80 can be used for detection of membrane-hybridized CSF-1R protein, and that the control proteins His small peptide, ROR1, LOX1, PTK7 are hardly developed, thus further demonstrating that DH04 and DH80 can specifically bind to CSF-1R protein.

2. Nucleic acid aptamer DH04 and DH80 spot hybridization experiments for detecting CSF-1R protein with different concentrations

CSF-1R protein was dissolved in DPBS buffer to 0.500mg/mL, 0.250mg/mL, 0.125mg/mL, 0.063mg/mL, 0.032mg/mL, 0.016mg/mL, otherwise the procedure was as in step 1.

The results of the spot hybridization experiments of biotin-modified aptamer DH04 with different concentrations of CSF-1R protein are shown in FIG. 13; the results of the spot hybridization experiments of biotin-modified aptamer DH80 with different concentrations of CSF-1R protein are shown in FIG. 14.

As can be demonstrated from FIGS. 13 and 14, 2 nucleic acid aptamers can be used to accurately detect CSF-1R protein at 0.063 mg/ml.

The foregoing is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art, who is within the scope of the present invention, should make equivalent substitutions or modifications according to the technical scheme of the present invention and the inventive concept thereof, and should be covered by the scope of the present invention.

Claims

1. A nucleic acid aptamer that binds CSF-1R protein, wherein the nucleic acid aptamer has a nucleotide sequence that is at least 60% homologous to any one of SEQ ID No.1 to SEQ ID No.4 and binds CSF-1R protein.

2. The aptamer of claim 1 that binds CSF-1R protein, wherein the aptamer has an RNA sequence transcribed from a nucleotide sequence set forth in any one of SEQ ID No.1 to SEQ ID No. 4.

3. The nucleic acid aptamer that binds to CSF-1R protein according to claim 1, wherein the nucleic acid aptamer has a nucleotide sequence as set forth in any one of SEQ ID No.1 to SEQ ID No. 4.

4. The nucleic acid aptamer of claim 1 that binds CSF-1R protein, wherein the nucleic acid aptamer has a nucleotide sequence as set forth in any one of SEQ ID No.2, SEQ ID No. 4.

5. A conjugate or derivative of the nucleic acid aptamer of claim 1, wherein the conjugate of the nucleic acid aptamer comprises a fluorescent label; derivatives of the nucleic acid aptamer include phosphorothioate backbones or peptide nucleic acids that bind CSF-1R proteins engineered from the nucleotide sequence backbones of the nucleic acid aptamer or conjugates of the nucleic acid aptamer.

6. Use of the nucleic acid aptamer of claim 1 for the preparation of a CSF-1R protein detection, purification or imaging reagent.

7. Use of the aptamer of claim 1 for the preparation of a medicament targeting CSF-1R protein.

8. Use of the aptamer of claim 1 for the preparation of a medicament for the treatment of abnormal CSF-1R protein expression.

9. A CSF-1R protein detection kit prepared using the nucleic acid aptamer of claim 1.

10. The use of claim 9, wherein said kit comprises said aptamer, or a conjugate or derivative of said aptamer.