CN116813781B

CN116813781B - Nanometer antibody targeting beta 2AR and preparation method and application thereof

Info

Publication number: CN116813781B
Application number: CN202310942009.3A
Authority: CN
Inventors: 董志强; 张敏; 蔡秉成
Original assignee: Shiyan Taihe Hospital
Current assignee: Shiyan Taihe Hospital
Priority date: 2023-07-29
Filing date: 2023-07-29
Publication date: 2024-01-12
Anticipated expiration: 2043-07-29
Also published as: CN116813781A

Abstract

The invention discloses a nano antibody targeting beta 2AR, and a preparation method and application thereof, and belongs to the technical field of biology. The amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 of the beta 2AR targeting nanobody are shown as Seq ID No.2, seq ID No.3 and Seq ID No.4, respectively. The preparation method of the nano antibody comprises the following steps: constructing a cell line over-expressing beta 2AR by using lentiviral infection; a fifth round of screening was performed with HEK293T cells overexpressing β2ar; and obtaining corresponding DNA information through second generation sequencing to obtain the nano antibody with the highest enrichment degree. The nano antibody provided by the invention can target the extracellular segment of beta 2AR, particularly the forward two segments, and can enhance the activity of HT22 cells after OGD/R treatment.

Description

Nanometer antibody targeting beta 2AR and preparation method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a beta 2AR targeting nano antibody, a preparation method and application thereof.

Background

G protein-coupled receptors (GPCRs) are the largest family of membrane proteins in the human genome. GPCRs have seven transmembrane helical feature sequences with the N-terminus located outside the cell membrane and the C-terminus located inside the membrane. By virtue of such characteristic sequences, GPCRs can respond to stimulation by hormones, neurotransmitters, ions, photons, odorants, etc. and mediate their transduction of transmembrane signals, thereby modulating intracellular signaling cascades (hilgeret al 2018). The response and transduction of GPCRs to a signal is often dependent on a change in its structure, e.g., an activator of rhodopsin will bind to GPCR transmembrane domain 6 (TM 6), causing it to move outward changing its conformation to activate the receptor. The activated receptor binds to intracellular G protein triggering guanylate exchange (Manglik and Kobilka 2014). Because GPCRs play a vital role in human pathophysiology, their extracellular domains become very potential drug targets. With the resolution of the structure of the GPCR, drugs can be designed to selectively modulate the structure and function of the GPCR by binding to the allosteric site of the GPCR. Thereby realizing the controllable targeted therapeutic value (Hauseret al 2017). Beta adrenergic receptors (βars), members of the GPCR superfamily, act as binding receptors for the regulated signaling of catecholamines on cells. And plays a key role in the control of cardiovascular function, the occurrence of arrhythmias, ventricular remodeling, and the evolution of heart failure (Steinberg 2018). β2ar was cloned and structurally characterized as a βars family member, the first. β2ar is a major target of catechols, playing an important role in the response to mental stress, cardiovascular and pulmonary physiology. The research results show that the beta 2AR plays an important role in the targeted treatment of cancers, the occurrence of pain and the progress of autoimmune diseases. For example, β2AR antagonists can inhibit proliferation, invasion and metastasis of gastric cancer cells by inhibiting ERK1/2-JNK-MAPK pathway and transcription factors (NF-. Kappa. B, AP-1, CREB, STAT 3) (Zhang et al 2019). While blocking of β2ar may also reduce the sensitivity of humans to pain (Nackley et al 2007). In the progression of autoimmune disease, β2ar can play a variety of regulatory roles through different immune cells and time nodes affecting disease progression (Wu et al 2018). Taken together, β2ar can serve as a target for a variety of physiological processes and disease progression. The discovery of specific binding proteins is a key step in the precise regulation of the proteins.

Nanobodies can efficiently bind and stabilize GPCR structures

Conventional antibodies consist of 4 polypeptide chains: two identical heavy chains (H chains) with relatively large molecular masses; two peptide chains of relatively small molecular mass are called light chain (L chain). The light chain and the heavy chain are connected by disulfide bonds, so that a Y-shaped antibody structure is formed. In addition to conventional hetero-tetrameric antibodies, camels can produce antibodies containing only heavy chains (Hamers-Casterman et al 1993). Nanobodies (nanobodies) are heavy chain domains (VHHs) of heavy chain antibodies, which have the same antigen recognition capacity as the parent antibody. The nano antibody has the characteristics of small volume, strong penetrability, high stability, high solubility and the like. Is a single domain protein encoded by a single gene. Nanobodies have a stable and unique crystal structure, and the constant regions (FR) and Complementarity Determining Regions (CDRs) fold over each other, rendering the nanobody compact and comprising raised elongated structures. The complementarity determining region 3 (CDR 3) long loop is most prominent, readily recognizes cryptic epitopes in protein conformation, and can enter pocket structures on protein surfaces that are inaccessible to conventional antibodies (De Genst et al 2006). This allows nanobodies to function to stabilize the intermediate conformation of the protein. And have been used to capture intermediates in the amyloid fibrillation pathway (Abskharon et al 2014).

GPCRs have flexible conformational changes in response to extracellular signals as previously described, and this conformational heterogeneity is an important obstacle to resolving the crystal structure in its active state (Kobilka 2013). In previous studies, antagonists with high affinity and sustained action have often been relied upon or mutations introduced to maintain stable structure of GPCRs. However, activators not only fail to stabilize the conformation of the GPCR but can also further activate its conformational heterogeneity. Thus limiting resolution of the active conformation of GPCRs (Cooke et al 2015). Based on the unique characteristics of nanobodies described above, researchers began to utilize nanobodies as alternatives to natural activators to stabilize the active conformation of GPCRs. Taking β2ar as an example, the agonist nanobody Nb80 has been developed to maintain its activated conformation (Rasmussen et al 2011), and to stabilize the Nb60 nanobody in its low activity conformation (Staus et al 2014). The angiotensin receptor (AT 1R) also acquires its crystal structure in the activated state under the stabilization of nanobody Nb110i1, and the affinity of Nb110i1 reaches 18.5nM through affinity maturation (Wingler et al 2019). In summary, nanobodies bind and stabilize GPCR structures with high efficiency and modulate the active/resting conformation of GPCRs with the action of activator/antagonist analogs.

Strategies for membrane protein antibody screening

Most of the current membrane protein screening strategies are to purify membrane proteins and bind them to solid supports, and many binding targets may be lost due to insufficient folding of the membrane protein structure. Some researchers have solved this problem by maintaining their active state through a bilayer membrane structure. However, these are based on purification of membrane proteins. The seven-time transmembrane protein with the complex structure of GPCRs has complex structure and larger molecular weight. The quality and cost of protein purification are key issues to be addressed. How to obtain the nano-antibody targeting the beta 2AR more simply is a problem to be solved in the prior art.

Disclosure of Invention

The invention aims to overcome the technical defects, and provides a beta 2AR targeting nano antibody, a preparation method and application thereof, and solves the technical problem of how to obtain the beta 2AR targeting nano antibody more simply in the prior art.

The screening of the present invention is based on living cells displaying β2ar receptors, which enable β2ar to assume a native conformation. Then co-incubating with antigen-displaying cells via a yeast library. Screening nanobodies targeting the extracellular segment of β2ar. And verifies that it targets the extracellular range and tolerates the effects of the glycooxygen deprivation model on neuronal cells.

To achieve the above technical objective, the present invention provides a β2ar targeting nanobody, wherein the amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 of the amino acid sequence of the nanobody are shown as Seq ID No.2, seq ID No.3 and Seq ID No.4, respectively.

Further, the amino acid sequence of the nanobody is shown as Seq ID No. 1.

Further, the nucleic acid sequence for expressing the nanobody is shown in Seq ID No. 5.

In addition, the present invention also provides a molecular expression vector comprising the amino acid sequence shown as Seq ID No.2, seq ID No.3, seq ID No.4 or Seq ID No.1 or the nucleic acid sequence shown as Seq ID No. 5.

Furthermore, the invention also provides a host cell containing the molecular expression vector, and the host cell is a prokaryotic cell, a yeast cell or a virus.

Further, the host cell is a human embryonic kidney cell or hamster ovary cancer cell.

In addition, the invention also provides a preparation method of the nano antibody, which comprises the following steps:

s1, taking a CHO-K1 cell line which overexpresses beta 2AR as an antigen, incubating yeast and cells together, marking yeast with fluorescence of APC647 by using myc labels displayed on the surface of the yeast, separating out a double-fluorescence complex carrying GFP and APC647 by flow, coating a Trp defect plate, and carrying out four rounds of CHO-K1 screening together; and performing a fifth round of screening with HEK293T cells overexpressing β2ar;

s2, scraping the screening product, extracting plasmids, carrying out PCR (polymerase chain reaction) by utilizing a constant region sequence of the nano antibody to obtain a DNA sequence of a screening library, obtaining corresponding DNA information through second-generation sequencing, and sequencing according to the sequence enrichment degree to obtain the nano antibody with the first rank.

Further, before step S1, the method further includes: and (3) fusing the nano antibody library sequence with the C end of Aga2 by adopting a PCR technology, realizing the display of the nano antibody on the surface of a yeast cell, and constructing an over-expression beta 2AR cell line.

Furthermore, the invention also provides application of the nano antibody in preparing an agent for enhancing HT22 cell activity.

Further, the activity of HT22 cells after OGD/R treatment was enhanced.

Compared with the prior art, the invention has the beneficial effects that: the nano antibody provided by the invention can target the extracellular section of beta 2AR, particularly the front two sections, and can enhance the activity of HT22 cells after OGD/R treatment.

Drawings

FIG. 1 is a flow chart of a live cell screening yeast library according to example 1 of the present invention.

FIG. 2 is a graph showing the results of the observation of the enriched sequences by second generation sequencing in example 1 of the present invention.

FIG. 3 is a graph showing the detection results of the co-immunoprecipitation technique according to example 1 of the present invention.

FIG. 4 is a graph showing the results of a survival test of HT22 cells under OGD/R treatment with nanobody Nb.A1 of example 1 of the invention.

FIG. 5 is a graph showing the results of the detection of the ability of Nb.A1 of HT22 cells to scavenge ROS accumulation under OGD/R treatment in accordance with the present invention.

Detailed Description

This embodiment provides a nanobody targeting β2ar whose amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 of the amino acid sequence are shown as Seq ID No.2, seq ID No.3 and Seq ID No.4, respectively.

Further, the amino acid sequence of the nanobody is shown as Seq ID No. 1.

In this embodiment, the nucleic acid sequence for expressing the nanobody is shown in Seq ID No. 5.

The present embodiment also proposes a molecular expression vector comprising the amino acid sequence shown as Seq ID No.2, seq ID No.3, seq ID No.4 or Seq ID No.1 or the nucleic acid sequence shown as Seq ID No. 5.

The specific embodiment also provides a host cell containing the molecular expression vector, wherein the host cell is a prokaryotic cell, a yeast cell or a virus; in certain embodiments, the host cell is a human embryonic kidney cell or hamster ovary cancer cell.

The specific embodiment also provides a preparation method of the nano antibody, which comprises the following steps:

s1, fusing a nanobody library sequence with the C end of Aga2 by adopting a PCR technology, realizing the display of the nanobody on the surface of a yeast cell, and constructing an over-expression beta 2AR cell line;

s2, taking a CHO-K1 cell line which overexpresses beta 2AR as an antigen, incubating yeast and cells together, marking fluorescence of APC647 on the yeast by utilizing a myc tag displayed on the surface of the yeast, separating out a double-fluorescence complex carrying GFP and APC647 by flow, coating a Trp defect plate, and carrying out four rounds of CHO-K1 screening together; and performing a fifth round of screening with HEK293T cells overexpressing β2ar;

s3, scraping the screening product, extracting plasmids, carrying out PCR (polymerase chain reaction) by utilizing a constant region sequence of the nano antibody to obtain a DNA sequence of a screening library, obtaining corresponding DNA information through second-generation sequencing, and sequencing according to the sequence enrichment degree to obtain the nano antibody with the first rank.

In addition, the specific embodiment also provides an application of the nano antibody in preparing a reagent for enhancing HT22 cell activity; further, the activity of HT22 cells after OGD/R treatment was enhanced.

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail below with reference to the accompanying drawings and the research process of the present invention. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

Experimental principle:

1) Construction of fully synthetic nanobody yeast display library

Trinucleotide mutagenesis techniques are based on triplet codon characteristics, using trinucleotide phosphoramides corresponding to 20 amino acids. According to the required amino acid frequency and the length of the CDR region, primers with different amino acid combinations are designed to form a primer pool. And amplifying the template by a PCR technology to achieve the purpose of continuous amino acid sequence mutation.

Yeast display systems are classified into lectin systems and lectin systems. The invention adopts the display technology of a lectin system, and the a-lectin of yeast has two subunits, a core subunit Aga-1 and a binding subunit Aga-2; wherein the core subunit Aga-1 consists of 725 amino acids, the C-terminal of which is covalently bound to yeast cell wall glucan, and the binding subunit Aga-2 consists of 69 amino acids, which is linked to Aga1 by disulfide bonds. Based on the system, the target protein sequence, namely the nano antibody library sequence, is fused with the C end of Aga2, so that the nano antibody is displayed on the surface of the yeast cell.

2) Construction of an overexpressing beta 2AR cell line

A lentiviral vector overexpressing β2ar and green fluorescent GFP was constructed. Positive cell populations were screened with puromycin by lentiviral infection methods over-expressing the β2AR receptor in CHO-K1 (hamster ovary cancer cells) and the β2AR receptor in HEK293T cells. Over-expression β2ar and CHO-K1 cell lines and HEK293T cell lines carrying green fluorescence were obtained. Causing it to carry the green fluorescence of GFP.

3) Exploration of the extracellular section interaction region of nanobody and beta 2AR by using co-immunoprecipitation technology

The four extracellular domains of β2ar are divided into two parts by truncation. Co-immunoprecipitation with nb.a1-GFP was performed using co-immunoprecipitation technique, and the interaction region was observed.

Experimental materials

The key materials, the concentration of the materials, the model and other accurate and complete information involved in the experimental process.

For related experimental reports related to genes or vectors, all related biological material information related to various experimental processes such as primer sequences, target gene sequences, vector structure schematic diagrams and the like are required to be provided.

Experimental strains

Yeast strain EBY100 is a laboratory preservation strain.

Cell lines

Table 1 cell information table for experiments

3) Vectors and plasmids

Eukaryotic expression vector pcDNA3.1-3 xFlag and yeast display vector pNACP are all preserved in laboratory, and other plasmids are all constructed by the invention.

Example 1

The embodiment provides a nano antibody targeting beta 2AR, which is prepared by the following steps:

1) Construction of fully synthetic nanobody library and screening of targeting β2AR ectodomain nanobody

Construction of nanobody library: the nanobody library was constructed as described previously. Briefly, DNA libraries of nanobodies were constructed by two-step overlap extension PCR. A set of ten primers was dissolved and mixed to prepare three mixed pools of short, medium and long, with CDR3 regions of 7, 11 and 15 random residues, respectively. Mixing the full-length nano antibody DNA products of the three mixing tanks in a molar ratio of 1:2:1 to obtain the nano antibodyDNA library pool, through homologous arm primer continuous amplification nanometer antibody DNA library for yeast transformation, target protein sequence, namely nanometer antibody library sequence, is fused with C end of Aga2, realizing nanometer antibody display on yeast cell surface, construction diversity is 10 ⁹ Is a fully synthesized nanobody yeast display library;

yeast cells inoculated in liquid medium after transformation were inoculated in SD-Trp medium for secondary subculture to remove dead cells, and cultured overnight (about 20 h) at 30 ℃ at 250 rpm. The culture was inoculated at an initial concentration od=1 into 1L of the medium and incubated at 30℃and 250rpm for 3d. Cells were collected by centrifugation at 2,500g for 5min, and frozen in aliquots at-80 ℃. The frozen cells were cultured overnight at 30℃and 225rpm in SD-Trp medium. Cells from the second passage (initial OD 0.1-0.2, 10 times the library diversity) were inoculated into SD-Trp (2% glucose) medium and incubated at 30 ℃ at 225rpm until od=0.5-1. Cells were collected by centrifugation at 2,500g for 5min, resuspended in SG-Trp (2% galactose in) medium to induce nanobody expression, and induced at 20℃for at least 36h. The CHO-K1 cell line over-expressing β2AR was used as antigen, which carried GFP fluorescence. Yeast was incubated with the cell number at a ratio of 10:1. The yeast was labeled with the fluorescence of APC647 using the myc tag displayed on the yeast surface. The dual fluorescent complexes carrying GFP and APC647 were sorted by flow. Trp-defective plates were coated. Four rounds of CHO-K1 screening were performed together. And a fifth round of screening was performed with HEK293T cells overexpressing β2ar to screen yeast cells targeting CHO-K1 cell background membrane proteins. In Table 2 below, WMT, TYT, RST, RVT, RSTANT, WAT and like capital letters represent amino acid sequences corresponding to trinucleotide combination pairs, and# represents any amino acid.

TABLE 2 primer information Table for experiments

2) And (3) carrying out second-generation sequencing on the screening products, analyzing the sequence enrichment condition, scraping the screening products grown on the defective culture medium, and extracting plasmids. PCR is carried out by utilizing the constant region sequence of the nano antibody to obtain the DNA sequence of the screening library, and the second generation sequencing primer-F: GACTCTCTTGTGCCGCCAGC, second-generation sequencing primer-R: ACCTGAGTACCCTGACCCCA. Corresponding DNA information was obtained by second generation sequencing. And are ordered according to the sequence enrichment degree. Subsequent experiments were performed by selecting the first ranked nanobody nb.a1, whose amino acid sequences of complementarity determining regions CDR1, CDR2, and CDR3 are shown as Seq ID No.2, seq ID No.3, and Seq ID No.4, respectively, whose amino acid sequences are shown as Seq ID No.1, and whose nucleic acid sequences expressing the nanobody are shown as Seq ID No. 5.

3) Glycooxygen deprivation/reoxygenation treatment of HT22

1uM and 2.5uM nanobody are added into HT22 cell culture system 12h in advance, and then OGD/R treatment is carried out, (1%, O ₂ ，5％CO ₂ 37 ℃, sugar-free serum-free environment). After OGD2h, cells were removed and replaced with normal medium and reoxygenated under normoxic conditions (5% CO2,37 ℃) for 24h. Cell activity was measured using cck 8.

Experimental results and conclusions

According to the experimental purposes and experimental steps, the submitted experimental results are matched with the initial experimental purposes, so that the initial experimental purposes can be truly demonstrated to achieve specific effects through specific experimental steps.

1. Judging screening process by stream sorting

Referring to fig. 1, live cells displaying β2ar and carrying GFP fluorescence were used as antigens by co-incubation with a library of yeasts labeled with AP647 fluorescence. The yeast-cell composite population carrying double fluorescence is screened out by using a flow type. The results showed that at the initial screening, only 0.86% of the biscationic cell population was present. That is, only 0.86% of the cells in all cell populations were bound by APC647 while carrying GFP fluorescence. Proceeding to the fourth round, the biscationic cell population had risen to 7.62%. After 293T screening, the double-positive cell population was reduced to 3.09% after screening the yeast cells targeting the non-target antigen on the CHO-k1 surface.

2. Enrichment sequence by second generation sequencing

And collecting the products after the fifth round of screening, and extracting the yeast plasmid. PCR was performed using the constant region as a primer. The PCR products were purified and subjected to second generation sequencing using PE150 primers. Sequencing results were analyzed to obtain different degrees of sequence enrichment (FIG. 2). And taking the A1 sequence with the highest enrichment degree for subsequent experiments. The variable regions CDR1,2,3 of the sequences are shown in fig. 3.

3. Monitoring by co-immunoprecipitation technique

The extracellular segment of β2ar has four segments in total. EC1, EC2, EC3, EC4, respectively. It is truncated into two parts, with β2ar-EC1-EC2-FLAG comprising the first two ectodomains EC1 and EC2 and β2ar-EC3-EC4-FLAG comprising the second two ectodomains EC3 and EC4. Through co-immunoprecipitation experiments, only β2ar full length and β2ar-EC1-EC2-FLAG were found to have an interaction relationship with nb.a1-GFP (fig. 3), indicating that the interaction region of nb.a1 with β2ar is present in the first two extracellular segments.

4. Survival of HT22 cells under OGD/R treatment by Nb.A1

HT22 cells were divided into 96-well plates. The Nb.A1 nanobody was added into the culture system at a concentration of 0uM,1uM,2.5uM 12h in advance. Control and OGD/R groups were set without OGD/R treatment. After OGD2 h/R24 h, cck8 is added into the culture system, and the mixture is protected from light at 37 ℃ and 5% CO ₂ After incubation for 1h in the cell incubator, the absorbance value of OD450 was measured. HT22 cells treated with OGD/R were found to have significantly reduced activity. And the nano antibody is added to obviously improve the cell activity according to the concentration gradient after OGD/R. The addition of nb.a1 significantly reduced ROS levels in HT22 cells subjected to OGD/R treatment (fig. 4). These results demonstrate that nb.a1 can bind to β2ar in cells and reduce ROS accumulation in neuronal cells following OGD/R treatment.

The results are shown above. We obtained a significantly enriched sequence nb.a1 by second generation sequencing after five rounds of screening. Through intracellular IP experiments, it was shown that nb.a1 has a significant interaction with extracellular segments 1, 2. Subsequent experiments with nanobody addition, the effect on HT22 activity and the effect on tolerance to OGD/R are likely to be related to the extracellular segment 1,2 it targets.

ROS detection experimental principle and method

Principle of experiment

The intermediate products of neuronal cell metabolism accumulate in large amounts during hypoxia, in Ca ²⁺ Free radicals such as Reactive Oxygen Species (ROS) are generated in large amounts by the activation of the pathway. ROS and the like cause damage to the nervous system through DNA damage, protein destruction, lipid peroxidation, and the like.

DCFH-DA is a general indicator of oxidative stress. Has cell membrane permeability and no fluorescence. Once inside the cell, it is hydrolyzed by cellular esterases to produce 2',7' -dichlorofluorescein (2 ',7' -dichlorofluorescein, DCFH), which is then rapidly oxidized to produce the strongly fluorescent product 2',7' -dichlorofluorescein (2 ',7' -dichlorofluorescein, DCF), which can be detected by fluorescence spectroscopy (Ex/em=504/529 nm). Is suitable for detecting Reactive Oxygen Species (ROS) and Nitric Oxide (NO), and determining the total oxidative stress level. Are commonly used to monitor cellular redox processes.

Cerebral stroke, also known as stroke, is a cerebrovascular disease, and is generally classified into ischemic stroke (vascular occlusion) and hemorrhagic stroke (vascular rupture). Ischemic stroke can cause injury to the brain at two different times. In the early stage of ischemic stroke, the blood vessel blockage caused by thrombus can lead to the local blood supply reduction of the brain, and the long-time blood supply deficiency leads to the microenvironment of cell glucose oxygen deprivation. Aerobic respiration of nerve cells is inhibited, ATP cannot be sufficiently synthesized to maintain intracellular and extracellular potential difference, resulting in depolarization of cells and promotion of Ca ²⁺ Influx, in turn, activates downstream calcium-dependent death signaling pathways, leading to cell death (Tymianski et al 1993). The intermediate products of neuronal cell metabolism accumulate in large amounts during hypoxia, in Ca ²⁺ Free radicals such as Reactive Oxygen Species (ROS) are generated in large amounts by the activation of the pathway. ROS and the like cause brain tissue damage through DNA damage, protein damage, lipid peroxidation and the like.

β2ar is capable of mediating hypoxia signal transduction and thus functions. Under hypoxic conditions, GPCR kinase GRK2 activates β2AR phosphorylation, which in turn promotes accumulation of hypoxia responsive protein HIF1α (Cheong et al 2016). This process may be associated with the disruption of the Beclin1/VPS34/Atg14 complex by β2ar, negatively regulated autophagy (Wu et al 2016). Hif1α promotes angiogenesis, glucose transport, and calcium ion balance, protecting brain cells from survival after stroke. However, β2ar is functionally complex and controversial during stroke. The βAR antagonist Propranolol, carvedilol, is known to be useful in the treatment of cerebral ischemia and to exert a neuroprotective effect (Amory et al 2002; little et al 1982; savitz et al 2000). Meanwhile, the β2ar activator clenbuterol also provides neuroprotection to cerebral ischemic tissue by promoting expression of Nerve Growth Factor (NGF) (Semkova et al 1996). MCAO modeling was performed on β2ar knockout mice with significantly reduced infarct size and nerve damage compared to WT mice, consistent with the results following treatment with β2ar antagonist ICI 118551. And HSP72 protein expression, which plays a neuroprotective and anti-apoptotic role in β2ar-KO mice, is significantly upregulated (Han et al 2009). The complexity of β2ar in stroke function may be related to the switching of β2ar from binding-activated G proteins (Gs) to binding-inhibited G proteins (Gi). In summary, β2ar plays an important role in responding to hypoxia and post-stroke nerve repair processes, and may be an important target for stroke treatment. Meanwhile, the effect of the beta 2AR in stroke may have complex spatiotemporalness, and still needs to be further explained by depending on new technical means.

Based on this, we further explored the effect of nb.a1 on ROS accumulation.

The experimental method comprises the following steps:

1. HT22 cells were plated onto the slide of a 12-well plate, 5 ten thousand cells per well. Two groups, a control group and OGD/R, were prepared.

2. After the cells adhere to the wall, 1uM,2.5uM Nb.A1 was added to the culture system and cultured for 12 hours.

3. Replacement of HT22 cells of OGD/R group with sugar-free serum-free DMEM, and placing into hypoxia chamber 1%O ₂ ，5％CO ₂ The treatment was carried out at 37℃for 2h. After 2h, the cells were removed and replaced with normal medium, and reoxygenated under normoxic conditions for 24h.

4. The medium was aspirated and the pbs washed once, and each well was incubated in 500ul 20uM DCFH-DA (stock solution: 20uM, pbs dilution) incubator for 30min.

5. The pbs were washed 2 times and each well was fixed with 500ul of 4% paraformaldehyde fixing solution at room temperature for 15min.

6. The pbs were washed 1 time, 500ul DAPI dye (solabio-C0060, diluted with pbs 1:2000) was added to each well and incubated for 15min at room temperature.

7. The pbs were washed 2 times, capped and sealed (approximately 8ul per slide), air dried in the dark and photographed by confocal.

In conjunction with fig. 5, the results show that OGD/R significantly increases ROS accumulation in HT22 cells. And after nb.a1 is added, the cumulative amount of ROS decreases with increasing nb.a1 concentration.

The specific embodiments do not limit the protection scope of the invention. Any other corresponding changes and modifications made in accordance with the technical idea of the present invention shall be included in the scope of the claims of the present invention.

Claims

1. A nanobody targeting β2ar, wherein the amino acid sequences of complementarity determining regions CDR1, CDR2, and CDR3 of the amino acid sequence of the nanobody are as shown in Seq ID No.2, seq ID No.3, and Seq ID No.4, respectively.

2. The β2ar-targeting nanobody according to claim 1, wherein the amino acid sequence of the nanobody is as shown in Seq ID No. 1.

3. The β2ar-targeting nanobody of claim 1 or claim 2, wherein the nucleic acid sequence expressing the nanobody is as set out in Seq ID No. 5.

4. A molecular expression vector, wherein the vector expresses the nanobody of any one of claims 1-3.

5. A host cell comprising the molecular expression vector of claim 4, wherein the host cell is a prokaryotic cell, a yeast cell, or a virus.

6. The host cell of claim 5, wherein the host cell is a human embryonic kidney cell or a hamster ovary cancer cell.

7. Use of the nanobody of any of claims 1-3 for the preparation of an agent for enhancing the activity of HT22 cells.

8. The use according to claim 7, wherein the activity of the OGD/R treated HT22 cells is enhanced.