CN116790801A - Gene marker for distinguishing rice starch quality - Google Patents
Gene marker for distinguishing rice starch quality Download PDFInfo
- Publication number
- CN116790801A CN116790801A CN202310892400.7A CN202310892400A CN116790801A CN 116790801 A CN116790801 A CN 116790801A CN 202310892400 A CN202310892400 A CN 202310892400A CN 116790801 A CN116790801 A CN 116790801A
- Authority
- CN
- China
- Prior art keywords
- gene
- rice
- seq
- snp
- distinguishing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 57
- 229940100486 rice starch Drugs 0.000 title claims abstract description 27
- 239000003550 marker Substances 0.000 title claims abstract description 18
- 235000007164 Oryza sativa Nutrition 0.000 claims abstract description 38
- 235000009566 rice Nutrition 0.000 claims abstract description 37
- 238000009395 breeding Methods 0.000 claims abstract description 13
- 230000001488 breeding effect Effects 0.000 claims abstract description 13
- 241000209094 Oryza Species 0.000 claims abstract 4
- 229920000856 Amylose Polymers 0.000 claims description 28
- 230000002068 genetic effect Effects 0.000 claims description 13
- 238000001514 detection method Methods 0.000 claims description 8
- 238000012163 sequencing technique Methods 0.000 claims description 8
- 238000012360 testing method Methods 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 229920002472 Starch Polymers 0.000 abstract description 10
- 235000019698 starch Nutrition 0.000 abstract description 10
- 239000008107 starch Substances 0.000 abstract description 10
- 240000007594 Oryza sativa Species 0.000 description 38
- 101150023956 ALK gene Proteins 0.000 description 12
- 239000003513 alkali Substances 0.000 description 11
- 108020004414 DNA Proteins 0.000 description 9
- 239000002773 nucleotide Substances 0.000 description 8
- 125000003729 nucleotide group Chemical group 0.000 description 8
- 230000008033 biological extinction Effects 0.000 description 7
- 238000012216 screening Methods 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 239000000463 material Substances 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 239000003147 molecular marker Substances 0.000 description 6
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 3
- 240000002582 Oryza sativa Indica Group Species 0.000 description 3
- 239000002585 base Substances 0.000 description 3
- 230000001276 controlling effect Effects 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 239000013078 crystal Substances 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 230000008030 elimination Effects 0.000 description 2
- 238000003379 elimination reaction Methods 0.000 description 2
- 230000006872 improvement Effects 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 239000011535 reaction buffer Substances 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 229920000945 Amylopectin Polymers 0.000 description 1
- 101000642824 Arabidopsis thaliana Starch synthase 2, chloroplastic/amyloplastic Proteins 0.000 description 1
- 101000690100 Homo sapiens U1 small nuclear ribonucleoprotein 70 kDa Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 101100029173 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) SNP2 gene Proteins 0.000 description 1
- 101100094821 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) SMX2 gene Proteins 0.000 description 1
- 102100024121 U1 small nuclear ribonucleoprotein 70 kDa Human genes 0.000 description 1
- 238000007792 addition Methods 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000010411 cooking Methods 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 150000007523 nucleic acids Chemical group 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 230000006641 stabilisation Effects 0.000 description 1
- 238000011105 stabilization Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The application discloses a gene marker for distinguishing rice starch quality, which comprises SNP locus sequences SEQ ID NO 5-6 selected from a wall gene. The gene markers can be used for distinguishing the starch quality of rice and effectively guiding the rapid breeding of high-starch-quality rice varieties.
Description
The application is a divisional application of an application patent application with the application number of 202110007361.9 and the application date of 2021, 1,5 and the application creation name of 'gene mark for distinguishing the quality of rice starch'.
Technical Field
The application belongs to the field of gene detection, and relates to a gene marker for distinguishing rice starch quality, in particular to a gene marker for distinguishing rice starch quality and application thereof.
Background
Rice (Oryza sativa l.) is one of the most important food crops in the world, and more than half of the world's population is fed with rice. Along with the improvement of the living standard of people, the requirements of people on the quality of rice are higher and higher, not only the appearance of rice such as chalkiness and transparency are concerned, but also the taste of high-quality rice is required, and the improvement of the quality of rice starch is directly related.
The quality of rice starch includes various indicators such as Gelatinization Temperature (GT), consistency, amylose content, protein content, etc. Generally, when the gelatinization temperature of the japonica rice is more than or equal to 6, and the gelatinization temperature of the indica rice is more than or equal to 4, the rice has good taste; when the amylose content of the japonica rice is 14-18, and when the amylose content of the indica rice is 17-22, the japonica rice has good taste; the polished round-grained nonglutinous rice has better taste when the protein content is more than or equal to 7 and the protein content of the indica rice is more than or equal to 8.
The Gelatinization Temperature (GT) is an important index for determining the cooking quality of rice and is also one of indexes for measuring the quality of starch. The gelatinization temperature means that rice is irreversibly and rapidly expanded in hot water and the crystal structure is disintegrated, so that the birefringence phenomenon is lost. It is difficult to directly measure the value, and it is generally evaluated indirectly by the alkaline elimination method (ASV). According to the difference of alkali elimination values, rice can be classified into seven grades, wherein grade 1-3 is high gelatinization temperature (more than 74 ℃), grade 4-5 is middle gelatinization temperature water (70-74 ℃), and grade 6-7 is low gelatinization temperature (less than 70 ℃). The ALK gene in rice is the main factor controlling gelatinization temperature, which encodes soluble starch synthase II. Changes in enzyme activity are related to changes in amino acids in the enzyme, affecting amylopectin synthesis, resulting in a change in the crystal layer structure of the starch, and thus affecting gelatinization temperature (Gao Zhenyu et al, 2003;Kawakatsu et al, 2009).
Amylose content is closely related to a gene, wax (Wx), which controls starch grain synthesis. The non-waxy gene (Wx) is incompletely dominant to the waxy gene (Wx) (Zhou et al, 2016; wang et al, 1995). Wx is differentiated into Wx a And Wx b Two alleles, gene Wx a Relative to Wx b High expression of (2) leads to an increased amylose content. Transcript content of Wx in japonica rice variety is reduced, and enzymeThe activity was decreased due to Wx in japonica rice b The 5' cleavage site of the first intron of (a) was mutated from GT to TT, resulting in a reduced efficiency of intron splicing, leading to a reduced amylose content (Isshiki et al, 1998).
Disclosure of Invention
In order to quickly select rice varieties with high starch quality, SNP is designed aiming at ALK genes for regulating and controlling gelatinization temperature and wall genes (Wx genes) for regulating and controlling amylose content, and specific relation exists between the SNP and gelatinization temperature or amylose content, so that the SNP can be used as a genetic marker or molecular marker for distinguishing rice starch quality, and target offspring can be quickly selected by using the molecular markers, so that families are quickly and stably selected as soon as possible. Specifically, the application comprises the following technical scheme.
A genetic marker for differentiating starch quality in rice comprising the following SNP site sequences selected from the ALK gene: SEQ ID NO. 1 (SNP 1-A, SNP-TT), SEQ ID NO. 2 (SNP 1-G, SNP-TT), SEQ ID NO. 3 (SNP 1-A, SNP-GC), SEQ ID NO. 4 (SNP 1-G, SNP 2-GC).
The above gene markers may further include the following SNP site sequences selected from the wall gene (abbreviated as Wx gene): SEQ ID NO. 5 (G), SEQ ID NO. 6 (A).
In the gene marker, when the SNP locus sequence of the ALK gene is SEQ ID NO:1 (SNP 1-A, SNP-TT), the alkali extinction value (ASV) is more than or equal to 6; when the SNP site sequence of ALK gene is SEQ ID NO:4 (SNP 1-G, SNP-GC), alkali extinction value (ASV) <6.
Furthermore, in the gene marker, when the SNP locus sequence of the Wx gene is SEQ ID NO. 5 (G), the amylose content is high, such as more than or equal to 20; when the SNP site sequence of the Wx gene is SEQ ID NO. 6 (A), it is suggested that the amylose content is low such as <20.
When rice genomic DNA is used as a template, the SNP locus sequence of ALK gene is amplified by PCR, and the primer pair used is:
forward primer: CGCAGCACAACAGCAAGGTGCG (SEQ ID NO: 7);
reverse primer: GGTCTCTTCACCATTGGTACTTG (SEQ ID NO: 8).
When rice genomic DNA is used as a template, the SNP site sequence of the Wx gene is amplified by PCR, and the primer pair used is:
forward primer: GAGGTGGCCGGTGGTGTTGTCCTTC (SEQ ID NO: 9);
reverse primer: GAAGATTCCATAATGTACCAGG (SEQ ID NO: 10).
The gene marker can be used for constructing a detection model for distinguishing rice starch quality.
Accordingly, a second aspect of the present application provides a test model for distinguishing rice starch quality, comprising the criterion of claim 3 or 4.
Specifically, when the SNP locus sequence of the ALK gene is SEQ ID NO:1 (SNP 1-A, SNP 2-TT), the alkali extinction value (ASV) is more than or equal to 6; when the SNP site sequence of ALK gene is SEQ ID NO. 4 (SNP 1-G, SNP-GC), alkali extinction value (ASV) <6; when the SNP locus sequence of the Wx gene is SEQ ID NO. 5 (G), the amylose content is high, for example, more than or equal to 20; when the SNP site sequence of the Wx gene is SEQ ID NO. 6 (A), it is suggested that the amylose content is low such as <20.
The detection model can be input into a computer, a gene detection device such as an ABI 3730 sequencer or an illuminea sequencer, etc., or a gene sequencing platform by programming or mathematical software package.
In a third aspect, the application provides a kit for distinguishing rice starch quality gene markers, characterized in that it comprises primers SEQ ID NOs 7-8 and/or SEQ ID NOs 9-10 for detecting the same as described in claim 5 or 6.
The kit may further comprise a standard reference table for use.
The application also provides the application of the gene marker, the detection model and the kit in rice variety breeding, preferably rice variety breeding with high starch quality.
The gene markers constructed by the application can accurately determine and judge the gelatinization temperature and the amylose content of rice starch through testing in 25 rice varieties, so that the gene markers are used for distinguishing the rice starch quality, effectively guiding the breeding of high-starch-quality rice varieties and the rapid and stable family, and rapidly eliminating low-starch-quality rice varieties, and have important economic significance.
Detailed Description
In order to screen rice varieties with high starch quality, we focused on the detection of genes (ALK gene and wall gene) affecting rice starch gelatinization temperature and amylose content, combined with the determined starch quality measurement value, by comparing SNP site sequences through gene sequencing, the gene markers of rice starch quality were found.
"genetic markers" may also be referred to herein as "molecular markers".
SNP is a single nucleotide polymorphism (Single Nucleotide Polymorphism) refers to a polymorphism of a nucleic acid sequence due to a single nucleotide base change (including single base transition, transversion, single base insertion/deletion, etc.), which is well known in the art.
Compared with the traditional rice breeding mode, the molecular marker breeding rice plants has a plurality of advantages. First, conventional breeding is performed by representativeness after observation, which requires a plurality of successive generations to determine, and often takes years. Compared with the traditional inoculation experiment result, the molecular marker method for screening rice plants has high stability and good reliability. This method allows rapid purification of the offspring, thus allowing genetic stabilization of the material. The molecular marker identification method can sample in the seedling stage, extract DNA, find out corresponding SNP through PCR amplification and sequencing, identify the single plant of the target, eliminate other plants, improve the screening efficiency of the individual, can meet the requirement of high-flux molecular marker assisted breeding, and realize the industrialized molecular breeding of genes.
The molecular markers capable of predicting the starch gelatinization temperature and the amylose content can be used for rapidly determining the genotype through gene detection in the seedling stage and helping to select donor and acceptor varieties required by breeding, so that the breeding process is accelerated, the rice breeding efficiency is improved, the time cost, the labor cost and the land use cost are greatly saved, the land utilization rate is greatly improved, and the economic significance is obvious.
In one embodiment, when the genetic markers for distinguishing rice starch quality and the uses thereof of the present application are provided in the form of a kit, the kit may include at least one of the following items, respectively, in addition to various primers: a carrying means, the space of which is divided into a defined space which can house one or more containers, such as kits, vials, test tubes, and the like, each of which contains a separate component for use in the method of the application; the instructions, which can be written on bottles, test tubes and the like, or on a single piece of paper, or outside or inside the container, for example paper with a video APP download window for the operation demonstration, such as a two-dimensional code, can also be in the form of multimedia, such as a CD, a U-disc, a netdisk, etc.
The technical effects of the present application are illustrated in the following examples of screening and verification of genetic markers for rice starch quality. It should be understood that the following examples are illustrative of the present application and are not intended to limit the scope of the present application.
The percentages referred to in the examples are by mass unless otherwise indicated (e.g., as a volume percentage or ratio).
Examples
Instrument: PCR instrument, ABI 3730 sequencer.
Rice gene donor variety: 25 rice varieties are presented by Shanghai plant physiological ecological research institute of China academy of sciences.
Example 1: gene marker screening affecting rice starch gelatinization temperature
SNP locus sequence screening of ALK gene comprises the following steps:
1) Extracting genome DNA of rice plants to be detected;
2) Performing PCR amplification on rice genomic DNA by using primers selected from the following table;
| ALK-SNP-F | CGCAGCACAACAGCAAGGTGCG | SEQ ID NO:7 |
| ALK-SNP-R | GGTCTCTTCACCATTGGTACTTG | SEQ ID NO:8 |
the PCR reaction system was 20. Mu.l: 10 XPCR reaction buffer 2.mu.1, 25mM MgSO 4 0.8 μl,2mM dNTP 2 μl, 5 μM forward primer (-F) and reverse primer (-R) each 1.2 μl, 20ng of genomic DNA, 0.4 μl of KOD-Plus polymerase, and ddH 2 O was made up to 20. Mu.1.
The PCR reaction conditions were: pre-denaturation at 94℃for 2 min, denaturation at 94℃for 15 sec, annealing at 55℃for 30 sec, extension at 68℃for 1 min for a total of 35 cycles; incubate at 68℃for 5 minutes.
3) Purifying a PCR product of the SNP locus sequence of the gene ALK, and then carrying out sequencing reaction and 3730 sequencer sequencing;
4) Based on the alkali value ASV of rice starch of the rice variety, the classification statistics are carried out with each detected genotype, and the genotype corresponding to the alkali value ASV, namely the gene molecular marker, is summarized.
The SNP locus sequence of the gene ALK is selected as follows:
CGCAGCACAACAGCAAGGTGCGCGGGTGGGTGGGGTTCTCGGTGAAGATGGCGCACCGGATCACGGCGGGCGCCGACGTGCTGGTCATGCCGTCGCGGTTCGAGCCGTGCGGCCTCAACCAGCTCTACGCCATGGCGTACGGCACCGTCCCCGTCGTGCACGCCGTCGGCGGGCTGAGGGACACC(A/G)TGTCGGCGTTCGACCCGTTCGAGGACACCGGCCTCGGGTGGACGTTCGACCGCGCCG AGCCGCACAAGCTCATCGAGGCGCTCGGCCACTGCCTCGAGACGTACCGCAAGTACA AGGAGAGCTGGAGGGG(GC/TT)TCCAGGTGCGCGGCATGTCGCAGGACCTCAGCTGGGACCACGCCGCCGAGCTCTACG AGGAGGTCCTTGTCAAGGCCAAGTACCAATGGTGAAGAGACC。
in this sequence, nucleotide 186 can be referred to as SNP1 site, and nucleotides 317 to 318 as SNP2 site, the SNP site sequence measured includes:
(SNP1-A、SNP2-TT)：
CGCAGCACAACAGCAAGGTGCGCGGGTGGGTGGGGTTCTCGGTGAAGATGGCGCACCGGATCACGGCGGGCGCCGACGTGCTGGTCATGCCGTCGCGGTTCGAGCCGTGCGGCCTCAACCAGCTCTACGCCATGGCGTACGGCACCGTCCCCGTCGTGCACGCCGTCGGCGGGCTGAGGGACACCATGTCGGCGTTCGACCCGTTCGAGGACACCGGCCTCGGGTGGACGTTCGACCGCGCCGAGCCGCACAAGCTCATCGAGGCGCTCGGCCACTGCCTCGAGACGTACCGCAAGTACAAGGAGAGCTGGAGGGGTTTCCAGGTGCGCGGCATGTCGCAGGACCTCAGCTGGGACCACGCCGCCGAGCTCTACGAGGAGGTCCTTGTCAAGGCCAAGTACCAATGGTGAAGAGACC(SEQ ID NO:1)；
(SNP1-G、SNP2-TT)：
CGCAGCACAACAGCAAGGTGCGCGGGTGGGTGGGGTTCTCGGTGAAGATGGCGCACCGGATCACGGCGGGCGCCGACGTGCTGGTCATGCCGTCGCGGTTCGAGCCGTGCGGCCTCAACCAGCTCTACGCCATGGCGTACGGCACCGTCCCCGTCGTGCACGCCGTC GGCGGGCTGAGGGACACCGTGTCGGCGTTCGACCCGTTCGAGGACACCGGCCTCGGGTGGACGTTCGACCGCGCCGAGCCGCACAAGCTCATCGAGGCGCTCGGCCACTGCCTCGAGACGTACCGCAAGTACAAGGAGAGCTGGAGGGGTTTCCAGGTGCGCGGCATGTCGCAGGACCTCAGCTGGGACCACGCCGCCGAGCTCTACGAGGAGGTCCTTGTCAAGGCCAAGTACCAATGGTGAAGAGACC(SEQ ID NO:2)；
(SNP1-A、SNP2-GC)：
CGCAGCACAACAGCAAGGTGCGCGGGTGGGTGGGGTTCTCGGTGAAGATGGCGCACCGGATCACGGCGGGCGCCGACGTGCTGGTCATGCCGTCGCGGTTCGAGCCGTGCGGCCTCAACCAGCTCTACGCCATGGCGTACGGCACCGTCCCCGTCGTGCACGCCGTCGGCGGGCTGAGGGACACCATGTCGGCGTTCGACCCGTTCGAGGACACCGGCCTCGGGTGGACGTTCGACCGCGCCGAGCCGCACAAGCTCATCGAGGCGCTCGGCCACTGCCTCGAGACGTACCGCAAGTACAAGGAGAGCTGGAGGGGGCTCCAGGTGCGCGGCATGTCGCAGGACCTCAGCTGGGACCACGCCGCCGAGCTCTACGAGGAGGTCCTTGTCAAGGCCAAGTACCAATGGTGAAGAGACC (SEQ ID NO: 3); and
(SNP1-G、SNP2-GC)：
CGCAGCACAACAGCAAGGTGCGCGGGTGGGTGGGGTTCTCGGTGAAGATGGCGCACCGGATCACGGCGGGCGCCGACGTGCTGGTCATGCCGTCGCGGTTCGAGCCGTGCGGCCTCAACCAGCTCTACGCCATGGCGTACGGCACCGTCCCCGTCGTGCACGCCGTCGGCGGGCTGAGGGACACCGTGTCGGCGTTCGACCCGTTCGAGGACACCGGCCTCGGGTGGACGTTCGACCGCGCCGAGCCGCACAAGCTCATCGAGGCGCTCGGCCACTGCCTCGAGACGTACCGCAAGTACAAGGAGAGCTGGAGGGGGCTCCAGGTGCGCGGCATGTCGCAGGACCTCAGCTGGGACCACGCCGCCGAGCTCTACGAGGAGGTCCTTGTCAAGGCCAAGTACCAATGGTGAAGAGACC(SEQ ID NO:4)。
determination of Gene markers of ALK Gene
We sequenced 21 rice material ALK genes and found that these materials can be divided into two sections of 6 or more and 6 or less according to the alkali extinction ASV. The relationship between the alkali value ASV of rice starch and genotype is shown in Table 1.
Table 1: SNP type and ASV value of 21 parts of material
As can be seen from Table 1, when the SNP site sequence of ALK gene is SEQ ID NO:1, the alkali extinction value (ASV) is not less than 6; when the SNP site sequence of ALK gene is SEQ ID NO:4, alkali extinction value (ASV) <6.
Example 2: gene marker screening for influencing amylose content of rice starch
SNP locus sequence screening of Wx genes comprises the following steps:
1) Extracting genome DNA of rice plants to be detected;
2) Performing PCR amplification on rice genomic DNA by using primers selected from the following table;
| Wx-SNP-F | GAGGTGGCCGGTGGTGTTGTCCTTC | SEQ ID NO:9 |
| Wx-SNP-R | GAAGATTCCATAATGTACCAGG | SEQ ID NO:10 |
the PCR reaction system was 20. Mu.l: 10 XPCR reaction buffer 2.mu.1, 25mM MgSO 4 0.8 μl,2mM dNTP 2 μl, 5 μM forward primer (-F) and reverse primer (-R) each 1.2 μl, 20ng of genomic DNA, 0.4 μl of KOD-Plus polymerase, and ddH 2 O was made up to 20. Mu.1.
The PCR reaction conditions were: pre-denaturation at 94℃for 2 min, denaturation at 94℃for 15 sec, annealing at 55℃for 30 sec, extension at 68℃for 1 min for a total of 35 cycles; incubate at 68℃for 5 minutes.
3) Purifying a PCR product of the SNP locus sequence of the gene Wx, and then carrying out sequencing reaction and 3730 sequencer sequencing;
4) Based on the amylose content (high or low) of rice starch of the rice variety which has been confirmed, classification statistics are performed with each of the genotypes measured, and genotypes corresponding to the amylose content, i.e., genetic molecular markers, are summarized.
The SNP site sequence of the selected gene Wx is as follows:
GAGGTGGCCGGTGGTGTTGTCCTTCTGTGGTCAAAAGGGAGAGAAGAGGGGAA AAGAGACACAGAAAGAGGCTGACGTAGCCAGCTGACATGTGGGGCCCACGTGGGTC CCACGGCTGACAGAACCGTCACGTA(A/G)GACAAAACCGGGGTAAAAACCACCTAAGAAGCTCGGGTAACCGGTTTTGTATAGTTA AGAGATCCCGTATATCTGGTTTTGTGGTTCGAGGATGTTTTTTTATCCCGATGATAAGT TGAGGGACCTTCGGTGTACTTTTTCCTGGTACATTATGGAATCTTC。
in the sequence, the 135 th nucleotide is an SNP locus, and the measured SNP locus sequence comprises:
(nucleotide 135 is G):
GAGGTGGCCGGTGGTGTTGTCCTTCTGTGGTCAAAAGGGAGAGAAGAGGGGAAAAGAGACACAGAAAGAGGCTGACGTAGCCAGCTGACATGTGGGGCCCACGTGGGTCCCACGGCTGACAGAACCGTCACGTAGGACAAAACCGGGGTAAAAACCACCTAAGAAGCTCGGGTAACCGGTTTTGTATAGTTAAGAGATCCCGTATATCTGGTTTTGTGGTTCGAGGATGTTTTTTTATCCCGATGATAAGTTGAGGGACCTTCGGTGTACTTTTTCCTGGTACATTATGGAATCTTC(SEQ ID NO:5)；
(nucleotide 135 is A):
GAGGTGGCCGGTGGTGTTGTCCTTCTGTGGTCAAAAGGGAGAGAAGAGGGGAAAAGAGACACAGAAAGAGGCTGACGTAGCCAGCTGACATGTGGGGCCCACGTGGGTCCCACGGCTGACAGAACCGTCACGTAAGACAAAACCGGGGTAAAAACCACCTAAGAAGCTCGGGTAACCGGTTTTGTATAGTTAAGAGATCCCGTATATCTGGTTTTGTGGTTCGAGGATGTTTTTTTATCCCGATGATAAGTTGAGGGACCTTCGGTGTACTTTTTCCTGGTACATTATGGAATCTTC(SEQ ID NO:6)。
gene marker determination of Wx Gene
The wall genes of 14 materials were sequenced and found to fall into two categories, high and low amylose content. In order to indicate the level of amylose content, a rice variety having a high amylose content is indicated as (G), and a rice variety having a low amylose content is indicated as (A).
The correspondence of amylose content of rice starch to genotype is shown in Table 2.
Table 2:14 parts of rice material, of the type of the SNP of the wall gene and of the amylose content
As is clear from Table 2, when the SNP site sequence of the wall gene is SEQ ID NO:5, it is suggested that the amylose content is high (G); when the SNP site sequence of the wall gene is SEQ ID NO. 6, it is suggested that the amylose content is low (A).
The foregoing description of the preferred embodiment of the application is not intended to be limiting in any way or nature, and it should be noted that modifications and additions may be made to those skilled in the art without departing from the scope of the application.
Reference is made to:
1.Kawakatsu T,Yamamoto M；Touno S et al.Compensation and interaction between RISBZ1 and RPBF during grain filling in rice.The Plant Journal,2009,59(6):908-920.
2. gao Zhenyu; great force is applied; cui Xia; zhou Yihua; yan Meixian; yellow years; li Guyang; map cloning of rice gelatinization temperature control gene ALK and its sequence analysis Chinese science (C edit), 2003,33 (6): 481-487.
3.Wang ZY，Zheng QF,Shen GZ et al.The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene The Plant Journal,1995,7(4):613-622.
4.Isshiki M,Morino K,Nakajima M et al.A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′splice site of the first intron.The Plant Journal,1998,15(1):133-138.
5.Zhou H,Wang L,Liu G et al.Critical roles of soluble starch synthase SSIIIa and granule-bound starch synthase Waxy in synthesizing resistant starch in rice.Proceedings of the National Academy of Sciences of the United States of America,2016,113(45):12844-12849.
Claims (7)
1.A genetic marker for distinguishing rice starch quality comprising the following SNP site sequences selected from the xy gene: SEQ ID NO. 5, SEQ ID NO. 6.
2. The genetic marker of claim 1, wherein when the SNP site sequence of the wall gene is SEQ ID NO. 5, it indicates that the amylose content is not less than 20; when the SNP site sequence of the wall gene is SEQ ID NO. 6, it is suggested that the amylose content is <20.
3. The genetic marker of claim 1, wherein when PCR amplification of SNP site sequences of the wall gene is performed using rice genomic DNA as a template, primer pairs are used as follows:
forward primer: GAGGTGGCCGGTGGTGTTGTCCTTC (SEQ ID NO: 9);
reverse primer: GAAGATTCCATAATGTACCAGG (SEQ ID NO: 10).
4. A test model for distinguishing rice starch quality comprising the criterion of claim 2.
5. The test model of claim 4, wherein the test model is input into a computer, a genetic testing device, or a genetic sequencing platform by programming, in the form of a mathematical software package.
6. A kit for distinguishing rice starch quality gene markers, which is characterized by comprising primers SEQ ID NOs 9-10 for detecting the primers as set forth in claim 3.
7. Use of the genetic marker according to claim 1 or 2, the detection model according to claim 4 or 5, or the kit according to claim 6 in the breeding of rice varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310892400.7A CN116790801A (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310892400.7A CN116790801A (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
| CN202110007361.9A CN114717348B (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110007361.9A Division CN114717348B (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116790801A true CN116790801A (en) | 2023-09-22 |
Family
ID=82233640
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110007361.9A Active CN114717348B (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
| CN202310892400.7A Pending CN116790801A (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110007361.9A Active CN114717348B (en) | 2021-01-05 | 2021-01-05 | Gene marker for distinguishing rice starch quality |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN114717348B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115896328A (en) * | 2022-10-20 | 2023-04-04 | 华智生物技术有限公司 | Haplotype SNP molecular marker of functional gene for detecting rice alkali elimination value and detection method |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1570110A (en) * | 2003-07-21 | 2005-01-26 | 中国科学院遗传与发育生物学研究所 | Rice grain gelatinization temperature main control gene ALK and its uses |
| CN110029187A (en) * | 2019-04-29 | 2019-07-19 | 华南农业大学 | A kind of application for marking the method for map based on competitive equipotential PCR building rice molecular and it being utilized to carry out breeding |
| CN110885895A (en) * | 2019-11-01 | 2020-03-17 | 广西壮族自治区农业科学院 | Molecular marking method of rice gelatinization temperature gene ALK and special primer thereof |
| CN111154906A (en) * | 2020-01-20 | 2020-05-15 | 安徽省农业科学院水稻研究所 | SNP functional molecular marker suitable for rice screening special for rice flour and application thereof |
-
2021
- 2021-01-05 CN CN202110007361.9A patent/CN114717348B/en active Active
- 2021-01-05 CN CN202310892400.7A patent/CN116790801A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115896328A (en) * | 2022-10-20 | 2023-04-04 | 华智生物技术有限公司 | Haplotype SNP molecular marker of functional gene for detecting rice alkali elimination value and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114717348A (en) | 2022-07-08 |
| CN114717348B (en) | 2023-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duan et al. | Natural variation in the promoter of GSE5 contributes to grain size diversity in rice | |
| US8039686B2 (en) | QTL “mapping as-you-go” | |
| CN110004244A (en) | Marker group, composition and the application of comprehensive screening transgene component | |
| CN105925689A (en) | Molecular marker and method for identifying allelotype of rice chalk gene Chalk5 | |
| AU2011253127B2 (en) | Use of brown midrib-3 gene specific markers in maize for trait introgression | |
| CN114717348B (en) | Gene marker for distinguishing rice starch quality | |
| CN114517241A (en) | Functional KASP molecular marker of wheat dwarf gene Rht8 and application thereof | |
| US20210348180A1 (en) | Terminator sequence for gene expression in plants | |
| Lu et al. | Development of new markers to genotype the functional SNPs of SSIIa, a gene responsible for gelatinization temperature of rice starch | |
| CN114717352B (en) | Molecular marker of rice high temperature resistant regulatory gene Hsp70 and application thereof | |
| CN107022646A (en) | Primer sets, kit and method for detecting cotton MON1445 transformant | |
| BR102014005635B1 (en) | Method for identifying at least one phytophthora resistance determinant in a soybean plant | |
| CN116479163A (en) | Molecular marker linked with loose cauliflower leaf yellowing gene and application thereof | |
| CN111593135A (en) | Detection primer and method for identifying internal and external genes in transgenic material and selfing, hybridization and backcross progeny thereof | |
| CN112251516A (en) | Method for detecting standard weight day age of pig by using No. 7 chromosome of pig and kit thereof | |
| Jeng et al. | Nucleotide polymorphisms in the waxy gene of NaN3-induced waxy rice mutants | |
| CN106318937B (en) | Molecular labeling and its application | |
| Chen et al. | Fine mapping and candidate gene analysis of qGL10 affecting rice grain length | |
| KR101500613B1 (en) | Discrimination method for rice genetic resource and primers for discrimination of rice having amylose content | |
| US20050250205A1 (en) | Use of associations between at least one nucleic sequence polymorphism of the sh2 gene and at least one seed quality characteristic in plant selection methods | |
| JP2021191240A (en) | Method for determining the ease of hardening of rice | |
| CN106319030B (en) | Molecular labeling and its application | |
| US20080047032A1 (en) | Eg307 nucleic acids and uses thereof | |
| Liu et al. | Targeted Deletion of the Wx Gene First Intron via CRISPR/Cas9 Significantly Increases Grain Amylose Content in Rice With a Wxb Allele, but Not in Rice With a Wxa Allele | |
| CN116377102A (en) | Wheat molecular marker AX-95660756 and application thereof in gluten aggregation characteristic improvement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |