CN116790620A - Rice yield regulating gene Os04t0686700, encoding protein, expression vector and application thereof - Google Patents

Abstract

The application discloses a rice yield regulating geneOs04t06867002The coded protein, the expression vector and the application thereof; the application regulates and controls the gene for the rice yieldOs04t06867002CRISPR/Cas9 knockout is carried out, so that the influence of the gene on the performance of rice tillering number, small spike number, yield, plant height and the like is clear; determining the regulation and control effect of the plant to the rice yield; thereby for utilization ofOs04t06867002Gene improvement in rice yield providesTechnical support.

Description

Rice yield regulating gene Os04t0686700, encoding protein, expression vector and application thereof

Technical Field

The application relates to the technical field of molecular breeding, in particular to a rice yield regulation geneOs04t0686700And its coded protein, expression vector and application.

Background

Rice [ (Oryza sativa L.)Oryza sativa L.) Is one of the most important food crops in the world and provides food for more than 50% of the population worldwide. Therefore, the improvement of the rice yield has important significance for guaranteeing the grain safety, promoting the economic development and stabilizing the society. With the growth of global population and the continuous increase of grain demand, the improvement of rice yield has become a common goal of governments and scientists in various countries.

The rice yield comprises effective spike (effective tillering number), small spike number, spike grain number, thousand grain weight and the like. In recent years, a plurality of key genes for rice yield-related traits have been cloned by means of gene editing techniques, genomics and the like, such asSD1、DEP1、GS3、GW2、IPA1、OsSPL14Etc. Although cloning and functional analysis of the genes provide important gene resources for breeding new varieties of high-yield rice, the yield-related traits are mostly quantitative traits, and are controlled by a few major genes and a plurality of minor genes, and the functional genes obtained at present are still very limited for comprehensively elucidating molecular mechanisms of yield formation. Therefore, it is necessary to further excavate more genes of rice yield-related traits and analyze the utilization ways thereof, thereby enriching the genetic basis of yield formation and providing excellent gene resources for breeding new varieties of rice.

The information disclosed in this background section is only for enhancement of understanding of the general background of the application and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art that is known to a person skilled in the art.

Disclosure of Invention

The inventor researches and determines the gene of the rice and the maizeKWE2Homologous genesOs04t0686700And the expression of the rice on the effective tillering and grain weight characteristics of the rice and the improvement of the yield are determined by creating corresponding knockout mutation. The application is to utilizeOs04t0686700The gene provides technical support for improving the rice yield.

One of the objects of the present application is to provide a rice yield-controlling geneOs04t06867002The nucleotide sequence is at least one of the following groups:

(1) As shown in SEQ ID NO. 1;

(2) DNA molecules which are formed by one to several base substitutions and/or one to several base insertions and/or deletions and large fragment nucleotide sequence insertions/deletions/shifts/inversions on the basis of SEQ ID NO.1 and which affect the phenotype of yield-related traits.

Another aspect of the present disclosure provides a rice yield-controlling geneOs04t0686700The amino acid sequence of the encoded protein is at least one of the following groups:

(1) A protein consisting of the amino acid sequence encoded by SEQ ID NO. 1;

(2) As shown in SEQ ID NO. 2;

(3) A protein which is obtained by substitution, deletion and/or addition of one or a plurality of amino acid residues from SEQ ID NO.2 and has the property of influencing yield.

In a third aspect of the present disclosure, there is provided a rice plant comprising the rice plant yield regulating geneOs04t0686700The recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium.

In a fourth aspect of the present disclosure, there is provided a method for identifying a regulatory gene of riceOs04t0686700A mutant primer pair having the sequence:

F: 5’- CGCCCATCCACCTCCTG -3’，

R: 5’- GGGGATGCTTCATCCACTTG -3’。

in a fifth aspect of the present disclosure, the rice regulatory geneOs04t0686700The primer is applied to rice yield trait improvement and dominant variety/strain breeding.

For example, silencing/down-regulating expression of the rice regulatory geneOs04t0686700To increase the effective tillering number, spike number and/or plant height of rice. Construction of Rice regulatory genesOs04t0686700And (3) the knockout vector or the silencing vector of the strain is transformed into plants, and corresponding homozygous mutants are cultured and screened to carry out hybridization breeding with corresponding inbred lines.

For another example, the rice regulatory gene is overexpressedOs04t0686700To increase the grain number of rice ears. Construction of Rice regulatory genesOs04t0686700And transforming plants, culturing and screening out corresponding positive single plants, and carrying out hybridization breeding with corresponding inbred lines.

The application relates to a rice regulatory geneOs04t06867002The transformable plant may be a monocot and dicot plant, including, but not limited to, rice, maize, wheat, barley, rye, sorghum, switchgrass, canola, cotton, sweet potato, sunflower, potato, soybean, pea, alfalfa, arabidopsis, and the like.

One or more technical solutions provided in the embodiments of the present application at least have any one of the following technical effects or advantages:

1. rice yield regulating geneOs04t06867002CRISPR/Cas9 knockout and overexpression are carried out, and homozygous CRISPR-Cas9 mutant and overexpression strain are obtained, which is clearOs04t06867002The gene has influence on the performance of the effective tillering number, the small ear number, the ear grain number, the yield, the plant height and the like of the rice; the regulation and control effect of the plant extract on the rice yield is verified; thereby for utilization ofOs04t06867002The gene provides technical support for improving the rice yield.

2. Genes disclosed by the applicationOs04t06867002The method can facilitate the creation of high-yield breeding materials for crops such as rice, corn, wheat and the like, and shorten the farmingThe breeding period of the new variety reduces the breeding cost and improves the breeding efficiency.

Drawings

FIG. 1 shows a rice plant according to an embodiment of the present applicationOs04t06867002Phylogenetic analysis tree of genes.

FIG. 2 shows rice in an embodiment of the present applicationOs04t06867002Knockout plants and ear phenotype map of homologous genes, bar=5 cm.

FIG. 3 shows rice in an embodiment of the present applicationOs04t06867002Field phenotype map of knockout of homologous genes.

FIG. 4 shows rice in an embodiment of the present applicationOs04t06867002A spike phenotype map of a homologous gene over-expression strain, bar=5 cm; in the figure, CK is the control variety, i.e., the transgenic recipient variety, and OE1, OE2, and OE3 are the spikelet phenotype of the over-expressed strain.

Detailed Description

Definitions and description of related terms:

the term "rice yield-controlling gene" refers to a nucleotide sequence having the ability to encode a protein, which specifically encodes a protein-active polypeptide having the function of controlling the grain weight and yield of the ear.

The rice yield regulation gene also comprises a gene capable of encoding a gene with natural regulation and effective tillering, spike number, plant height and yieldOs04t06867002Variant forms of the open reading frame sequences of the same functional protein; these variants include, but are not limited to: deletions, insertions and/or substitutions of 1 or several nucleotides, and additions of several (usually within 60, preferably within 30, more preferably within 10, most preferably within 5) nucleotides at the 5 'or 3' end.

The rice yield regulating gene also comprises an amino acid sequence which can translate and has the functions of regulating and controlling the effective tillering number, the small ear number and the yield of rice, and is shown as SEQ ID NO. 2. The amino acid sequence also comprises a variant form with the same function of naturally regulating and controlling the grain weight protein of the rice. These variants include, but are not limited to: deletion, insertion and/or substitution of 1 or several amino acids, and addition of 1 or several (usually 20 or less, preferably 10 or less, more preferably 5 or less) amino acids at the C-terminal and/or N-terminal. In the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein; the addition of one or several amino acids at the C-terminal and/or N-terminal will not normally alter the function of the protein either.

In addition, the full-length nucleotide sequence of the "rice yield-controlling gene" or a fragment thereof can be usually obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, the corresponding primers can be designed based on the nucleotide sequences disclosed in this example, particularly the open reading frame sequences, and amplified to the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it usually requires two or more nested PCR amplifications, and then the PCR amplification products are spliced together in the correct order.

Particularly preferred is at least one rice yield regulating gene disclosed in the present application expressed in higher plantsOs04t06867002Once the desired nucleotide sequence has been transformed into a particular plant species, it can be propagated in that species or transferred into other varieties of the same species using conventional breeding techniques. The rice yield regulating gene disclosed by the applicationOs04t0686700Is inserted into an expression cassette or is contained in a non-pathogenic self-replicating virus, and then preferably is stably integrated into the plant genome. Receptors transformed according to the application can be monocots and dicots including, but not limited to, rice, maize, wheat, barley, rye, canola, cotton, sunflower, potato, soybean, pea, switchgrass, arabidopsis and the like. By expressing the nucleotide sequences disclosed herein in transgenic plants, the biosynthesis of functional proteins capable of enhancing the expression of the corresponding hybrid vigour is thereby promoted in the transgenic plants. In this way, transgenic plants can be produced that enhance hybrid vigour performance. In order to express the nucleotide sequences of the present application in transgenic plants, the nucleotide sequences disclosed herein may requireModification and optimization the codons may be changed to meet plant preferences while maintaining the amino acids encoded by the nucleotide sequences of the present application. Moreover, high levels of expression in plants can be best achieved from coding sequences having a GC content of at least about 35%, preferably greater than about 45%, more preferably greater than 50%, and most preferably greater than about 60%.

The following examples are provided to facilitate a better understanding of the present application, but it should be understood that the scope of the application is not limited to the specific embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

The experimental methods in the embodiments of the application are all conventional methods unless otherwise specified; it will be understood by those skilled in the art that the reagents, enzymes, etc., used in the examples described below are all reagents or enzymes of analytically pure grade commercially available from the reagent company, unless otherwise specified. The materials, methods, and examples are illustrative only and not intended to be limiting.

Example one, riceOs04t06867002Functional verification of Gene

The inventor based on long-term scientific research discovers that the riceOs04t0686700Gene (shown as SEQ ID NO. 1) and cornKWE2Genetic relationships of genes have recently been evolutionarily located in the same branch (see FIG. 1). Further studies have also demonstrated that riceOs04t0686700Gene and maizeKWE2Genes have similar functions: negative control of yield and heterosis.

To clarify the regulating and controlling way and effect of the gene on rice yield, the gene is used in riceOs04t06867002CRISPR-Cas9 knockout is carried out on the gene (the cDNA sequence and the protein amino acid sequence after knockout are shown as SEQ ID NO.3 and SEQ ID NO. 4). The specific operation steps are as follows:

1. design of RiceOs04t06867002CRISPR-Cas9 vector of gene cDNA, design double target gRNA in exon region: target I: aggacggaggaggcaaatcccgg; target II: ccgataagctgcggcaatgccgg.

And constructing corresponding intermediate vectors based on the primers VSF-Y1 and VSF-B1:

VSF-B1 reaction system: gRNA 2. Mu. L, VSF-B1 empty 1.5. Mu. L, ECO31l endonuclease 0.5. Mu. L, T4-DNA ligase 0.5. Mu. L, T4 buffer 1. Mu. L, ddH ₂ O4.5. Mu.L, and incubated at 37℃for 2h.

VSF-Y1 reaction system: gRNA 2. Mu. L, VSF-Y1 empty 1.5. Mu. L, ECO31l endonuclease 0.5. Mu. L, T4-DNA ligase 0.5. Mu. L, T4 buffer 1. Mu. L, ddH ₂ O4.5. Mu.L, incubated at 37℃for 2h.

PCR reaction procedure: 95 ℃ for 10 min;55 ℃ for 10 min;14℃for 5 min.

VSF- -B1 primer:

VSF--B1（+）：cagtGGTCTCaggcaggacggaggaggcaaatcc；VSF--B1（-）：cagtGGTCTCaaaacggatttgcctcctccgtcc。

VSF- -Y1 primer:

VSF--Y1（+）：cagtGGTCTCaggcaccggcattgc cgcagcttat；VSF--Y1（-）：cagtGGTCTCaaaacataagctgcggcaatgccgg。

2. recombinant plasmid transformation: (1) 5 mu L of the ligation product and 200 mu L of E.coli competent cells DH5a were mixed and incubated on ice for 30 min; (2) then rapidly placing the mixture in a constant-temperature water bath (42 ℃) for heat shock conversion of 90 s; (3) adding 500 mu L of LB liquid medium after ice bath for 2min, and uniformly mixing; (4) culturing at 37deg.C and 200 rpm for 45 min to recover normal growth state; (5) uniformly inoculating the bacterial liquid on an LB solid culture medium plate; (6) after 30min, the cells were incubated overnight at 37℃in a constant temperature incubator.

3. Selecting a monoclonal extraction plasmid: (1) Picking and inoculating a monoclonal in a LB solid culture medium plate to a kana-resistant LB liquid (final concentration 50 mug/mL) culture medium, and standing at 37 ℃ for overnight culture; (2) Centrifuging activated bacteria solution 4 mL at room temperature at 10000 rpm for 2min, and removing supernatant; (3) Taking 250 mu L of Solution I reagent containing ribonuclease A to fully resuspend fungus blocks; (4) Taking 250 mu L of Solution II reagent to lyse the bacterial blocks, and slightly reversing the steps up and down for a plurality of times until the bacterial bodies are transparent; (5) Taking 350 mu L of Solution III reagent, and reversing for several times until white compact floccules are formed; (6) Centrifuging at 12000rpm at room temperature for 10 min, and collecting supernatant; (7) Taking out the nucleic acid purification column from the kit and placing the nucleic acid purification column on a collecting pipe; (8) Taking the clear supernatant obtained in the step (6) into a nucleic acid purification column, centrifuging at 12000rpm for 1min at room temperature, and discarding filtrate; (9) Taking 500 mu L of Buffer W1 into a nucleic acid purification column, centrifuging at 12000rpm for 30s at room temperature, and discarding the filtrate; (10) Taking 700 mu L of Buffer W2 into a nucleic acid purification column, centrifuging at 12000rpm for 30s at room temperature, and discarding the filtrate; (11) repeating step (10); (12) Placing the nucleic acid purification column on a collecting tube, and performing air-separation at 12000rpm for 2min at room temperature to remove residual liquid as much as possible; (13) Discarding the collection tube, placing the nucleic acid purification column in a 1.5 mL EP tube, adding 50 μl of eluent to elute DNA attached to the membrane of the nucleic acid purification column, and standing at room temperature for 2min; (14) Centrifuging at 12000rpm for 2min at room temperature, eluting DNA attached to the nucleic acid purification column membrane, and preserving at-40deg.C in a low temperature refrigerator; (15) Taking trace recovery products, and detecting plasmid extraction quality by agarose gel electrophoresis with the concentration of 1%; the plasmid of (16) was subjected to monoclonal sequencing.

4. Double-target enzyme digestion connection system: 1. Mu.L of VSF-Y1-1 (plasmid), 1.5. Mu.L of VSF-B1-1 (plasmid), 0.5. Mu.L of LguI, 0.5. Mu.L of T4 ligase, 1. Mu.L of T4 buffer, ddH ₂ O5.5. Mu.L, and after 2h incubation in an incubator at 37℃E.coli was transformed and cultured with shaking, the bacteria were examined.

5. And (3) bacterial inspection: 2 XMix 10. Mu.L, 1. Mu.L VSF-Y1+ (Forward detection primer), 1. Mu.L GET- (reverse detection primer), H ₂ And detecting bacterial liquid by O8 mu L, wherein the target band is 750bp. Picking correct monoclonal bacteria, extracting plasmid and sequencing.

Reverse detection primer GET-ATACGAAGTTATGACTGCGACCGA.

6. Mature rice seeds are mechanically dehulled, full sterile high-quality seeds are selected, sterilized and inoculated to corresponding culture media to induce callus.

7. And (3) selecting an agrobacterium single colony, placing the agrobacterium single colony in a culture solution, and performing shake culture.

8. Co-culturing agrobacterium and callus: (1) placing the cultured bacterial liquid into a centrifuge tube, centrifuging to obtain supernatant, and preparing agrobacterium suspension; (2) picking out the callus which grows to a certain size, and placing the callus in an agrobacterium suspension for infection; (3) callus was placed on co-culture medium.

9. Screening: (1) taking out the callus; (2) transferring the dried calli to a screening culture medium for first screening; (3) the initial calli with the growing resistant calli were transduced into new medium and subjected to a second screening.

10. Induced differentiation and rooting of resistant calli: (1) selecting resistant callus, transferring into a culture dish filled with differentiation medium, sealing with sealing film, and placing into a constant temperature culture room for waiting differentiation into seedlings; (2) and (5) after the seedlings grow to about 1cm, transferring to a rooting culture medium to strengthen the seedlings.

11. The CTAB method is used for extracting the genome of the plant, and the positive plant is detected by PCR.

At the same time, for riceOs04t0686700The gene over-expression vector is subjected to genetic transformation: (1) adding the overexpression vector plasmid 1 [ mu ] L into 50 [ mu ] L of EHA105 agrobacterium competent cells; (2) after fully and uniformly mixing, sucking the mixture into an electric rotating cup for electric rotating, adding 1mL of LB liquid culture medium after electric rotating, sucking the mixture into a 1.5 mL Ep tube after fully and uniformly mixing, carrying out shaking culture at a shaking table of 30 ℃ and 180rpm for 30min, sucking 50 [ mu ] L of activated agrobacterium tumefaciens bacteria liquid, inoculating the activated agrobacterium tumefaciens bacteria liquid onto the LB solid culture medium, and carrying out dark culture at the temperature of 30 ℃ for 48h; (3) agro-bacteria detection primer pair hyg (280) +: 5'-ACGGTGTCGTCCATCACAGTTTGCC-3' hyg (280) -:5'-TTCCGGAAGTGCTTGACATTGGGGA-3'; (4) selecting 86 rice grains with normal bud and mouth and no mildew, sterilizing with 75% alcohol for 1min, and cleaning with sterilized water for 1 min/time; sterilizing with sodium hypochlorite for 20min, and cleaning with sterilized water for 3 times and 1 min/time; inoculating the sterilized rice grains into an induction culture medium, and culturing for 20d at 26 ℃ under illumination; (5) the agrobacterium is selected in the invasion solution to prepare agrobacterium heavy suspension with OD600 = 0.2, the callus is selected in a triangular flask, the agrobacterium heavy suspension is added, the bacterial solution is discarded after 10-15 min of infection, the callus is inoculated in a co-culture medium, and the co-culture is carried out for 48-72 h at 20 ℃; (6) inoculating the callus to a screening culture medium, and culturing in dark at 26 ℃ for 20-30 d; selecting positive calli to a secondary screening culture medium, and selecting monoclonal calli in the calli selection process, and culturing in dark at 26 ℃ for 7-10 d; (7) inoculating positive callus to differentiation medium, culturing at 25-27 deg.C under illumination for 15-20 d, inoculating to rooting medium after differentiating 2-5 cm budsCulturing for 7-10 d at 30 ℃ under illumination; (8) and extracting rice genome DNA by adopting a CTAB method, and carrying out PCR detection to detect positive seedlings.

T for transgenic positive plants ₂ Genotyping was performed on the generations to obtain the corresponding homozygous CRISPR-Cas9 mutants and over-expression lines (see figures 2-4).

Example two, riceOs04t0686700Evaluation of Gene Effect

Obtained by transformation of Japanese sunny (reference variety) according to the above examplesOsKO-1、101×OsKO-110% H for rice seed of 101 XNippon Nippon, transgenic acceptor 101 ₂ O ₂ Treating for 30min, washing with distilled water for 4 times, and dark culturing at 30deg.C for 3 days while changing water once a day; after exposure, the culture is transferred to an illumination incubator for culture, and water is changed every 1 d. When the seedlings grow to 3-4 cm, continuously culturing in an illumination incubator by using Hoagland culture solution; and when the seedlings grow to about 15 and cm, the rice seedlings are moved to the outdoor with sufficient illumination for potting culture. And (5) extracting leaf DNA of the seedlings after the seedlings are slowly grown, and detecting editing sites. After the rice was matured, the plant height, effective tillering number and spike number of each material were investigated and photographed (see fig. 2 and 3). Comprehensive test results show that at the level of inbred line, the mutantOsKO-1The plant height, the spike number and the single plant yield of the strain are obviously higher than those of a control Japanese sunny day, and the level of the hybrid seeds is highOsKO-1The plant height, spike number and individual yield of the hybrid matched with 101 were also higher than those of the corresponding hybrid control (101×japan). The result shows that the riceOs04t0686700CRISPR-Cas9 knockouts of (i) can increase effective tillering and spikelet number (see fig. 2 and 3), whereas their overexpression reduces effective tillering and increases spikelet number (see fig. 4). As can be seen, riceOs04t0686700The negative regulation of the gene can effectively control the tillering number and the small ear number, and the positive regulation of the increase of the ear grain number can further influence the dominant expression of the hybrid yield.

Claims (10)

1. Rice yield regulation geneOs04t0686700The nucleotide sequence is at least one of the following groups:

(1) As shown in SEQ ID NO. 1;

(2) DNA molecules which are formed by one to several base substitutions and/or one to several base insertions and/or deletions and large fragment nucleotide sequence insertions/deletions/shifts/inversions on the basis of SEQ ID NO.1 and which affect the phenotype of yield-related traits.

2. Rice yield regulation geneOs04t0686700The amino acid sequence of the encoded protein is at least one of the following groups:

(1) A protein consisting of the amino acid sequence encoded by SEQ ID NO. 1;

(2) As shown in SEQ ID NO. 2;

(3) A protein which is obtained by substitution, deletion and/or addition of one or a plurality of amino acid residues from SEQ ID NO.2 and has the property of influencing yield.

3. A rice yield regulating gene according to claim 1Os04t0686700The recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium.

4. Identification of rice regulatory geneOs04t0686700A mutant primer pair having the sequence:

F: 5’- CGCCCATCCACCTCCTG -3’，

R: 5’- GGGGATGCTTCATCCACTTG - 3’。

5. the rice yield-controlling gene according to claim 1Os04t0686700Use of the recombinant expression vector of claim 3 or the primer pair of claim 4 for regulating the effective tillering number, the spikelet number and/or the plant height of rice.

6. The rice yield-controlling gene according to claim 1Os04t0686700The recombinant expression vector of claim 3 or the primer pair of claim 4 is applied to rice yield trait improvement and dominant variety/strain breeding.

7. The use according to claim 6, wherein silencing/down-regulating expression of said waterRice yield regulating geneOs04t0686700To increase the effective tillering number, spike number and/or plant height of rice.

8. The use according to claim 7, characterized by the steps of:

construction of Rice yield controlling GeneOs04t0686700And (3) the knockout vector or the silencing vector of the strain is transformed into plants, and corresponding homozygous mutants are cultured and screened to carry out hybridization breeding with corresponding inbred lines.

9. The use according to claim 6, wherein the rice yield-controlling gene is overexpressedOs04t0686700To increase the grain number of rice ears.

10. The use according to claim 9, characterized by the steps of: construction of Rice yield controlling GeneOs04t0686700And transforming plants, culturing and screening out corresponding over-expression lines, and carrying out cross breeding with corresponding inbred lines.