CN116790457A - Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof - Google Patents

Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof Download PDF

Info

Publication number
CN116790457A
CN116790457A CN202310387908.1A CN202310387908A CN116790457A CN 116790457 A CN116790457 A CN 116790457A CN 202310387908 A CN202310387908 A CN 202310387908A CN 116790457 A CN116790457 A CN 116790457A
Authority
CN
China
Prior art keywords
rhodobacter sphaeroides
strain
coenzyme
recombinant
clsc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310387908.1A
Other languages
Chinese (zh)
Inventor
张颖
祁峰
梁可伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FUJIAN FUKANG PHARMACEUTICAL CO LTD
Fujian Normal University
Original Assignee
FUJIAN FUKANG PHARMACEUTICAL CO LTD
Fujian Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by FUJIAN FUKANG PHARMACEUTICAL CO LTD, Fujian Normal University filed Critical FUJIAN FUKANG PHARMACEUTICAL CO LTD
Priority to CN202310387908.1A priority Critical patent/CN116790457A/en
Publication of CN116790457A publication Critical patent/CN116790457A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1288—Transferases for other substituted phosphate groups (2.7.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/66—Preparation of oxygen-containing organic compounds containing the quinoid structure
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/08—Transferases for other substituted phosphate groups (2.7.8)
    • C12Y207/08011—CDP-diacylglycerol--inositol 3-phosphatidyltransferase (2.7.8.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for producing coenzyme Q 10 The recombinant rhodobacter sphaeroides strain and the construction method thereof belong to the technical field of bioengineering. The invention is realized by modifying rhodobacter sphaeroides original strainRhodobacter sphaeroides 2.4.1 to achieve increased coenzyme Q 10 Method for producing a product, in particular by strengtheningRhodobacter sphaeroides 2.4.1 intracellular cardiolipin Synthesis pathway center Phospholipidsynthase C(Cardiolipin synthase,clsC) Realizes the increase of the synthesis amount of cardiolipin on the cell membrane of the recombinant rhodobacter sphaeroides strain and strengthensRecombinant rhodobacter sphaeroides strain cell membrane-bound coenzyme Q 10 The capability of synthesizing coenzyme Q by the recombinant rhodobacter sphaeroides strain is obviously improved 10 Is a product of the above process. The invention is suitable for coenzyme Q 10 Is suitable for industrial production.

Description

Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof
Technical Field
The invention belongs to the technical field of bioengineering, and in particular relates to a method for producing coenzyme Q 10 Recombinant rhodobacter sphaeroides strain and a construction method thereof.
Background
Coenzyme Q 10 (Coenzyme Q 10 Or CoQ 10 ) The chemical name 2, 3-dimethoxy-5-methyl-6-decaprenyl benzoquinone is one kind of liposoluble quinone compound in natural world, and its structure is synthesized with quinone derivative and several isopentene monomers, and Q 10 A family of quinone compounds having ten isoprene units in the side chain is represented, with 10 isoprene units in both humans and mammals. CoQ 10 Is an important cell respiratory chain electron transporter, exists on the mitochondrial inner membrane of eukaryotes or on the cytoplasmic membrane of prokaryotes, and participates in the energy metabolism of cells. CoQ 10 Generally in both oxidized and reduced forms, coQ is intracellular because of its antioxidant activity in its reduced form 10 Essentially in the reduced form. CoQ 10 The transition between oxidized and reduced forms has the effects of activating cellular metabolism, resisting oxidation, protecting lipoproteins, protecting DNA molecules from attack (inhibiting free radical induced oxidation), and CoQ 10 Is synthesized endogenously by cells, so that the cell contains little impurities. CoQ 10 Has important functions in resisting tumor and aging, treating gastrointestinal tract, liver and heart diseases, improving immune system function and the like; has obvious effect in treating scurvy, duodenal ulcer, necrotic periodontitis, promoting pancreas function and secretion, etc. Thus, coQ 10 Is receiving increasing attention as an antioxidant in pharmaceutical, cosmetic, food and clinical applications.
CoQ 10 Is ubiquitous in plants and animals in nature, and CoQ is currently available 10 The production method includes animal and plant tissue extraction, chemical synthesis and biological synthesis. Extraction and chemical synthesis methods have the advantages of less sources of raw materials, complex processes and yieldLow problem, the microbial fermentation method has the advantages of wide sources, good product activity, high yield and the like, and becomes CoQ 10 The main method of industrial production. CoQ production 10 Is of a large microorganism variety, wherein rhodobacter sphaeroides belonging to photosynthetic bacteria synthesize CoQ due to its intracellular synthesis 10 The content is high, the extraction step is relatively simple, and the method is the current industrialized mass production of CoQ 10 Is an important strain of (a). However, the production of CoQ by microbial fermentation is currently restricted 10 The main factor of (2) is that the product yield is lower due to the complex genetic characteristics of strains and fermentation regulation. CoQ synthesis in rhodobacter sphaeroides cells 10 The pathway of (a) is similar to most bacteria, and mainly comprises isoprene pyrophosphate synthesis (mevalonate pathway), polyisoprene pyrophosphate synthesis (MEP pathway), quinone ring synthesis and modification (branched acid pathway) and other processes. CoQ 10 Is a lipid-soluble molecule, and acts in lipid bilayer which is specifically delivered to cell membrane after intracellular synthesis, and thus enables large-scale synthesis of CoQ 10 In industrial species of (C), the cell membrane is often excessively infected with CoQ 10 Filling and even changing cell membrane state, thereby affecting more CoQ 10 Localization at the lipid bilayer. If the content of phospholipid in the microbial cell membrane can be increased, the CoQ can be improved 10 Solubility in lipid bilayers, enabling cell membranes to accommodate more CoQ 10 Molecules, at the same time, can enhance cell synthesis of CoQ 10 Is not limited to the above-described embodiments.
There are reports on the utilization of metabolic engineering means to CoQ of rhodobacter sphaeroides 10 Is genetically modified and altered to increase CoQ of rhodobacter sphaeroides 10 Is a product of the above process. For example, chinese patent application CN 105441371A discloses a metabolic engineering method for modifying rhodobacter sphaeroides and its application in the production of CoQ 10 Is used in the field of applications. CoQ is to 10 The rate-limiting enzyme gene UbiE, ubiG, ubiF in the biosynthetic pathway is transformed into the rhodobacter sphaeroides genome, and the three genes are used for series overexpression to strengthen the CoQ of the rhodobacter sphaeroides 10 Synthetic ability, engineered CoQ 10 The yield is obviously improved.
Chinese patent application CN 103509729A utilizes strongKey genes DXS and DDS synthesized by polydextrose pyrophosphoric acid in merger path in rhodobacter sphaeroides cell, thereby increasing engineering bacteria CoQ 10 Is a product of the above process.
Chinese patent application CN 106148263B enhances the ability of rhodobacter sphaeroides strain to take up parahydroxybenzoic acid from outside by introducing the parahydroxybenzoic acid transporter pcaK gene from Acinetobacter calcoaceticus into rhodobacter sphaeroides strain, thereby improving the yield of coenzyme Q10 synthesized in rhodobacter sphaeroides strain
Disclosure of Invention
The invention aims to provide a recombinant rhodobacter sphaeroides strain for producing coenzyme Q10 and a construction method thereof, aiming at improving the production of coenzyme Q by a microbial fermentation method 10 The defects of lower yield, higher production cost and the like are overcome, and the coenzyme Q of the engineering bacteria is obviously improved 10 Yield. The method can remarkably improve the intracellular synthesis of coenzyme Q of rhodobacter sphaeroides 10 Reducing the production of coenzyme Q in industrial production 10 Is not limited by the cost of (a).
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
coenzyme Q production 10 The recombinant rhodobacter sphaeroides strain comprises an endogenous cardiolipin synthase C (Cardiolipin synthase, clsC) gene cloned from a rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1 genome, the clsC gene has a sequence shown as SEQ ID NO.3, and the rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1 has a strain number of ATCC-17023.
The synthesis amount of cardiolipin on the cell membrane of the recombinant rhodobacter sphaeroides strain is improved.
Recombinant rhodobacter sphaeroides strain cell membrane phospholipid bilayer combined coenzyme Q 10 Is strengthened.
Intracellular synthesis of coenzyme Q by the recombinant rhodobacter sphaeroides strain 10 The yield of (a) is improved.
Further, the production of coenzyme Q 10 The construction method of the recombinant rhodobacter sphaeroides strain comprises the steps of introducing a sequence shown in SEQ ID NO.3 into rhodobacter sphaeroides initial strain Rhodobacter sphaeroides2.4.1, whereby endogenous cardiolipin synthase is expressed recombinantly in Rhodobacter sphaeroides 2.4.1 cells. The method comprises the following specific steps:
1. construction of pBBR1MCS-2-tac-clsC-his recombinant plasmid and transformation of E.coli S17-1 (donor strain):
the endogenous cardiolipin synthase C (clsC) gene was cloned from the genome of the rhodobacter sphaeroides starting strain (Rhodobacter sphaeroides 2.4.1) using the corresponding primers: the corresponding genome of the rhodobacter sphaeroides starting strain (Rhodobacter sphaeroides 2.4.1) is extracted as a template, and the clsC-F (SalI cleavage site) and the clsC-R (HindIII cleavage site) are cloned from the genome of the rhodobacter sphaeroides starting strain (Rhodobacter sphaeroides.2.4.1) to obtain the clsC gene. The sequences of clsC-F, clsC-R, clsC genes are shown in SEQ ID NO. 1-3 respectively.
clsC-F:CGTAACAGGAGGAATTAACCATGATCGACGACTGGCTGG
clsC-R:GTACCAGATCTACCCTCGAGTCAGAGGTAGCTCTGGATCG
The cloned clsC gene is recovered by agarose gel recovery kit, the clsC gene and plasmid pBBR1MCS-2 are respectively digested by Sal I enzyme and HindIII enzyme, the clsC gene and plasmid pBBR1MCS-2 are connected, the connection product is transformed into E.coli T1 cell, the cell is coated, the cell is cultured overnight, the positive strain with Kan resistance is selected for expansion culture, and the positive cloning plasmid pBBR1MCS-2-tac-clsC-his is obtained by using plasmid small extraction kit. The obtained pBBR1MCS-2-tac-clsC-his plasmid is transformed into E.coli competent cell E.coli S17-1 (donor strain) by a heat shock method, and the plasmid is extracted for sequencing.
2. Ligation of pBBR1MCS-2-tac-clsC-his into rhodobacter sphaeroides (recipient bacteria):
culturing donor strain S17-1 (containing plasmid pBBR1 MCS-2-tac-clsC-his) in LB liquid medium containing kana antibiotic at 37deg.C and 220rpm for 12 hr, transferring to 50mL fresh LB (containing kana) liquid medium with 10% transfer amount, and continuing culturing for about 1-2 hr until donor strain S17-1 completely reaches logarithmic phase (OD 600 ＝0.4-0.6)；
The recipient fungus rhodobacter sphaeroides initial strain (Rhodobacter sphaeroides 2.4.1) is prepared in LB liquid medium at 30℃,After 220rpm culture, transferring to 50ml fresh LB liquid medium, and after 20 hr, the recipient bacteria are completely in logarithmic phase (OD) 600 :2.5). 1.4ml of each broth was centrifuged and washed 2 times with fresh LB medium, and 400. Mu.L and 600. Mu.L of each of the donor and recipient bacteria were resuspended in LB medium. Mixing donor bacteria and acceptor bacteria in a ratio of 1:6; 200 μl of the mixed bacterial liquid was applied to a solid non-resistant LB plate and pre-joined for 20-24 hours. Pre-conjugations on plates were eluted with pre-chilled 1mL bacterial conjugation medium into 1.5mL EP tubes; centrifuging at 4 ℃ for 2min at 5000-8000 rpm, discarding supernatant, and repeating the steps for washing for 1 time; the bacteria were resuspended in 100. Mu.l of bacteria-joining medium and then spread on a medium containing a final concentration of 200mg/L K 2 TeO 3 And 50mg/ml Kan-resistant bacteria joint culture medium solid plate, culturing in a 30 ℃ incubator for 3d to grow black joint, wherein the black joint is rhodobacter sphaeroides clsC recombinant strain.
Ingredients of the bacterial engagement medium: each 1L of the medium contained 2.0g of succinic acid, 0.8g (NH) 4 ) 2 SO 4 0.10g of sodium glutamate, 0.04g of aspartic acid, 1.0mg of niacin, 0.50mg of vitamin B1,0.010mg of biotin, 2.44g of MgCl 2 ·6H 2 O or 3.0g MgSO 4 ·7H 2 O，0.344g CaCl 2 ·H 2 O，0.02g FeSO 4 ·7H 2 O，0.2ml(NH 4 ) 6 MO 7 O 24 (1% Solution) and the pH was adjusted to 4.5-4.9.
clsC recombinant rhodobacter sphaeroides fermentation culture and coenzyme Q 10 Detection of yield
And (5) extracting plasmids in the positive recombinant rhodobacter sphaeroides cells, and sequencing and verifying. The positive clone of the preserved seed was cultured in 500. Mu.L to 25mL of seed medium at 32℃and 220rpm for 24 hours. The seed culture medium after cultivation is evenly mixed, and the bacterial liquid is transferred to 45ml rhodobacter sphaeroides fermentation culture medium according to the inoculation amount of 20 percent, and the rhodobacter sphaeroides fermentation culture medium is cultivated and cultivated for 48 hours at the temperature of 32 ℃ and at the speed of 220 rpm.
Rhodobacter sphaeroides fermentation medium formulation was per 100mL: glucose 3.2g, peptone 0.32g, sodium glutamate 0.65g, (NH) 4)2 SO 4 0.4g，FeCl 3 0.025g，MgSO 4 1g, corn steep liquor 0.4g, KH 2 PO 4 0.12g，ZnCl 2 0.006g，KCl 0.24g，CuSO 4 0.006g，Ca(HCO 3 ) 2 0.72g, thiamine hydrochloride 2g, riboflavin 0.3g, folic acid 0.1g and niacinamide 2.5g.
Extraction of coenzyme Q 10 Then, coenzyme Q was quantitatively analyzed by using high performance liquid chromatography 10 。
The invention clones endogenous cardiolipin synthetase C (CLsC) gene clsC from rhodobacter sphaeroides initial strain (Rhodobacter sphaeroides.4.1) genome, constructs an over-expression vector for recombinant expression in Rhodobacter sphaeroides.4.1 cells, obviously improves the content of lipid bilayer central phospholipid of cell membrane of the recombinant strain, and further strengthens cell membrane accommodation and CoQ combination 10 Further improving the ability of coenzyme CoQ 10 Yield in rhodobacter sphaeroides cells.
Drawings
FIG. 1 is a graph of ClsC overexpression at Rhodobacter sphaeroides, 2.4.1.
FIG. 2 is a diagram showing the detection of coenzyme CoQ by HPLC 10 The retention time was 15.9min.
FIG. 3 shows the content of cardiolipin and CoQ of the ClsC-overexpressing strain RS-ClsC and the starting strain Rhodobacter sphaeroides.4.1 10 Yield comparison.
Detailed Description
All strains and materials in this example were purchased commercially. For example, rhodobacter sphaeroides starting strain (Rhodobacter sphaeroides.2.4.1) was purchased from ATCC (strain number ATCC-17023).
Example 1
Constructing rhodobacter sphaeroides starting strain containing pBBR1MCS-2-tac-clsC-his vector and capable of expressing endogenous cardiolipin synthase (clsC), and enhancing the output of coenzyme Q10, wherein the specific steps are as follows:
construction of pBBR1MCS-2-tac-clsC-his vector:
the endogenous cardiolipin synthase (clsC) gene is cloned from the genome of rhodobacter sphaeroides (Rhodobacter sphaeroides 2.4.1) and is prepared by the following specific method: inoculating seed preservation solution of rhodobacter sphaeroides (Rhodobacter sphaeroides 2.4.1) to LB liquid culture medium for overnight culture, centrifugally collecting thalli, and extracting genome of the rhodobacter sphaeroides starting strain by using a genome extraction kit as a DNA template for standby; the clsC target gene is cloned from the genome of the rhodobacter sphaeroides starting strain by using primers clsC-F (Sal I restriction site) and clsC-R (HindIII restriction site). The PCR conditions were: pre-denaturation at 95℃for 5min, denaturation at 95℃for 40s, annealing at 58℃for 30s, extension at 72℃for 2min,30 cycles. The sequences of clsC-F, clsC-R, clsC genes are shown in SEQ ID NO. 1-3 respectively.
clsC-F:CGTAACAGGAGGAATTAACCATGATCGACGACTGGCTGG
clsC-R:GTACCAGATCTACCCTCGAGTCAGAGGTAGCTCTGGATCG
The obtained clsC gene was digested and recovered using agarose gel recovery kit, and the clsC gene and vector plasmid pBBR1MCS-2 were digested and digested with Sal I endonuclease and Hind III endonuclease, respectively, and digested with T 4 The clsC gene and plasmid pBBR1MCS-2 are connected by ligase (NEB company in the U.S.) at 16 ℃ for 3 hours, the connection product is transformed into escherichia coli T1 competent cells by a 42 ℃ heat shock method, 100 mu l of bacterial liquid is coated on an LB plate (containing kan with the concentration of 50 mg/ml), positive clones are screened, grown clones are selected into LB liquid culture medium for expansion culture, 4ml of bacterial liquid is taken, the plasmid small extraction reagent (TIANGEN) is used for extracting positive clone plasmid pBBR1MCS-2-tac-clsC-his (the plasmid map is shown in figure 1), and the positive clone plasmid pBBR1 MCS-2-tac-his is stored in a refrigerator with the temperature of 4 ℃ for standby.
E.coli S17-1 (donor strain) was transformed with pBBR1 MCS-2-tac-clsC-his:
e.coli S17-1 competent cells are taken out from an ultralow temperature refrigerator, placed on ice, added with 0.5 mu L of recombinant plasmid pBBR1MCS-2-tac-clsC-his, subjected to ice bath for 10min again, placed in a 42 ℃ water bath for heat shock for 60S, subjected to ice bath for 10min again, added with 600 mu L of non-anti-LB liquid culture medium, placed at 37 ℃ for 45min, subjected to shaking culture for 5000r/min, centrifuged for 5min, removed from 400 mu L of supernatant, re-blown and uniformly mixed, sucked into 100 mu L of LB plates (containing kan resistance), cultured overnight, picked up the cloned seeds, extracted the plasmids and sequenced for verification.
3. Ligation of pBBR1MCS-2-tac-clsC-his into rhodobacter sphaeroides (recipient bacteria):
(1) Recombinant pBBR 1-containing MCS-2-tac-clsC-hisE.coli S17-1 of the plasmid was transferred to LB liquid medium (containing antibiotic kana) and cultured at 37℃for 12 hours, then transferred to fresh LB liquid medium (containing antibiotic kana) at an inoculum size of 10% the next day, and the culture was continued for about 1 to 2 hours until the donor strain reached the logarithmic growth phase (OD 600 :0.4-0.6)；
(2) Taking recipient fungus rhodobacter sphaeroides original strain (Rhodobacter sphaeroides 2.4.1), culturing in a non-antibiotic LB liquid medium at 30deg.C and 220rpm for 20h, transferring to a fresh non-antibiotic LB medium with 10% transfer amount, and continuously culturing until the recipient fungus is completely in logarithmic phase (OD) 600 :2.5). Taking 1.4 mu L of bacterial liquid respectively, centrifuging at 8000rpm for 5min, repeatedly washing with LB liquid culture medium for 2 times, taking 200 and 300 mu L of LB liquid culture medium for resuspension of donor bacteria and acceptor bacteria respectively, and finally mixing the donor bacteria and the acceptor bacteria in a ratio of 1:6;
(3) Coating 100 μl of the mixed bacteria on a solid non-resistant LB plate, pre-culturing for 20-24h, eluting the bacteria on the plate with pre-cooled 1mL of bacteria joint culture medium into a pre-cooled 1.5mL EP tube;
(4) Centrifuging at 8000rpm for 2min, removing supernatant, adding 500 μl of ice pre-bacterial conjugation medium, mixing, and repeatedly washing for 1 time;
(5) 100. Mu.l of the mixed solution was spread on a solid plate of the bacterial junction medium (containing 200mg/L K final concentration) 2 TeO 3 And 50mg/mL Kan resistance), and placing in a 32 ℃ incubator for 3d to grow black zygotes, namely clsC recombinant rhodobacter sphaeroides.
Ingredients of the bacterial engagement medium: each liter of medium contained 2.0g succinic acid, 0.8g (NH) 4 ) 2 SO 4 0.10g of sodium glutamate, 0.04g of aspartic acid, 1.0mg of niacin, 0.50mg of vitamin B1,0.010mg of biotin, 2.44g of MgCl 2 ·6H 2 O or 3.0g MgSO 4 ·7H 2 O，0.344g CaCl 2 ·H 2 O，0.02g FeSO 4 ·7H 2 O，0.2mL(NH 4 ) 6 MO 7 O 24 (1% Solution) and the pH was adjusted to 4.5-4.9.
Example 2
clsC recombinant rhodobacter sphaeroides fermentation culture:
plasmids of rhodobacter sphaeroides positive strains were extracted using a plasmid miniprep kit (purchased from TIANGEN corporation) and sent to sequencing to verify positivity. The positive strain was inoculated in 25ml seed medium from 500. Mu.L in a seed retention tube, placed at 32℃and cultured in an incubator at 220rpm for 24 hours. Then the mixed bacterial liquid is transferred to a rhodobacter sphaeroides fermentation medium containing 45ml according to the inoculation amount of 20 percent, and is cultivated and cultured for 48 hours at the temperature of 32 ℃ and at the speed of 220 rpm.
Rhodobacter sphaeroides fermentation medium formulation per 100ml: glucose 3.2g, peptone 0.32g, sodium glutamate 0.65g, (NH) 4 ) 2 SO 4 0.4g，FeCl 3 0.025g，MgSO 4 1g, corn steep liquor 0.4g, KH 2 PO 4 0.12g，ZnCl 2 0.006g，KCl 0.24g，CuSO4 0.006g，Ca(HCO 3 ) 20.72g, thiamine hydrochloride 2g, riboflavin 0.3g, folic acid 0.1g and niacinamide 2.5 g).
Coenzyme Q 10 Extraction and analysis of (2):
taking 1ml of fermentation culture solution, centrifuging, removing supernatant, adding 200 mu L of 6mol/L hydrochloric acid, and shaking and mixing uniformly; adding 2ml of acetone, and shaking and uniformly mixing; adding 100 μl hydrogen peroxide, shaking and mixing; adding absolute ethyl alcohol to a volume of 10mL, and shaking and uniformly mixing; mixing, and placing into an ultrasonic cleaning instrument for ultrasonic treatment for 45min (the temperature in the whole process is less than 30 ℃). Standing the solution for 10min, filtering the upper organic phase with 0.22 μm organic microporous membrane to remove bacterial fragments, bottling, and quantitatively analyzing with high performance liquid HPLC. The analytical conditions for HPLC were: the liquid phase analysis instrument is a high performance liquid chromatograph DAD3000 of Thermo company, the chromatographic column type is SunFireTM, the C18 reverse phase column (4.6X105 mm,1.7 μm), the mobile phase is methanol: ethanol=3:7, the column temperature box is 30 ℃, the flow rate is 1ml/min, the detection wavelength is 275nm, and the sample injection amount is 10 μl.
HPLC detection results: coenzyme Q 10 Peak was seen at 15.9 minutes retention time (FIG. 2), original strain coenzyme Q 10 The yield was 18.85.+ -. 0.52mg/gDCW, whereas the recombinant strain coenzyme Q was engineered 10 The yield is 21.68 +/-0.73 mg/gDCW, the yield is increased by 15.01 percent (figure 3), and the results initially show that the coenzyme Q can be obviously improved by increasing the phospholipid content in the center of the cell membrane 10 Is a product of the above process.
The invention realizes the increase of the synthesis amount of cardiolipin on the cell membrane of the starting strain Rhodobacter sphaeroides.4.1 by strengthening the expression of the central phospholipid synthetase C (CLsC) of the synthesis path of the endocardium of Rhodobacter sphaeroides.4.1, and strengthens the cell membrane of the starting strain to combine with coenzyme Q 10 Is provided).

Claims (7)

1. Coenzyme Q production 10 The recombinant rhodobacter sphaeroides strain is characterized by comprising an endogenous cardiolipin synthase C gene cloned from a genome of a rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1, wherein the gene sequence of the cardiolipin synthase C is shown as SEQ ID NO.3, and the rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1 is provided with a strain number ATCC-17023.
2. The method for producing coenzyme Q according to claim 1 10 The recombinant rhodobacter sphaeroides strain is characterized in that the synthesis amount of cardiolipin on the cell membrane of the recombinant rhodobacter sphaeroides strain is improved.
3. The method for producing coenzyme Q according to claim 1 10 The recombinant rhodobacter sphaeroides strain is characterized in that a cell membrane phospholipid bilayer of the recombinant rhodobacter sphaeroides strain is combined with coenzyme Q 10 Is strengthened.
4. The method for producing coenzyme Q according to claim 1 10 Recombinant rhodobacter sphaeroides strain of (2), characterized in that the recombinant rhodobacter sphaeroides strain synthesizes coenzyme Q intracellularly 10 The yield of (a) is improved.
5. Coenzyme Q production 10 The construction method of the recombinant rhodobacter sphaeroides strain is characterized by comprising the steps of introducing a sequence shown in SEQ ID NO.3 into rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.2.4.1 so as to enable endogenous cardiolipin synthase to be subjected to intracellular recombinant expression in Rhodobacter sphaeroides.2.4.1, wherein the rhodobacter sphaeroides starting strain Rhodobacter sphaeroidThe strain of es 2.4.1 was ATCC-17023.
6. A coenzyme Q-producing process according to claim 5 10 The construction method of the recombinant rhodobacter sphaeroides strain is characterized by comprising the following steps:
(1) Constructing a pBBR1MCS-2-tac-clsC-his recombinant plasmid, wherein the steps comprise cloning an endogenous cardiolipin synthase C gene from a rhodobacter sphaeroides initial strain Rhodobacter sphaeroides.4.1 genome, wherein the gene sequence of the cardiolipin synthase C is shown as SEQ ID NO.3, a primer pair adopted during cloning is clsC-F, clsC-R, and the sequences of the clsC-F, clsC-R are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2;
(2) E.coli S17-1 was transformed with pBBR1MCS-2-tac-clsC-his recombinant plasmid;
(3) Binding to transformed pBBR1MCS-2-tac-clsC-his to Rhodobacter sphaeroides.2.4.1.
7. Improving rhodobacter sphaeroides coenzyme Q 10 The method for producing the rhodobacter sphaeroides is characterized by comprising the step of cloning an endogenous gene of cardiolipin synthase C from a genome of a rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1, wherein the gene sequence of the cardiolipin synthase C is shown as SEQ ID NO.3, and the rhodobacter sphaeroides starting strain Rhodobacter sphaeroides.4.1 is provided with a strain number ATCC-17023.
CN202310387908.1A 2023-04-12 2023-04-12 Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof Pending CN116790457A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310387908.1A CN116790457A (en) 2023-04-12 2023-04-12 Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310387908.1A CN116790457A (en) 2023-04-12 2023-04-12 Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof

Publications (1)

Publication Number Publication Date
CN116790457A true CN116790457A (en) 2023-09-22

Family

ID=88038785

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310387908.1A Pending CN116790457A (en) 2023-04-12 2023-04-12 Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof

Country Status (1)

Country Link
CN (1) CN116790457A (en)

Similar Documents

Publication Publication Date Title
CN103509729A (en) Construction method of engineering bacterium for producing coenzyme Q10, engineering bacterium and application of engineering bacterium
CN105441371B (en) A kind of genetic engineering bacterium and its application in production Co-Q10
CN112210519A (en) Genetically engineered bacterium for secreting acetaldehyde dehydrogenase by using edible fungi
CN108456652B (en) Sphingosine monad gene engineering bacterium and construction method and application thereof
CN103509816A (en) Coenzyme-Q10-production engineered bacteria construction method, engineered bacteria, and application thereof
CN104593407B (en) Pichia stipitis gene expression system and its structure and application
CN104745520B (en) A kind of strain excellent of high yield L phenylalanines and its application
CN108642041B (en) Method for improving L-alanine fermentation production capacity of recombinant escherichia coli
KR102473375B1 (en) Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10
CN114107356B (en) Method for transforming pseudomonas putida to assimilate D-galactose
CN116790457A (en) Coenzyme Q production 10 Recombinant rhodobacter sphaeroides strain and construction method thereof
CN112175890A (en) Genetically engineered bacterium for secreting alcohol dehydrogenase by using edible fungi
KR20200132835A (en) High productivity method for growing algae
JP4221476B2 (en) Plasmid cloned icosapentaenoic acid biosynthesis genes and cyanobacteria producing icosapentaenoic acid
CN117535331A (en) Modification method and application of genetically engineered bacteria for producing coenzyme Q10
CN114854660B (en) Genetically engineered bacterium for high-yield ergothioneine
CN113817752B (en) Application of slr0681 gene in synthesis of synechocystis carotene
CN116426448B (en) Visualized zymomonas mobilis, construction method and application
TWI290175B (en) A method for promoting growth of gene recombinant cell and enhancing production of target gene product
CN117603930B (en) Recombinant bacterium for expressing mutant sirohem synthase
CN114891711B (en) Method for improving recombinant escherichia coli catalytic synthesis of biliverdin through enhanced electron transfer
CN117384933B (en) Strain for producing 3-hydroxy propionic acid by utilizing xylose, construction method and application thereof
CN114317468B (en) Escherichia coli chassis cell for enhancing carbon source metabolism
CN106967627A (en) A kind of fermenting and producing ALA recombinant bacterial strain and preparation method thereof
CN114350688A (en) Application of guaA gene, plasmid and strain in expression of azotobacterin

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination