CN116784280A

CN116784280A - Construction method and application of TFRC humanized mouse model

Info

Publication number: CN116784280A
Application number: CN202311003323.1A
Authority: CN
Inventors: 梁娟; 王韬; 冀梦瑶; 张宇曦; 朱珠; 陈颖珊
Original assignee: Guangdong Yaokang Biotechnology Co ltd
Current assignee: Guangdong Yaokang Biotechnology Co ltd
Priority date: 2023-08-10
Filing date: 2023-08-10
Publication date: 2023-09-22

Abstract

The invention relates to a construction method of a TFRC humanized mouse model, which comprises the following steps: (1) constructing a targeting vector for expressing a humanized TFRC gene; (2) designing and obtaining sgrnas for the mouse TFRC gene; (3) Co-injecting or co-electrotransferring the targeting vector, sgRNA and Cas9 protein into cytoplasm or nucleus of fertilized egg of mouse, transplanting fertilized egg into pseudopregnant mouse, and carrying out genotype identification to pseudopregnant mouse, and screening positive F0 mouse successfully inserted into correct humanized fragment; (4) F1 mice are obtained by breeding F0 mice and background mice, and a TFRC humanized mouse model is screened. The TFRC humanized mice constructed by the invention have application value in the fields of oncology, immunology and the like.

Description

Construction method and application of TFRC humanized mouse model

Technical Field

The invention relates to the field of animal genetic engineering, in particular to a construction method and application of a TFRC humanized mouse model.

Background

As CRISPR/Cas9 technology matures, its application is becoming more and more widespread, with the most important aspect being the use of CRISPR/Cas9 to construct transgenic pattern animals (principally gene editing mice) to provide a basic study of animal-level therapy in the pre-clinical setting.

Research on pathogenesis of human diseases and screening for effective therapeutic drugs all require extensive preclinical testing. Because of ethical limitations in preclinical studies using human cells and tissues directly, animal models are an alternative to human biological studies. The mice have small volume, easy maintenance and operation, short propagation period, similar to human in aspects of genome, physiology and the like, and have correspondingly mature gene modification technology, so the mice become widely applied mammalian model biological systems. At present, a great number of diseases are expected to be based on CRISPR/Cas9 technology, and are verified by a gene editing animal experiment and then applied to human clinical treatment.

The TFRC transferrin receptor (also known as CD 71) is a transmembrane protein responsible for the transport of iron absorbed by the digestive tract and released by erythrocyte degradation. Erythrocytes at the end stage of differentiation up-regulate the expression of the transferrin receptor (TFRC) gene to increase iron assimilation and heme production. TFRC interacts with Transferrin (TF) on the cell surface to form a complex that is internalized by clathrin-mediated endocytosis. Once the iron is released in the mature endosome, the iron-free TF-TFRC complex is circulated to the cell surface for the next round of iron absorption. TFRC is highly expressed in actively proliferating cells, particularly tumor cells, and the pathways of iron uptake, storage, transport and regulation are all disturbed, and anemia is common in tumor patients, indicating that iron metabolism is closely related to tumor cell survival. Studies have shown that the use of anti-TFRC monoclonal antibodies can effectively inhibit proliferation of malignant tumor cells of the blood system. In addition, since iron metabolism plays an important role in the vital activities of the body, the lack of TFRC may show impaired erythrocyte development and abnormal iron metabolism. Thus, a TFRC Cas9-KI mouse model was developed that could be used to evaluate various studies related to the TFRC gene.

In the process of drug development, the important role played by the mouse experimental model is not replaceable. However, due to race variability, the efficacy of TFRC inhibitors screened in mouse experiments may vary from that of humans. Therefore, the construction of the TFRC humanized mouse model has higher application value in screening and evaluating TFRC target medicaments. At present, a method for constructing a TFRC humanized mouse model and related literature reports of the TFRC humanized mouse model in the aspect of target drug application are not seen.

Disclosure of Invention

In view of the problems existing at present, a first aspect of the present invention provides a method for constructing a TFRC humanized mouse model, the method comprising the steps of:

(1) Constructing a targeting vector for expressing the humanized TFRC gene, and inserting the humanized TFRC gene;

(2) Designing sgRNA aiming at a translation initiation site of a mouse TFRC gene, and obtaining the sgRNA by using an in vitro transcription technology;

(3) Co-injecting or co-electrotransferring the targeting vector constructed in the step (1), the sgRNA obtained in the step (2) and the Cas9 protein into cytoplasm or nucleus of fertilized ovum of the mouse, transplanting the fertilized ovum into pseudopregnant mouse, carrying out genotype identification on pseudopregnant mouse, and screening positive F0 mouse successfully inserted into correct human fragment;

(4) F0 mice and background mice are bred to obtain F1 mice, and gene identification is carried out on the tail of the F1 generation, so that a TFRC humanized mouse model is screened.

Preferably, the step (1) includes the following steps: according to the structure and function of human TFRC, human TFRC gene and 3' UTR-polyA of TFRC are inserted after murine TFRC translation initiation codon (ATG), the amino acid sequence of selected human TFRC gene is shown as SEQ ID No.1, and the amino acid sequence of replaced murine TFRC gene is shown as SEQ ID No. 2.

Preferably, the step (1) includes the following steps: and selecting 91-760Aa of a human TFRC gene, replacing 91-763Aa of a mouse TFRC gene by using a homologous recombination technology, wherein the sequence of the selected human TFRC gene is shown as SEQ ID No. 3.

Preferably, the sequence of the targeting vector successfully constructed in the step (1) is shown as SEQ ID No. 4.

Preferably, the sgRNA in step (2) has the gene sequences of (a) SEQ ID NO.5 and SEQ ID NO.6, (b) SEQ ID NO.7 and SEQ ID NO.8 or (c) SEQ ID NO.9 and SEQ ID NO.10.

More preferably, the sgRNA in the step (2) has a gene sequence of SEQ ID NO.5 and SEQ ID NO.6.

Preferably, the strain of mice and pseudopregnant mice provided with fertilized eggs in step (3) is BALB/c.

Preferably, the 5 'end identification primer used for F0 mouse genotype identification in the step (3) is shown as SEQ ID NO.11 and SEQ ID NO.12, and the 3' end identification primer is shown as SEQ ID NO.13 and SEQ ID NO. 14.

Preferably, the PCR reaction system used for genotyping the F0 mice in the step (3) is as follows:

preferably, the PCR reaction conditions used for genotyping the F0 mice in the step (3) are as follows:

the second aspect of the invention provides the application of the mice obtained by the construction method in researching the related functions and action mechanisms of the TFRC genes.

Preferably, the use is for non-diagnostic and non-therapeutic purposes.

In a third aspect, the present invention provides the use of the mice obtained by the above construction method in screening for a medicament for treating a disease associated with the TFRC gene.

Preferably, the use is for non-diagnostic and non-therapeutic purposes.

The invention has the beneficial effects that:

the animal model designs the sgRNA of a cut murine TFRC gene, designs the Donor containing the human TFRC gene, the 3' UTR of the TFRC gene and the polyA, mixes the sgRNA, the Donor and the Cas9, injects the mixture into fertilized eggs of a BALB/cJGpt background mouse to carry out homologous recombination, and obtains a positive F0, F0 mouse and the BALB/cJGpt mouse are bred to obtain a stable genetic positive F1 mouse model. Compared with an ES targeting mouse model, the animal model constructed by the invention has the characteristics of high efficiency, rapidness, simplicity, convenience, low cost and the like, and saves time and cost.

Drawings

FIG. 1 is an electrophoretogram of the identification of the 5 'and 3' end genes of TFRC-KI F0 mice;

FIG. 2 is an electrophoretogram of the identification of the 5 'and 3' end genes of TFRC-KI F1 mice;

FIG. 3 is a flow cytometry plot of human TFRC expression in bone marrow of BALB/c mice and BALB/c-hTFRC F1 heterozygous mice;

FIG. 4 is a flow cytometry plot of the ratio of peripheral blood B cells to T cells in BALB/c mice and BALB/c-hTFRC F1 heterozygous mice;

FIG. 5 is a flow cytometry plot of the proportion of peripheral blood NK cells and macrophages in BALB/c mice and BALB/c-hTFRC F1 heterozygous mice;

FIG. 6 is a flow cytometry plot of the ratio of peripheral blood dendritic cells to neutrophils in BALB/c mice and BALB/c-hTFRC F1 heterozygous mice;

FIG. 7 is a flow cytometry plot of the ratio of peripheral blood mononuclear cells to eosinophils in BALB/c mice and BALB/c-hTFRC F1 heterozygous mice.

Detailed Description

The present invention is further illustrated by way of examples, but the present invention is not limited to the following examples.

Test example 1, establishment of TFRC humanized mouse model

The invention uses CRISPR/Cas9 technology to replace a mouse-derived TFRC gene with a human-derived TFRC gene on a mouse with BALB/c background, thereby constructing a mouse model capable of expressing the human-derived TFRC, and the specific method is as follows:

1. determination of human fragment substitution region and inserted human sequence

The human TFRC gene and the 3' UTR-polyA of the TFRC were inserted after the murine TFRC translation initiation codon (ATG) according to the structure and function of the TFRC gene, and the insert was about 5.5kb in length. The amino acid sequence (Aa: 91-760) of the selected human TFRC gene is shown as SEQ ID No.1, and the amino acid sequence (Aa: 91-763) of the replaced murine TFRC gene is shown as SEQ ID No. 2.

GVEPKTECERLAGTESPVREEPGEDFPAARRLYWDDLKRKLSEKLDSTDFTGTIKLLNENSYVPREAGSQKDENLALYVENQFREFKLSKVWRDQHFVKIQVKDSAQNSVIIVDKNGRLVYLVENPGGYVAYSKAATVTGKLVHANFGTKKDFEDLYTPVNGSIVIVRAGKITFAEKVANAESLNAIGVLIYMDQTKFPIVNAELSFFGHAHLGTGDPYTPGFPSFNHTQFPPSRSSGLPNIPVQTISRAAAEKLFGNMEGDCPSDWKTDSTCRMVTSESKNVKLTVSNVLKEIKILNIFGVIKGFVEPDHYVVVGAQRDAWGPGAAKSGVGTALLLKLAQMFSDMVLKDGFQPSRSIIFASWSAGDFGSVGATEWLEGYLSSLHLKAFTYINLDKAVLGTSNFKVSASPLLYTLIEKTMQNVKHPVTGQFLYQDSNWASKVEKLTLDNAAFPFLAYSGIPAVSFCFCEDTDYPYLGTTMDTYKELIERIPELNKVARAAAEVAGQFVIKLTHDVELNLDYERYNSQLLSFVRDLNQYRADIKEMGLSLQWLYSARGDFFRATSRLTTDFGNAEKTDRFVMKKLNDRVMRVEYHFLSPYVSPKESPFRHVFWGSGSHTLPALLENLKLRKQNNGAFNETLFRNQLALATWTIQGAANALSGDVWDIDNEF(SEQ ID No.1)

RVEQKEECVKLAETEETDKSETMETEDVPTSSRLYWADLKTLLSEKLNSIEFADTIKQLSQNTYTPREAGSQKDESLAYYIENQFHEFKFSKVWRDEHYVKIQVKSSIGQNMVTIVQSNGNLDPVESPEGYVAFSKPTEVSGKLVHANFGTKKDFEELSYSVNGSLVIVRAGEITFAEKVANAQSFNAIGVLIYMDKNKFPVVEADLALFGHAHLGTGDPYTPGFPSFNHTQFPPSQSSGLPNIPVQTISRAAAEKLFGKMEGSCPARWNIDSSCKLELSQNQNVKLIVKNVLKERRILNIFGVIKGYEEPDRYVVVGAQRDALGAGVAAKSSVGTGLLLKLAQVFSDMISKDGFRPSRSIIFASWTAGDFGAVGATEWLEGYLSSLHLKAFTYINLDKVVLGTSNFKVSASPLLYTLMGKIMQDVKHPVDGKSLYRDSNWISKVEKLSFDNAAYPFLAYSGIPAVSFCFCEDADYPYLGTRLDTYEALTQKVPQLNQMVRTAAEVAGQLIIKLTHDVELNLDYEMYNSKLLSFMKDLNQFKTDIRDMGLSLQWLYSARGDYFRATSRLTTDFHNAEKTNRFVMREINDRIMKVEYHFLSPYVSPRESPFRHIFWGSGSHTLSALVENLKLRQKNITAFNETLFRNQLALATWTIQGVANALSGDIWNIDNEF(SEQ ID No.2)

2. Injection to obtain positive mice

1) Determination of human fragment substitution region and inserted human sequence

According to the extracellular functional domain of the human TFRC protein and the homology comparison of human and mice, 91-760Aa of the human TFRC gene replaces 91-763Aa of the mouse TFRC gene, and the sequence of the selected human TFRC gene replacement is shown as SEQ ID No. 3.

GGGGTAGAACCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGTGAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCTTATATTGGGATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCGGCACCATCAAGCTGCTGAATGAAAATTCATATGTCCCTCGTGAGGCTGGATCTCAAAAAGATGAAAATCTTGCGTTGTATGTTGAAAATCAATTTCGTGAATTTAAACTCAGCAAAGTCTGGCGTGATCAACATTTTGTTAAGATTCAGGTCAAAGACAGCGCTCAAAACTCGGTGATCATAGTTGATAAGAACGGTAGACTTGTTTACCTGGTGGAGAATCCTGGGGGTTATGTGGCGTATAGTAAGGCTGCAACAGTTACTGGTAAACTGGTCCATGCTAATTTTGGTACTAAAAAAGATTTTGAGGATTTATACACTCCTGTGAATGGATCTATAGTGATTGTCAGAGCAGGGAAAATCACCTTTGCAGAAAAGGTTGCAAATGCTGAAAGCTTAAATGCAATTGGTGTGTTGATATACATGGACCAGACTAAATTTCCCATTGTTAACGCAGAACTTTCATTCTTTGGACATGCTCATCTGGGGACAGGTGACCCTTACACACCTGGATTCCCTTCCTTCAATCACACTCAGTTTCCACCATCTCGGTCATCAGGATTGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCAGAAAAGCTGTTTGGGAATATGGAAGGAGACTGTCCCTCTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCTCAGAAAGCAAGAATGTGAAGCTCACTGTGAGCAATGTGCTGAAAGAGATAAAAATTCTTAACATCTTTGGAGTTATTAAAGGCTTTGTAGAACCAGATCACTATGTTGTAGTTGGGGCCCAGAGAGATGCATGGGGCCCTGGAGCTGCAAAATCCGGTGTAGGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGATATGGTCTTAAAAGATGGGTTTCAGCCCAGCAGAAGCATTATCTTTGCCAGTTGGAGTGCTGGAGACTTTGGATCGGTTGGTGCCACTGAATGGCTAGAGGGATACCTTTCGTCCCTGCATTTAAAGGCTTTCACTTATATTAATCTGGATAAAGCGGTTCTTGGTACCAGCAACTTCAAGGTTTCTGCCAGCCCACTGTTGTATACGCTTATTGAGAAAACAATGCAAAATGTGAAGCATCCGGTTACTGGGCAATTTCTATATCAGGACAGCAACTGGGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGCTGAGAAAACAGACAGATTTGTCATGAAGAAACTCAATGATCGTGTCATGAGAGTGGAGTATCACTTCCTCTCTCCCTACGTATCTCCAAAAGAGTCTCCTTTCCGACATGTCTTCTGGGGCTCCGGCTCTCACACGCTGCCAGCTTTACTGGAGAACTTGAAACTGCGTAAACAAAATAACGGTGCTTTTAATGAAACGCTGTTCAGAAACCAGTTGGCTCTAGCTACTTGGACTATTCAGGGAGCTGCAAATGCCCTCTCTGGTGACGTTTGGGACATTGACAATGAGTTTTAA(SEQ ID No.3)

2) Humanized targeting vector construction

The coding sequence of 91-760Aa of the human TFRC gene, the coding sequence of 1-90Aa of the mouse and the 3' UTR of the human TFRC gene are constructed into a fusion CDS, a targeting vector is constructed, the homologous recombination technology is utilized to insert the targeting vector into the initial position of the mouse TFRC gene, and the sequence of the successful targeting vector is shown as SEQ ID No.4 (KI fragment is shown in italics).

3) Construction of sgRNA

(1) Synthesizing an upstream primer and a downstream primer of the sgRNA, wherein the purification mode of the primers is PAGE;

(2) The upstream and downstream primers of the sgRNA are respectively diluted to 100 umol/mu l and evenly mixed according to the proportion of 1:1, and the mixture is automatically and slowly annealed at room temperature;

(3) The double strand formed by annealing is connected with Puc57-sgRNA-NEO-Amp (Bsa I) for 1h, transformed and coated with Amp+ plates;

(4) Selecting a monoclonal, and carrying out PCR identification;

(5) Further sequencing and confirming the PCR positive monoclonal, wherein the sequencing primer is pUC57-T7-F;

(6) Using the properly sequenced clone as a template, and then using a primer to amplify the sgRNA transcribed DNA product by PCR;

(7) The sgrnas were transcribed and further purified using the transcribed DNA product of the sgrnas as templates.

4) sgRNA screening prepared from TFRC humanized mice

3 sets of sgrnas (Tfrc-s1+tfrc-S2, tfrc-s3+tfrc-S4 and Tfrc-s5+tfrc-S6 were designed and synthesized, see table 1 for specific sequence information) with the sgRNA recognition site at the start codon of the mouse Tfrc gene. Then, after each pair of sgrnas and Cas9 protein were incubated, they were injected into fertilized eggs for 0.5 day, and after culturing to blasts, the sgrnas cleavage activity was verified by identifying the KO positive rate of the mouse TFRC gene.

The sgRNA cleavage experimental identification method comprises the following steps: the collected blasts were subjected to PCR amplification, the protocol for PCR is shown in tables 3-4, the amplified bands were subjected to second generation sequencing, and the results were compared with the WT bands, and the probability of mutation was counted (the identified protocol is shown in Table 2).

TABLE 1 sgRNA information and cleavage efficiency

5) TFRC humanized mouse model establishment

Designing and constructing ssDNAdonor carrying human sequences by using the screened sgRNA (Trc-S1+Trc-S2), injecting the ssDNAdonor and Cas9/sgRNA system into fertilized eggs of 0.5d mice, transplanting the fertilized eggs into 0.5d pseudopregnant female mice, and screening out a mid-target mouse (F0) through genetic identification after the mice are born.

6) Genotyping of humanized F0 mice

The obtained rat tail genomic DNA of the F0 mouse was subjected to two-end PCR identification after mid-targeting using the two pairs of primers shown in table 2, and the PCR reaction conditions and reaction procedures are shown in tables 3 and 4, respectively. The primer mTFRC-5tF1/hTFRC-5tR1 is respectively positioned outside the homologous arm of the 5 'end and in the human fragment of ssDNAdonor, if the pair of primers are amplified to generate PCR products, the target donor is effectively inserted into the 5' end of the mouse genome; BGH-pA-tF1/mTFRC-3tR1 is respectively positioned in the human fragment of ssDNAdonor and outside the 3 '-end homology arm, and if the pair of primers are amplified to generate PCR primers, the target donor is effectively inserted into the 3' -end of the mouse genome.

TABLE 2 F0 identification primers

TABLE 3 PCR reaction System

TABLE 4 PCR reaction conditions

In this test example, 49F 0 mice were obtained by co-injection, and positive F0 mice were detected using the above-described identification scheme. As shown in the PCR electrophoresis results of FIG. 1 (WT is BALB/cJGpt genomic DNA (negative control), N is negative blank control (no template control), M is DNAMaroker, TRANS2K PLUS II band, 5000bp,3000bp,2000bp, 750bp,500bp,250bp,100 bp), and 5 'and 3' ends of No. 26 and No. 49 mouse TFRC genes were identified positively, and sequencing was free from mutation, indicating that the mice were positive mice for correctly carrying out gene recombination, and breeding can be attempted.

The positive F0 mice and the background mice are bred to obtain F1, the gene identification is carried out on the tail of the F1 generation, the gene identification result of the F1 generation mice is shown in the graph shown in the figure 2 ((1) is 5 'end, (2) is 3' end, (3) is wild type), and the 5 'and 3' end identification of the 58# mouse, the 60# mouse and the 64# mouse human TFRC genes are positive, which indicates that the obtained mice are heterozygous positive mice for correctly carrying out gene recombination. And F1 mice are subjected to mass propagation and then are matched with each other to obtain homozygous mice.

Test example 2 detection of hTFRC expression in BALB/c-hTFRC F1 heterozygous mice

1. Test method

Flow cytometry experiments examined the expression of TFRC protein in bone marrow of BALB/c mice and BALB/c-hTFRC F1 heterozygous positive mice. In addition, peripheral blood of BALB/c mice and BALB/c-hTFRC F1 heterozygous mice was collected, and the classification of immune cells such as T cells, B cells, NK cells, macrophages, dendritic cells, neutrophils, monocytes, eosinophils, etc., in the peripheral blood of the BALB/c mice and BALB/c-hTFRC F1 heterozygous mice was examined using a flow cytometer.

2. Test results

As shown in FIG. 3, heterozygous BALB/c-hTFRC mice detected human TFRC expression. In addition, the results of the peripheral blood immune cell grouping experiments of wild-type and heterozygous BALB/c-hTFRC mice show that the proportion of various immune cell subsets of the humanized mice is consistent with that of the wild-type mice (figures 4-7), which shows that the expression of the humanized TFRC protein by the mice has no influence on the development of immune cell subsets such as T cells, B cells, NK cells, macrophages, dendritic cells, neutrophils, monocytes, eosinophils and the like of the mice.

The test results show that the BALB/c-hTFRC mouse model is successfully constructed by replacing the humanized gene of the mouse TFRC gene, which indicates that the model has wide application prospect in the fields of oncology, immunology and the like.

Although the method has been described in detail with respect to the steps, it will be apparent to those skilled in the art that modifications may be made to some of the parameters and aspects of the overall process within the scope of the invention. Therefore, the present invention is intended to cover all modifications, alternatives, and adaptations falling within the spirit and scope of the present invention.

Claims

1. A method for constructing a TFRC humanized mouse model, the method comprising the steps of:

2. The construction method according to claim 1, wherein the step (1) comprises the steps of: according to the structure and function of human TFRC, human TFRC gene and 3' UTR-polyA of TFRC are inserted after murine TFRC translation initiation codon (ATG), the amino acid sequence of selected human TFRC gene is shown as SEQ ID No.1, and the amino acid sequence of replaced murine TFRC gene is shown as SEQ ID No. 2.

3. The construction method according to claim 1, wherein the step (1) comprises the steps of: and selecting 91-760Aa of a human TFRC gene, replacing 91-763Aa of a mouse TFRC gene by using a homologous recombination technology, wherein the sequence of the selected human TFRC gene is shown as SEQ ID No. 3.

4. The construction method according to claim 1, wherein the sequence of the targeting vector successfully constructed in the step (1) is shown in SEQ ID No. 4.

5. The method of claim 1, wherein the sgrnas in step (2) have the gene sequences of (a) SEQ ID No.5 and SEQ ID No.6, (b) SEQ ID No.7 and SEQ ID No.8 or (c) SEQ ID No.9 and SEQ ID No.10.

6. The construction method according to claim 5, wherein the sgRNA in the step (2) has a gene sequence of SEQ ID NO.5 and SEQ ID NO.6.

7. The construction method according to claim 1, wherein the strain of mice and pseudopregnant mice provided with fertilized eggs in the step (3) is BALB/c.

8. The construction method according to claim 1, wherein the 5 '-terminal identification primer used in the genotyping of the F0 mouse in the step (3) is shown in SEQ ID NO.11 and SEQ ID NO.12, and the 3' -terminal identification primer is shown in SEQ ID NO.13 and SEQ ID NO. 14.

9. Use of a mouse obtained by the method for constructing a TFRC humanized mouse model according to any one of claims 1-8 for studying TFRC gene related functions and mechanisms of action.

10. Use of a mouse obtained by the method for constructing a TFRC humanized mouse model according to any one of claims 1-8 for screening a medicament for treating a disease associated with a TFRC gene.