CN116768991A

CN116768991A - Soybean four-transmembrane-region protein GmTET270 related to lipid metabolism regulation and encoding gene and application thereof

Info

Publication number: CN116768991A
Application number: CN202210238364.8A
Authority: CN
Inventors: 张劲松; 金萌; 张万科; 韦伟; 陶建军; 阴翠翠; 陈受宜
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2022-03-10
Filing date: 2022-03-10
Publication date: 2023-09-19

Abstract

The application discloses a soybean four-transmembrane protein GmTET270 related to lipid metabolism regulation, and a coding gene and application thereof. The protein provided by the application, named GmTET270, is derived from soybean (Glycine max (L.) Merrill) and consists of an amino acid sequence shown in a sequence 2 in a sequence table. Experiments prove that the GmTET270 and the coding gene thereof can regulate and control the content of the oil in the plant seeds, and the oil content in the plant seeds can be improved by over-expressing the GmTET270. The gene has important theoretical and practical significance for improving and improving the oil components of crops, in particular to improving the oil components in oil plant seeds of soybeans and the like and cultivating high-oil varieties.

Description

Soybean four-transmembrane-region protein GmTET270 related to lipid metabolism regulation and encoding gene and application thereof

Technical Field

The application relates to soybean four-transmembrane region protein GmTET270 related to lipid metabolism regulation and an encoding gene and application thereof in the field of biotechnology.

Background

71% of the fat in the human diet is from plants. In several major oleaginous crops in the world, soybean total oil production is about 30% and the world is the first in vegetable oil production (table 1).

Table 1 shows the world's main oleaginous crops

Species of type	Throughput (million tons)	Percentage of total yield	Relative order
				Soybean (Soybean)	15.50	29.1	1
Palm (Palm)	8.52	16.0	2
				Rapeseed (Rapeteed)	7.03	13.2	3
Sunflower (Sunflower)	7.00	13.1	4
				Cotton seed (Cottonseed)	3.31	6.2	5
Coconut (Cocout)	2.71	5.1	6
				Peanut (Peanut)	2.69	5.0	7
Olive (Olive)	1.63	3.1	8

The synthesis of fatty acids is one of the most important metabolic pathways in plants, and its presence in any cell of the plant is essential for growth. Blocking it leads to cell death, and thus a plant mutant blocking fatty acid synthesis has not been found to date.

Plants differ greatly from other eukaryotes in enzymes involved in the fatty acid synthesis pathway. The synthesis of fatty acids of 16 or 18 carbon atoms from acetyl-CoA and malonyl-CoA requires at least 30 different enzyme-catalyzed reactions to accomplish this, which in animals, fungi and some bacteria are accomplished by a multi-enzyme complex present in the cytoplasm. In plants, enzymes involved in fatty acid synthesis are present in soluble form in the cytoplasm of plastids.

In most plants, the fat is stored in the form of Triacylglycerols (TAG), the content of which is a very important agronomic trait, the biosynthesis of TAG is called the Kennedy pathway, like the pathway for the synthesis of membranous glycerides in eukaryotes, the fatty acids are transferred to the 1 and 2 positions of glycerol-3-phosphate after removal of CoA, forming the intermediate PA. PA dephosphorylation yields DAG. In the last step of TAG synthesis, the third fatty acid molecule is transferred to the empty DAG 3' -OH position, which is catalyzed by diacylglycerol acetyltransferase (DGAT), which is considered to be the only rate limiting step in TAG biosynthesis.

The pathway of lipid synthesis has been known, and many enzyme genes involved in lipid synthesis have been cloned. However, in plants, the regulatory mechanisms for lipid synthesis and their related genes remain largely unknown.

The TETs were designated as the "four transmembrane superfamily", and then collectively designated as the "tetraspan superfamily". The TETs are a large class of evolutionarily conserved protein superfamily with 4 transmembrane domains, widely distributed in all multicellular organisms, capable of transmembrane attachment of proteins, facilitating intercellular and intracellular signal transduction. Such proteins have been described in greater detail in animals, and they are involved in not only the growth of the animal, but also in the recognition of infection by certain viruses, their members are related to each other and form a huge tetrans network with other proteins, playing an important role in the immune response. Relatively few studies have been conducted in plants. Studies in the model plant Arabidopsis thaliana indicate that the proteins are almost involved in various stages of the growth and development of organisms and are necessary for plant growth and development. At least 17 genes encoding TET proteins are present in the Arabidopsis genome, where TET1 plays an important role in early root and leaf development, and it has been found that dimers and heterodimers can form between TETs to function. Such proteins are not reported to be involved in vegetable fat accumulation.

Disclosure of Invention

The application aims to solve the technical problem of how to increase the grease content of plant seeds.

To solve the above technical problems, the present application provides, first, any one of the following applications of proteins or substances regulating the activity or content of the proteins:

d1 Regulating and controlling the content of vegetable oil;

d2 Preparing a product for regulating and controlling the content of vegetable oil;

d3 Cultivating the fat content-increasing plant;

d4 Preparing a cultivated plant product with increased grease content;

d5 Plant breeding;

the protein is derived from soybean, and is named GmTET270, and is A1), A2) or A3) as follows:

a1 A protein whose amino acid sequence is sequence 2;

a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in the sequence 2 in the sequence table and has the same function;

a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2).

In order to facilitate purification of the protein of A1), a tag as shown in the following table may be attached to the amino-terminal or carboxyl-terminal of the protein consisting of the amino acid sequence shown in the sequence 2 in the sequence table.

Table: tag sequence

The GmTET270 protein in A2) has 75% or more identity with the amino acid sequence of the protein shown in the sequence 2 and has the same function. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

The GmTET270 protein in the A2) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

The coding gene of the GmTET270 protein in the A2) can be obtained by deleting one or more amino acid residues in the DNA sequence shown in the sequence 1 and/or carrying out one or more base pair missense mutations and/or connecting the coding sequences of the labels shown in the table at the 5 'end and/or the 3' end. Wherein the DNA molecule shown in the sequence 1 codes GmTET270 protein shown in the sequence 2.

In the above application, the substance may be any one of the following B1) to B7):

b1 A nucleic acid molecule encoding GmTET 270;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1) or a transgenic plant cell line comprising the expression cassette of B2);

b6 A transgenic plant tissue comprising the nucleic acid molecule of B1) or a transgenic plant tissue comprising the expression cassette of B2);

b7 A transgenic plant organ comprising the nucleic acid molecule of B1) or a transgenic plant organ comprising the expression cassette of B2).

In the above applications, the nucleic acid molecule of B1) may be B11) or B12) or B13) or B14) as follows:

b11 A cDNA molecule or a DNA molecule of which the coding sequence is a sequence 1 in a sequence table;

b12 A cDNA molecule or a DNA molecule of a sequence 1 in a sequence table;

b13 A cDNA molecule or DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) and encoding GmTET 270;

b14 Under stringent conditions with a nucleotide sequence defined under b 11) or b 12) or b 13) and a cDNA molecule or a DNA molecule encoding GmTET270.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the GmTET270 protein according to the application can be mutated easily by a person skilled in the art using known methods, for example directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the GmTET270 protein isolated according to the present application are all derived from and are identical to the nucleotide sequence of the present application as long as they encode the GmTET270 protein and have the function of the GmTET270 protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 2 of the present application. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

In the above application, the stringent conditions may be as follows: 50℃in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 1 XSSC, 0.1% SDS at 50 ℃; can alsoThe method comprises the following steps: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; the method can also be as follows: hybridization and washing the membrane 2 times at 68℃in a solution of 2 XSSC, 0.1% SDS for 5min each time, and hybridization and washing the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time; the method can also be as follows: hybridization and washing of membranes were performed at 65℃in 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

In the above applications, the expression cassette (GmTET 270 gene expression cassette) described in B2) containing a nucleic acid molecule encoding a GmTET270 protein refers to DNA capable of expressing the GmTET270 protein in a host cell, which DNA may include not only a promoter that initiates transcription of the GmTET270 gene, but also a terminator that terminates transcription of the GmTET270 gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5, 057,422); seed-specific promoters, e.g. millet seed-specific promotersPromoter pF128 (CN 101063139B (China patent 200710099169.7)), seed storage protein specific promoters (e.g., promoters of phaseolin, napin, oleosin and soybean beta-glucose (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Recombinant vectors containing the GmTET270 gene expression cassette can be constructed with existing expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA Co.), etc. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal may direct the addition of polyadenylation to the 3 'end of the mRNA precursor and may function similarly to the 3' transcribed untranslated regions of Agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase gene Nos) and plant genes (e.g., soybean storage protein genes). When the gene of the present application is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. To facilitate identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to the herbicide phosphinothricin, hph gene conferring resistance to antibiotic hygromycin, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or chemical marker genes, etc. (such as herbicide resistance genes), mannose-6-phosphate isomerase gene providing mannose metabolization ability, etc. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector. The plasmid may specifically be a pBin438 vector.

B3 The recombinant vector may specifically be pBin438-GmTET270. The pBin438-GmTET270 is a recombinant vector obtained by inserting GmTET270 genes shown as a sequence 1 in a sequence table into pBin438, and the recombinant vector expresses GmTET270.

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacterium may be Agrobacterium, such as Agrobacterium GV3101.

In the above applications, none of the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs include propagation material.

In the above application, the plant is M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) leguminous plants;

m3) soybean.

The application also provides any one of the following methods:

x1) a method of growing a fat-containing plant comprising expressing GmTET270 in a recipient plant, or increasing the content of GmTET270 in a recipient plant, or increasing the activity of GmTET270 in a recipient plant, to obtain a plant of interest with increased fat content;

x2) increasing the amount of vegetable fat, comprising expressing GmTET270 in a recipient plant, or increasing the amount of GmTET270 in a recipient plant, or increasing the activity of GmTET270 in a recipient plant, to obtain a target plant with increased fat content, and achieving an increase in vegetable fat content.

In the above method, increasing the content of GmTET270 in the recipient plant in X1) and X2) may be achieved by introducing a gene encoding GmTET270 into the recipient plant and allowing the gene to be expressed.

In the above method, the coding gene may be the nucleic acid molecule of B1).

In the above method, the encoding gene of GmTET270 may be modified as follows before being introduced into the recipient plant to achieve better expression effect:

1) Modification and optimization are carried out according to actual needs so as to enable the genes to be expressed efficiently; for example, the codon of the coding gene of GmTET270 of the present application may be changed to correspond to plant preferences while maintaining the amino acid sequence thereof according to the codon preferred by the recipient plant; during the optimization process, it is preferable to maintain a certain GC content in the optimized coding sequence to best achieve high level expression of the introduced gene in the plant, wherein the GC content may be 35%, more than 45%, more than 50% or more than about 60%;

2) Modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

3) Ligating to promoters expressed by various plants to facilitate expression thereof in plants; the promoter may include constitutive, inducible, chronologically regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space of expression requirements and will also depend on the target species; for example, a tissue or organ specific expression promoter, depending on the desired time period of development of the receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, it is desirable to select dicot promoters for expression in dicots and monocot promoters for expression in monocots;

4) The expression efficiency of the gene of the application can be improved by connecting with a proper transcription terminator; e.g., tml derived from CaMV, E9 derived from rbcS; any available terminator known to function in plants may be ligated to the gene of the present application;

5) Enhancer sequences such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV) are introduced.

The coding gene of GmTET270 may be introduced into a recipient plant using a recombinant vector containing the coding gene of GmTET270. The recombinant vector can be specifically pBin438-GmTET270.

The recombinant vector may be introduced into plant cells or tissues by conventional biological methods using Ti plasmids, ri plasmids, plant viral vectors, direct DNA transformation, microinjection, electroporation, agrobacterium-mediated methods, etc., and the transformed plant tissues are cultivated into plants. The plant host to be transformed may be either a monocot or a dicot.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants. From the safety of transgenic plants, transformed plants can be screened directly by drought treatment without adding any selectable marker gene.

The plant of interest is understood to include not only the first generation plants in which the GmTET270 protein or the gene encoding it has been altered, but also their progeny. For the plant of interest, the gene may be propagated in that species, or may be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The plants of interest include seeds, calli, whole plants and cells.

In the above method, the recipient plant may be M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) leguminous plants;

m3) soybean.

The application also provides a product for increasing the content of vegetable oil, which contains GmTET270 or a substance for regulating the activity or the content of the protein.

The product can take GmTET270 or the substance for regulating the activity or the content of the protein as an active ingredient, and can also combine GmTET270 or the substance for regulating the activity or the content of the protein with substances with the same functions as the active ingredient.

In the above products, the plant may be M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) leguminous plants;

m3) soybean.

GmTET270 or the substances regulating the activity or the content of the protein also belong to the scope of protection of the application.

In the present application, the oil content may be the oil content in the seed. The grease comprises the following fatty acids: palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3) and arachidonic acid (20:1).

The application provides a four-transmembrane protein GmTET270 related to the grease content of plant tissues and a coding gene thereof, and the grease content in seeds is improved by over-expressing the transgene in model plant Arabidopsis. The RNA binding protein GmTET270 and the coding gene thereof can positively regulate the grease content in plant seeds. The gene has important theoretical and practical significance for improving the oil content of seeds and cultivating high-oil varieties.

Drawings

FIG. 1 shows the expression analysis of GmTET270 in different organs of soybean.

FIG. 2 is a schematic representation of cloning vector and plant expression vector GmTET270.

FIG. 3 is a molecular characterization of GmTET270 transgenic lines.

FIG. 4 is a graph showing the measurement of oil content in seeds of GmTET270 transgenic plants. * P is less than 0.05; * P < 0.01.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents, instruments and the like used in the examples described below are commercially available unless otherwise specified. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

Agrobacterium GV3101 strain is described in Clough-SJ, bent-AF. Flora skip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thiana. Plant-journal.1998,16:6,735-743, publicly available from the national academy of sciences of genetics and developmental biology.

Columbia ecological Arabidopsis thaliana (col-0): seeds are derived from Arabidopsis Biological Resource Center (ABRC), hereinafter abbreviated as wild type arabidopsis.

The pBin438 vector (binary expression vector) was enjoyed by Fang Rongxiang institutions. The study of highly efficient insect-resistant transgenic tobacco [ J ]. Chinese science (edit B), 1994,24 (3): 276-282.) "is described in" Li Taiyuan, tian Yingchuan, qin Xiaofeng, et al, and is available from the institute of genetics and developmental biology at the national academy of sciences after approval by the public at the institution Fang Rongxiang.

Soybean Williams 82 (W82) is described in the following literature: scott a Jackson et al Genome sequence of the palaeopolyploid soybean, nature,2010, vol.463,178-183; the public is available from research institute of genetic and developmental biology at national academy of sciences; the soybean material was a american cultivar, given by the professor Purdue University, department of Agronomy, scott Jackson.

EXAMPLE 1 cDNA clone of the Gene GmTET270 encoding the soybean oil metabolism control-related RNA binding protein GmTET270 and tissue-specific expression detection

1. Cloning of GmTET270

The soybean varieties with different seed fat contents are used as materials, transcriptomes in the early and middle stages of rapid accumulation of grease in seed development are analyzed, a co-expression network is constructed by comparing differential expression genes, and candidate genes participating in regulation and control of the grease content of seeds are screened from co-expression network nodes. The primers were designed to clone the gene of interest from W82 based on the Williams 82 (W82) genomic sequence. All candidate genes were overexpressed in the model plant arabidopsis for functional verification. The result shows that the oil content of the Glyma.17G069300 positive regulation seed in the candidate gene is obviously greater than that of the seed of the over-expression Arabidopsis plant. Glyma.17G069300 was checked in the database as GenBank: KRH02964.1, which was a member of the protein superfamily with 4 transmembrane domains according to amino acid sequence alignment, as a four-transmembrane protein "tetraspins superfamily", and no functional record was made about the protein.

Extracting total RNA of the W82 metaphase seed by adopting CTAB, and carrying out reverse transcription on the RNA by using reverse transcriptase to synthesize cDNA.

Based on information on the full-length cDNA sequence of Glyma.17G069300 in the W82 genome sequence, primers were designed with the following sequences:

Glyma.17G069300-F:ATGGTTCGGTTCAGCAACA；

Glyma.17G069300-R:CTAACGAGAATATCCCTTCCAATT。

PCR amplification was performed using W82 cDNA as a template and Glyma.17G069300-F and Glyma.17G069300-R as primers, yielding a PCR product of about 800 bp. Through sequencing, the PCR product is 813bp, the nucleotide shown as a sequence 1 in a sequence table is provided, the protein coded by the gene is named GmTET270, the protein contains 270 amino acids, and the amino acid sequence of the protein is a sequence 2 in the sequence table.

2. Expression analysis of GmTET270 in different organs of soybean

The total RNA of soybean root, seedling, leaf, pod and seed is reverse transcribed with reverse transcriptase to synthesize cDNA. The primers were identified by Real Time-PCR as above. The soybean Tublin gene is an internal standard, and the Primer used is Primer-TF:5' -AACCTCCTCCTCATCGTACT, and Primer-TR:5'-GACAGCATCAGCCATGTTCA-3'. FIG. 1 shows that the transcription of the GmTET270 gene is expressed most in seeds, and the expression levels in other organs are very low, namely pods, leaves and roots in turn, and the expression is hardly measured in seedlings.

Example 2 acquisition of GmTET270 Arabidopsis thaliana

1. Construction of GmTET270 overexpressing plant vector

And (3) taking cDNA of soybean Williams 82 seeds as a template, and carrying out PCR amplification by adopting F and R to obtain a PCR product.

Cloning the used primers:

first round PCR primers:

F：CTCATTGATTCATCATGGTTCG；

R：CTAACGAGAATATCCCTTCCAATT。

second round PCR primers (amplification CDS region):

F：ATGGTTCGGTTCAGCAACA；

R：CTAACGAGAATATCCCTTCCAATT。

adding homologous arm sequences (CAATTACTGCAGGGATCCGTCGAC and CTTATCGTCGTCATCCTTGTAATC respectively) for carrying out homologous recombination with pBin438 at two ends of a primer used for the second round of PCR, and amplifying the first round of PCR product; double enzyme digestion is carried out on a plant expression vector pBin438 by restriction enzymes BamHI and KpnI, and a PCR recovery fragment of a second round PCR product is connected into the pBin438 vector by adopting a homologous recombination method to obtain a recombinant vector pBin438-GmTET270 (part of the vector schematic diagram is shown in figure 2). pBin438-GmTET270 is a recombinant vector obtained by replacing a DNA fragment between BamHI and KpnI recognition sequences of a pBin438 vector with a GmTET270 gene shown in a sequence 1 in a sequence table, and the recombinant vector is labeled as NPT II, so that fusion proteins formed by the GmTET270 and the NPT II shown in a sequence 2 in the sequence table can be expressed.

2. Acquisition of recombinant Agrobacterium

The recombinant vector pBin438-GmTET270 containing GmTET270 is introduced into an agro-pole GV3101 by an electric shock method, recombinant agrobacterium is picked up, and the recombinant agrobacterium is named GV3101/GmTET270.

3. Acquisition and identification of GmTET 270-transformed Arabidopsis thaliana

Recombinant Agrobacterium GV3101/GmTET270 was cultured to log phase and then transformed into Columbia ecological Arabidopsis thaliana (col-0) by vacuum. Harvesting seeds after cultivation, sowing the seeds on MS screening culture medium containing kanamycin (50 mg/L), and obtaining T after screening ₁ The plants grow on vermiculite when the generation plants grow to 4-6 leaves, and T is harvested ₁ Single plants were replaced, each single plant seed was sown separately, and selection was continued with the same MS selection medium to observe T ₂ And (3) the separation of the generations, repeating the steps until genetically stable transgenic homozygous lines are obtained, and obtaining 12 overexpressed GmTET270 arabidopsis thaliana lines. Extracting RNA of the 12 strain seedlings, and carrying out reverse transcription to obtain cDNA as a template, wherein the primers are as follows: f: ATGGTTCGGTTCAGCAACA and R: CTAACGAGAATATCCCTTCCAATT, real Time-PCR identification was performed. Wild type Arabidopsis thaliana (Col-0) was used as a control. The Arabidopsis AtActin2 gene is an internal standard, and the Primer used is Primer-TF:5' -ATGCCCAGAAGTCTTGTTCC, and Primer-TR:5'-TGCTCATACGGTCAGCGATA-3'. Pure lines OE1, OE7, OE12, OE6, OE2, OE5, and OE15 were selected for further testing (FIG. 3).

The pBin438 vector was used to replace pBin438-GmTET270 to obtain a trans-empty vector control.

The relative expression levels of GmTET270 in OE1, OE7, OE12, OE6, OE2, OE5 and OE15 were about 42, 30, 28, 21, 27, 13 and 10, respectively, and no expression level of GmTET270 could be detected in the control.

The above results indicate that GmTET270 is transferred into arabidopsis and expressed.

3. Phenotypic analysis of GmTET270 transgenic Arabidopsis thaliana

Total lipid content in transgenic empty vector control, gmTET270 over-expressed pure lines OE1, OE7, OE12, OE6, OE2, OE5 and OE15 seeds was determined. The method comprises the following steps:

thoroughly drying the grains to be tested, grinding into powder, taking 10mg, adding into a 2ml centrifuge tube with a screw, and weighing four samples in parallel. 10 μl of 17:0 fatty acid (10 mg/ml) was added as an internal standard. 1ml of a methanol solution containing 2.5% concentrated sulfuric acid was added, and the mixture was incubated in a water bath at 85℃for 1 hour, while shaking several times. After natural cooling, 500. Mu.l of the supernatant was taken into a fresh tube, 600. Mu.l of 0.9% (mass percent) NaCl aqueous solution and 300 n-hexane were added, and the mixture was stirred and mixed for several minutes, centrifuged at 4000 rpm for 10 minutes, and the supernatant was taken into the fresh tube. N-hexane was allowed to evaporate completely overnight in a fume hood, and then 50 μl of ethyl acetate was added to dissolve the methyl esterified fatty acids. The relative content of each component of the methyl esterified fatty acid sample is measured by a gas chromatography mass spectrometer (Perkin-Elmer Turbomas), then the absolute content of each component fatty acid is compared with the added 17:0 internal standard, and then the total fat content, namely the sum of the absolute contents of each component, is calculated. (Shen, b., et al, the homeobox gene GLABRA, affects seed oil content in Arabidopsis, plant mol. Biol.,60,377-387,2006.)

Gas chromatograph: shimadzu corporation (GC-2014, shimadzu). Detection conditions: chromatographic column: FAMEWAX, carrier gas: nitrogen, column flow: 4.21mL/min, column temperature: 170 ℃, sample injection temperature: 250 ℃, detector temperature: 250 ℃, pressure: 163.8kPa, analysis time: 25min, internal standard: 17:0 fatty acid (Margaric, heptadecanoic acid, sigma-Aldrich huoh, cat# H3500-25G), sample volume: 1 μl, solvent: ethyl acetate.

The fatty acids detected were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3) and arachidonic acid (20:1).

The 30 seeds of each strain are taken, biological experiments are repeated three times, and the results are taken as average value plus or minus standard deviation.

The results are shown in FIG. 4, and the total oil content of the empty carrier control Arabidopsis seeds is 22.5+/-0.5%, namely the total oil content is the percentage of the total weight of the seeds. The total oil content of seeds of GmTET270 Arabidopsis strains OE1, OE7, OE12, OE6, OE2, OE5 and OE15 is 27.0+ -1.8, 26.1+ -3.1, 28.3+ -2.8, 29.1+ -3.1, 24.5+ -3.5, 25.6+ -1.8% and 25.3+ -7.8, respectively. The results show that the oil content in the seeds of the 6 transgenic lines except OE15 is significantly or very significantly higher than that of the transgenic empty vector control.

The experiment shows that the soybean four-transmembrane protein GmTET270 positively regulates the synthesis and accumulation of oil in seeds, and the overexpression of the encoding gene GmTET270 can improve the content of total oil in transgenic plant seeds.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> institute of genetic and developmental biology of national academy of sciences

<120> soybean four-transmembrane-region protein GmTET270 related to lipid metabolism regulation, and coding gene and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 813

<212> DNA

<213> Glycine max Merrill

<400> 1

atggttcggt tcagcaacaa tgttatcgga ctccttaact tcctcacctt cctcttgtcc 60

atcccgatcc tggtggccgg agtgtggctg agcaagcaag gcgccaccga gtgcgagcgg 120

tggctggaga agcccgtcat cgcgctcggc gtcttcctca tgctcgtctc actcgccggc 180

ctcgtcggcg cgtgctgccg cgtgtcgtgg ctcctctggc tctacctcct cgtcatgttt 240

gtcctcatcg ttcttctctt cgccttcacc attttcgctt tcgtcgttac caacaagggc 300

gctggtgaag ttgtttctaa tagagggtat aaagagtata ggcttgggga ttactcgaat 360

tggctgcaga agaaggttaa taacactaag acgtggaaca ggatcagtag ttgcttgcat 420

tctgggaaag tctgcactga gtttcaatcc aagtttctaa acgacaccgt tactcagttt 480

tacaccgagc acctgtccgc gcttcagtct ggatgctgta aacctgcaga agaatgccta 540

tttacctatg agaattcaac gagctggacg aagcctggaa atgtgaccag ttacaacaat 600

cctgactgtg atgcttggaa taacaatcaa acagttctgt gcttcaattg ccaatcatgc 660

aaggctggct ttctgcaaaa cttcaagact gaatggaaga gggtggctgt tgttaacatc 720

gtattccttg ttcttctcat tattgtatac tccatagggt gctgtgcatt caggaacaat 780

aggagggaaa attggaaggg atattctcgt tag 813

<210> 2

<211> 270

<212> PRT

<213> Glycine max Merrill

<400> 2

Met Val Arg Phe Ser Asn Asn Val Ile Gly Leu Leu Asn Phe Leu Thr

1 5 10 15

Phe Leu Leu Ser Ile Pro Ile Leu Val Ala Gly Val Trp Leu Ser Lys

20 25 30

Gln Gly Ala Thr Glu Cys Glu Arg Trp Leu Glu Lys Pro Val Ile Ala

35 40 45

Leu Gly Val Phe Leu Met Leu Val Ser Leu Ala Gly Leu Val Gly Ala

50 55 60

Cys Cys Arg Val Ser Trp Leu Leu Trp Leu Tyr Leu Leu Val Met Phe

65 70 75 80

Val Leu Ile Val Leu Leu Phe Ala Phe Thr Ile Phe Ala Phe Val Val

85 90 95

Thr Asn Lys Gly Ala Gly Glu Val Val Ser Asn Arg Gly Tyr Lys Glu

100 105 110

Tyr Arg Leu Gly Asp Tyr Ser Asn Trp Leu Gln Lys Lys Val Asn Asn

115 120 125

Thr Lys Thr Trp Asn Arg Ile Ser Ser Cys Leu His Ser Gly Lys Val

130 135 140

Cys Thr Glu Phe Gln Ser Lys Phe Leu Asn Asp Thr Val Thr Gln Phe

145 150 155 160

Tyr Thr Glu His Leu Ser Ala Leu Gln Ser Gly Cys Cys Lys Pro Ala

165 170 175

Glu Glu Cys Leu Phe Thr Tyr Glu Asn Ser Thr Ser Trp Thr Lys Pro

180 185 190

Gly Asn Val Thr Ser Tyr Asn Asn Pro Asp Cys Asp Ala Trp Asn Asn

195 200 205

Asn Gln Thr Val Leu Cys Phe Asn Cys Gln Ser Cys Lys Ala Gly Phe

210 215 220

Leu Gln Asn Phe Lys Thr Glu Trp Lys Arg Val Ala Val Val Asn Ile

225 230 235 240

Val Phe Leu Val Leu Leu Ile Ile Val Tyr Ser Ile Gly Cys Cys Ala

245 250 255

Phe Arg Asn Asn Arg Arg Glu Asn Trp Lys Gly Tyr Ser Arg

260 265 270

Claims

1. Any of the following uses of a protein or a substance that modulates the activity or content of said protein:

d1 Regulating and controlling the content of vegetable oil;

d3 Cultivating the fat content-increasing plant;

d4 Preparing a cultivated plant product with increased grease content;

d5 Plant breeding;

the protein is A1), A2) or A3) as follows:

a1 A protein whose amino acid sequence is sequence 2;

2. The use according to claim 1, characterized in that: the substance is any one of the following B1) to B7):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

3. The use according to claim 2, characterized in that: b1 The nucleic acid molecule is b 11) or b 12) or b 13) or b 14) as follows:

b12 A cDNA molecule or a DNA molecule of a sequence 1 in a sequence table;

b13 A cDNA or DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) and encoding the protein according to claim 1;

b14 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b 11) or b 12) or b 13) and which codes for the protein according to claim 1.

4. A use according to any one of claims 1-3, characterized in that: the plant is M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) leguminous plants;

m3) soybean.

5. The method comprises the following steps:

x1) a method for growing a plant with increased lipid content comprising expressing the protein of claim 1 in a recipient plant, or increasing the activity of the protein of claim 1 in a recipient plant, to obtain a plant of interest with increased lipid content;

x2) a method for increasing the lipid content of a plant comprising expressing the protein of claim 1 in a recipient plant, or increasing the protein content of claim 1 in a recipient plant, or increasing the activity of the protein of claim 1 in a recipient plant, to obtain a plant of interest having an increased lipid content, to achieve an increase in the lipid content of a plant.

6. The method according to claim 5, wherein: increasing the content of the protein according to claim 1 in a recipient plant in X1) and X2) is achieved by introducing into the recipient plant a gene encoding the protein according to claim 1 and allowing the gene to be expressed.

7. The method according to claim 6, wherein: the coding gene is the nucleic acid molecule of B1) in claim 2 or 3.

8. The method according to any one of claims 5-7, wherein: the recipient plant is M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) leguminous plants;

m3) soybean.

9. A vegetable oil content enhancing product comprising the protein of any one of claims 1 to 3 or the substance regulating the activity or content of said protein.

10. A protein according to any one of claims 1 to 3 or said substance which modulates the activity or content of said protein.