CN116763778A - Application of OSU-A9 in preparation of medicines for treating myocardial hypertrophy - Google Patents

Abstract

The invention discloses application of OSU-A9 in preparing a medicament for treating myocardial hypertrophy, and researches show that the OSU-A9 treatment can obviously inhibit the ubiquitination degradation of GSNOR induced by TAC, thereby relieving myocardial hypertrophy and heart contraction function decline of mice. OSU-A9 treatment significantly inhibited Ang II-induced ubiquitination degradation of GSNOR, thereby ameliorating cardiomyocyte hypertrophy. OSU-A9 can be used for the treatment of cardiac hypertrophy.

Description

Application of OSU-A9 in preparation of medicines for treating myocardial hypertrophy

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to an application of OSU-A9 in preparing a medicament for treating myocardial hypertrophy.

Background

The prevalence rate of cardiovascular diseases in China is high, and the Chinese cardiovascular health and disease report 2021 indicates that: at present, about 3.3 hundred million people in China suffer from cardiovascular diseases, and cardiovascular disease death accounts for the first cause of total death of urban and rural residents. Myocardial hypertrophy is a common pathological reaction in the development process of various cardiovascular diseases, and due to the increase of the oxygen consumption of the hypertrophic myocardium, the unbalance of the supply and demand of the myocardial oxygen further induces arrhythmia, myocardial infarction, sudden death and the like. Thus, myocardial hypertrophy is considered as a predictor of cardiovascular disease morbidity and mortality. Myocardial hypertrophy occurs in early stages of cardiovascular diseases, and can be reversed to a certain extent after pathogenic factors are eliminated. Therefore, inhibiting the occurrence of cardiac hypertrophy is important for reducing the incidence rate and the death rate of cardiovascular diseases.

Nitrosoglutathione reductase (GSNOR) belongs to the family of alcohol dehydrogenases, and is mainly involved in the metabolism of nitrosoglutathione, regulating the maintenance of nitric oxide homeostasis in the body. Studies have shown that GNSOR expression levels are significantly reduced during the course of cardiac hypertrophy, while overexpression of GSNOR reduces cardiac hypertrophy. This suggests that down-regulation of GSNOR may be an important causative factor in cardiac hypertrophy, and we have therefore explored specific reasons for down-regulation of GSNOR in cardiac hypertrophy. We have found that in cardiac hypertrophy, E3 ubiquitin ligase NEDD4 promotes ubiquitination and degradation of GSNOR, resulting in reduced GSNOR expression and thus exacerbation of cardiac hypertrophy. Thus, inhibitors of NEDD4 activity may inhibit GSNOR degradation, alleviating cardiac hypertrophy.

Currently known NEDD4 inhibitors are mainly Indole-3-methanol (I3C), but I3C is unstable under acidic conditions, and I3C in plasma, liver, kidney, lung, heart and brain tissues is below the detection limit within 1 hour after oral administration of the mice. OSU-A9 is a modified compound of I3C, which avoids degradation under acidic conditions, has stable structure and high drug effect. The literature indicates that OSU-A9 can significantly inhibit proliferation and invasion of various tumors, such as prostate cancer, gastric cancer, liver cancer, breast cancer and the like. However, the role and mechanism of OSU-A9 in cardiovascular disease have not been reported.

Disclosure of Invention

The invention aims to provide an application of novel NEDD4 activity inhibitor OSU-A9 in preparing medicaments for treating myocardial hypertrophy, and researches show that OSU-A9 can obviously relieve myocardial hypertrophy.

The aim of the invention can be achieved by the following technical scheme:

the use of a compound OSU-A9 of formula (I) in at least one of the following (1) to (3),

(1) Preparing a medicament for preventing and/or treating myocardial hypertrophy;

(2) Preparing a medicament having an improved systolic function;

(3) Preparing an agent having a function of improving myocardial cell hypertrophy;

preferably, the medicament or reagent is a pharmaceutical composition or reagent composition prepared by taking OSU-A9 as a main active ingredient and pharmaceutically acceptable carriers or auxiliary materials. Further preferably, the pharmaceutical or agent is in the form of an oral dosage form.

The compound shown in the structural formula (I) is a novel NEDD4 activity inhibitor, and is named as: OSU-A9. The research of the invention shows that OSU-A9 can obviously relieve myocardial hypertrophy. The synthetic method of OSU-A9 has been disclosed in the prior art (Jing-Ru Weng, et al A content Indle-3-carbide-Derived Antitumor Agent with Pleiotropic Effects on Multiple Signaling Pathways in Prostate Cancer Cells, cancer Res2007;67 (16)), and the synthetic route of OSU-A9 is as follows:

the invention has the beneficial effects that:

the research result of the invention shows that OSU-A9 can relieve the increase of the surface area of the myocardial cells induced by Ang II, inhibit the increase of atrial natriuretic peptide (atrial natriuretic peptide, anp), brain natriuretic peptide (brain natriureticpeptide, bnp) and beta-myosin heavy chain (beta-myosin heavy chain, beta-mhc) of the myocardial cell center hypertrophic markers induced by Ang II, and indicate that the invention can be used for improving myocardial cell hypertrophy; OSU-A9 can improve EF, FS values of aortic arch stenosis (transverse aortic constriction, TAC) mice hearts, suggesting that the invention can be used to improve the systolic function under cardiac hypertrophy; OSU-A9 can reduce the ratio of the heart weight to the body weight of the mice, reduce the expression level of myocardial hypertrophy markers Anp, bnp and beta-mhc in heart tissues, reduce the myocardial cell cross-sectional area of TAC mice, and indicate that the invention can be used for treating myocardial hypertrophy.

Drawings

FIG. 1 is a schematic diagram of TAC modeling and OSU-A9 dosing regimen.

FIG. 2 is an OSU-A9 alleviating TAC-induced myocardial hypertrophy and GSNOR ubiquitination degradation;

a, echocardiography detects mouse EF, FS, IVS and LVPW value changes (n=10);

b, first behavioural mouse heart photograph, second behavioural HE staining (scale 1mm, n=10), third behavioural WGA staining (scale 100 μm, n=10). On the right are quantitative analysis of heart to body weight ratio (HW/BW) and cardiomyocyte cross-sectional area (n=10);

c, qRT-PCR detects the levels of myocardial hypertrophy markers Anp, bnp and beta-mhc (n=10) of the heart tissue of the mouse, the expression level of RNA is uniform according to the expression level of 18s, and the statistical figures are relative values compared with sham groups;

d, western-blot detects GSNOR ubiquitination levels (n=10) in heart tissue. * P <0.01, P <0.001.

FIG. 3 is an OSU-A9 alleviating Ang II-induced cardiomyocyte hypertrophy and GSNOR ubiquitination degradation;

a, observing the surface area of myocardial cells by alpha-actinin immunofluorescence staining and carrying out statistical analysis (the scale is 100 μm, n=3), wherein the surface area statistical graphs are all relative values compared with CON groups;

b, qRT-PCR detects the levels of Anp, bnp, β -mhc (n=3) in mouse cardiomyocytes, the RNA expression levels are uniform according to the expression level of 18s, and the statistical figures are relative values compared with the CON group;

c, western blot detects GSNOR ubiquitination levels (n=3) in cardiomyocytes. * P <0.001.

Detailed Description

The following examples will provide those skilled in the art with a more complete understanding of the invention, but are not intended to limit the invention in any way.

Example 1: therapeutic effect of OSU-A9 on TAC-induced cardiac hypertrophy mice

1. TAC-induced mouse myocardial hypertrophy model:

male C57BL/6J mice (purchased from Experimental animal center of Nanjing medical university) of 25-28 g in weight at 8 weeks of age were selected and randomly classified as: sham surgery (sham) group, TAC group, sham+osu-A9 group, tac+osu-A9 group, 10 per group. The mice are anesthetized and fixed, chest is opened through a sternum handle, and the mice are connected with a rodent breathing machine through an trachea cannula to carry out artificial ventilation. Opening the chest between the 2 nd rib and the 3 rd rib on the left side of the chest, and separating the aortic arch; threading after the innominate artery, winding the aortic arch, tying two dead knots above the aortic arch, restoring thymus and heart to original positions, carefully closing the chest cavity, and suturing the skin; sham group mice repeat the above procedure except that only the threading is not narrowed.

As shown in FIG. 1, all animals were perfused with OSU-A9 (20 mg/kg/d) or its control solvent (ultrapure water containing 0.1% (v/v) Tween, 0.5% methylcellulose (g/100 ml, 0.5g methylcellulose per 100ml solvent), 10% (v/v) DMSO) at once-a-day frequency; after one week, TAC modeling is carried out, and sham group carries out false operation; after molding for 4 weeks, an ultrasonic cardiography examination is performed, and heart tissues are taken for subsequent myocardial hypertrophy index examination.

2. Echocardiography:

4 weeks after TAC molding, echocardiography images were acquired by cardiac M-mode ultrasound techniques using a small animal ultrasound imaging system Visual Sonics Vevo 2100 to assess the thickening and contractile function of the mouse's heart, including left ventricular posterior wall thickness (left ventricular posterior wall, LVPW), ventricular septum thickness (interventricular septum, IVS), left ventricular posterior wall ejection fraction (ejection fraction, EF), short axis foreshortening rate (fraction shortening, FS).

3. Mice heart weighing:

after euthanasia of the mice, hearts were taken, weighed, and the ratio of Heart Weight (HW) to Body Weight (BW) was calculated.

4. Heart tissue paraffin sections HE staining, WGA staining:

heart tissue was collected, paraffin sections were prepared, after dewaxing and rehydration, hematoxylin stained nuclei for 3min, after washing with clear water, eosin stained for 3min, after washing, air dried, and blocked, and observed using an Olympus BX63 microscope.

After baking heart paraffin sections in an oven at 55 ℃ for 3h, membrane rupture, washing, wheat germ lectin (Wheat Germ Agglutinin, WGA) staining at 37 ℃ for 1h, dapi staining and sealing, observations were made using an Olympus BX63 microscope.

5. RT-qPCR detects heart tissue Anp, bnp, beta-mhc levels:

after extracting RNA of heart tissue and synthesizing cDNA by reverse transcription, the expression of myocardial hypertrophy markers Anp, bnp and beta-mhc is detected by adopting a real-time fluorescence quantitative PCR (RT-qPCR) technology. Wherein the reverse transcription system (20. Mu.L) is: super Mix (5×) 4. Mu.L, total RNA 1000ng, RNase Free dH ₂ O makes up the volume to 20 mu L at 50 ℃,15 min-85 ℃ and 5 s-12 ℃. The RT-qPCR system (10. Mu.L) was: SYBR GREEN (2×) 5. Mu.L, primer F0.2. Mu.L, primer R0.2. Mu. L, cDNA 1. Mu.L, RNase Free dH ₂ O3.6. Mu.L, provided that: pre-denaturation and enzyme activation, 95 ℃ for 10min; denaturation, 95 ℃,10s, annealing and stretching, 60 ℃,60s,40 cycles; dissolution profile, 95 ℃,15 s-60 ℃,60 s-95 ℃,15s. The primer sequences used for RT-qPCR are shown in Table 1.

TABLE 1 primer sequences for RT-qPCR of mouse heart tissue

Gene	Forward(5'to 3')	Reverse(5'to 3')	Species of species
				Anp	ATTGACAGGATTGGAGCCCAGAGT	TGACACACCACAAGGGCTTAGGAT	A mouse
Bnp	CTCAAGCTGCTTTGGGCACAAGAT	AGCCAGGAGGTCTTCCTACAACAA	A mouse
				β-mhc	ACTGTCAACACTAAGAGGGTCA	TTGGATGATTTGATCTTCCAGGG	A mouse
18s	AGTCCCTGCCCTTTGTACACA	CGATCCGAGGGCCTCACTA	A mouse

6. Detection of GSNOR ubiquitination levels in cardiac tissue:

20mg of heart tissue was weighed, sheared, washed 1 time with ice PBS, 1mL of ubiquitinated lysate (50 mM Tris-HCl, pH7.5, 150mM NaCl,1mM EDTA,1Mm EGTA,1% (v/v) Triton X-100,1mM PMSF,20mM NEM, protease inhibitor added prior to use) was added, and homogenized with a homogenizer until no solids were present. The homogenate was spun at 4℃for 30min. The cell suspension was centrifuged at 12,000rcf,4℃for 10min. Protein concentration was measured, 50. Mu.g of protein was retained as input according to the measured protein concentration, 500. Mu.g of protein was added to protein G beads and GSNOR antibody, and the mixture was spun overnight at 4 ℃. Washing the beads for 5 times, adding 2×loading buffer equal to the volume of the beads, shaking, centrifuging, and boiling the protein at 100deg.C for 5min.

7. Western-blot detection of GSNOR ubiquitination level:

12% of the separation gel and 3% of the concentrate gel were prepared as shown in Table 2, and the loading per well was about 30. Mu.g. And (3) carrying out 110V constant-pressure electrophoresis for about 90min until bromophenol blue completely disappears. After electrophoresis, the concentrated gel was cut off, and the protein band was transferred to a PVDF membrane by wet transfer (SDS-gel at negative electrode and PVDF membrane at positive electrode), followed by 0.3A constant-current electrophoresis for 90min. After the transfer, the PVDF membrane was removed and immersed in TBST containing 5% skimmed milk powder for 1h. After blocking, the membrane was shaken with the antibody overnight at 4 ℃. After washing the membrane, horseradish peroxidase-labeled secondary antibody was added and incubated for 2h at room temperature. After washing the membrane, ECL developed and the results were observed.

TABLE 2 preparation of SDS-PAGE

Composition of the components	Release adhesive (12%)	Concentrated glue (3%)
			Deionized water	1.6mL	1.8mL
30% (v/v) AA mother liquor	2.0mL	0.3mL
			1.5M Tris-HCl(pH8.8)	1.3mL
1M Tris-HCl(pH6.8)		0.75mL
			10％(g/100ml)SDS	50μL	30μL
10% (g/100 ml) Ammonium Persulfate (APS)	50μL	50μL
			TEMED	5μL	5μL
Total volume of	5mL	About 3mL

8. Statistical methods:

two-way ANOVA (two-way ANOVA) was used between the different groups in the experiment, and it was considered that P <0.05 had statistical significance; statistical plots were drawn using prism8.0 statistical software.

9. Analysis of results:

echocardiography showed that OSU-A9 reduced IVS and LVPW in TAC mice and increased hearts EF and FS in TAC mice compared to TAC group, indicating that OSU-A9 improved left ventricular hypertrophy and systole function in TAC mice (as shown in fig. 2A). OSU-A9 significantly reduced the ratio of heart weight to body weight (HW/BW) in mice compared to the TAC group, and the HE staining and WGA staining of heart tissue sections showed that OSU-A9 was able to significantly reduce the heart volume and cardiomyocyte cross-sectional area in TAC mice (as shown in FIG. 2B). Simultaneously, OSU-A9 reduced the expression level of markers of cardiac hypertrophy (amp, bnp, β -mhc) in cardiac tissue (as shown in fig. 2C). The above results indicate that OSU-A9 significantly improved myocardial hypertrophy and contractile function in TAC mice. The ubiquitination results showed that OSU-A9 significantly reduced the TAC-induced increase in GSNOR ubiquitination levels in myocardial tissue (as shown in figure 2D).

In conclusion, OSU-A9 treatment significantly inhibited TAC-induced ubiquitination degradation of GSNOR, thereby alleviating myocardial hypertrophy and decreased systolic function in mice.

Example 2: protective effect of OSU-A9 on Ang II-induced cardiomyocyte hypertrophy

1. Ang II induced cardiomyocyte hypertrophy model:

SD rat rats (purchased from Experimental animal center of Nanjing medical university) were harvested 1-3 days after birth, and primary cardiomyocytes were isolated and divided into Control (CON) group, ang II group, CON+OSU-A9 group, ang II+OSU-A9 group. The cells were all cultured in DMEM medium containing 10% fetal bovine serum. Before the experiment, the cells were treated with serum-free medium for 12 hours, then replaced with DMEM medium containing 10% fetal bovine serum, and incubated with 5 mu MOSU-A9 or equivalent control solvent (DMSO) for 4 hours, then with 1 mu mab II or equivalent control solvent (PBS) for 24 hours, and then subjected to detection such as RT-qPCR, immunofluorescent staining, etc.

2. Detecting the area size of myocardial cells by alpha-actinin staining:

after washing the cardiomyocytes with PBS, 4% (v/v) paraformaldehyde was fixed at room temperature for 20min,0.3% (v/v) Triton X-100 membrane was broken for 15min,5% (g/100 ml) BSA was blocked at room temperature for 30min, alpha-actinin antibody (1:100, sigma-Aldrich, A7811) was incubated overnight at 4℃and then secondary antibody was added, incubated at 37℃for 30min away from light, photographed under a fluorescence microscope Leica DMi8 and analyzed.

3. RT-qPCR detects cardiomyocyte Anp, bnp, beta-mhc levels:

after extracting total RNA of myocardial cells and synthesizing cDNA by reverse transcription, the expression of myocardial hypertrophy markers Anp, bnp and beta-mhc is detected by adopting a real-time fluorescence quantitative PCR (RT-qPCR) technology. The conditions are as described previously. The primer sequences used for RT-qPCR are shown in Table 3.

TABLE 3 primer sequences for myocardial cell RT-qPCR

Gene	Forward(5'to 3')	Reverse(5'to 3')	Species of species
				Anp	ATCTGCCCTCTTGAAAAGCA	GGATCTTTTGCGATCTGCTC	Rat (rat)
Bnp	ATCGGCGCAGTCAGTCGCTT	GGTGGTCCCAGAGCTGGGGAA	Rat (rat)
				β-mhc	AGATCGAGGACCTGATGGTG	GATGCTCTTCCCAGTTGAGC	Rat (rat)
18s	AGTCCCTGCCCTTTGTACACA	CGATCCGAGGGCCTCACTA	Rat (rat)

4. Detecting GSNOR ubiquitination levels in cardiomyocytes:

cells were washed 3 times with pre-chilled PBS, scraped with 500. Mu.L of ubiquitinated lysate (50 mM Tris-HCl, pH7.5, 150mM NaCl,1mM EDTA,1Mm EGTA,1% (v/v) Trinton X-100,1mM PMSF,20mM NEM, added with protease inhibitor before use) and transferred to a 1.5mL centrifuge tube. Rotating at 4 ℃ for 30min. The cell suspension was centrifuged at 12,000rcf,4℃for 10min. Protein concentration was measured, 50. Mu.g of protein was retained as input according to the measured protein concentration, 500. Mu.g of protein was added to protein G beads and GSNOR antibody, and the mixture was spun overnight at 4 ℃. Washing the beads for 5 times, adding 2×loading buffer equal to the volume of the beads, shaking, centrifuging, and boiling the protein at 100deg.C for 5min.

5. Western-blot detection of GSNOR ubiquitination level:

as previously described.

6. Statistical methods:

two-way ANOVA (two-way ANOVA) was used between the different groups in the experiment, and it was considered that P <0.05 had statistical significance; statistical plots were drawn using prism8.0 statistical software.

7. Analysis of results:

alpha-actinin staining showed that OSU-A9 treatment reduced cardiomyocyte surface area compared to Ang II group (as shown in figure 3A). qRT-PCR results showed that OSU-A9 reduced the expression levels of Anp, bnp, beta-mhc in cardiomyocytes (as shown in FIG. 3B). The ubiquitination assay showed that OSU-A9 significantly reduced the rise in GSNOR ubiquitination levels in cardiomyocytes caused by Ang II (as shown in figure 3C).

In conclusion, OSU-A9 treatment significantly inhibited Ang II-induced ubiquitination degradation of GSNOR, thereby ameliorating cardiomyocyte hypertrophy.

Claims (3)

1. The use of a compound OSU-A9 of formula (I) in at least one of the following (1) to (3),

(1) Preparing a medicament for preventing and/or treating myocardial hypertrophy;

(2) Preparing a medicament having an improved systolic function;

(3) Preparing an agent having a function of improving myocardial cell hypertrophy;

2. a use according to any one of claims 1-3, characterized in that: the medicine or reagent is a medicine composition or reagent composition prepared by taking OSU-A9 as a main active ingredient and pharmaceutically acceptable carriers or auxiliary materials.

3. Use according to claim 1 or 2, characterized in that: the dosage form of the medicine or the reagent is an oral dosage form.