CN116751867A - Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe - Google Patents

Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe Download PDF

Info

Publication number
CN116751867A
CN116751867A CN202311000903.5A CN202311000903A CN116751867A CN 116751867 A CN116751867 A CN 116751867A CN 202311000903 A CN202311000903 A CN 202311000903A CN 116751867 A CN116751867 A CN 116751867A
Authority
CN
China
Prior art keywords
mutation
primer
seq
detecting
fluorescent probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311000903.5A
Other languages
Chinese (zh)
Inventor
杨康
李修春
杨超
秦瑶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sinafo Suzhou Life Technology Co ltd
Sinaford Beijing Medical Technology Co ltd
Suzhou Sinafu Medical Technology Co ltd
Original Assignee
Sinaford Beijing Medical Technology Co ltd
Sinafo Suzhou Life Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sinaford Beijing Medical Technology Co ltd, Sinafo Suzhou Life Technology Co ltd filed Critical Sinaford Beijing Medical Technology Co ltd
Priority to CN202311000903.5A priority Critical patent/CN116751867A/en
Publication of CN116751867A publication Critical patent/CN116751867A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer and a fluorescent probe for detecting EGFR mutant genes and application thereof. The nucleic acid sequence of the primer comprises any one or a combination of at least two of sequences shown as SEQ ID NO.1-SEQ ID NO. 33; the nucleic acid sequence of the fluorescent probe comprises any one or a combination of at least two of sequences shown as SEQ ID NO.34-SEQ ID NO. 43. The invention creatively designs the primer and the fluorescent probe for detecting EGFR mutant genes, can specifically and simultaneously detect the deletion mutation of the exon 19, the point mutation of the exon 21, the point mutation of the exon 18 and the insertion mutation of the exon 20 of EGFR, can detect EGFR mutation in 41 base mutation forms, and has high sensitivity and accuracy and easy operation.

Description

Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe
Technical Field
The invention belongs to the technical field of biology, and relates to a primer and a fluorescent probe for detecting EGFR mutant genes and application thereof.
Background
There are many kinds of Epidermal Growth Factor Receptor (EGFR) gene mutations, and there are mainly four types: exon 19 deletion mutations, exon 21 point mutations, exon 18 point mutations and exon 20 insertion mutations. The mutations are classified into sensitive mutations, 90% of which belong to 19del and L858R mutations, and G719X, L861Q, S768I mutations, which are mainly T790M and 20ins mutations, occur in a small number of cases. EGFR-sensitive mutations can be treated with targeted inhibitors with good efficacy and drug-resistant mutations require replacement of new drugs to obtain an optimal therapeutic regimen.
The current gene mutation detection method mainly comprises three major types of a first generation sequencing (Sanger sequencing) method, an ARMS method based on fluorescent quantification of a point mutation difficult-to-amplify mutation system (ARMS) and a second generation sequencing method. The sequencing detection period of the first generation sequencing method is long (1-2 days are needed), the sensitivity is low, and more than 10% of mutation can be detected; although ARMS has become the most common method for detecting gene mutation, its sensitivity is only 1%. The NGS method has the disadvantages of low sensitivity of about 1%, high requirement on samples, large dosage and complicated operation. The cfDNA content in the plasma cfDNA is mostly below 1%, so the sensitivity of the above three detection techniques is not satisfied. For example, CN109457018A discloses an EGFR mutant gene detection method based on multiple fluorescence, which comprises preparing a plurality of specific ARMS amplification primers for different EGFR mutant genes and a blocker capable of inhibiting wild type gene amplification, amplifying fragments containing mutant genes in a sample to be detected, judging whether corresponding EGFR gene mutation exists in different samples according to fluorescence values, wherein the sensitivity of the method is only 1%, and 3-tube detection of a plurality of base mutation forms cannot be effectively realized at the same time, so that accurate quantification cannot be realized.
The digital PCR is a third generation PCR technology, the statistics is that the total number of single molecules is counted, each reaction unit can be theoretically made into a single copy template, absolute quantification of nucleic acid molecules can be realized, and the digital PCR has extremely high detection sensitivity which can be less than 0.1%, so that the digital PCR is very suitable for detecting important mutation sites of genes such as EGFR, KRAS and the like of cfDNA in blood. For example, CN108642154a discloses a primer probe combination and a kit for detecting EGFR mutation sites and application thereof, and adopts a digital PCR amplification method, the sensitivity is higher, but the detected EGFR mutation sites are single, the number of detectable base mutation forms is only 29, the minimum detection limit is less than or equal to 0.2%, and the detection cost is higher.
In view of the foregoing, there is a need to develop a primer and a fluorescent probe for detecting EGFR mutant gene, which can detect EGFR mutation with high accuracy, reproducibility, short period and high sensitivity.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides a primer and a fluorescent probe for detecting EGFR gene mutation and application thereof, which are suitable for clinical demands, have high automation degree, low cost and high sensitivity, can detect the deletion mutation of an exon 19, the point mutation of an exon 21, the point mutation of an exon 18 and the insertion mutation of an exon 20 simultaneously, and 7 target genes T790M, L858R, 19del, 20ins, G719X, L861Q and S768I totally account for EGFR mutation in 41 base mutation forms, and can complete EGFR mutation detection in the 41 base mutation forms only by 3 PCR tubes, and the sensitivity can reach 0.1 percent.
In order to achieve the aim of the invention, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer for detecting EGFR gene mutation and a fluorescent probe, wherein the nucleic acid sequence of the primer comprises any one or a combination of at least two of sequences shown as SEQ ID NO.1-SEQ ID NO.33, and the nucleic acid sequence of the fluorescent probe comprises any one or a combination of at least two of sequences shown as SEQ ID NO.34-SEQ ID NO. 43;
the primer is used for multiplex droplet digital PCR amplification; the sensitivity of the amplification result was 0.1%;
the base mutant forms of the EGFR mutant gene include: c.2369c > T, c.2238_2252del15, c.2239_2253del15, c.2240_2254del15, c.2240_2251del12, c.2238_2252del gca, c.2238_2248del gc, c.2239_2247del9, c.2239_2256del18, c.2240_2257del18, c.2237_2251del15, c.2237_2255> T, c.2237_2253> ttgct, c.2237_2257> tct, c.2237_2254del18, c.2238_2255del18, c.2237_2252T, c.2235_2248del attc, c.2235_1 del, c.2235_2 at any one or a combination of at least two of c.2235_2255 delainsaat, c.2235_2249del15, c.2236_2250del15, c.2236_2253del18, c.2233_2247del15, c.2239_2251> C, c.2239_2256 delainscaa, c.2239_2248 delainsc, c.2239_2258 delainsca, c.2307_2308ins9GCCAGCGTG, c.2311_2312ins9GCGTGGACA, c.2309_2310ac > ccagcgtggat, c.2310_2311insGGT, c.2319_2320insCAC, c.2319_2320 inscccac, c.2156g > C, c.2155g > a, c.2582T > a or c.2303g > T.
The invention creatively designs the primer and the fluorescent probe for detecting EGFR mutant genes, can specifically and simultaneously detect the deletion mutation of the exon 19, the point mutation of the exon 21, the point mutation of the exon 18 and the insertion mutation of the exon 20 of EGFR, can detect EGFR mutation in 41 base mutation forms, and has high sensitivity and accuracy and easy operation.
SEQ ID NO.1：TGCTGGGCATCTGCCTCAC。
SEQ ID NO.2：GTCTTTGTGTTCCCGGACATAG。
SEQ ID NO.3：CCAGGAACGTACTGGTGAAAAC。
SEQ ID NO.4：TTCTTTCTCTTCCGCACCCACCA。
SEQ ID NO.5：GTCGCTATCAAGGAACCATCTCC。
SEQ ID NO.6：CCGTCGCTATCAAGGCACC。
SEQ ID NO.7：AATTCCCGTCGCTATCAAGACATC。
SEQ ID NO.8：TTCCCGTCGCTATCAAGGAATCT。
SEQ ID NO.9：GTCGCTATCAAGGAACAGAA。
SEQ ID NO.10：CGTCGCTATCAAGGAATCGA。
SEQ ID NO.11：TCGCTATCAAGGAACATACA。
SEQ ID NO.12：TTCCCGTCGCTATCATGGTT。
SEQ ID NO.13：GTTAAAATTCCCGTCGCTATCAAAATT。
SEQ ID NO.14：TCGCTATCAAGGAACTGAA。
SEQ ID NO.15：TCGCTATCAAGGAACAACAGAA。
SEQ ID NO.16：TCCCGTCGCTATCAAGGAGC。
SEQ ID NO.17：TTCCCGTCGCTATCAAGGTCT。
SEQ ID NO.18：CGTCGCTATCGCAACATCTCC。
SEQ ID NO.19：TCGCTATCAAGGAAGCAACA。
SEQ ID NO.20：TGGGCCTGAGGTTCAGAGC。
SEQ ID NO.21：GATGGCCAGCGTGACC。
SEQ ID NO.22：GACAACCCCCACCACGT。
SEQ ID NO.23：GCCAGCGTGGACATTG。
SEQ ID NO.24：GGCCAGCGTGGTCGG。
SEQ ID NO.25：GATGAGCTGCACGGTGGA。
SEQ ID NO.26：GCCGAACGCACCGGATG。
SEQ ID NO.27：CCGAACGCACCGGAGAA。
SEQ ID NO.28：CCGAACGCACCGGAGAT。
SEQ ID NO.29：TGTGGAGCCTCTTACACCCAG。
SEQ ID NO.30：CCAGGAACGTACTGGTGAAAAC。
SEQ ID NO.31：TTCTTTCTCTTCCGCACCCACCA。
SEQ ID NO.32：GAAGCCTACGTGATGGCCCT。
SEQ ID NO.33：GCTGCGTGATGAGCTGCA。
SEQ ID NO.34：AGCTCATCATGCAGCTCAT。
SEQ ID NO.35：AGCTCATCACGCAGCTCAT。
SEQ ID NO.36：AGTTTGGCCcGCCCAA。
SEQ ID NO.37：AGCCAACAAGGAAATCCTC。
SEQ ID NO.38：CTCCACCGTGCAGCTCATC。
SEQ ID NO.39：CTCCCAACCAAGCTCTCTTG。
SEQ ID NO.40：TGGCCAAACTGCTGGGTG。
SEQ ID NO.41：CATCTGCCTCACCTCCAC。
SEQ ID NO.42：CGCACCCAGCTGTTTGGCC。
SEQ ID NO.43：TGGCCAAACTGCTGGGTG。
Preferably, the fluorescent probe comprises a fluorescent group at the 5 'end and a quenching group at the 3' end.
Preferably, the fluorophore comprises any one or a combination of at least two of FAM, VIC, CY5 or ROX.
Preferably, the quenching group comprises any one or a combination of at least two of BHQ1, BHQ2 or MGB.
In a second aspect, the invention provides the primer for detecting EGFR mutant gene and the application of the fluorescent probe in preparation of products for detecting EGFR mutant gene.
In a third aspect, the invention provides a kit for detecting EGFR mutant genes, which comprises the primer for detecting EGFR mutant genes and a fluorescent probe according to the first aspect.
In a fourth aspect, the invention provides the primer for detecting EGFR mutant gene and the application of the fluorescent probe in EGFR mutant gene detection.
In a fifth aspect, the present invention provides a method for detecting an EGFR mutant gene, the method comprising:
extracting cfDNA from a sample to be detected as a template, performing multiple-droplet digital PCR amplification by using the primer for detecting EGFR mutant genes and the fluorescent probe according to the first aspect, and judging according to a fluorescent PCR amplification result.
The free DNA (cfDNA) can replace tissues or be used as a supplement for tissue detection, so that the problem that a conventional specimen for detecting EGFR gene mutation is a pathological tissue or cytological specimen is solved, but tissue material has traumatic defects, is not affected by the size and the position of a tumor, and is convenient to sample.
cfDNA detection of EGFR gene mutations still presents some challenges: (1) The plasma cfDNA content varies from person to person and most people are low; (2) cfDNA fragments are short, at most about 180 bp; (3) The cfDNA content of the cfDNA from tumor cells is mostly below 1%, even only one ten thousandth of the total cfDNA can be occupied, so the sensitivity and specificity requirements on the detection technology are high. The invention adopts a digital PCR detection method, designs a specific primer probe, controls the maximum sample loading amount, realizes the cfDNA sample dosage as low as 10 ng per hole, solves the problem of small clinical cfDNA sample amount, and can detect 41 base mutation forms by 3 tubes and accurately quantify.
Preferably, the criterion for the judgment is:
tube 1:
tube 1 reference copy number = T790M mutant copy number + T790M wild copy number.
The T790M mutation frequency was calculated by: T790M mutation frequency = T790M mutation copy number/(tube 1 reference copy number).
The L858R mutation frequency was calculated as: L858R mutation frequency = L858R mutation copy number/(tube 1 reference copy number).
The 19del mutation frequency was calculated as: 19del mutation frequency = 19del mutation copy number/(tube 1 internal reference copy number).
Tube 2:
reference copy number = ROX channel wild-type copy number in tube 2.
The mutation frequency of 20ins was calculated in the following manner: 20ins mutation frequency = 20ins mutation copy number/(tube 2 reference copy number).
The G719X mutation frequency was calculated as: G719X mutation frequency = G719X mutation copy number/(tube 2 internal reference copy number).
Tube 3:
tube 3 internal reference copy number = L861Q mutant copy number + L861Q wild copy number.
The L861Q mutation frequency was calculated by: L861Q mutation frequency = L861Q mutation copy number/(tube 3 internal reference copy number).
The calculation mode of the S768I mutation frequency is as follows: S768I mutation frequency = S768I mutation copy number/(tube 3 internal reference copy number).
It can be understood that the mutation frequency can be calculated by using an instrument detection value or a copy number in the invention, and the copy number can be calculated by the following way: copy number = instrument measurement (copy/μl) x generated droplet volume (nL, read in instrument) x effective droplet number (read in instrument measurement)/1000.
Preferably, the method of multiplex droplet digital PCR amplification comprises:
(1) The reaction system is configured and split charging is carried out in 8 rows;
(2) Template input;
(3) Vibrating, mixing uniformly and detecting on the machine;
(4) A detection program is set.
Preferably, the reaction system in step (1) comprises 3X-5X PCR buffer, dNTPs and Taq DNA polymerase.
Specific point values among 3× to 5× can be selected from 3×, 4×, and 5×. Preferably, the concentration of dNTPs is 50 nM-200 nM, and the concentration of Taq DNA polymerase is 0.1U-5U.
Specific point values in the above 50 nM-200 nM may be selected from 50 nM, 51 nM, 52 nM, 53 nM, 60 nM, 70 nM, 80 nM, 100 nM, 150 nM, 160 nM, 170 nM, 190 nM, 195nM, 196 nM, 197 nM, 198 nM, 199 nM, 200 nM.
Specific point values in the above 0.1U-5U may be selected from 0.1U, 0.2U, 0.3U, 0.4U, 0.5U, 1U, 2U, 3U, 4U, 4.5U, 4.6U, 4.7U, 4.8U, 4.9U, 5U.
Preferably, the template loading in step (2) is from 20 to 300 ng.
Specific point values in the above 20-300 ng may be selected from 20 ng, 21 ng, 22 ng, 23 ng, 30 ng, 40 ng, 50 ng, 60 ng, 80 ng, 90 ng, 100 ng, 120 ng, 180 ng, 200 ng, 240 ng, 260 ng, 280 ng, 290 ng, 295 ng, 296 ng, 298 ng, 299 ng, 300 ng.
Preferably, the detection procedure in step (4) includes: UDG contamination, droplet tiling, enzyme activation, denaturation, annealing, and extension.
The temperature of the UDG pollution prevention is 20-30 ℃, the time is 5-10 min, and the cycle number is 1-3 cycles.
The specific values of the above 20-30deg.C can be 20 deg.C, 21 deg.C, 22 deg.C, 23 deg.C, 24 deg.C, 25 deg.C, 26 deg.C, 27 deg.C, 28 deg.C, 29 deg.C, 30 deg.C, etc.
The specific point value of the above 5-10 min can be selected from 5 min, 5.5 min, 6 min, 7 min, 8 min, 9 min, 9.5 min, 10 min, etc.
The specific point value in the 1-3 loops can be 1 loop, 2 loops and 3 loops.
The invention is provided with an anti-pollution system, which can pollute and degrade potential products and can effectively prevent products such as aerosol and the like from being polluted. The invention increases the annealing extension temperature of the program to 63 ℃, can effectively reduce the generation of non-specific products or reduce the height of the signal value of the wild type gDNA template amplified by the mutant probe, as shown in figures 1-3.
When a mutation frequency detection system is developed, false positive results can be caused by too high sample loading quantity of two wild types, or positive points can be formed in a single positive region or a double positive region for a negative sample which is normally loaded.
Preferably, the EGFR mutation comprises any one or a combination of at least two of an EGFR exon 19 deletion mutation, an exon 21 point mutation, an exon 18 point mutation, or an exon 20 insertion mutation.
Preferably, the site of EGFR mutation comprises any one or a combination of at least two of T790M, L858R, 19del, 20ins, G719X, L861Q or S768I.
Preferably, the system for multiplex droplet digital PCR amplification further comprises a blocker sequence.
The blocking primer is used for blocking the sample joint sequence, avoiding the non-specific combination of the probe and the joint and ensuring the specific combination of the probe and the target fragment.
Preferably, the blocker sequence contains a 19del gene mutation site.
Preferably, the blocker sequence comprises SEQ ID 44.
Preferably, the blocker sequence further comprises the reverse complement of SEQ ID 44.
SEQ ID NO.44：AGAAAGTTAAAATTCCCGTCGCTATC。
Preferably, the sample to be tested comprises plasma.
Compared with the prior art, the invention has the following beneficial effects:
(1) The invention can detect the deletion mutation of the exon 19, the point mutation of the exon 21, the point mutation of the exon 18 and the insertion mutation of the exon 20 of EGFR simultaneously, and can detect EGFR mutation in 41 base mutation forms in total by 3 tubes;
(2) The T790M, L858R and 28 19del mutation types can be detected simultaneously in a single tube, and the accuracy is 100%;
(3) The L861Q mutation type and the S768I mutation type can be detected simultaneously in a single tube, and the accuracy is 100%;
(4) The invention combines ARMS, blocking primer and Taqman probe method to detect 28 19del mutation types accurately by 100% single tube;
(5) The invention combines the ARMS and Taqman probe method, and can detect 3G 719X mutation types and 6 20ins mutation types simultaneously and 100% accurately;
(6) The detection results of the 3 tubes of the invention are all independent, and any tube can be selected for experiment, result analysis and report generation according to clinical requirements;
(7) According to the invention, the sample solution is subjected to microdroplet treatment, so that background interference is reduced, the copy number can be directly interpreted according to the fluorescent type and the number result of fluorescent microdroplets, the operation is simplified, the detection cost is reduced, the sensitivity of the previous detection technical method is generally between 1 and 50%, and the sensitivity of the experimental method can reach 0.1%, so that the method is used for detecting the absolute quantity and proportion of EGFR gene wild type and mutant type in a sample;
(8) The cfDNA sample dosage is as low as 10 ng per hole, so that the problem of small clinical cfDNA sample dosage is solved;
(9) The invention does not need to set standard substances or quality control substances, can achieve absolute quantification in a true sense, detects the template quantity as low as 1 copy number, and overcomes the defect that q-PCR does not have accurate quantification;
(10) The invention uses digital PCR technology to detect EGFR gene mutation, provides a method for noninvasively, rapidly and quantitatively and dynamically detecting EGFR gene mutation condition of non-small cell lung cancer patients, can detect mutation rate change of EGFR gene mutation, and has important guiding significance for treatment and prognosis of non-small cell lung cancer.
Drawings
FIG. 1 is a graph of amplification 1D of a target gene at an annealing extension temperature of 56 ℃;
FIG. 2 is a 1D map of target gene amplification at an annealing extension temperature of 58 ℃;
FIG. 3 is a 1D map of target gene amplification at an annealing extension temperature of 63 ℃;
FIG. 4 is a graph of the detection results of combination 1 (left to right of the detection sample: NTC, wild-type gDNA, H1975);
FIG. 5 is a graph of the results of the combination 2 (left to right of the test sample: NTC, wild-type gDNA, H1975);
FIG. 6 is a graph of the results of the combination 3 (left to right of the test sample: NTC, wild-type gDNA, H1975);
FIG. 7 combines 4 graphs of the detection results (left to right of the detection sample: NTC, wild-type gDNA, H1975);
FIG. 8a is a graph of the results of the maximum tolerability assays for wild type in tubes 1-19 del;
FIG. 8b is a graph of the results of tube 1-T790M wild-type maximum tolerability assays;
FIG. 8c is a graph of the results of the wild-type maximum tolerability assays for tubes 1-L858R;
FIG. 9a is a graph showing the results of the wild-type maximum tolerance test for tube 2-20 ins;
FIG. 9b is a graph showing the results of the wild-type maximum tolerability assay for tube 2-G719X;
FIG. 10a is a graph showing the results of the wild-type maximum tolerability assay for tube 3-L861Q;
FIG. 10b is a graph of the results of wild-type maximum tolerability assays for tubes 3-S768I;
FIG. 11 is a graph showing the results of the T790M accuracy test of the H1975 cell line;
FIG. 12 is a graph showing the results of the H1975 cell line L858R accuracy test;
FIG. 13 is a graph showing the results of 19del accuracy testing of H1650 cell lines;
FIG. 14 is a graph showing the results of 20ins accuracy testing of a 20ins cell line;
FIG. 15 is a graph of the results of the S768I cell line S768I accuracy test;
FIG. 16 is a graph of a 19del linear analysis;
FIG. 17 is a T790M linear analysis plot;
FIG. 18 is a graph of L858R linear analysis;
FIG. 19 is a 20ins linear analysis chart;
FIG. 20 is a graph of a G719X linear analysis;
FIG. 21 is a graph of S768I linear analysis;
FIG. 22 is a graph of L861Q linear analysis;
FIG. 23a is a graph showing the results of the detection of mutation frequency of 0.1% in tubes 1-19 del;
FIG. 23b is a graph showing the results of the detection of mutation frequency of 0.1% in tube 1-T790M;
FIG. 23c is a graph showing the results of the detection of mutation frequency at 0.1% for tubes 1-L858R;
FIG. 23d is a graph showing the results of the detection of 0.1% mutation frequency for the 1-tube internal control;
FIG. 24a is a graph showing the results of the detection of mutation frequency of 0.1% in tubes 2-20 ins;
FIG. 24b is a graph showing the results of the detection of 0.1% mutation frequency in tube 2-G719X;
FIG. 24c is a graph showing the results of detection of 0.1% mutation frequency for 2-internal control of the tube;
FIG. 25a is a graph showing the results of detection of mutation frequency of tube 3-L861Q 0.1%;
FIG. 25b is a graph showing the results of detection of mutation frequency of 0.1% in tube 3-S768I;
FIG. 25c is a graph showing the results of detection of mutation frequency of 0.1% in 3-internal control of the tube.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
Example 1
Primers and probes were designed.
(1) In this example, primer design screening was performed to simultaneously detect exon 19 deletion mutation, exon 21 point mutation, exon 18 point mutation and exon 20 insertion mutation of EGFR, and the detection sites of EGFR gene mutation are shown in Table 1.
TABLE 1
(2) EGFR mutation grouping of 41 base mutant forms
By analyzing the sequences of 41 base mutant forms, the factors such as sensitive mutation, drug-resistant mutation and mutation frequency are considered to divide the sequences into 3 groups:
1) Combination 1 (tube 1) -T790M, L858R, 19del;
2) Combination 2 (tube 2) -20ins, G719X;
3) Combination 3 (tube 3) -L861Q, S768I;
(3) Primer probe design and performance test
Aiming at base mutation types with different forms, the invention adopts a mode of combining different detection methods to design a primer probe. Wherein, T790M, L858R, L861Q, S768I only contains one single base mutation, and adopts the common Taqman method; aiming at polymorphic base mutation, G719X contains 3 species and 20ins contains 6 species, and the invention adopts the combination of an ARMS method and a Taqman method for primer probe design; for 19del mutation, the ARMS method and Taqman method are combined and a Blocker probe method is added at the same time. When the system is built, firstly confirming that the performance of the single system is optimal, and then building a multiple system, specifically: firstly, respectively carrying out a single-weight system test on each pair of primer probes by taking a plasmid as a template, if the performance is poor, optimizing the sequence, the adding concentration and the adding proportion of the primer probes, confirming that the amplification performance is optimal and meets the requirement, and screening out primer probe combinations with better performance in the single-weight system; according to the preset 3 groups of mutation type combinations, mixing single primer probes into 3 groups of multiple primer probe mixtures (Mix), and performing multiple system tests by taking T790M or L858R or L861Q or S768I or G719X or 20ins or 19del mutant plasmids as templates. If the performance is poor, the sequence, the addition concentration and the addition proportion of the primer probe are optimized, and the optimal amplification performance is confirmed and the requirement is met. The total primer probes designed and screened by optimizing the primer probe sequence, the adding concentration and the adding proportion are shown in table 2, and the nucleotide sequence and the concentration of the primer probe used in the invention are shown in table 3:
TABLE 2
TABLE 3 Table 3
Example 2
And (5) screening and verifying the primer probes. PCR amplification reagent: the Suzhou Si Nafu medical science and technology Co., ltd., specification/model 100 test/suite.
Primer probe: bioengineering (Shanghai) Co., ltd, size/model 2 OD/tube.
Digital PCR instrument: su-state sinafu medical science, inc, specification/model DQ24.
(1) Preparation of PCR System
Specifically configured as in table 4.
TABLE 4 Table 4
After the preparation is completed, the mixture is vibrated and mixed uniformly, and the machine is started after no bubble in the pipe is confirmed.
(2) PCR amplification upper machine
The upper program is shown in table 5.
TABLE 5
(3) Result derivation and analysis
The digital PCR instrument used in the present invention is DQ24 model from medical science and technology Inc. of Si Nafu, suzhou. The instrument is compatible with four functions of liquid drop segmentation, PCR amplification, signal acquisition and data analysis. And directly exporting the result on an instrument.
Taking T790M primer probe screening as an example, the screening results are as follows:
the mutant primer probe combinations with high screening efficiency and good specificity are shown in Table 6.
TABLE 6
The results show that in the combination 1-3, the differentiation of yin and yang liquid drops is not good, the signal value of the wild gDNA template amplified by the mutant probe is too high, and the negative and positive can not be differentiated; or positive liquid drops are dispersed, and the amplification efficiency is not high enough; the combination 4 yin-yang detection was normal as shown in figures 4-7.
After screening and verification of all mutation type singleplex systems, multiplex system combination is carried out.
Example 3
And (5) testing system performance.
After the multiple system was set up, the system performance was tested and verified using commercial cell lines (H1650, 20ins, G719S (c.2155G > a), S768I, L861Q, purchased from kolbe), positive plasmids (T790M, L858R (c.G > T), L858R (c.gt > TG), C797S (c.2389T > a), C797S (c.2390G > C), L747S (c.2440T > C), purchased from Shanghai strapdown) as follows.
(1) Wild type maximum tolerance test.
When a mutation frequency detection system is developed, false positive results can be caused by too high sample loading of two wild types, or positive points can appear in a single positive area or a double positive area for a negative sample which is normally loaded, and the maximum point number needs to be determined, so that the maximum sample loading of the sample needs to be confirmed.
With wild type gDNA broken by ultrasound as a template, adding 100 ng, 80 ng, 60 ng, 40 ng and 20 ng templates into a single reaction tube respectively, wherein the maximum tolerance results of the wild type gDNA of the tube 1, the tube 2 and the tube 3 are respectively shown in figures 8a, 8b, 8c, 9a, 9b, 10a and 10b, and when the input amount of the wild type template of the tube 3 reaches 100 ng, the number of mutant single-positive regions or fluorescent signals is <1. The wild-type maximum tolerance of each of tubes 1, 2, 3 was determined to be 100 ng.
(2) And (5) testing accuracy.
Sample preparation: first, 26 cases of 19del plasmid (from the family of the Praeparata), 6 cases of 20ins plasmid (from Shanghai Jieli) and 3 cases of G719X plasmid (from Shanghai Jieli) were dissolved in water and then diluted to E6copies/ml in a gradient. And 6 cell lines (H1975 (76-78%), H1650 (del 19 p. E746_A750del) (76-78%), 20ins (p.V769_D770 insASV) (45-50%), p.G 7199S (30%), p.S768I (45-50%), p.L 8615Q (100%), purchased from Kebai) were transferred to 25℃for thawing. The corresponding branch tubes were detected with 35E 6 plasmids and 6 cell lines as templates, and the results were analyzed and summarized. The summarized results are shown in Table 7, the cell line detection results are shown in FIGS. 11-15, the theoretical result is 100% identical to the detection result, and the system accuracy is better.
TABLE 7
(3) Specificity-cross-reaction test.
Commercial cell lines (H1975, H1650, 20ins, G719S (c.2155G > A), S768I, L861Q, purchased from Kebai), positive plasmids (T790M, L858R (c.G > T), L858R (c.GT > TG), purchased from Shanghai Jieli), EGFR gene other mutation site plasmids (C797S (c.2389T > A), C797S (c.2390G > C), L747S (c.2440T > C), purchased from Shanghai Jieli) were used as templates, and tube 1, tube 2 and tube 3 were tested without cross positive detection, with better specificity.
(4) And (5) linear analysis.
Commercial cell lines (H1975, H1650, 20ins, G719S (c.2155G > A), S768I, L861Q, purchased from Kebai) were diluted with ultrasound-disrupted wild-type gDNA as dilution to prepare 10%, 5%, 1%, 0.2%, 0.1% mutation frequency samples, where combination 1 was the H1650 cell line, combination 2 was the 20ins and G719S cell lines, combination 3 was the S768I and L861Q cell lines, and samples of different invariant frequencies were examined and the detection values were analyzed linearly, where the linear correlation R of T790M, L858R, 19del in tube 1 2 0.9997, 0.9999, 0.9997, respectively; linear correlation R of 20INS, G719X in tube 2 2 0.9985, 0.9996 respectively; linear correlation R of S768I, L861Q in tube 3 2 0.9959 and 0.9997, respectively, each site is R 2 >0.99, the linear relationship holds.
Linear analysis of tubes 1, 2, 3
First, the ultrasound-disrupted wild-type gDNA, H1975, H1650, 20ins, G719S (c.2155G > A), S768I, L861Q cell lines were quantified for the first time and the concentrations were determined. Then, the wild-type gDNA disrupted by sonication was used as a diluent, and H1975, H1650, 20ins, G719S (c.2155G > A), S768I, L861Q cell lines were diluted to prepare 10%, 5%, 1%, 0.2%, 0.1% mutation frequency samples, and the above samples were examined 3 times, and 4 times, respectively, and the results of the examination were subjected to linear analysis, and the results are shown in FIGS. 16 to 22.
(5) Minimum detection limit verification
Tube 1, with ultrasound-disrupted wild-type gDNA as diluent, was diluted with H1975 and H1650 cell lines (from Kebai) to prepare samples with a mutation frequency of 0.1% and then the samples were repeatedly examined 20 times, and the results are shown in FIGS. 23a, 23b, 23c, 23d, with a detection rate of 100% and no less than 95%, indicating that the minimum detection limit of tube 1in the system was 0.1%.
Tube 2, with ultrasound-disrupted wild-type gDNA as diluent, was diluted with a 20ins cell line and a G719X cell line to prepare a 0.1% mutation frequency sample, which was then repeatedly tested 20 times, and the results are shown in FIGS. 24a, 24b, 24c, with a detection rate of 100% or more than 95%, indicating that the minimum detection limit of tube 2in the system was 0.1% mutation rate.
Tube 3, with ultrasound-disrupted wild-type gDNA as diluent, was diluted with L861Q cell line and S768I cell line to prepare 0.1% mutation frequency samples, which were then repeatedly tested 20 times, with the results shown in fig. 25a, 25b, 25c, and the detection rates of 100%, both being greater than or equal to 95%, indicating that the minimum detection limit of tube 3 in the system was 0.1% mutation rate.
(6) Precision testing
Samples of 3 groups of 0.2% mutation frequencies were each tested 20 times and then analyzed for a test value CV, wherein the CV of T790M, L858R, 19del in tube 1 was 4.91%, 3.07%, 0.72%, respectively; CV of 20INS and G719X in tube 2 was 2.85% and 3.65% respectively; the CV of S768I, L861Q in the tube 3 is 2.8% and 0.9%, respectively, and the CV of each site is less than 5%, so that the precision is good.
In conclusion, the invention creatively designs the primer and the fluorescent probe for detecting EGFR mutant genes, can specifically and simultaneously detect the exon 19 deletion mutation, the exon 21 point mutation, the exon 18 point mutation and the exon 20 insertion mutation of EGFR, can detect EGFR mutation in 41 base mutation forms, and has high sensitivity and accuracy and easy operation.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims (10)

1. A primer and a fluorescent probe for detecting EGFR mutant genes, which are characterized in that the nucleic acid sequence of the primer comprises any one or a combination of at least two of sequences shown as SEQ ID NO.1-SEQ ID NO. 33; the nucleic acid sequence of the fluorescent probe comprises any one or a combination of at least two of sequences shown as SEQ ID NO.34-SEQ ID NO. 43;
the primer is used for multiplex droplet digital PCR amplification; the sensitivity of the amplification result was 0.1%;
the base mutant forms of the EGFR mutant gene include: c.2369c > T, c.2238_2252del15, c.2239_2253del15, c.2240_2254del15, c.2240_2251del12, c.2238_2252del gca, c.2238_2248del gc, c.2239_2247del9, c.2239_2256del18, c.2240_2257del18, c.2237_2251del15, c.2237_2255> T, c.2237_2253> ttgct, c.2237_2257> tct, c.2237_2254del18, c.2238_2255del18, c.2237_2252T, c.2235_2248del attc, c.2235_1 del, c.2235_2 at any one or a combination of at least two of c.2235_2255 delainsaat, c.2235_2249del15, c.2236_2250del15, c.2236_2253del18, c.2233_2247del15, c.2239_2251> C, c.2239_2256 delainscaa, c.2239_2248 delainsc, c.2239_2258 delainsca, c.2307_2308ins9GCCAGCGTG, c.2311_2312ins9GCGTGGACA, c.2309_2310ac > ccagcgtggat, c.2310_2311insGGT, c.2319_2320insCAC, c.2319_2320 inscccac, c.2156g > C, c.2155g > a, c.2582T > a or c.2303g > T.
2. The use of the primer for detecting EGFR mutant gene as defined in claim 1, and a fluorescent probe for preparing a product for detecting EGFR mutant gene.
3. A kit for detecting an EGFR mutant gene, comprising the primer for detecting an EGFR mutant gene according to claim 1 and a fluorescent probe.
4. The primer for detecting EGFR mutant gene as defined in claim 1, and the use of the fluorescent probe for detecting EGFR mutant gene.
5. A method of detecting an EGFR mutant gene, comprising:
extracting cfDNA from a sample to be detected as a template, performing multiple-droplet digital PCR amplification by using the primer for detecting EGFR mutant genes and the fluorescent probe according to claim 1, and judging according to a fluorescent PCR amplification result.
6. The method of claim 5, wherein the method of multiplex droplet digital PCR amplification comprises:
(1) The reaction system is configured and split charging is carried out in 8 rows;
(2) Template input;
(3) Vibrating, mixing uniformly and detecting on the machine;
(4) Setting a detection program;
the reaction system in the step (1) comprises a PCR buffer solution, dNTPs and Taq DNA polymerase;
the PCR buffer solution is 3X-5X PCR buffer solution, the concentration of dNTPs is 50 nM-200 nM, and the concentration of Taq DNA polymerase is 0.1U-5U;
the template loading in the step (2) is 20 ng-300 ng.
7. The method of claim 5, wherein the site of EGFR mutation comprises any one or a combination of at least two of T790M, L858R, 19del, 20ins, G719X, L861Q, or S768I.
8. The method of claim 5, wherein the system for multiplex droplet digital PCR amplification further comprises a blocker sequence.
9. The method of claim 8 wherein the blocker sequence contains a 19del gene mutation site.
10. The method of claim 8 wherein the blocker sequence comprises SEQ ID No.44.
CN202311000903.5A 2023-08-10 2023-08-10 Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe Pending CN116751867A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311000903.5A CN116751867A (en) 2023-08-10 2023-08-10 Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311000903.5A CN116751867A (en) 2023-08-10 2023-08-10 Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe

Publications (1)

Publication Number Publication Date
CN116751867A true CN116751867A (en) 2023-09-15

Family

ID=87951635

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311000903.5A Pending CN116751867A (en) 2023-08-10 2023-08-10 Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe

Country Status (1)

Country Link
CN (1) CN116751867A (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105349654A (en) * 2015-11-23 2016-02-24 厦门艾德生物医药科技股份有限公司 Probes, primers, detection system and kit for detecting mutations of EGFR gene
CN105624309A (en) * 2016-02-23 2016-06-01 深圳华大基因研究院 Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation
CN106520931A (en) * 2016-10-17 2017-03-22 上海赛安生物医药科技有限公司 EGFR gene mutation detection primer probe and kit thereof
CN107723213A (en) * 2017-11-28 2018-02-23 北京爱普拜生物技术有限公司 A kind of Human epidermal growth factor receptor gene quadruple multisite mutation detection kit and method
CN108949990A (en) * 2018-08-08 2018-12-07 中山大学达安基因股份有限公司 A kind of kit and method detecting EGFR genetic mutation
CN110923325A (en) * 2019-12-30 2020-03-27 阅尔基因技术（苏州）有限公司 Primer Blocker group, kit and method for detecting EGFR gene mutation
CN111363810A (en) * 2018-12-25 2020-07-03 河南爱微迪生物技术有限公司 Detection agent composition and kit for detecting multiple mutation sites of EGFR (epidermal growth factor receptor) gene
CN113930501A (en) * 2020-07-13 2022-01-14 铭炽生物科技(上海)有限公司 Digital PCR detection method for human EGFR gene mutation and application

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105349654A (en) * 2015-11-23 2016-02-24 厦门艾德生物医药科技股份有限公司 Probes, primers, detection system and kit for detecting mutations of EGFR gene
CN105624309A (en) * 2016-02-23 2016-06-01 深圳华大基因研究院 Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation
CN106520931A (en) * 2016-10-17 2017-03-22 上海赛安生物医药科技有限公司 EGFR gene mutation detection primer probe and kit thereof
CN107723213A (en) * 2017-11-28 2018-02-23 北京爱普拜生物技术有限公司 A kind of Human epidermal growth factor receptor gene quadruple multisite mutation detection kit and method
CN108949990A (en) * 2018-08-08 2018-12-07 中山大学达安基因股份有限公司 A kind of kit and method detecting EGFR genetic mutation
CN111363810A (en) * 2018-12-25 2020-07-03 河南爱微迪生物技术有限公司 Detection agent composition and kit for detecting multiple mutation sites of EGFR (epidermal growth factor receptor) gene
CN110923325A (en) * 2019-12-30 2020-03-27 阅尔基因技术（苏州）有限公司 Primer Blocker group, kit and method for detecting EGFR gene mutation
CN113930501A (en) * 2020-07-13 2022-01-14 铭炽生物科技(上海)有限公司 Digital PCR detection method for human EGFR gene mutation and application

Similar Documents

Publication Publication Date Title
CN106520931B (en) EGFR genetic mutation detection primer probe and its kit
CN110241215B (en) Primer and kit for detecting benign and malignant genetic variation of thyroid nodule
CN112048560B (en) Kit for analyzing HER2 gene copy number variation by combining multiple internal references with sequential probability ratio test and use method
CN111235272A (en) Composition for one-time detection of lung cancer multiple gene mutation and application thereof
CN109182529B (en) Specific probe and kit for detecting T790M, C797S and L798I sites of EGFR gene
CN111748628B (en) Primer and kit for detecting thyroid cancer prognosis related gene variation
CN108531598B (en) ROS1 gene fusion detection primer, method and kit
CN111850117A (en) Primer, probe, kit and device for detecting mutation of human TERT promoter
CN116751867A (en) Primer and fluorescent probe for detecting EGFR mutant gene and application of primer and fluorescent probe
CN113718020A (en) Primer-probe combination and kit for detecting internal tandem repeat mutation of human leukemia FLT3 gene and application of primer-probe combination and kit
CN112899365A (en) Detection method and kit for lung cancer gene mutation site
CN111206117A (en) Kit for detecting human immunodeficiency virus
CN109811041A (en) A kind of specific primer detecting the site PIK3CA gene H1047R is to, probe and kit
CN110616261A (en) Kit and method for detecting EGFR gene T790M mutation
CN114908086B (en) Primer probe composition, kit and detection method for detecting EGFR 19del based on digital PCR
CN116024360B (en) Primer combination for mycobacterium tuberculosis complex identification and drug-resistant gene mutation detection and application thereof
CN113502332B (en) Primer, probe and kit for detecting FLT3 gene mutation
CN116590293A (en) crRNA combination for detecting EB virus based on micro-droplet digital analysis and application thereof
CN110343746B (en) Fixed value method for correcting EGFR gene mutation frequency
CN108330171A (en) Detect kit, the method and its application of the 19th exon deletion mutation of EGFR gene
CN111206099A (en) Kit for detecting L858R site mutation of EGFR gene
CN118006744A (en) DdPCR method and kit for quantitatively detecting TP53 gene copy number variation
CN113493837A (en) Detection kit for cis-trans mutations of EGFR genes T790M and C797S
CN115961032A (en) Detection probe, detection kit and mutation quality control product for bladder cancer related mutant gene
CN115786507A (en) Method for detecting BCR-ABL rare mutation typing, primers and probes thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20231225

Address after: Unit 101-1, Building 27, No. 218 Sangtian Street, Industrial Park, Suzhou City, Jiangsu Province, 215000

Applicant after: Sinafo (Suzhou) Life Technology Co.,Ltd.

Applicant after: Sinaford (Beijing) Medical Technology Co.,Ltd.

Applicant after: Suzhou sinafu Medical Technology Co.,Ltd.

Address before: Unit 101-1, Building 27, No. 218 Sangtian Street, Industrial Park, Suzhou City, Jiangsu Province, 215000

Applicant before: Sinafo (Suzhou) Life Technology Co.,Ltd.

Applicant before: Sinaford (Beijing) Medical Technology Co.,Ltd.