CN116751292A - Porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof - Google Patents

Porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof Download PDF

Info

Publication number
CN116751292A
CN116751292A CN202310950240.7A CN202310950240A CN116751292A CN 116751292 A CN116751292 A CN 116751292A CN 202310950240 A CN202310950240 A CN 202310950240A CN 116751292 A CN116751292 A CN 116751292A
Authority
CN
China
Prior art keywords
antibody
chain variable
variable region
amino acid
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310950240.7A
Other languages
Chinese (zh)
Other versions
CN116751292B (en
Inventor
曹明亚
李霞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan University
Original Assignee
Henan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan University filed Critical Henan University
Priority to CN202310950240.7A priority Critical patent/CN116751292B/en
Publication of CN116751292A publication Critical patent/CN116751292A/en
Application granted granted Critical
Publication of CN116751292B publication Critical patent/CN116751292B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567—Framework region [FR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/91—Cell lines ; Processes using cell lines
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/10—Detection of antigens from microorganism in sample from host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof. The present invention provides 3 hybridoma cells designated as 2D9B9, 2F5F8, 3B2F7, and the hybridoma cells secrete 3 types of Mfa1 monoclonal antibodies, the Mfa monoclonal antibodies comprising three CDR heavy chain variable regions and three CDR light chain variable regions. The invention also discloses a nucleic acid molecule, a vector, a host cell and application of the antibody. Experimental study shows that the Mfa1 monoclonal antibody can obviously inhibit the adhesion of P.gingivalis, reduce alveolar bone absorption and relieve periodontitis; mfa1 monoclonal antibody provides more medication choices for patients infected by P.gingivalis, and has wide application prospect.

Description

Porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof
Technical Field
The invention belongs to the fields of cell biotechnology and immunology, and relates to a porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof.
Background
Porphyromonas gingivalis (Porphyromonas gingivalis, P.gingivalis) is prevalent in the root canal of the oral cavity of periodontal disease patients and plays a role in various stages of disease initiation and progression. The fungus is adhered to host cells through structures such as pili, capsules and the like on the surface of the fungus body. The lipopolysaccharide, gingival protease, indole, organic acid and other virulence factors secreted by the thallus can promote the release of inflammatory cytokines, chemotactic factors and mediators, trigger host immune response and pro-inflammatory response, and cause the pathogenesis of periodontal disease. In the later stages of the disease, p.gingivalis can lead to loss of tooth support structure, severely affecting oral health.
Pilin on the surface of p.gingivalis is believed to be intimately involved in the development and progression of periodontal disease. Many studies have shown that Porphyromonas gingivalis pili have strong immunological and biological activities. The model strain of Porphyromonas gingivalis ATCC33277 has two different types of pili, fimA and Mfa1. Wherein Mfa is a short wire tightly combined with the surface of the bacterial body, and the length is 80-120 nm. Mainly composed of the corresponding protein polymers and promote binding to host cells, matrix proteins and other bacteria. P. gingivalis can specifically bind to SspB protein on early colonized streptococcus gordonii by Mfa1, followed by recruitment of free p.gingivalis to accumulate to form heterotypic biofilm microcolonies, forming dental plaque. Meanwhile, mfa pili can stimulate mouse peritoneal macrophages to produce inflammatory cytokines such as IL-1 alpha, IL-1 beta, TNF alpha, IL-6 and the like. Furthermore, studies have shown that Mfa1 is capable of inducing the expression of oral epithelial cells, macrophages and human bronchial epithelial inflammatory factors. Continued cytokine production can deregulate the immune regulation mechanism, exacerbating the inflammatory response. Thus, finding a drug against Mfa that reduces p.gingivalis colonization and invasion in the oral cavity is critical in treating diseases associated with p.gingivalis infection.
Monoclonal antibodies are antibodies raised against a single epitope by a single B cell, and have the advantages of high sensitivity, high specificity, low cross-reactivity, low production cost, and the like. Toxins and bacterial surface components are good targets for antibacterial antibodies, which have been successful against staphylococcus aureus, streptococcus pyogenes, clostridium and escherichia coli toxins over the last few years. The antibacterial antibody can effectively solve the defects of non-specificity, easy drug resistance and the like caused by antibiotic treatment while targeting treatment of diseases. Pilin is a key protein molecule for bacterial microorganism colonization, and the antibacterial antibody aiming at P.gingivalis pilin can effectively reduce the colonization of P.gingivalis in a host body, inhibit the growth of Porphyromonas gingivalis and reduce the incidence and severity of diseases related to P.gingivalis infection. However, there is a lack of antibody drugs against Mfa1 protein in the market. Thus, the study of antibody drugs against Mfa1 is of great importance for achieving detection and treatment of diseases associated with p.gingivalis infection.
Disclosure of Invention
In order to make up for the defects of the prior art, the invention aims to provide a porphyromonas gingivalis Mfa1 monoclonal antibody and application thereof.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
the first aspect of the present invention provides a monoclonal antibody against Mfa1, said monoclonal antibody comprising any one of the following antibodies: 2D9B9 antibody, 2F5F8 antibody, 3B2F7 antibody.
Further, the heavy chain variable region of the 2D9B9 antibody comprises VH-CDR1, VH-CDR2 and VH-CDR3 of the amino acid sequences shown in SEQ ID NO.1, 2 and 3; the light chain variable region of the 2D9B9 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID NO.9, 10 and 11.
Further, the heavy chain variable region of the 2D9B9 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 2D9B9 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.4, 5, 6 and 7, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.12, 13, 14 and 15.
Further, the heavy chain variable region of the 2D9B9 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 8; the light chain variable region of the 2D9B9 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 16.
Further, the amino acid sequence of the heavy chain variable region of the 2D9B9 antibody is shown as SEQ ID NO. 8; the amino acid sequence of the light chain variable region of the 2D9B9 antibody is shown as SEQ ID NO. 16.
Further, the heavy chain variable region of the 2F5F8 antibody comprises VH-CDR1, VH-CDR2 and VH-CDR3 of the amino acid sequences shown in SEQ ID NO.17, 18 and 19; the light chain variable region of the 2F5F8 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID No.25, 26 and 27.
Further, the heavy chain variable region of the 2F5F8 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 2F5F8 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.20, 21, 22 and 23, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.28, 29, 30 and 31.
Further, the heavy chain variable region of the 2F5F8 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 24; the light chain variable region of the 2F5F8 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 32.
Further, the amino acid sequence of the heavy chain variable region of the 2F5F8 antibody is shown as SEQ ID NO. 24; the amino acid sequence of the light chain variable region of the 2F5F8 antibody is shown as SEQ ID NO. 32.
Further, the heavy chain variable region of the 3B2F7 antibody comprises VH-CDR1, VH-CDR2 and VH-CDR3 of the amino acid sequences shown in SEQ ID NO.33, 34 and 35; the light chain variable region of the 3B2F7 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID No.41, 42 and 43.
Further, the heavy chain variable region of the 3B2F7 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 3B2F7 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.36, 37, 38 and 39, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.44, 45, 46 and 47.
Further, the heavy chain variable region of the 3B2F7 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 40; the light chain variable region of the 3B2F7 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 48.
Further, the amino acid sequence of the heavy chain variable region of the 3B2F7 antibody is shown as SEQ ID NO. 40; the amino acid sequence of the light chain variable region of the 3B2F7 antibody is shown as SEQ ID NO. 48.
Further, the heavy chain subtype of the 2D9B 9-containing antibody is IgG2B.
Further, the heavy chain subtype of the 2F5F8, 3B2F7 comprising antibodies is IgG1.
In a second aspect, the invention provides a hybridoma cell capable of secreting a monoclonal antibody according to the first aspect of the invention.
Further, the hybridoma cells comprise any one of the following: 2D9B9, 2F5F8, 3B2F7.
In a third aspect, the invention provides a nucleic acid molecule encoding a monoclonal antibody according to the first aspect of the invention.
In a fourth aspect, the invention provides a vector comprising a nucleic acid molecule according to the third aspect of the invention.
In a fifth aspect the invention provides a host cell comprising a nucleic acid molecule according to the third aspect of the invention or a vector according to the fourth aspect of the invention.
In a sixth aspect, the invention provides a drug conjugate comprising a monoclonal antibody according to the first aspect of the invention.
Further, the drug conjugate further comprises a coupling moiety selected from the group consisting of: a detectable label, drug, toxin, cytokine or enzyme.
The seventh aspect of the invention provides a pharmaceutical composition comprising a monoclonal antibody according to the first aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, a host cell according to the fifth aspect of the invention or a drug conjugate according to the sixth aspect of the invention.
Further, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
In an eighth aspect the invention provides a product for detecting or assaying Mfa protein or an antigenic fragment thereof in a sample, said product comprising a monoclonal antibody according to the first aspect of the invention.
Further, the product also contains reagents for processing the sample.
The ninth aspect of the invention provides a method as defined in any one of the following:
1) A method of detecting Mfa1 protein or an antigenic fragment thereof in a sample of non-diagnostic interest, said method comprising contacting a test sample with a monoclonal antibody according to the first aspect of the invention.
Further, the method further comprises determining the presence or level of Mfa protein or an antigenic fragment thereof in the test sample.
2) A method of producing a monoclonal antibody according to the first aspect of the invention, the method comprising culturing a hybridoma cell according to the second aspect of the invention or a host cell according to the fifth aspect of the invention, thereby producing the monoclonal antibody.
The tenth aspect of the invention provides any one of the following applications:
1) The monoclonal antibody of the first aspect of the invention, the nucleic acid molecule of the third aspect of the invention, the vector of the fourth aspect of the invention, the host cell of the fifth aspect of the invention, and the product of the eighth aspect of the invention are used for detecting Mfa1 protein or antigen fragment thereof.
2) The monoclonal antibody of the first aspect of the invention, the nucleic acid molecule of the third aspect of the invention, the vector of the fourth aspect of the invention, the host cell of the fifth aspect of the invention and the product of the eighth aspect of the invention are used for preparing a product for diagnosing Mfa1 related diseases.
3) The monoclonal antibody of the first aspect of the invention, the nucleic acid molecule of the third aspect of the invention, the vector of the fourth aspect of the invention, the host cell of the fifth aspect of the invention, the drug conjugate of the sixth aspect of the invention, and the use of the pharmaceutical composition of the seventh aspect of the invention in preparing a medicament for treating Mfa 1-related diseases.
4) Use of a monoclonal antibody according to the first aspect of the invention for the preparation of a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, a host cell according to the fifth aspect of the invention, a drug conjugate according to the sixth aspect of the invention, a pharmaceutical composition according to the seventh aspect of the invention or a product according to the eighth aspect of the invention.
5) Use of a nucleic acid molecule according to the third aspect of the invention for the preparation of a vector according to the fourth aspect of the invention, a host cell according to the fifth aspect of the invention or a pharmaceutical composition according to the seventh aspect of the invention.
6) The use of a vector according to the fourth aspect of the invention for the preparation of a host cell according to the fifth aspect of the invention or a pharmaceutical composition according to the seventh aspect of the invention.
7) The use of a host cell according to the fifth aspect of the invention for the preparation of a pharmaceutical composition according to the seventh aspect of the invention.
Further, the Mfa 1-related diseases include diseases associated with p.gingivalis infection.
Further, the diseases associated with p.gingivalis infection include periodontitis, bone resorption, cardiovascular diseases, rheumatoid, brain disorders, poor pregnancy outcomes, obesity, inflammatory enteritis, cancer, diabetes, nonalcoholic steatohepatitis.
Further, the p.gingivalis infection comprises periodontitis and bone resorption.
Further, the bone resorption is alveolar bone resorption.
The invention has the advantages and beneficial effects that:
the invention provides 3 monoclonal antibodies which are specifically combined with Porphyromonas gingivalis Mfa1 and are respectively named as a 2D9B9 antibody, a 2F5F8 antibody and a 3B2F7 antibody, wherein the 3 monoclonal antibodies have higher affinity, specificity and sensitivity, can obviously inhibit the growth and proliferation of Porphyromonas gingivalis, inhibit the adhesion of P.gingivalis to cells, and reduce the colonization of P.gingivalis in the oral cavity of a rat, thereby relieving inflammatory reaction in the oral cavity.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram showing the construction process of a recombinant vector pET28a-Mfa1, wherein 1A is a result diagram of amplifying Mfa1 CDS fragment based on P.gingivalis genome, 1B is a result diagram of PCR of 4 positive cloning bacteria, 1C is a result diagram of PCR amplification based on recombinant vector Mfa1 and double digestion verification of pET-28a/Mfa1 plasmid (lane 1 is Mfa1 amplified fragment, lane 2 is pET-28a/Mfa1 plasmid double digestion, and lane 3 is pET-28a/Mfa1 recombinant plasmid);
FIG. 2 is a diagram showing the results of SDS-PAGE electrophoresis detection of Mfa1 recombinant protein expression and purification, wherein 2A is a diagram showing the results of Mfa protein induction expression, 2B is a diagram showing the results of Mfa protein purification (lane 1 is the supernatant after ultrasound induction, lane 2 is the flow through solution after column chromatography, lanes 4-9 are respectively imidazole eluents of different concentrations);
FIG. 3 is a graph showing the results of serum titer detection after immunization of a mouse with Mfa1 antigen, wherein 3A is a schematic diagram of the mouse immunization strategy, and 3B is a statistical graph of the serum titer results;
FIG. 4 is a graph showing the results of subtype identification and antibody purification, wherein 4A is a graph showing the results of subtype identification of 2D9B9 antibody, 4B is a graph showing the results of subtype identification of 2F5F8 antibody, 4C is a graph showing the results of subtype identification of 3B2F7 antibody, and 4D is a graph showing the results of SDS-PAGE for detection of antibody purification;
FIG. 5 is a graph showing the results of BLI assay Mfa1 monoclonal antibody affinity with Mfa1 antigen, wherein 5A is a graph showing the results of the binding and dissociation curves for Mfa1 antigen interaction with 2D9B9 antibody, 5B is a graph showing the results of the binding and dissociation curves for Mfa1 antigen interaction with 2F5F8 antibody, and 5C is a graph showing the results of the binding and dissociation curves for Mfa1 antigen interaction with 3B2F7 antibody;
FIG. 6 is a graph showing the results of ELISA method for identifying epitope similarity, wherein 6A is the graph showing the results of binding of 2D9B9, 2F5F8 antibodies to Mfa1 antigen, 6B is the graph showing the results of binding of 2D9B9, 3B2F7 antibodies to Mfa1 antigen, and 6C is the graph showing the results of binding of 2F5F8, 3B2F7 antibodies to Mfa1 antigen;
FIG. 7 is a graph showing the results of ELISA assay for the sensitivity of Mfa1 monoclonal antibody to Mfa1 antigen, wherein 7A is a graph showing the results of binding Mfa1 monoclonal antibody 2D9B9 to Mfa1 antigen at different dilution ratios, 7B is a graph showing the results of binding Mfa1 monoclonal antibody 2F5F8 to Mfa1 antigen at different dilution ratios, and 7C is a graph showing the results of binding Mfa1 monoclonal antibody 3B2F7 to Mfa antigen at different dilution ratios;
FIG. 8 is a graph showing the results of a double-antibody sandwich assay for detecting the sensitivity of Mfa1 monoclonal antibody to Mfa1 antigen, wherein 8A is a graph of the results of a sandwich assay for coating Mfa1 monoclonal antibody 2F5F8, binding Mfa1 protein, using HRP-labeled Mfa1 monoclonal antibody 2D9B9, 8B is a graph of the results of a sandwich assay for coating Mfa1 monoclonal antibody 2F5F8, binding Mfa1 protein, using HRP-labeled Mfa1 monoclonal antibody 3B2F7, and 8C is a graph of the results of a sandwich assay for coating Mfa1 monoclonal antibody 3B2F7, binding Mfa protein, and using HRP-labeled Mfa1 monoclonal antibody 2D9B 9;
FIG. 9 is a graph showing the results of Western Blot detection Mfa1 monoclonal antibody specificity, wherein 9A is a graph showing the results of detection of 2D9B9 antibody specificity, 9B is a graph showing the results of detection of 2F5F8 antibody specificity, and 9C is a graph showing the results of detection of 3B2F7 antibody specificity;
FIG. 10 is a graph showing the results of detecting the specificity of the Mfa1 monoclonal antibody 2D9B9 for Porphyromonas gingivalis, wherein 10A is a graph showing the results of immunofluorescence detection, and 10B is a graph showing the results of flow cytometry detection;
FIG. 11 is a graph showing the results of detecting the growth inhibition of Porphyromonas gingivalis by the Mfa1 monoclonal antibody, wherein 11A is a graph showing the results of detecting the inhibition of Porphyromonas gingivalis by the Mfa1 monoclonal antibody cell culture supernatant by absorbance value, and 11B is a graph showing the results of detecting the inhibition of Porphyromonas gingivalis by the qRT-PCR detecting Mfa1 monoclonal antibody cell culture supernatant;
FIG. 12 is a graph showing the effect of a hydroxyapatite test and a cell test to detect Mfa1 monoclonal antibody on Porphyromonas gingivalis adhesion, wherein 12A is a graph showing the effect of a qRT-PCR test Mfa1 monoclonal antibody on Porphyromonas gingivalis adhesion hydroxyapatite, 12B is a graph showing the effect of a qRT-PCR test Mfa1 monoclonal antibody on Porphyromonas gingivalis adhesion human lung cancer cell A549, and 12C is a graph showing the effect of a qRT-PCR test Mfa1 monoclonal antibody on Porphyromonas gingivalis adhesion human gingival fibroblast HGF;
FIG. 13 is a graph showing the measurement results of the animal experiment to detect the influence of Mfa1 monoclonal antibody on periodontitis, wherein 13A is a graph showing the result of qRT-PCR to detect the capacity of Porphyromonas gingivalis in the oral cavity, 13B is a graph showing the result of gingival index, and 13C is a graph showing the gingival bleeding index;
FIG. 14 is a graph showing the results of alveolar bone resorption, wherein 14A is a graph showing the loss of maxillary permanent molar bone in the right side of the tooth as observed by the methylene blue staining method, 14B is a statistical graph showing the results of bone loss in the methylene blue staining method, and 14C is a graph showing the loss of maxillary permanent molar bone in the right side of the tooth as observed by using Micro-CT scanning and three-dimensional reconstruction;
FIG. 15 is a graph showing the effect of HE staining of maxillary permanent molar tissue of an experimental animal (E, epithelium; A, alveolar bone; T, tooth; yellow line for epithelial basement membrane; red line for alveolar bone crown).
Detailed Description
The following provides definitions of some of the terms used in this specification. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Through extensive and intensive studies, 3 kinds of monoclonal antibodies against Porphyromonas gingivalis Mfa1, designated as 2D9B9 antibodies, 2F5F8 antibodies and 3B2F7 antibodies, were selected and prepared. Through an antibody affinity experiment, the monoclonal antibodies can be combined with Mfa1 antigen; through an antibody sensitivity and specificity identification experiment, the monoclonal antibody is combined with Mfa antigen to have higher sensitivity and specificity; according to the bacterial inhibition test, mfa1 monoclonal cell supernatant can obviously inhibit bacterial proliferation; through a hydroxyapatite adhesion experiment and a cell adhesion experiment of a tooth similar material, the Mfa1 monoclonal antibody can obviously inhibit the adhesion effect of P.gingivalis; experiments of constructing periodontitis models show that the Mfa1 monoclonal antibody and P.gingivalis co-incubated group can prevent the pathological changes, obviously lighten inflammatory cell infiltration, reduce alveolar bone absorption and lighten periodontitis.
In the present invention, the term "hybridoma" and the term "hybridoma cell line" are used interchangeably. When referring to the term "hybridoma" and the term "hybridoma cell line", they also include subclones and progeny cells of the hybridoma.
In the present invention, the term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind to the same epitope, such variants typically being present in minimal amounts, except for possible variants that may be produced during the production of the monoclonal antibody. Such monoclonal antibodies typically comprise an antibody that binds to a polypeptide sequence of a target, wherein the target-binding polypeptide sequence is obtained by a process comprising selecting a single target-binding polypeptide sequence from a plurality of polypeptide sequences. For example, the selection process may be to select unique clones from a collection of clones such as hybridoma clones, phage clones, or recombinant DNA clones. It will be appreciated that the selected target binding sequences may be further altered, for example, to increase affinity for the target, humanise the target binding sequences, increase their yield in cell culture, reduce their immunogenicity in vivo, create multispecific antibodies, and the like, and antibodies comprising altered target binding sequences are also monoclonal antibodies of the invention. Unlike polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibody preparations have the advantage that they are generally not contaminated with other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
In the present invention, a monoclonal antibody encompasses sequences that have a degree of sequence identity or sequence identity to the amino acid sequence of the antibody or any nucleotide sequence encoding the antibody, where "identity" may be equivalent to "identity".
Those skilled in the art will also appreciate that antibodies may be subjected to various post-translational modifications. The type and extent of these modifications often depend on the host cell line used to express the antibody and the culture conditions. Such modifications may include variations in glycosylation, methionine oxidation, piperazine dione formation, aspartic acid isomerization, and asparagine deamidation. Common modifications are deletions of the carboxyl-terminal basic residues (such as lysine or arginine) due to the action of carboxypeptidase.
In the present invention, the term "identity" indicates that at any particular position of aligned sequences, the amino acid residues between the sequences are identical. Amino acid residues between sequences may also be of similar type at any particular position in the aligned sequences. For example, leucine may be replaced with isoleucine or valine. Other amino acids that may be generally substituted for one another include, but are not limited to: phenylalanine, tyrosine and tryptophan (amino acids with aromatic side chains), lysine, arginine and histidine (amino acids with basic side chains), aspartic acid and glutamic acid (amino acids with acidic side chains), asparagine and glutamine (amino acids with amide side chains), and cysteine and methionine (amino acids with sulfur-containing side chains).
In general, modification of one or more amino acids in a protein does not affect the function of the protein. Those skilled in the art will recognize that individual additions, deletions, insertions, substitutions to a single amino acid or a small percentage of amino acids or to an amino acid sequence are conservative modifications, where a change in protein results in a protein with similar function. Conservative substitution tables providing functionally similar amino acids are well known in the art.
The final derivative or variant may be achieved using substitutions, deletions, insertions or any combination thereof. Typically, these changes are made at several amino acids to minimize molecular changes, particularly the immunogenicity and specificity of antigen binding proteins. However, in some cases greater variation may be tolerated. Amino acid substitutions are typically single base; the insertion will typically be on the order of about one to about twenty amino acid residues, although significantly larger insertions may be tolerated. Deletions range from about one to about twenty amino acid residues, although in some cases the deletions may be much larger.
In some embodiments, the amino acid sequence of the variable region of the antibody, including but not limited to the framework region, the hypervariable region, and particularly the variable region of the CDR3 region, is modified. Typically, the light or heavy chain region comprises three hypervariable regions (comprising three CDRs) and a more conserved region (the so-called Framework Region (FR)). The hypervariable region comprises amino acid residues from CDRs and amino acid residues from hypervariable loops. Computer algorithms known to those skilled in the art, such as Gap or Bestfit, can be used to optimally align amino acid sequences to be aligned and define similar or identical amino acid residues. The parent monoclonal antibody or portion thereof may be altered by general molecular biological methods known in the art, including PCR, oligonucleotide site-directed mutagenesis (oligonucleotide-directed mutagenesis) and site-directed mutagenesis (site-directed mutagenesis), or functional variants may be obtained by organic synthetic methods.
The term "nucleic acid molecule" as used herein refers to DNA molecules and RNA molecules. The nucleic acid molecule may be single-stranded or double-stranded, but is preferably double-stranded DNA. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. The nucleic acid molecule generally has a homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, preferably 100% with respect to the specific base sequence. In addition, the nucleic acid molecule may be one in which a part or all of the nucleotides are replaced with an artificial nucleic acid such as PNA, LNA, ENA, GNA, TNA.
The present invention is not particularly limited to the expression vector, and the choice thereof depends on the desired function. Non-limiting examples of vectors include plasmids, cosmids, viruses, bacteriophages and other vectors conventionally used, for example, in genetic engineering. Methods well known to those skilled in the art can be used to construct a variety of plasmids and vectors.
In one embodiment, the vector is an expression vector. The expression vector according to the invention is capable of directing replication and expression of the nucleic acid molecule of the invention in a host and thus ensuring expression of the variable chain domain of the anti-IgG antibody of the invention encoded thereby in the host of choice. In further embodiments, one or more vectors comprise further sequences to ensure expression of not only the variable chain domains of the invention, but also full length IgG antibodies comprising the variable chain domains of the invention.
The expression vector may be, for example, a cloning vector, a binary vector or an integrative vector. Expression comprises transcription of the nucleic acid molecule, for example into translatable mRNA.
Non-limiting examples of vectors include pQE-12, pUC-series, pBluescript (Stratagene), pET-series expression vectors (Novagen) or pCRTOPO (Invitrogen), λgt11, pJOE, pBBR1-MCS series, pJB861, pBSMuL, pBC2, pUCPKS, pTACT1, pTRE, pCAL-n-EK, pESP-1, pOP13CAT, E-027pCAG Kosak-Cherry (L45 a) vector system, pREP (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV-dhfr, pZD 35, okayama-Berg cDNA expression vectors DV1 (Pharmacia), pRc/CMV, pcDNA1, pcDNA3 (Invitrogen), pcA 3.1, pSBRO 1, pSBRO 26, pS-36, pSHi-36, and pEIR-67, and Biosystem (Biotechnology). Non-limiting examples of plasmid vectors suitable for Pichia pastoris include, for example, plasmids pAO815, pPIC9K and pPIC3.5K (all Invitrogen). Another vector suitable for expression of proteins in Xenopus (Xenopus) embryos, zebra fish embryos and a wide variety of mammalian and avian cells is the multipurpose expression vector pCS2 + 。
In general, vectors may contain one or more origins of replication (ori) and genetic systems for cloning or expression, one or more markers for selection in a host (e.g., antibiotic resistance), and one or more expression cassettes. In addition, the coding sequences contained in the vectors can be linked to transcriptional regulatory elements and/or to other amino acid coding sequences using established methods. Such regulatory sequences are well known to those skilled in the art and include, but are not limited to, regulatory sequences that ensure transcription initiation, internal Ribosome Entry Sites (IRES), and optionally regulatory elements that ensure transcription termination and transcript stabilization. Non-limiting examples of such regulatory elements that ensure transcription initiation include promoters, translation initiation codons, enhancers, insulators, and/or regulatory elements that ensure transcription termination, which are included downstream of the nucleic acid molecules of the invention. Further examples include Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing, nucleotide sequences encoding secretion signals, or signal sequences depending on the expression system used, which are capable of directing the expressed protein to a cellular compartment or culture medium. The vector may also contain additional expressible polynucleotides encoding one or more chaperones to facilitate correct protein folding.
Additional examples of suitable origins of replication include, for example, full-length ColE1, truncated ColEI, SV40 virus, and M13 origins of replication, while additional examples of suitable promoters include, but are not limited to, the Cytomegalovirus (CMV) promoter, the SV 40-promoter, the RSV-promoter (Rous sarcoma virus), the lacZ promoter, the tetracycline promoter/operator (tetp/o), the chicken beta-actin promoter, the CAG-promoter (a combination of chicken beta-actin promoter and cytomegalovirus immediate early enhancer), the gai10 promoter, the human elongation factor 1 alpha-promoter, the AOX1 promoter, the GAL1 promoter CaM-kinase promoter, the lac, trp or tac promoters, the T7 or T5 promoters, the lacUV5 promoter, the Autographa californica (Autographa californica) polynuclear viral (AcMNPV) polyhedrin promoter or the globin intron in mammalian and other animal cells. An example of an enhancer is, for example, the SV 40-enhancer. Non-limiting additional examples of regulatory elements that ensure transcription termination include SV 40-polyadenylation sites, tk-polyadenylation sites, rho-factor independent lpp terminators or AcMNPV polyhedrin polyadenylation signals. Further non-limiting examples of selectable markers include dhfr, which confers resistance to methotrexate, npt, which confers resistance to the aminoglycosides neomycin, kanamycin and paromycin (paromycin), and hygro, which confers resistance to hygromycin. Additional selection genes have been described, namely trpB, which allow cells to use indole instead of tryptophan; hisD, which allows cells to replace histidine with histidinol (histidinol); mannose 6-phosphate isomerase, which allows cells to utilise mannose and ODC (ornithine decarboxylase), which confers resistance to the ornithine decarboxylase inhibitor 2- (difluoromethyl) -DL-ornithine DFMO or deaminase from aspergillus terreus (Aspergillus terreus) which confers resistance to blasticidin S.
The nucleic acid molecules and/or vectors of the invention may be designed to be introduced into cells by, for example, chemical-based methods (polyethylenimine, calcium phosphate, liposomes, DEAE-dextran, nuclear transfection, non-chemical methods (electroporation, sonoporation, phototransfection, gene electrotransfer, fluid delivery or transformation that occurs naturally when a cell is contacted with a nucleic acid molecule of the invention), particle-based methods (gene gun, magnetic transfection, puncture transfection), phage vector-based methods and viral methods.
To facilitate purification of the nucleic acid molecules of the invention, tag (tag) sequences may be inserted into the expression vector. Examples of tags include, but are not limited to, six histidine tags, myc tags, or FLAG tags. Any tag known to those skilled in the art to facilitate purification may be used in the present invention.
In the present invention, any suitable host cell/vector system may be used for expression of the DNA sequences encoding the antibody molecules of the present invention. Bacterial (e.g., E.coli) and other microbial systems may be used, or eukaryotic (e.g., mammalian) host cell expression systems may also be used. Such cells include, but are not limited to, mammalian cells, plant cells, insect cells, fungal cells, or cells of bacterial origin. As the mammalian cell, one selected from the group consisting of CHO cells, F2N cells, CSO cells, BHK cells, bowes melanoma cells, heLa cells, 911 cells, AT1080 cells, a549 cells, HEK 293 cells, and HEK 293T cells may be preferably used as a host cell. Any cell known to those skilled in the art to be useful as a mammalian host cell may be used in the art.
The host cells of the invention can then be used for expression as well as for culture purposes for antibody expression for the production of large quantities of pharmaceuticals. Can also be used as active ingredient of pharmaceutical composition. Any suitable culture technique may be used, including but not limited to stationary culture, roller bottle culture, ascites fluid, hollow fiber bioreactor cartridges, modular mini-fermenters, stirred tanks, microcarrier culture, ceramic core perfusion, and the like.
As an alternative embodiment, the product of the present invention comprises the monoclonal antibody or functional fragment thereof prepared according to the present invention. As another alternative embodiment, the product of the invention comprises a diagnostic composition comprising at least one detectable label, such as a detectable moiety/agent. The tag may be non-covalently conjugated to a monoclonal antibody of the invention. The tag may also be conjugated directly to the monoclonal antibody by a covalent bond. Alternatively, the tag may be conjugated to the monoclonal antibody described above using one or more linking compounds. Techniques for conjugating a tag to a monoclonal antibody are well known to those skilled in the art. The detectable moiety/agent as a label is preferably one selected from the group consisting of, but not limited to, enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting materials and non-radioactive paramagnetic metal ions. Suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; suitable prosthetic groups include streptavidin, avidin, and biotin; suitable fluorescent substances include, but are not limited to, HRP, FITC, 5-carboxyfluorescein, 6-carboxyfluorescein; a rhodamine-type label comprising TAMRA; dansyl; lizhixian; cyanine; phycoerythrin; texas Red; and the like. Fluorescent labels can be conjugated to aldehyde groups contained in a target molecule using the techniques disclosed herein. Suitable luminescent substances include luminol, acridine compounds, coelenterazine and analogs, dioxetane, peroxyoxalic acid based systems and derivatives thereof; suitable bioluminescent materials include luciferase, luciferin and jellyfish; and suitable radionuclides include 125I, 131I, 111In and 99Tc.
In the present invention, the method for detecting or determining the amount of the antigen of interest (for example Mfa 1) may be any known method. For example, it comprises an immunoassay or an assay method.
The immunodetection or measurement method is a method of detecting or measuring the amount of an antibody or an antigen by using a labeled antigen or antibody. Examples of immunodetection or assay methods include radio-labeled immune antibody methods (RIA), enzyme immunoassays (EIA or ELISA), fluorescent Immunoassays (FIA), luminescent immunoassays, western immunoblotting, flow cytometry, physicochemical methods, and the like.
Diseases associated with Mfa1 can be diagnosed by detecting or assaying Mfa-expressing cells with the antibodies of the invention.
In the present invention, the sample for detecting or measuring the target antigen (e.g., mfa 1) is not particularly limited as long as it has a possibility of containing cells expressing the target antigen (e.g., mfa 1), such as tissue cells, blood, plasma, serum, pancreatic juice, urine, feces, tissue juice, or culture solution.
The pharmaceutical composition of the invention comprises the monoclonal antibody of the invention and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may additionally contain liquids such as water, physiological saline, glycerol and ethanol. In addition, auxiliary substances such as wetting or emulsifying agents or pH buffering substances may be present in the composition. These carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries and suspensions, for ingestion by a patient.
Suitable forms of administration include forms suitable for parenteral administration, for example by injection or infusion, for example by bolus injection or continuous infusion, intravenous, inhalable or subcutaneous forms. In the case of products for injection or infusion, they may take the form of suspensions, solutions or emulsions in oily or aqueous vehicles and they may contain formulating agents such as suspending, preserving, stabilizing and/or dispersing agents. Alternatively, an antibody or antigen binding fragment thereof according to the invention may be in dry form for reconstitution with a suitable sterile liquid prior to use. Solid forms suitable for dissolution or suspension in a liquid vehicle prior to injection may also be prepared.
Once formulated, the compositions of the invention may be administered directly to a subject. Accordingly, provided herein is the use of an antibody or antigen-binding fragment thereof according to the invention for the manufacture of a medicament.
The subject to be treated may be an animal. Further, the pharmaceutical composition according to the invention is adapted for administration to a human subject.
In the present invention, diseases associated with p.gingivalis infection include, but are not limited to, periodontitis, bone resorption, cardiovascular disease, rheumatoid, brain disorders, bad pregnancy outcomes, obesity, inflammatory enteritis, cancer, diabetes, or nonalcoholic steatohepatitis. Cardiovascular diseases include, but are not limited to, hyperlipidemia, coronary heart disease, atherosclerosis, peripheral vascular disease, cardiomyopathy, inflammatory heart disease, ischemic heart disease, congestive heart failure, hypertensive heart disease, heart valve disease, hypertension, myocardial infarction, diabetic heart disease, aneurysms, embolism, disjunction, pseudoaneurysms, vascular malformations, vascular nevi, thrombosis, or varicose veins. Brain disorders include, but are not limited to, alzheimer's disease, down's syndrome, epilepsy, autism, parkinson's disease, essential tremor, frontotemporal dementia, progressive supranuclear palsy, amyotrophic lateral sclerosis, huntington's disease, multiple sclerosis, mild cognitive impairment, age-related memory impairment, chronic traumatic brain injury, stroke, cerebrovascular disease, lewy body disease, multiple system atrophy, schizophrenia or depression. Bad pregnancy outcomes include, but are not limited to, miscarriage, stillbirth, premature birth, low birth weight infants, large children, congenital anomalies, stillbirth, neonatal death, caesarean section, shoulder dystocia, birth injury, or pregnancy hypertension (including preeclampsia). Inflammatory bowel disease includes, but is not limited to, ulcerative enteritis, crohn's disease or other intestinal tissue related diseases. Cancers include, but are not limited to, rectal cancer, pancreatic cancer, esophageal cancer, or lung cancer. In particular embodiments of the invention, diseases associated with p.gingivalis infection include, but are not limited to, periodontitis, bone resorption; further, bone resorption is alveolar bone resorption.
The invention will now be described in further detail with reference to the drawings and examples. The following examples are only illustrative of the present invention and are not intended to limit the scope of the invention. Simple modifications of the invention in accordance with the essence of the invention are all within the scope of the invention as claimed.
Example 1 preparation of Mfa1 recombinant antigen protein
1. Experimental method
1) Construction of Mfa1 recombinant expression plasmid
The genome of Porphyromonas gingivalis (ATCC-33277) was extracted and used as an amplification template. The Mfa gene CDS fragment was amplified by PCR using Mfa1 specific primers (upstream primer (5 '-3'): CTAGCTAGCATGAAGTTAAACAAAATGTTTTTGGTC, downstream primer (5 '-3'): CCGCTCGAGGAGATCAACCTCATAGGAATGAACT). The PCR product was subjected to agarose gel electrophoresis to recover the desired fragment.
The recovered product and pET-28a carrier are digested with NheI and XhoI, and agarose gel electrophoresis is performed to recover the target fragment and the carrier. The vector and the target fragment are linked by the action of T4-DNA ligase. The ligation product pET-28a/Mfa1 recombinant plasmid was transformed into DH 5. Alpha. Strain and screened in solid LB plates containing 50. Mu.g/mL kanamycin. The colonies are picked for culture, positive strains are determined by bacterial liquid PCR and agarose gel electrophoresis, and sequencing is carried out. And taking 1 mu L of bacterial liquid as an amplification template for PCR verification, determining a positive bacterial strain through agarose gel electrophoresis, sequencing the positive bacterial liquid, and preserving the sequenced correct bacterial strain for later use.
2) Expression and purification of Mfa1 recombinant proteins
pET-28a/Mfa1 recombinant plasmid was transformed into BL21 (DE 3) strain. The monoclonal is selected, cultured until the OD600 reaches 0.4-0.8, added with 100mM IPTG (final concentration is 0.1 mM) for induction expression for 12-16h, and the thalli are collected. After the cells were disrupted by sonication, the supernatant and the precipitate were separated, and the supernatant was filtered through a 0.45 μm filter. The supernatant and precipitated protein expression were examined by SDS-PAGE electrophoresis and Coomassie Brilliant blue staining. The system was expanded to 2L and the supernatant was collected after ultrasonication. The protein Mfa with HIS tag was purified by nickel column affinity chromatography, pre-column samples, flow-through solutions and samples eluted at various concentrations (20, 50, 70, 100, 200, 300, 500 mM) Soluble Elution Buffer (imidazole elution) were collected and purified proteins were validated for purity by SDS-PAGE electrophoresis and coomassie brilliant blue staining.
Mixing imidazole eluents with purity of more than 90%, concentrating and replacing with amicon ula-15 30K centrifugal filter, centrifuging, replacing salt ions in the original solution with PBS, and concentrating to 2-5mg/mL. The Mfa antigen protein was quantified using the BCA protein quantification kit.
2. Experimental results
The verification result of the agarose gel electrophoresis method is shown in figure 1, and the PCR amplification experimental result shows that the Mfa gene CDS fragment is successfully amplified; the bacterial liquid PCR experiment result shows that positive clone bacteria are screened out; the PCR amplification and pET-28a/Mfa1 recombinant plasmid double enzyme digestion verification experiment result based on the recombinant vector Mfa1 shows that the Mfa1 fragment is successfully inserted into the pET-28a vector.
The base sequence of strain No. 2 was found to be identical to the base sequence of Mfa1 by sequencing; the result shows that the pET-28a/Mfa1 recombinant expression vector is successfully constructed.
The SDS-PAGE electrophoresis detection result is shown in FIG. 2, and the result shows that the 100mM IPTG induces Mfa1 soluble protein, and the molecular weight is about 70 kd; proteins with a purity of more than 90% can be obtained at 50mM, 70mM, 100mM, 200mM imidazole elution.
EXAMPLE 2 preparation of Mfa1 monoclonal antibody
1. Experimental method
1) Serum titer detection
5 female BALB/C mice of 8 weeks old were selected, one of them was used as a negative control, the other 4 mice were used for immunization, and three immunizations were performed on days 0, 14, and 21, respectively, and 50. Mu.g of Mfa antigen was injected subcutaneously into each mouse. On day 28, 20 μl of mouse tail venous blood was taken, serum was collected and subjected to gradient dilution, and the titer of antibodies in mouse serum was detected.
2) Antibody subtype detection and ascites antibody purification
2 mice with high antibody titer in serum are selected, the mice are subjected to intraperitoneal injection impact by using Mfa1 antigen, and spleen cells and myeloma cells SP2/0 of the mice are taken for fusion after three days. When the hybridoma cells grow to about 30% of the bottom of the hole, the positive cloned cells can be screened by indirect ELISA. The light and heavy chain subtype of antibodies secreted by hybridoma cells was determined using a mouse monoclonal antibody subtype detection kit. Monoclonal hybridoma cells were injected into the abdominal cavity of mice by the ascites purification method, ascites were collected, and HiTrapTM Protein A HP (Protein a column) or HiTrapTM Protein G HP (Protein G column) were selected to purify hybridoma cells according to the heavy chain subtype of the antibody. And purifying the obtained antibody by using an AKTA protein purifier and a matched purification column, collecting target proteins, verifying the target proteins to be correct by SDS-PAGE electrophoresis and Coomassie brilliant blue staining, and storing the target proteins for later use.
2. Experimental results
The serum titer detection experiment result is shown in fig. 3, and the result shows that the titer of the antibodies in the serum of 4 mice is over 40 ten thousand, which shows that the cell fusion requirement is met.
3 hybridoma cells capable of stably secreting the specific antibody are obtained through screening and are named as 2D9B9, 2F5F8 and 3B2F7 respectively. The sequences of the 2D9B9, 2F5F8, 3B2F7 antibodies are shown in tables 1-3.
The results of the detection and purification of the light and heavy chain subtypes of the antibodies are shown in FIG. 4, and the results show that the light chain subtype of the three antibodies obtained by screening is KAPPA (KAPPA) type, the heavy chain subtype of the 2D9B9 antibody is IgG2B, and the heavy chain subtype of the 2F5F8 and 3B2F7 antibodies is IgG1; the results of antibody purification showed that heavy chain bands appeared at about 55KD, light chain bands appeared at about 27KD, and no bands appeared at other positions, indicating that the purity of the purified antibody was greater than 95%.
TABLE 1 sequences of 2D9B9 antibodies
TABLE 2 sequence of 2F5F8 antibodies
TABLE 3 sequences of 3B2F7 antibodies
Example 3 antibody affinity assay
1. Experimental method (biological layer interferometry)
The affinity of the antigen to 3 antibodies was measured using the Octet Systems of cidolis, the binding of the antigen was measured by capturing Mfa protein with the 3 antibodies immobilized using AMC as a sensor. The data are processed by analytical software to calculate Kon or Ka (binding rate constant), koff or Kd (dissociation rate constant) and finally the affinity constant Kd (dissociation equilibrium constant).
2. Experimental results
The results of the antibody affinity assay are shown in fig. 5, and the results show that Mfa1 antigen can be combined with 3 prepared antibodies, and the combination and dissociation types belong to the fast combination and slow dissociation types. After data processing and analysis by related professional software, the affinity of the obtained antigen and antibody is higher than nM.
Example 4Mfa epitope similarity identification
1. Experimental method
Double validation was performed using a conventional ELISA additive method and BLI (biological layer interferometry). The ELISA assay was performed by incubating Mfa1 antibody with antibody A and then antibody B. In addition, a group to which only antibody A or antibody B was added was set. AI values were calculated by the formula ai= [ 2a1+2/(a1+a2) -1] ×100%, when AI <10%, they recognized the same or similar epitope; when AI >10%, the epitopes they recognize are not identical.
2. Experimental results
The experimental results are shown in fig. 6, which shows that after the addition of the second antibody, the absorbance values of all groups increased by different amounts compared to the value of the single antibody group, and the AI values were calculated to be 78.03% for 2D9B9 and 2F5F8, 76.39% for 2D9B9 and 3B2F7, and 55.38% for 2F5F8 and 3B2F 7. Indicating that there was a difference in the epitope recognized by the Mfa1 antigen by the 3 antibodies.
Example 5Mfa monoclonal antibody sensitivity and specificity identification
1. Experimental method
Enzyme-linked immunosorbent assay (ELISA) detects antibody sensitivity. Diluting the purified Mfa protein to 2 mug/mL by using a coating liquid, coating 100 mu L of each hole in an ELISA plate, sealing, standing overnight at 4 ℃, washing 5 times by using a Wash Buffer working liquid, adding 200 mu L of a blocking liquid to block a non-specific binding site, blocking at room temperature for 2 hours, washing by using the Wash Buffer working liquid, adding a gradient diluted Mfa1 monoclonal antibody, 100 mu L/hole, reacting at 37 ℃ for 2 hours, washing by using the Wash Buffer working liquid, adding 1:10000 diluted HRP-labeled anti-mouse secondary antibody, reacting at 37 ℃ for 1 hour, washing by using the Wash Buffer working liquid for 5 times, adding TMB color development liquid, reacting at 37 ℃ for 30 minutes, adding a stop liquid, measuring an OD450 value, and analyzing and mapping the result.
Antibody sensitivity was detected using the double antibody sandwich method. Firstly, diluting a Mfa1 monoclonal antibody to 2 mug/mL by using a coating liquid, coating the monoclonal antibody in an ELISA plate, sealing the ELISA plate, standing overnight at 4 ℃, washing the ELISA plate by using a Wash Buffer working liquid for 5 times, adding 200 mu L of a blocking liquid to block a non-specific binding site, sealing the ELISA plate for 1h at room temperature, washing the Wash Buffer working liquid, adding a Mfa1 antigen diluted in a gradient manner, 100 mu L/hole, reacting the ELISA plate at 37 ℃ for 1h, washing the Wash Buffer working liquid, adding a Mfa1 monoclonal antibody of a HRP modified non-similar epitope diluted by 1:2000, reacting the Wash Buffer working liquid at 37 ℃ for 1h, washing the Wash Buffer working liquid for 5 times, adding a TMB color development liquid, reacting the TMB color development liquid at 37 ℃ for 15min, adding a stop liquid, determining an OD450 value, and analyzing and making a graph.
The specificity of the Mfa1 monoclonal antibody was identified by Western Blot. Collecting total protein of P.gingivalis bacteria, respectively loading recombinant Mfa protein and common oral bacteria, separating by using 10% SDS-PAGE gel electrophoresis, transferring to PVDF membrane or NC membrane, sealing by using 5% skimmed milk powder for 2 hours, adding 3 kinds of Mfa1 monoclonal antibodies diluted by 1:5000, incubating overnight at 4 ℃, adding 1:10000 diluted HRP-labeled anti-mouse secondary antibodies after membrane washing, incubating for 1 hour at room temperature, adding chemiluminescent liquid after membrane washing, and imaging and analyzing by an imaging system.
The fluorophore FITC was covalently coupled to a Mfa1 monoclonal antibody (2D 9B 9), the unbound antibody was washed off by spin co-incubation of the antibody with p.gingivalis at 37 ℃, centrifugation at 4000g, and the cells obtained by centrifugation were resuspended and dripped onto a slide glass using PBS, observed using a fluorescence microscope, and bacterial markers were detected using a flow cytometer.
2. Experimental results
The ELISA detection results are shown in FIG. 7, and the results show that the 3 different Mfa1 monoclonal antibodies have higher sensitivity, the optimal dilution ratio is more than 1:2000, and the monoclonal antibodies still have display effect after being diluted to 25 ten thousand times.
The detection result of the double antibody sandwich method is shown in fig. 8, and the result shows that the lowest detection lower limit of Mfa1 antigen is 7.8ng/mL, and the detection control can be effectively used in the concentration range of 7.8-2000 ng/mL.
The results of the Western Blot are shown in FIG. 9, which shows that 3 different Mfa1 monoclonal antibodies are capable of specifically recognizing the Mfa protein and the recombinant Mfa1 protein of P.gingivalis bacteria.
Immunofluorescence and flow cytometry results are shown in FIG. 10, which shows that FITC-conjugated Mfa1 monoclonal antibody is capable of recognizing and binding to the surface of P.gingivalis bacteria, and performing fluorescent labeling on the P.gingivalis.
Note that: mAb represents monoclonal antibody, PBS represents phosphate buffer, FITC-A represents green fluorescent FITC-labeled protein A, bright represents stronger fluorescence intensity, and Mock represents blank control group.
EXAMPLE 6 inhibition by Mfa1 monoclonal antibody
1. Experimental method
During hybridoma cell culture, a large amount of Mfa1 monoclonal antibody is released into the cell culture medium. The control cell culture supernatant and 3 kinds of Mfa hybridoma cell culture supernatants were collected by filtration through a 0.45 μm filter, the control cell culture supernatant and Mfa hybridoma cell culture supernatant were added to a bacterial culture medium at a ratio of 1:9, inoculated with the same bacterial amount of P.gingivalis (100. Mu.L/5 mL), anaerobically cultured for 24 hours, the bacterial culture was collected, OD450 was detected by an ultraviolet-visible spectrophotometer, and the copy number of P.gingivalis was detected by qRT-PCR, and the detection results were analyzed by GraphPad and mapped.
2. Experimental results
The results are shown in FIG. 11, and the detection results of the ultraviolet-visible spectrophotometer show that compared with the control cell culture supernatant, the light absorption value of the bacterial culture solution can be remarkably reduced by the culture supernatant of the 3 hybridoma cells; the qRT-PCR detection result shows that the supernatant of 3 kinds of Mfa1 monoclonal cells can obviously inhibit bacterial proliferation and reduce the copy number of the bacterial proliferation.
EXAMPLE 7Mfa monoclonal antibody inhibiting the adhesion of Porphyromonas gingivalis
1. Experimental method
Dental analogue hydroxyapatite adhesion experiments. Incubating spherical hydroxyapatite with saliva overnight, collecting P.gingivalis in logarithmic phase, and adjusting bacterial droplet size to 10 9 After incubation with 200. Mu.g/mL of Mfa1 monoclonal antibody for 60min, 100. Mu.L of bacterial solution was mixed with saliva-coated hydroxyapatite and incubated for 1h with spin, and unbound Porphyromonas gingivalis cells were washed away with PBS. The P.gingivalis genome in the above mixture was extracted, and qRT-PCR was performed using the genomic DNA as a template to detect the bacterial copy number bound to hydroxyapatite.
Cell adhesion experiments. Lung cancer cell line A549 or isolated cultured Human Gingival Fibroblast (HGF) (1×10) 6 Cells) were inoculated in 24-well plates, cultured overnight, p.gingivalis in the logarithmic phase was taken the next day, washed once with DMEM serum-free antibiotic-free medium, and the bacterial solution was adjusted to 10 9 CFU/mL, after a 2h incubation with 200. Mu.g/mL mAb-Mfa1 in advance at 37℃with rotation, 1X 10 was added 7 CFU p.gingivalis (moi=100) infected cells for 40min. The total genomic DNA was extracted by washing three times with DMEM serum-free medium, and the attached copy number was detected by qRT-PCR.
2. Experimental results
The results are shown in fig. 12, and the results show that compared with the control group, the Mfa1 monoclonal antibody can effectively inhibit the adhesion of the p.gingivalis to the hydroxyapatite which is a tooth similar material, and the number of the p.gingivalis treated by the Mfa1 monoclonal antibody is bound to the hydroxyapatite and is reduced by more than 50%; after Mfa monoclonal antibody treatment, the adhesion capability of P.gingivalis to tumor cells and gingival fibroblasts is obviously reduced. The above results indicate that the Mfa1 monoclonal antibody is capable of significantly inhibiting the adhesion of p.
Example 8 influence of Mfa1 monoclonal antibody on P.gingivalis colonization in rat periodontitis model
1. Experimental method
1) 160-180g SD rats were purchased from Beijing vitamin Toril Liwa company and were fed adaptively for one week. The study was approved by the university of henna laboratory animal welfare committee. Antibiotic feeding was performed for three days (azithromycin-total dose: 30 mg/kg) in drinking water to eliminate the effect of original oral microorganisms, and normal drinking water was further administered for 3 days to remove the antibiotic, followed by high sugar water (50 g/L) feeding.
2) The rats were anesthetized by intraperitoneal injection of 3% pentobarbital sodium, the rats were fixed and the mouth was opened to expose the maxilla, a gap between the second tooth and the third tooth was found, a small gap was gently opened with pointed forceps, and force was not applied to cut, preventing tooth breakage. A fine wire (or an orthodontic wire with 0.2 MM) with better toughness and water absorption is used, the tooth and the gingival tissue (the implantation line is deep as possible and embedded into the gingival tissue) are separated by pulling down the tooth and the gingival tissue from each other, and the fine wire is fixed by a surgical knotting method to perform double-side implantation. The silk thread is found to fall off in the experimental process to supplement buried thread ligation in time.
3) Taking the P.gingivalis culture mixture, measuring the OD600 value of the mixture to be about 1.5, and calculating the bacterial content. Centrifuge at 2000rpm for 5min at room temperature. Resuspension washing with sterile physiological saline, adding sodium carboxymethylcellulose with final concentration of 2% to adjust concentration to 2×10 10 cfu/mL。
4) Grouping
Normal group (5): no ligation treatment is carried out, and 2% sodium carboxymethylcellulose is normally smeared every other day.
Control group (5): after ligation, 2% sodium carboxymethylcellulose was normally applied every other day.
Group p.gingivalis (5): after ligation, 10 is respectively smeared on two sides at intervals 9 CFU p.gingivalis, fixed at 0.1mL volume, and 2% sodium carboxymethylcellulose was used to adjust the volume to 0.1mL.
Co-incubation group of P.gingivalis+ Mfa1-mAb (50. Mu.g/mL) (5): will 10 9 After incubation of CFU p.gingivalis with Mfa1 monoclonal antibody (2D 9B 9) 100 μg/mL) at 37 ℃ for 1h with rotation, the volume was adjusted to 0.1mL with 2% sodium carboxymethyl cellulose and smeared onto the bilateral ligation site of rats. After being smeared, the paint is forbidden for more than 1 hour, is smeared once every other day, and is smeared for 8 times continuously.
2. Index measurement
1) Oral swab assay p.gingivalis copy number: the roots of the rat molars were gently swabbed using oral swabs, 4-5 times on each side, the swabs were added to bacterial lysis, and the genome extracted. The genome is used as a template, and the oral P.gingivalis loading is detected by a qRT-PCR detection method.
2) Clinical index: after removing the ligature wire, the periodontal probe is used for checking 2 indexes of gingival index and bleeding index. For ease of data statistics, we recorded both the gingival index and the bleeding index of the normal group as 0.1.
3) Alveolar bone resorption and gingival atrophy: the dental tissue of the experimental rat was collected and subjected to Micro-CT scan (NMC-200; pingshengsheng medical NEMO) using a fixed maxillary permanent molar specimen, and a standard Image of the cheek-palate side of the maxillary molar was obtained after three-dimensional reconstruction, and the bone absorption area of the maxillary surface thereof was measured using Image J software. Subsequently, after removing the excessive soft tissue, the alveolar bone was stained again by a methylene blue staining method, and photographed by a microscope. The distance between cementum-enamel and the crest of the alveolar ridge was measured with Image J software.
4) Histopathological examination: dissecting and separating molar teeth and periodontal tissue of maxilla, and decalcifying with 10% ethylenediamine tetraacetic acid (EDTA pH 7.5-8.0) decalcifying solution at room temperature. Flushing with running water, and embedding into tissue wax blocks by using embedding wax. Hematoxylin-eosin (HE) staining was used to observe gingival atrophy, alveolar bone resorption and periodontitis. .
3. Experimental results
The qRT-PCR detection results are shown in FIG. 13, and the results show that the bacterial load of the P.gingivalis in the oral cavity of the P.gingivalis group is obviously higher than that of the control group and the Mfa1 monoclonal antibody treatment group, so that Mfa1 monoclonal antibody can obviously reduce the colonization of the P.gingivalis in the oral cavity; the clinical index detection result shows that the normal group rats which do not do any treatment have fresh red gum, no bleeding phenomenon occurs after probing, and after the rats are only subjected to simple silk ligation, the gums have little edema, and the probes probe no bleeding. After ligation with silk threads, the P.gingivalis group rats were simply smeared, the gum color was dark red before probing, and after probing, the gum bleeds, and the bleeding was full and overflowed from the gingival sulcus. The group incubated by adding the antibody and the P.ginbivalis has dark red gum before probing, but the gum is redder than the gum purely coated with the P.ginbivalis group, and the gum bleeds in a punctiform manner after probing.
Alveolar bone resorption and gingival atrophy as shown in fig. 14, the results show that the rat can have alveolar bone resorption after ligation with silk thread, and bone resorption can be significantly aggravated after application of p. After the antibody is added and incubated with the P.ginbivalis, the bone resorption is obviously reduced compared with the situation that the P.ginbivalis group is simply smeared, but is more serious than the situation that the group is simply ligated by silk threads, and the distance between cementum, enamel and the crest of an alveolar ridge is obviously different; the CT detection is consistent with the detection result of the methylene blue staining method, and the gingival atrophy degree and the alveolar bone absorption degree of the rats in the P.gingivalis group are obviously larger than those of the rats in the control group and the Mfa1 treatment group.
The HE staining results are shown in fig. 15, and the results show that the periodontal tissue of the untreated group is not obviously abnormal, inflammatory cell infiltration is not generated, and bone is not obviously damaged; in the silk thread ligature group, a small amount of inflammatory cells infiltrate, bone destruction is not obvious, and periodontal ligament fibers are orderly arranged; in the model of smearing P.gingivalis after ligation, a large amount of inflammatory cells infiltrate and infiltrate into the epithelium, bone destruction is obvious, alveolar bone atrophy is obvious, periodontal ligament fibers are arranged in a disordered way, and the epithelium is slightly separated from enamel dentin boundary; the Mfa monoclonal antibody and the P.gingivalis co-incubated group can prevent the pathological changes, obviously relieve inflammatory cell infiltration, reduce alveolar bone absorption and relieve periodontitis.
And (3) injection: e is the epithelium; a is alveolar bone; t is teeth; yellow lines represent epithelial basement membrane, and yellow lines are lines beside E; the red line indicates the alveolar bone crown, and the red line is a line beside a.
The above description of the embodiments is only for the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications will fall within the scope of the claims of the invention.

Claims (10)

1. A monoclonal antibody directed against Mfa1, said monoclonal antibody comprising any one of the following antibodies: 2D9B9 antibodies, 2F5F8 antibodies, 3B2F7 antibodies;
preferably, the heavy chain variable region of the 2D9B9 antibody comprises VH-CDR1, VH-CDR2, VH-CDR3 of the amino acid sequences shown in SEQ ID nos. 1, 2, 3; the light chain variable region of the 2D9B9 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID NO.9, 10 and 11;
preferably, the heavy chain variable region of the 2D9B9 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 2D9B9 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.4, 5, 6 and 7, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.12, 13, 14 and 15;
Preferably, the heavy chain variable region of the 2D9B9 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 8; the light chain variable region of the 2D9B9 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 16;
preferably, the amino acid sequence of the heavy chain variable region of the 2D9B9 antibody is shown as SEQ ID NO. 8; the amino acid sequence of the light chain variable region of the 2D9B9 antibody is shown as SEQ ID NO. 16;
preferably, the heavy chain variable region of the 2F5F8 antibody comprises the VH-CDR1, VH-CDR2, VH-CDR3 of the amino acid sequences shown in SEQ ID NO.17, 18, 19; the light chain variable region of the 2F5F8 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID NO.25, 26 and 27;
preferably, the heavy chain variable region of the 2F5F8 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 2F5F8 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.20, 21, 22 and 23, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.28, 29, 30 and 31;
Preferably, the heavy chain variable region of the 2F5F8 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 24; the light chain variable region of the 2F5F8 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 32;
preferably, the amino acid sequence of the heavy chain variable region of the 2F5F8 antibody is shown in SEQ ID NO. 24; the amino acid sequence of the light chain variable region of the 2F5F8 antibody is shown as SEQ ID NO. 32;
preferably, the heavy chain variable region of the 3B2F7 antibody comprises the VH-CDR1, VH-CDR2, VH-CDR3 of the amino acid sequences shown in SEQ ID NO.33, 34, 35; the light chain variable region of the 3B2F7 antibody comprises VL-CDR1, VL-CDR2 and VL-CDR3 of the amino acid sequences shown in SEQ ID NO.41, 42 and 43;
preferably, the heavy chain variable region of the 3B2F7 antibody further comprises heavy chain variable region framework regions FR1, FR2, FR3 and FR4; the light chain variable region of the 3B2F7 antibody further comprises light chain variable region framework regions FR1, FR2, FR3 and FR4; wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.36, 37, 38 and 39, and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3 and FR4 are shown as SEQ ID NO.44, 45, 46 and 47;
Preferably, the heavy chain variable region of the 3B2F7 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 40; the light chain variable region of the 3B2F7 antibody is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID No. 48;
preferably, the amino acid sequence of the heavy chain variable region of the 3B2F7 antibody is shown as SEQ ID NO. 40; the amino acid sequence of the light chain variable region of the 3B2F7 antibody is shown as SEQ ID NO. 48;
preferably, the heavy chain subtype of the 2D9B9 antibody is IgG2B;
preferably, the heavy chain subtype of the 2F5F8, 3B2F7 antibody is IgG1.
2. A hybridoma cell capable of secreting the monoclonal antibody of claim 1;
preferably, the hybridoma cells comprise any one of the following: 2D9B9, 2F5F8, 3B2F7.
3. A nucleic acid molecule encoding the monoclonal antibody of claim 1.
4. A vector comprising the nucleic acid molecule of claim 3.
5. A host cell comprising the nucleic acid molecule of claim 3 or the vector of claim 4.
6. A drug conjugate comprising the monoclonal antibody of claim 1;
preferably, the drug conjugate further comprises a coupling moiety selected from the group consisting of: a detectable label, drug, toxin, cytokine or enzyme.
7. A pharmaceutical composition comprising the monoclonal antibody of claim 1, the nucleic acid molecule of claim 3, the vector of claim 4, the host cell of claim 5, or the drug conjugate of claim 6;
preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
8. A product for detecting or determining Mfa protein or an antigenic fragment thereof in a sample, said product comprising the monoclonal antibody of claim 1;
preferably, the product further comprises a reagent for processing the sample.
9. The method comprises the following steps:
1) A method of detecting Mfa protein or an antigenic fragment thereof in a sample of non-diagnostic interest, said method comprising contacting the monoclonal antibody of claim 1 with a test sample;
Preferably, the method further comprises determining the presence or level of Mfa protein or antigenic fragment thereof in the test sample;
2) A method of producing the monoclonal antibody of claim 1, comprising culturing the hybridoma cell of claim 2 or the host cell of claim 5, thereby producing the monoclonal antibody.
10. Any of the following applications:
1) Use of the monoclonal antibody of claim 1, the nucleic acid molecule of claim 3, the vector of claim 4, the host cell of claim 5, the product of claim 8 in the detection of Mfa1 protein or an antigenic fragment thereof;
2) Use of the monoclonal antibody of claim 1, the nucleic acid molecule of claim 3, the vector of claim 4, the host cell of claim 5, the product of claim 8 for the preparation of a product for diagnosing Mfa 1-related diseases;
3) Use of the monoclonal antibody of claim 1, the nucleic acid molecule of claim 3, the vector of claim 4, the host cell of claim 5, the drug conjugate of claim 6, the pharmaceutical composition of claim 7 for the preparation of a medicament for the treatment of Mfa 1-related diseases;
4) Use of the monoclonal antibody of claim 1 in the preparation of the nucleic acid molecule of claim 3, the vector of claim 4, the host cell of claim 5, the drug conjugate of claim 6, the pharmaceutical composition of claim 7 or the product of claim 8;
5) Use of the nucleic acid molecule of claim 3 for the preparation of the vector of claim 4, the host cell of claim 5 or the pharmaceutical composition of claim 7;
6) Use of the vector of claim 4 for the preparation of the host cell of claim 5 or the pharmaceutical composition of claim 7;
7) Use of the host cell of claim 5 for the preparation of a pharmaceutical composition of claim 7;
preferably, the Mfa 1-associated disease comprises a disease associated with a p.gingivalis infection;
preferably, the p.gingivalis infection comprises periodontitis, bone resorption, cardiovascular disease, rheumatoid, brain disorders, bad pregnancy outcome, obesity, inflammatory enteritis, cancer, diabetes, non-alcoholic steatohepatitis;
preferably, the p.gingivalis infection comprises periodontitis and bone resorption;
Preferably, the bone resorption is alveolar bone resorption.
CN202310950240.7A 2023-07-31 2023-07-31 Porphyromonas gingivalis Mfa monoclonal antibody and application thereof Active CN116751292B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310950240.7A CN116751292B (en) 2023-07-31 2023-07-31 Porphyromonas gingivalis Mfa monoclonal antibody and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310950240.7A CN116751292B (en) 2023-07-31 2023-07-31 Porphyromonas gingivalis Mfa monoclonal antibody and application thereof

Publications (2)

Publication Number Publication Date
CN116751292A true CN116751292A (en) 2023-09-15
CN116751292B CN116751292B (en) 2024-05-14

Family

ID=87953414

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310950240.7A Active CN116751292B (en) 2023-07-31 2023-07-31 Porphyromonas gingivalis Mfa monoclonal antibody and application thereof

Country Status (1)

Country Link
CN (1) CN116751292B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118598992A (en) * 2024-08-05 2024-09-06 广州医科大学 Antibody for detecting porphyromonas gingivalis Mfa and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101014363A (en) * 2004-05-21 2007-08-08 辉瑞产品公司 Vaccine for periodontal disease
CN102712693A (en) * 2009-08-02 2012-10-03 圣诺菲·帕斯图尔有限公司 Porphyromonas gingivalis polypeptides
KR20130020393A (en) * 2011-08-19 2013-02-27 경희대학교 산학협력단 Monoclonal antibody specific against fima protein of porphyromonas gingivalis, nucleotide sequence coding thereof, and pharmaceutical composition comprising thereof
WO2019075260A1 (en) * 2017-10-12 2019-04-18 Sutrovax, Inc. Periodontitis vaccine and related compositions and method of use
CN112010981A (en) * 2020-09-10 2020-12-01 南京妙迪生物科技有限公司 Mouse anti-human IgG monoclonal antibody

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101014363A (en) * 2004-05-21 2007-08-08 辉瑞产品公司 Vaccine for periodontal disease
CN102712693A (en) * 2009-08-02 2012-10-03 圣诺菲·帕斯图尔有限公司 Porphyromonas gingivalis polypeptides
KR20130020393A (en) * 2011-08-19 2013-02-27 경희대학교 산학협력단 Monoclonal antibody specific against fima protein of porphyromonas gingivalis, nucleotide sequence coding thereof, and pharmaceutical composition comprising thereof
WO2019075260A1 (en) * 2017-10-12 2019-04-18 Sutrovax, Inc. Periodontitis vaccine and related compositions and method of use
CN112010981A (en) * 2020-09-10 2020-12-01 南京妙迪生物科技有限公司 Mouse anti-human IgG monoclonal antibody

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
李昂;谢红帼;梁平;朱春晖;石建峰;饶国洲;苟建重;: "牙龈卟啉单胞菌菌毛蛋白FimA基因在大肠杆菌中的融合表达和纯化", 华西口腔医学杂志, no. 03, 20 June 2010 (2010-06-20), pages 19 - 23 *
郑赛男;蒋丽;李伟;: "口腔细菌黏附机制的研究进展", 国际口腔医学杂志, no. 02, 1 March 2016 (2016-03-01), pages 105 - 109 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118598992A (en) * 2024-08-05 2024-09-06 广州医科大学 Antibody for detecting porphyromonas gingivalis Mfa and application thereof
CN118598992B (en) * 2024-08-05 2024-11-05 广州医科大学 Antibody for detecting porphyromonas gingivalis Mfa and application thereof

Also Published As

Publication number Publication date
CN116751292B (en) 2024-05-14

Similar Documents

Publication Publication Date Title
CN104903350B (en) It is specific to the new antibodies and application thereof of CLEC14A
EA023406B1 (en) Anti-hepcidin antibodies and uses thereof
CN116003598B (en) Recombinant humanized monoclonal antibody targeting human GPRC5D and application thereof
CN110028584B (en) Bispecific antibodies against EGFR and MET proteins
CN113307869B (en) anti-IL 5 nano antibody and application thereof
US20220119546A1 (en) Plectin-1 binding antibodies and uses thereof
US20230391886A1 (en) Compositions and methods for muc18 targeting
US20180250360A1 (en) Method for detecting cancer cells, reagent for introducing substance into cancer cells, and composition for treating cancer
CN116751292B (en) Porphyromonas gingivalis Mfa monoclonal antibody and application thereof
KR20120078192A (en) Serum amyloid a specific monoclonal antibody and hybridoma cell producing the same
KR20180114936A (en) Methods and compositions for the detection and diagnosis of kidney disease and periodontal disease
CN113999303B (en) Novel coronavirus nucleocapsid protein antibodies for in vitro diagnosis
CN111378040B (en) Antibody for detecting multiple malignant tumor cells and application thereof
CN118546246A (en) Antibodies, antibody fragments, and uses thereof that specifically bind IL-8
CN114685664B (en) Single-domain antibody for resisting human B lymphocyte surface antigen CD20 and application thereof
CN107868127A (en) A kind of monoclonal antibody for being used to detect Oncoprotein Expression in histopathologic slide
CN116731169A (en) Nano antibody with sortilin 1 specificity and application thereof
WO2021083248A1 (en) Anti-tspan8 monoclonal antibody and use thereof
EP3922646A1 (en) Detection of malignant tumor cells antibodies and uses thereof
KR102695052B1 (en) Comosition for Detecting Infectious Myonecrosis Virus Contiaining Monoclonal Antibody Specific for Infectious Myonecrosis Virus
KR102695056B1 (en) Comosition for Detecting Koi Herpes Virus Contiaining Monoclonal Antibody Specific for Koi Herpes Virus
CN117510636B (en) GPRC5D antibody and application thereof
CN112538117B (en) Anti-human carcinoembryonic antigen antibody and coding gene and application thereof
CN113999302B (en) Novel coronavirus nucleocapsid protein antibodies for in vitro diagnosis
EP3936523A1 (en) Detection of malignant tumor cells antibodies and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant