CN116747305A

CN116747305A - Drug target for resisting pulmonary fibrosis and application

Info

Publication number: CN116747305A
Application number: CN202310569976.XA
Authority: CN
Inventors: 陈冰
Original assignee: Kunming University
Current assignee: Kunming University
Priority date: 2023-05-19
Filing date: 2023-05-19
Publication date: 2023-09-15

Abstract

The application relates to application of CD31 and CD34, VEGF and/or TGF-beta 1 as targets in resisting pulmonary fibrosis, and relates to the field of medicines. The application provides application of CD31 and CD34, VEGF and/or TGF-beta 1 as targets in anti-pulmonary fibrosis, and provides a new action target for developing anti-pulmonary fibrosis medicines.

Description

Drug target for resisting pulmonary fibrosis and application

Technical Field

The application relates to the field of medicines, in particular to a medicine target spot for resisting pulmonary fibrosis and application thereof, and particularly relates to application of CD31 and CD34, VEGF and/or TGF-beta 1 serving as target spots in preparing medicines for treating the pulmonary fibrosis and application of inhibitors of CD31 and CD34, VEGF and/or TGF-beta 1 in preparing medicines for treating the pulmonary fibrosis.

Background

Idiopathic pulmonary interstitial fibrosis (idiopathic pulmonary interstitial fibrosis, IPF) is a special type of chronic progressive fibrotic interstitial pneumonia localized to the lungs ^【1,2】 The pathogenesis is unknown, the disability and mortality rate is high, and the disease is a serious and serious worldwide disease. The currently available drugs of pirfenidone and nidanib are expensive, have obvious side effects and poor accessibility, and the like, and the fibrosis progress is considered to be another treatment method with great potential except for lung transplantation, but the treatment response of an IPF patient to the traditional immunomodulatory therapy is not ideal.

In recent years, the field of traditional Chinese medicine carries out meaningful researches on the diseases, and the core pathogenesis of the deficiency, the excess, the deficiency and the excess and the mixed deficiency and excess is becoming clear, but attempts on highland medicine resources are rarely made. "Tianlong" is a prescription with the characteristic of vivid cloud medicine, and has the functions of invigorating the vital energy, promoting blood circulation and removing obstruction in collaterals. The prior study shows that the formulation of the pseudo-ginseng and the rhodiola rosea has obvious effect of inhibiting hypoxia-induced pulmonary angiogenesis, the Yunnan dragon's blood can effectively slow down the alveolitis and fibrosis progress induced by bleomycin, and the mechanism of the Yunnan dragon's blood is possibly related to regulating IL-4/IFN-gamma imbalance and inhibiting the expression of a core promoter FIZZ1 of 'inflammatory burst cascade reaction' in the lung so as to prevent subsequent series of changes such as collagen deposition, angiogenesis and the like.

Disclosure of Invention

Aiming at the situation that patients with advanced IPF have good strategy, the application selects the dragon's blood compound to perform stage intervention on experimental PF, and detects CD31 and CD34, VEGF, hyp and TGF-beta ₁ Expression in lung tissue and pathological changes of the lung tissue are combined to investigate the pharmacodynamic action mechanism of the dragon's blood, and attempt to enrich IPF therapeutic targets.

In order to achieve the above purpose, the application provides a drug target for resisting pulmonary fibrosis and application thereof, and the specific technical scheme is as follows:

use of CD31 and CD34, VEGF and/or TGF- β1 as targets in the manufacture of a medicament for treating pulmonary fibrosis.

Further, the use includes use in the manufacture of a medicament for treating pulmonary fibrosis, the disease including idiopathic pulmonary interstitial fibrosis.

Use of inhibitors of CD31 and CD34, VEGF and/or TGF- β1 for the manufacture of a medicament for the treatment of pulmonary fibrosis.

Further, the medicine can down regulate the protein expression of CD31 and CD34, reduce the lung coefficient and inhibit the abnormal generation of pathological pulmonary tissue microvasculature.

Further, the medicament inhibits VEGFmRNA and protein expression, reduces the Hyp content of lung tissues, and inhibits the abnormal generation of micro blood vessels of lesion lung tissues.

Further, the medicament reduces TGF-beta 1mRNA and protein expression, inhibits alveolar inflammation and interstitial proliferation, and reduces collagen deposition.

Further, the inhibitor is dragon's blood.

Further, the dragon's blood includes: rhodiola rosea, pseudo-ginseng and Yunnan dragon's blood.

Further, the rhodiola rosea is the dry root and rhizome of rhodiola crenulata of Crassulaceae, the pseudo-ginseng is the root of pseudo-ginseng of Araliaceae, and the resina draconis is the resin of the dracaena cochinchinensis of Liliaceae.

Compared with the prior art, the application has the beneficial effects that:

(1) The application provides application of CD31 and CD34, VEGF and/or TGF-beta 1 as targets in preparing medicaments for treating pulmonary fibrosis, and provides new action targets for medicaments for resisting pulmonary fibrosis.

Drawings

FIG. 1 shows the positive rate of CD31 and CD34 protein expression in rats of experiment 1;

FIG. 2 is a schematic representation of the immunohistochemical microscopic imaging (10X 10) of CD31 from each group of rats in experiment 1 of the present application;

FIG. 3 is a schematic representation of CD34 immunohistochemical microscopy (10X 10) for each group of rats in experiment 1 of the present application;

FIG. 4 shows a graph of the VEGF gene real-time amplification and product melting curve of experiment 2 of the present application

(note: a is an amplification curve, b is a melting curve);

FIG. 5 shows the detection of PF rat VEGF protein expression by SABC method in accordance with experiment 2 of the present application;

FIG. 6 is a colorimetric detection of PF rat Hyp expression according to experiment 2 of the present application;

FIG. 7 shows a real-time amplification curve of TGF-beta 1 gene and a melting curve of the product of experiment 3 of the present application

(Note: a is amplification curve and b is melting curve)

FIG. 8 shows the detection of TGF-beta 1 protein expression by Western Blot method of experiment 3 of the present application

FIG. 9 shows the observation of HE staining (10X 10) and MASSN staining (10X 10) of lung tissue from rats in each group of experiment 3 according to the present application

Detailed Description

The objects, technical solutions and advantages of the present application will become more apparent by the following detailed description of the present application when taken in conjunction with the accompanying drawings. It should be understood that the description is only illustrative and is not intended to limit the scope of the application. In addition, in the following application, descriptions of well-known structures and techniques are omitted so as not to unnecessarily obscure the concepts of the present application.

The cloud medicine "Tianlong dragon' is applied to IPF patients in early clinic, and the ideal curative effect is obtained through a random contemporaneous control experiment. Rhodiola rosea is used as a monarch drug for supplementing zong-qi, promoting blood circulation and relieving asthma; 37. dragon blood is good at activating blood circulation, removing blood stasis, dredging collaterals and resolving hard mass, and is used as ministerial drug together with the other drugs; notoginseng radix can strengthen body, and is an adjuvant drug for tonifying the body qi. The dragon's blood has natural property, is based on the compatibility of ' horn drugs ', has the effects of strengthening and nourishing the zong qi, promoting blood circulation and removing obstruction in collaterals, and is suitable for the core pathogenesis of the pulmonary interstitial fibrosis (consumptive lung disease/arthralgia) with the deficiency of zong qi and the stasis of lung collaterals.

Experiment 1: influence of cloud medicine "Tianlong" stage intervention on expression of CD31 and CD34 and lung coefficient of PF rat lung tissue

Materials and methods

1. Animals and groups

SPF-class male Wistar rats 60, 6-8 weeks old, 180-200 g in mass, supplied by Chengdu laboratory animal Co., ltd (regular animal number: SCXK 2020-030). SPF-class Barrier Environment (animal experiment license number: SYXK (Dian) K2013-0007) in the university of Chinese medicine center laboratory of Yunnan. The temperature is 22+/-2 ℃, the humidity is 50% -60%, and 12h/12h of illumination and night circulation are carried out. All animal experiments in this study were approved by the ethical review board of animal experiments at the university of Yunnan traditional Chinese medicine (No. R-062021096).

Experimental animals were randomly divided into 9 groups: blank (C), model control early (ME), model control late (ML), dragon's early intervention (TEM), day Long Jie late intervention low dose (TLL), day Long Jie late intervention medium dose (TLM), day Long Jie late intervention high dose (TLH), pirfenidone early intervention (PFDE), pirfenidone late intervention (PFDL).

2. Main medicine and reagent

TABLE 1 Main drugs, reagents, antibodies

Table 1 Main Main Drugs,Reagents,Antibodies

3. Main instrument

TABLE 2 Main laboratory apparatus

Table 2 Main Experimental Instruments

Name of the name	Manufacturer' s
		Medical centrifuge (H1850R)	HUNAN XIANGYI LABORATORY INSTRUMENTS DEVELOPMENT Co.,Ltd.
Front fluorescence microscopic imaging system (C1/Ds-Fi)	NiKon
		GENEGNOME XRQ chemiluminescent imager	GENEGNOME
SX-700 steam sterilizer	TOMY KOGYO
		Quantum real-time fluorescence quantitative PCR instrument	Applied Biosystems
SYN-ERGY H1 multifunctional full-band enzyme-labeled instrument	BioTek
		SW-CT-1F ultra-clean workbench	The Antai technique hasLimited company
VE-386 protein transfer printing instrument	Tan
		RM2016 paraffin slicer	Leica
XSP-C204 microscope	CIC

The method comprises the following steps: the method of bleomycin is adopted to build a rat PF model. 90 rats were randomly divided into 9 groups: blank control group, model early group, model late group, dragon's blood early intervention group, low, medium and high dose group of day Long Jie late intervention, pirfenidone early intervention group, pirfenidone late intervention group. The early intervention group and the late intervention group are respectively used for filling corresponding medicines on the 7 th day or the 14 th day after molding, continuously taking medicines, observing the survival state of the rat and taking materials on the 28 th day after molding. Protein expression of CD31, CD34 in lung tissue was detected by SABC technique and lung coefficients were calculated by stripping off the lungs.

4. Moulding administration and material drawing

Fasted non-forbidden water treatment 12 hours before model preparation, reference method ^【8】 With the improvement, rats in each group are anesthetized by intraperitoneal injection of 10% chloral hydrate (3 ml/kg), a blank group is injected with 0.3ml of physiological saline, the other groups are slowly injected with bleomycin hydrochloride solution for injection (5 mg/kg is dissolved in 0.3ml of 0.9% sodium chloride injection) through a tracheal cannula needle, and immediately after the injection, the rats are erected and rotated left and right along the longitudinal axis of the body for 3 minutes to ensure that the liquid medicine is uniformly distributed.

Dosage of administration: calculating equivalent amount by referring to equivalent dose rate table of human and animal body surface area conversion ^【9】 . Pirfenidone equivalent weight is 0.12 mg/kg.d, dragon's blood equivalent weight is 2.52 g/kg.d, 3ml distilled water is taken as suspension, and model group is given to equal volume distilled water for stomach filling. The early intervention group and the late intervention group were dosed at day 7 and day 14 after molding, respectively, and were obtained at day 28.

At the end of the experiment, 10% chloral hydrate (3 ml/kg) was injected intraperitoneally for anesthesia, the head and limbs were fixed, the abdominal cavity was opened, and abdominal aorta was collected and sacrificed; injecting normal saline at 4 ℃ into pulmonary artery after chest opening, washing out blood in the lung, cutting out pulmonary portals, sucking surface water by filter paper, intercepting double lung tissues, and taking lower right lung as tissue homogenate; the left lung tissue is fixed in 10% neutral buffer formalin solution (PH 7.4), a tissue block with the thickness of 0.3cm is cut at the maximum transverse diameter of the left lower lung tissue, the tissue block is dehydrated and xylene is transparent, and the tissue block is embedded by an automatic paraffin embedding machine, and is sliced by an automatic slicing machine with the thickness of 4 mu m for standby.

5. Determination of CD31 and CD34 content in Lung tissue

The positive rate of CD31 and CD34 expression in the lung tissue of PF rat is detected by SABC technology, and the experimental steps are strictly carried out according to the instruction of SABC kit. Interpretation of the results: hematoxylin-stained nuclei were blue and DAB chromogenically positive expression was brown-yellow.

6. Lung coefficient determination

Rats were sacrificed by abdominal aortic exsanguination, the lungs of the rats were rapidly freed, the changes in lung morphology were observed, weighed, and the lung coefficients, i.e., wet lung weight (g)/body weight (kg) x 100%, were calculated.

7. Statistical method

Statistical treatment with SPSS21.0 statistical analysis software, the data were measured as mean.+ -. Standard deviationThe two groups are compared by t test, multiple comparison adopts SNK method, and P is used<A difference of 0.05 is statistically significant.

Results:

1. changes in CD31 and CD34 protein expression in rat lung tissue

The expression level of CD31 and CD34 protein in the lung tissues of rats in each model group is obviously increased compared with that in a blank control group (P < 0.001). CD31 and CD34 protein expression levels were significantly reduced (P <0.01, P < 0.001) in each intervention group compared to the model group. There were significant differences (P <0.05, P < 0.01) between the early-intervention group of dragon's blood and the low and medium-dose groups of late-intervention. Day Long Jie late intervention there was a significant difference between the high, medium and low dose groups compared (P <0.05, P < 0.01). The early intervention of dragon's blood was not significantly different from the early intervention of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention of pirfenidone (P > 0.05). (Table 3, FIGS. 1-3)

TABLE 3 relative expression of CD31 and CD34 proteins in PF rat lung tissuen＝9)

Group of	CD31	CD34
			C	2.292±0.807	2.457±0.661
ME	15.511±1.940***	17.276±1.032***
			ML	17.433±2.560***	18.223±2.110***
TEM	5.025±0.579 ^△△△	4.955±1.812 ^△△△
			TLL	8.968±0.230 ^△△##	8.955±2.430 ^△△##
TLM	6.308±1.544 ^△△#Ο	6.323±0.535 ^△△#Ο
			TLH	4.882±1.143 ^{△△△ΟΟ}	5.074±0.535 ^△△△Ο
PFDE	4.536±0.474 ^△△△	4.264±0.641 ^△△△
			PFDL	5.963±0.185 ^△△	5.849±0.971 ^△△

Note that: model group was compared with blank group, P <0.05, P <0.01, P <0.001;

each of the drug intervention groups was compared to the model group, ^△ P<0.05， ^△△ P<0.01， ^△△△ P<0.001；

early intervention of dragon's blood was compared with late intervention in each group, ^# P<0.05， ^## P<0.01， ^### P<0.001；

day Long Jie late intervention was performed in the high and medium dose groups compared to the low dose groups, ^○ P<0.05， ^○○ P<0.01， ^○○○ P<0.001。

2. rat pulmonary coefficient changes

The lung mass and lung coefficient of PF rats in each model group were significantly increased (P <0.01, P < 0.001) compared to the blank group. Compared with the model group, the lung quality and lung coefficient of each intervention group are obviously reduced (P <0.05, P < 0.01). The interference groups of dragon's blood were not significantly different from the group of bifeitinone (P > 0.05) (Table 4)

TABLE 4 PF rat lung Mass and Lung coefficient variationn＝9)

Group of	Lung quality (g)	Pulmonary coefficient (%)
			C	1.627±0.055	0.40±0.01
ME	2.063±0.104**	0.70±0.01***
			ML	2.103±0.095**	0.71±0.02***
TEM	1.707±0.093 ^△	0.47±0.02 ^△△
			TLL	1.830±0.056 ^△	0.54±0.02 ^△△
TLM	1.787±0.061 ^△	0.51±0.02 ^△△
			TLH	1.727±0.085 ^△	0.48±0.02 ^△△
PFDE	1.657±0.015 ^△	0.44±0.01 ^△△
			PFDL	1.683±0.040 ^△	0.45±0.02 ^△△

each of the drug intervention groups was compared to the model group, ^△ P<0.05， ^△△ P<0.01， ^△△△ P<0.001。

from the above, it can be seen that: (1) CD31 and CD34 expression: compared with the model group, the early and late intervention of the dragon's blood can reduce the protein expression level of CD31 and CD34 in the lung tissue of the PF rat (P <0.01, P < 0.001); there were significant differences (P < 0.05) in early versus late intervention dose groups; there was a significant difference (P < 0.05) between the late-intervention high and medium dose groups compared to the low dose group. Early and late intervention with pirfenidone reduced CD31 and CD34 protein expression levels (P < 0.05) in lung tissues of PF rats. The early intervention of dragon's blood was not significantly different from the early intervention of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention of pirfenidone (P > 0.05). (2) Lung coefficient: compared with the model group, the lung quality and the lung coefficient of the dragon's blood intervention group are obviously reduced (P <0.05, P < 0.01). The interference groups of dragon's blood were not significantly different from the pirfenidone group (P > 0.05).

Conclusion: the dragon's blood is used as an inhibiting agent for down regulating the protein expression of CD31 and CD34, reducing the lung coefficient, inhibiting the micro-vascular abnormality generation of lesion lung tissue, effectively reducing the protein expression of CD31 and CD34 in the lung tissue of PF rat in early and late interventions, reducing the lung coefficient and being more effective in early interventions. Therefore, the CD31 and CD34 can be used as drug attack targets for treating pulmonary fibrosis to further treat the pulmonary fibrosis by developing and preparing protein expression medicaments for inhibiting the CD31 and the CD 34.

Experiment 2: influence of cloud drug "Dragon's blood" stage intervention on PF rat lung tissue VEGF and Hyp expression

1. Materials and methods

1. Animals and groups

SPF-class male Wistar rats 90, 6-8 weeks old, 180-200 g in mass, supplied by Chengdu laboratory animal Co., ltd (regular animal number: SCXK 2020-030). SPF-class Barrier Environment (animal experiment license number: SYXK (Dian) K2013-0007) in the university of Chinese medicine center laboratory of Yunnan. The temperature (22+/-2) DEG C, the humidity of 50% -60%, 12h/12h illumination and night circulation. All animal experiments in this study were approved by the ethical review board of animal experiments at the university of Yunnan traditional Chinese medicine (No. R-062021096).

Experimental animals were randomly divided into 9 groups: blank (C), model control early (ME), model control late (ML), dragons early intervention mid dose (TEM), day Long Jie late intervention low dose (TLL), day Long Jie late intervention mid dose (TLM), day Long Jie late intervention high dose (TLH), pirfenidone early intervention (PFDE), pirfenidone early intervention (PFDL).

2. Main medicine and reagent

TABLE 5 principal drugs, reagents, antibodies

Table 1 Main Main Drugs,Reagents,Antibodies

3. Main instrument

TABLE 6 Main laboratory instrument

Table 2 Main Experimental Instruments

The method comprises the following steps: the method of bleomycin is adopted to build a rat PF model. 90 rats were randomly divided into 9 groups: blank control group, model early group, model late group, intermediate dose group of Dragon early intervention, low, intermediate and high dose groups of day Long Jie late intervention, pirfenidone early intervention group, and pirfenidone late intervention group. The early intervention group and the late intervention group are respectively used for filling corresponding medicines on the 7 th day or the 14 th day after molding, continuously taking medicines, observing the survival state of the rat and taking materials on the 28 th day after molding. Protein and mRNA expression levels of VEGF in lung tissues are detected by SABC and RT-PCR technology, and Hyp content in lung tissues is detected by a colorimetric method.

4. Moulding administration and material drawing

Fasted non-forbidden water treatment 12 hours before model preparation, reference method ^【8】 Modified, rats of each group were anesthetized with 10% chloral hydrate (3 ml/kg) by intraperitoneal injection, blank controlThe group is injected with 0.3ml of physiological saline, the rest groups are slowly injected with bleomycin hydrochloride solution for injection (5 mg/kg is dissolved in 0.3ml of 0.9% sodium chloride injection) through an endotracheal intubation needle, and immediately after the injection, the rat is erected and rotated left and right along the longitudinal axis of the rat body for 3 minutes to ensure that the liquid medicine is uniformly distributed.

Dosage of administration: calculating equivalent amount by referring to equivalent dose rate table of human and animal body surface area conversion ^【9】 . Pirfenidone is taken to have the equivalent weight of 0.12 mg/kg.d, dragon's blood is taken to have the equivalent weight of 2.52 g/kg.d, 3ml distilled water is taken as suspension, and the model group is subjected to equal volume distilled water gastric lavage. The early intervention group and the late intervention group were dosed at day 7 and day 14 after molding, respectively, and were obtained at day 28.

5. VEGF content determination in lung tissue

VEGF protein content in lung tissue of PF rat is detected by SABC technology, and VEGF mRNA expression in lung tissue of PF rat is detected by RT-PCR technology.

TABLE 7 names and sequences of rat q-PCR primers

Gene name	Primer sequence (5 '-3')
		VEGF	Forward primer：TCGGACGAAGTTGAACATGATGACC
	Reverse primer：CGCCACAACGATGTAGCTCCAC

6. Determination of Hyp content in lung tissue

By colorimetric method ^【10】 The Hyp content in the lung homogenate was determined.

All the above assays were performed strictly according to the protocol of the instructions in the kit.

7. Statistical method

Results: 1. rat lung tissue VEGFmRNA and protein expression changes

VEGF mRNA and protein expression levels in the lung tissues of rats in each model group were significantly increased (P < 0.01) compared with the blank control group. VEGF mRNA and protein expression levels were significantly reduced (P <0.05, P < 0.01) in each intervention group compared to the model group. There were significant differences (P <0.05, P < 0.01) between the early-intervention group of dragon's blood and the late-intervention low-dose group. Day Long Jie late intervention was significantly different in the high, medium and low dose groups (P < 0.05) compared to the low dose group. The early intervention group of dragon's blood was not significantly different from the early intervention group of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention group of pirfenidone (P > 0.05). (Table 8, FIG. 4, FIG. 5)

TABLE 8 relative expression levels of VEGFmRNA and protein in PF rat lung tissuen＝9)

day Long Jie late intervention was performed in the high and medium dose groups compared to the low dose groups, ^○ P<0.05， ^○○ P<0.01，， ^○○○ P<0.001。

2. rat lung tissue Hyp expression changes

The hydroxyproline expression in lung tissue showed a significant trend of increase (P < 0.01) compared to the control group; each intervention group had reduced hydroxyproline expression (P <0.05, P < 0.01) compared to the model group; late-stage intervention effects on day Long Jie exhibit a dose-dependent behavior; the early intervention of dragon's blood was not significantly different from the early intervention of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention of pirfenidone (P > 0.05). (FIG. 6)

From the above, it can be seen that: (1) VEGF expression: compared with the model group, the early intervention and the late intervention of the dragon's blood can reduce the expression level of VEGF mRNA and protein in lung tissues of PF rats (P <0.05, P < 0.01); there were significant differences (P <0.05, P < 0.01) in early versus late intervention dose groups; there was a significant difference (P < 0.05) between the late-intervention high and medium dose groups compared to the low dose group. Early and late intervention with pirfenidone reduced mRNA and protein expression levels of VEGFF in lung tissue of PF rats (P < 0.01). The early intervention of dragon's blood was not significantly different from the early intervention of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention of pirfenidone (P > 0.05). (2) Hyp expression: reduced hydroxyproline expression (P <0.05, P < 0.01) for each intervention group compared to the model group; late-stage intervention effects on day Long Jie exhibit a dose-dependent behavior; there was no significant difference in early intervention of dragon's blood compared to early intervention of pirfenidone (P < 0.05), and in late intervention of day Long Jie there was no significant difference in the dose group compared to late intervention of pirfenidone (P < 0.05).

Conclusion: the dragon's blood is used as an inhibiting drug for inhibiting VEGFmRNA and protein expression, reducing the Hyp content of lung tissues, and reducing collagen deposition by inhibiting the abnormal generation of micro blood vessels of lesion lung tissues, so that the pulmonary fibrosis process is inhibited, and the early intervention is more effective. Therefore, medicines for inhibiting the expression of VEGF can be prepared in early stage through research and development, VEGF is used as a medicine attack target for treating pulmonary fibrosis, and the Hyp content in lung tissues is further reduced for treating pulmonary fibrosis.

Experiment 3: influence of stage intervention of cloud medicine "Tianlong" on expression and pathological changes of lung fibrosis rat lung tissue TGF-beta 1

The method comprises the following steps: the method of bleomycin is adopted to build a rat PF model. 90 rats were randomly divided into 9 groups: blank control group, model early group, model late group, intermediate dose group of Dragon early intervention, low, intermediate and high dose groups of day Long Jie late intervention, pirfenidone early intervention group, pirfenidone late intervention group. The early intervention group and the late intervention group respectively perfuse the corresponding medicines on the 7 th day or the 14 th day after molding, continuously take medicines, observe the survival state of rats, and draw materials on the 28 th day after molding. The protein and mRNA expression level of TGF-beta 1 in lung tissue is detected by SABC and RT-PCR technology, and pathological changes of the lung tissue are observed by HE staining and Masson triple staining.

1. Materials and methods

1. Animals and groups

2. Main medicine and reagent

TABLE 9 principal drugs, reagents, antibodies

3. Main instrument

Table 10 Main laboratory apparatus

Name of the name	Manufacturer' s
		Medical centrifuge (H1850R)	HUNAN XIANGYI LABORATORY INSTRUMENTS DEVELOPMENT Co.,Ltd.
Front fluorescence microscopic imaging system (C1/Ds-Fi)	NiKon
		GENEGNOME XRQ chemiluminescent imager	GENEGNOME
SX-700 steam sterilizer	TOMY KOGYO
		Quantum real-time fluorescence quantitative PCR instrument	Applied Biosystems
SYN-ERGY H1 multifunctional full-band enzyme-labeled instrument	BioTek
		SW-CT-1F ultra-clean workbench	Antai technologies Co Ltd
VE-386 protein transfer printing instrument	Tan
		RM2235 paraffin slicer	Leica

4. Moulding administration and material drawing

Fasted non-forbidden water treatment 12 hours before model preparation, reference method ^【8】 With the improvement, rats in each group are anesthetized by intraperitoneal injection of 10% chloral hydrate (3 ml/kg), a blank group is injected with 0.3ml of physiological saline, and the rest groups are slowly injected with bleomycin hydrochloride solution for injection (5 mg/kg is dissolved in 0.3ml of 0.9% sodium chloride injection) through a tracheal cannula needle, and immediately after injection, the rats are erected and rotated left and right along the longitudinal axis of the body for 3 minutes to ensure that the liquid medicine is uniformly distributed.

Dosage of administration: reference to humans and animalsEquivalent dose rate table for converting body surface area to calculate equivalent quantity ^【9】 . Pirfenidone is taken as an equivalent amount of 0.12 mg/kg.d, dragon's blood is taken as an equivalent amount of 2.52 g/kg.d as a medium dose, 1.26 g/kg.d as a low dose, 5.04 g/kg.d as a high dose, 3ml of distilled water is taken as a suspension, and the model group is subjected to gastric lavage with equal volume of distilled water. Early intervention groups were dosed at day 7 post-molding, and late intervention groups were dosed at day 14 post-molding, all with material taken on day 28.

5. Detection of TGF-beta ₁ Expression of

Detection of TGF-beta in rat lung tissue and serum by SABC method ₁ The experimental procedure was strictly according to the kit instructions. Detection of TGF-beta in rat lung tissue and serum by RT-qPCR technique ₁ The experimental procedure was strictly followed according to the kit instructions.

TABLE 11 names and sequences of rat q-PCR primers

Gene name	Primer sequence (5 '-3')
		TGF-β	Forward primer：GACCGCAACAACGCAATCTATGAC
	Reverse primer：CTGGCACTGCTTCCCGAATGTC

6. Pathological morphology observation of rat lung tissue

The embedded lung tissue of the section was subjected to HE staining and Masson staining, respectively, and the image results were recorded using a panoramic scanner, according to Schissel SL ^[10] The criteria are integrated in stages. The above is strictly according to the specification.

7. Statistical method

Results: 1. rat lung tissue TGF-beta ₁ mRNA and protein expression changes

TGF-beta in rat lung tissue of each model group ₁ mRNA and protein expression levels were significantly elevated compared to the blank control (P<0.01，P<0.001). TGF-beta in each intervention group compared to model group ₁ mRNA and protein expression levels were significantly reduced (P)<0.05，P<0.01). There was a significant difference between the early intervention group of dragon's blood and the low and medium dose group of the late intervention (P<0.05). Day Long Jie late intervention was significantly different in the high, medium and low dose groups (P<0.05). Early intervention of dragon's blood was not significantly different from early intervention of pirfenidone (P)>0.05 No significant difference between the dose group in day Long Jie late intervention compared to pirfenidone late intervention (P)>0.05). (Table 4, FIG. 7, FIG. 8)

TABLE 12 PF relative expression levels of TGF-beta 1mRNA and protein in rat lung tissuen＝9)

2. pulmonary histopathological results

The dragon's blood and pirfenidone can reduce alveolitis and fibrosis degree to different degrees, so that the early intervention effect is most obvious. Quantitative analysis of alveolitis and fibrosis was performed in each group with no significant difference in early intervention scores (P > 0.05) for dragon's blood and pirfenidone. (Table 13, FIG. 9)

Table 13 quantitative analysis of alveolitis and fibrosis in rats of each group (n=9)

In fig. 9, HE staining results show that the alveolar walls of the rats in the blank group are thinner than those in the other groups, the morphological structure is smooth and complete, inflammatory cell infiltration is avoided, and congestion is avoided; the alveolar walls of the rats in the early and late groups of the model are obviously thickened, the alveolar structure is disordered, partial alveoli collapse and fusion are carried out, and interstitial inflammatory cell infiltration is carried out; the early (medium dose) intervention group of the dragon's blood, the late (low, medium and high dose) intervention group of the dragon's blood, the early and late intervention group of the pirfenidone, the degree of alveolar structure destruction of rats, the degree of alveolar interstitial inflammatory cell infiltration and the degree of fibrosis change are all lighter than those of rats in the early and late groups of the model, the early intervention is obviously improved compared with the late intervention, and the improvement situation is obvious along with the increase of the dose.

The Masson staining result shows that the alveoli of the rats in the blank control group have complete structures, and no blue collagen is deposited in the normal lung interstitium; thickening alveolar spaces of rats in early and late groups, damaging alveolar structures, and depositing blue collagen in each region of lung tissues; early (medium dose) intervention group of dragon's blood, late (low, medium and high dose) intervention group of dragon's blood, early and late intervention group of pirfenidone, rat alveolar structure destruction degree, blue collagen deposition degree and fibrosis change degree of each region in lung tissue are all lighter than that of model early and late group rats, early intervention is obviously improved than late intervention, and the improvement situation is obvious along with the increase of dose.

From the above, it can be seen that: (1) TGF-. Beta.1 expression: compared with the model group, the early and late intervention of the dragon's blood can reduce the mRNA and protein expression level of TGF-beta 1 in the lung tissue of the PF rat (P <0.05, P < 0.01); there were significant differences (P < 0.05) in early versus late intervention dose groups; there was a significant difference (P < 0.05) between the late-intervention high and medium dose groups compared to the low dose group. Early and late intervention with pirfenidone reduced TGF- β1mRNA and protein expression levels (P < 0.05) in lung tissue of PF rats. The early intervention of dragon's blood was not significantly different from the early intervention of pirfenidone (P > 0.05), and the dose group in the late intervention of day Long Jie was not significantly different from the late intervention of pirfenidone (P > 0.05). (2) Pathological changes: compared with the model group, the intervention of the dragon's blood and the pirfenidone can reduce alveolitis, collagen deposition and interstitial cell proliferation, and the early intervention effect is more obvious. The pathomorphology quantitative analysis shows that the early intervention scores of the dragon's blood and the pirfenidone have no obvious difference (P > 0.05).

Conclusion: the dragon's blood can be used as an inhibitory medicament, can reduce TGF-beta 1mRNA and protein expression, inhibit alveolar inflammation and interstitial hyperplasia, reduce collagen deposition, effectively slow down the process of bleomycin-induced alveolar inflammation and fibrosis, and has more effect in early intervention. Therefore, the TGF-beta 1 can be used as a drug attack target for treating pulmonary fibrosis by developing and preparing medicaments for inhibiting TGF-beta 1mRNA and protein expression, so that alveolar inflammation and interstitial hyperplasia are further inhibited, and collagen deposition is reduced for treating pulmonary fibrosis.

The method is as follows: the experimental PF is subjected to stage intervention by selecting the dragon's blood compound, and the result shows that (1) the dragon's blood can inhibit the protein expression of PF rats CD31 and CD34, reduce the lung coefficient, and effectively inhibit the occurrence and development of pulmonary fibrosis by inhibiting the abnormal generation of pathological pulmonary tissue microvascular, and the early intervention is more significant. (2) The dragon's blood can inhibit the expression of PF rat VEGFmRNA and protein, reduce the Hyp content of lung tissue, and inhibit the generation of pathological change lung tissue capillary abnormal blood vessel, thereby effectively inhibiting the generation and development of pulmonary fibrosis, and the early intervention is more significant. (3) The dragon's blood can reduce TGF-beta 1mRNA and protein expression, inhibit alveolar inflammation and interstitial hyperplasia, reduce collagen deposition, thereby effectively inhibiting occurrence and development of pulmonary fibrosis, and has more significance in early intervention.

Inhibitors of CD31 and CD34, VEGF and/or TGF-beta 1 can therefore be used to treat pulmonary fibrosis.

It is to be understood that the above-described embodiments of the present application are merely illustrative of the application or serve to explain the principles of the application and are not to be construed as limiting the application. Accordingly, any modification, equivalent replacement, improvement, etc. made without departing from the spirit and scope of the present application should be included in the scope of the present application. Furthermore, the appended claims are intended to cover all such changes and modifications that fall within the scope and boundary of the appended claims, or equivalents of such scope and boundary.

Claims

Use of CD31 and CD34, VEGF and/or TGF- β1 as targets in the manufacture of a medicament for the treatment of pulmonary fibrosis.
2. The use according to claim 1, wherein the use comprises use in the manufacture of a medicament for the treatment of pulmonary fibrosis, the disease comprising idiopathic pulmonary interstitial fibrosis.
Use of inhibitors of CD31 and CD34, VEGF and/or TGF- β1 for the preparation of a medicament for the treatment of pulmonary fibrosis.
4. The use according to claim 3, wherein the use comprises use in the manufacture of a medicament for the treatment of pulmonary fibrosis, the disease comprising idiopathic pulmonary interstitial fibrosis.
5. The use according to claim 3, wherein the medicament down-regulates the protein expression of CD31 and CD34, reduces lung coefficients, inhibits micro-angiogenesis in diseased lung tissue.
6. The use according to claim 3, wherein the medicament inhibits VEGFmRNA and protein expression, reduces Hyp content in lung tissue by inhibiting micro-vascular abnormalities in diseased lung tissue.
7. The use according to claim 3, wherein the medicament reduces TGF- β1mRNA and protein expression, inhibits alveolar inflammation and interstitial proliferation, reduces collagen deposition.
8. The use according to any one of claims 3 to 7, wherein the inhibitor is dragon's blood.
9. The use of claim 8, wherein said dragon's blood comprises: rhodiola rosea, pseudo-ginseng and Yunnan dragon's blood.
10. The use according to claim 9, wherein the rhodiola rosea is the dried root and rhizome of rhodiola crenulata of the family Crassulaceae, the pseudo-ginseng is the root of pseudo-ginseng of the family Araliaceae, and the dragon's blood is the resin of the family liliaceae, the family dracaena cochinchinensis.