CN116744787A - Downy mildew resistance in spinach - Google Patents

Downy mildew resistance in spinach Download PDF

Info

Publication number
CN116744787A
CN116744787A CN202180073985.9A CN202180073985A CN116744787A CN 116744787 A CN116744787 A CN 116744787A CN 202180073985 A CN202180073985 A CN 202180073985A CN 116744787 A CN116744787 A CN 116744787A
Authority
CN
China
Prior art keywords
leu
allele
plant
spinach
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180073985.9A
Other languages
Chinese (zh)
Inventor
E·德恩波尔
R·J·J·M·弗里特斯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rijk Zwaan Zaadteelt en Zaadhandel BV
Original Assignee
Rijk Zwaan Zaadteelt en Zaadhandel BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rijk Zwaan Zaadteelt en Zaadhandel BV filed Critical Rijk Zwaan Zaadteelt en Zaadhandel BV
Priority claimed from PCT/EP2021/080275 external-priority patent/WO2022090543A1/en
Publication of CN116744787A publication Critical patent/CN116744787A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1245—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance
    • A01H1/1255—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance for fungal resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/12—Leaves
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/02—Amaranthaceae or Chenopodiaceae, e.g. beet or spinach
    • A01H6/028—Spinacia oleracea [spinach]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

The present invention relates to an allele designated α -WOLF27 conferring resistance to at least one race of downy mildew, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity. When homozygously present in a spinach plant, the allele confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 of the species Peronospora crassa.

Description

Downy mildew resistance in spinach
Technical Field
The present invention relates to genes capable of conferring resistance to one or more race(s) of peronospora california (Peronospora effusa) on spinach plants. The invention also relates to a spinach plant, propagation material of said spinach plant, cells of said spinach plant, and seeds of said spinach plant carrying the gene. The invention further relates to a method for producing a spinach plant carrying the gene and to the use of the gene for conferring resistance against downy mildew in breeding.
Background
Downy mildew (downy mildew) is a major threat to spinach growers because it directly affects harvested leaves. In spinach (Spinacia oleracea), downy mildew is caused by the oomycete downy mildew (formerly known as the downy mildew spinach specialization (Peronospora farinosa f.sp.space)). Infection makes leaves unsuitable for sale and consumption because they manifest themselves phenotypically as yellow lesions on old leaves, and gray fungal growth can be observed on the back surface of the leaves. Infection can spread very rapidly and it can occur in greenhouse cultivation and soil cultivation. The optimal temperature for the formation and germination of the spores of Peronospora farinosa is 9 to 12℃and is promoted by a high relative humidity. Spores can readily germinate and infect leaves when they deposit on moist leaf surfaces. The optimum temperature for fungus growth is 8-20deg.C, relative humidity is not less than 80%, and hypha growth can be observed within 6-13 days after infection. Oospores of downy mildew can survive in soil for up to 3 years, or be present as mycelium in seeds or living plants.
To date, 19 pathogenic micro-species of spinach downy mildew (Pe) have been formally identified and characterized, and many new candidates have been observed in the field. The 17 formally approved species of Peronospora reesei are designated Pe 1 to Pe 19 (Pe 1 to Pe 17 were previously designated as Pfs 1 to Pfs 17; irish et al Phypath 98pg.894-900,2008;Plantum NL (Netherlands seed and young plant breeding, tissue culture, production, trade Association (Dutch association for breeding, tissue culture, production and trade of seed and young plants)) news release, "Benoeming van Pfs:14,een nieuwe fysio van valse meeldauw in spinazie", september 19,2012;Report Jim Correl (Univ. Arkansas) and Steven Koike (UC Cooperative Extension, montrey County), "Race Pfs 14-Another new Race of the spinach downy mildew pathogen", september 18,2012;Plantum NL news release, "Denomination of Pfs:15,a new Race of downy mildew in spinach", september 2,2014September 2,2014;Plantum NL news release, "Denomination of Pfs:16,a new Race of downy mildew in spinach,March 15,2016;Plantum NL news release, denomination of Pfs:17,a new Race of downy mildew in spinach", april 16,2018;Plantum NL news release, "Denomination of Pe:18and 19,two new races of downy mildew in spinach", april 15,2021).
All 19 formally approved Pe minispecies are publicly available from Department of PlantPathology, university of Arkansas, fayetteville, AR 72701, usa, and NAK Tuinbouw, sotaw 22,2371GD Roelofarendsveen,the Netherlands.
In particular, newly identified species of the genus peronospora can break the resistance of many spinach varieties currently in commercial use worldwide, and thus they pose a serious threat to the productivity of the spinach industry. Therefore, maintaining the development front in this area is of paramount importance, as the genus downy grows with the ability to break the resistance present in commercial spinach varieties. Thus, new resistance genes against downy mildew are a very valuable asset, and they form an important research focus for breeding, especially spinach and lettuce breeding. One of the main goals of spinach breeders is to rapidly develop spinach varieties that are resistant to as many of the peronospora species (including the newly identified species) as possible before these species become widespread and can threaten the industry.
In commercial spinach varieties, resistance against downy mildew is usually caused by the so-called R gene. R-gene mediated resistance is based on the ability of plants to recognize invading pathogens. In many cases, this recognition occurs after the pathogen has established a first phase of interaction and transferred a so-called pathogenic (or avirulence) factor into the plant cell. These causative agents interact with the host components to establish conditions that favor pathogen penetration into the host and thereby cause the disease. A resistance response may be initiated when a plant is able to recognize an event triggered by a pathogenic agent. In many different plant pathogen interaction systems, such as the interaction of spinach with different downy mildew strains, plants will initiate these events only after specific recognition of the invading pathogen.
Co-evolution of plants and pathogens has led to a army competition in which R-gene mediated resistance is sometimes overcome, with the result that pathogens can interact with alternative host targets or the same targets in different ways and modify them so that recognition is lost and infection can be successfully established, leading to disease. In order to reestablish resistance in plants, a new R gene must be introduced, which is able to recognize the mode of action of alternative pathogenic agents.
Despite the fact that the persistence of the R gene is relatively low, the R gene remains the predominant form of resistance to downy mildew in spinach. This is mainly because it is the only form of defense that provides absolute resistance. Plant breeders have so far been very successful in producing downy mildew resistant spinach varieties using resistance genes present in the wild germplasm of a crop species. Although R genes are widely used in spinach breeding, so far little is known about these R genes.
Until recently it was not found that the formally approved R genes in spinach were actually all the different alleles of two closely related genes, the alpha-WOLF and beta-WOLF genes. This is also the first characterization of the R gene or better R allele at the molecular level, i.e. determination of its nucleotide and amino acid sequence. While this provides a tool for breeders to increase the efficiency of detection and selection of R alleles, adequate response to emerging downy mildew races is still critical to developing commercially successful spinach varieties. It is therefore an object of the present invention to provide new resistance alleles conferring resistance to emerging downy mildew isolates and to provide molecular biological tools for identifying the new resistance alleles.
Summary of The Invention
In the studies leading to the present invention, novel allelic variants of the α -WOLF gene described in WO2018059651 were found. The alpha-WOLF gene encodes a protein belonging to the CC-NBS-LRR family (coiled-coil-nucleotide binding site-leucine-rich repeat). Depending on the allelic variant (or variants) present in the spinach plant, the plant will produce a variant of the WOLF protein that confers a certain resistance profile to pathogenic races of downy mildew.
In the context of the present invention, the term "allele" or "allelic variant" is used to designate a version of a gene associated with a particular phenotype, i.e. resistance profile. Spinach was found to carry one or two WOLF genes. Each of these two WOLF genes comprises multiple alleles, each of which confers a specific resistance profile. In the context of the present invention, an allele or allelic variant is a nucleic acid.
The beta WOLF gene is located on scaffold12735 (scaffold 12735) (sequence: genBank: KQ 143339.1), positions 213573-221884. If the spinach plant also carries or carries only the alpha-WOTF gene, the alpha-WOTF gene is located at about the same position as the beta-WOTF gene on scaffold12735 in the Virofbay genome assembly.
The newly discovered alpha-WOLF allele provides resistance to at least the downy mildew small species Pe:14, pe:15, and Pe: 17.
Detailed Description
Genome assembly of spinach cultivar Virofbay, which is susceptible to all known pathogenic races of Peronospora farinosa, is publicly available (spinach (Spinacia oleracea) cultivar SynVirofbay, whole genome shotgun sequencing project; bioproject: PRJNA41497; genBank: AYZV00000000.2; biosample: SAMN02182572, see also Dohm et al, 2014,Nature 505:546-549). In the Virofbay genome assembly, the β -WOTF gene is located on a scaffold 12735 (sequence: genBank: KQ 143339.1) at positions 213573-221884. The sequence covered by this gap includes the entire genomic sequence of the Virofbay beta-WOTF gene, plus 2000 base pair sequences upstream of the gene, plus sequences downstream of the gene, up to the locus of the adjacent gene downstream of the WOTF gene. Spinach variety virofly has only a single WOLF gene, i.e., the β -WOLF gene, but most other spinach strains carry a single α -WOLF gene at the same location in the genome. Other spinach lines contain two WOLF genes at approximately the same location in the genome. In this case, the two WOLF genes are adjacent to each other. In most spinach lines containing two WOLF genes, one of the WOLF genes belongs to the alpha type and the other WOLF gene belongs to the beta type. It was observed that this allelic variation in the WOLF locus was responsible for the difference in resistance to pathogenic races of downy mildew.
The difference between the alleles of the alpha-WOLF gene and the alleles of the beta-WOLF gene is the presence of specific conserved amino acid motifs in the encoded protein sequence. As described above, all WOLF proteins have the following domains (from N-terminus to C-terminus) well known in the art: coiled coil domains (RX-CC like, cd 14798), NBS domains (also known as "NB-ARC domains", pfam00931; van der Biezen & Jones,1998, curr. Biol.8: R226-R228), and leucine rich repeats (IPR 032675) comprising an LRR domain. Furthermore, all WOLF proteins contain the motif "MAEIGYSVC" (SEQ ID NO: 1) at the N-terminus of their amino acid sequence. In addition, all alpha-WOLF proteins contained the motif "KWMCLR" (SEQ ID NO: 2) in their amino acid sequences, while all beta-WOLF proteins contained the motif "HVGCVVDR" (SEQ ID NO: 3) in their amino acid sequences.
The present invention relates to an allele of the alpha-WOTF gene conferring resistance to novel downy mildew, designated alpha-WOTF 27.
In particular, the invention relates to an allele conferring resistance to downy mildew designated α -WOLF27, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; b) Motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Optionally, the α -WOLF27 allele also comprises an additional motif in its amino acid sequence, namely "DQEDEGEDN".
The invention further relates to an allele conferring resistance to downy mildew designated α -WOLF27, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; b) Motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Optionally, the α -WOLF27 allele also comprises an additional motif in its amino acid sequence, namely "DQEDEGEDN".
The invention also relates to an alpha-WOLF 27 allele having an LRR domain with an amino acid sequence that hybridizes in increasing order of preference to SEQ ID NO:9 has a sequence of at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
For the purposes of the present invention, the LRR domain of the protein of the α -WOLF27 allele is defined as having an increased order of preference to the sequence of SEQ ID NO:10 has an amino acid sequence of at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
For the purposes of the present invention, the LRR domain of the protein of the α -WOLF27 allele is defined as having an increased order of preference to the sequence of SEQ ID NO:10 has an amino acid sequence of at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
The skilled person is familiar with methods for calculating sequence identity and sequence identity. Using an EMBOSS stratcher 6.6.0 (www.ebi.ac.uk/Tools/psa/emboss_stratcher), using the EBLOSUM62 matrix, with set gap opening penalty: 12 and gap extension penalty: 2 to calculate the sequence identity of the amino acid sequence. For DNA, using a DNA full matrix, with set gap opening penalty: 16 and gap extension penalty: 4 to calculate sequence identity.
The LRR domain of the α -WOLF27 allele as defined herein can be determined by amplifying and sequencing genomic DNA encoding the amino acid sequence of the LRR domain using specific primers, and then translating the DNA sequence into the amino acid sequence, thereby applying the common sense of selecting the correct reading frame. The skilled person can do this using a freely provided online bioinformatics tool (e.g. can be found here: http:// web. Expasy. Org/transfer /).
The genomic sequence of an LRR domain of an α -WOLF gene, such as α -WOLF27, can be amplified using a primer pair having a forward primer and a reverse primer, the forward primer being a primer having the sequence of SEQ ID No:4, the reverse primer is a nucleic acid molecule having the sequence of SEQ ID No:5, and a nucleic acid molecule of the sequence of 5.
The invention also relates to a nucleic acid molecule conferring resistance to at least one species of downy mildew, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; b) Motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.
The invention also relates to a nucleic acid molecule conferring resistance to at least one species of downy mildew, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; b) Motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.
Using a polypeptide having the sequence of SEQ ID NO:4 and SEQ ID NO:5, the conditions for PCR for amplifying the LRR domain coding region of the alpha-WOLF gene were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific): at 95℃for 3 minutes (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95℃for 30 seconds, annealing at 60℃for 30 seconds, and extension at 72℃for 30 seconds; at 72℃for 2 minutes (final extension step).
The LRR domain of the β -WOLF gene can be amplified using forward and reverse primers, for example, null alleles present in the variety Viroflay, the forward primer being a primer having the sequence of SEQ ID NO:6, and the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:5, and a nucleic acid molecule of the sequence of 5.
Using a polypeptide having the sequence of SEQ ID NO:5 and SEQ ID NO:6, the PCR conditions for amplifying the LRR domain coding region of the beta-WOLF gene were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific): at 95℃for 3 minutes (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95℃for 30 seconds, annealing at 58℃for 50 seconds, and extension at 72℃for 50 seconds; at 72℃for 2 minutes (final extension step).
Thus, the invention also relates to a primer pair for amplifying the LRR domain of the α -WOLF gene, more specifically for amplifying the LRR domain of the α -WOLF27 allele, wherein the forward primer is a primer having the sequence of SEQ ID NO:4, and the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:5, and a nucleic acid molecule of the sequence of 5. The primers disclosed herein are specifically designed to selectively amplify portions of the WOTF gene, but not any other CC-NBS-LRR protein encoding gene.
The present invention relates to alpha-WOLF 27 alleles having a sequence of increasing preference to SEQ ID NO:12 has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
In another aspect of the invention, the α -WOLF27 allele encodes a protein having a sequence of increasing preference to SEQ ID NO:13 has an amino acid sequence of at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
In another aspect of the invention, the α -WOLF27 allele encodes a protein having a sequence of increasing preference with the sequence of SEQ ID NO:13 at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100%.
When present in spinach plants, the α -WOLF27 allele confers complete resistance to at least one of the 19 formally approved cymoxanil microsatellites. In other embodiments, the α -WOLF27 allele confers complete resistance to at least two of the 19 formally approved cymoxanil microsatellites when present in a spinach plant. In other embodiments, the α -WOLF27 allele confers complete resistance to at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen of the 19 formally approved downy mildew panels in increasing order of preference when present in a spinach plant.
When homozygously present in spinach plants, the alpha-WOTF 27 allele confers complete resistance to at least formally approved species of Peronospora farinosa Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17. More particularly, when homozygously present in spinach plants, the alpha-WOTF 27 allele confers complete resistance to at least officially approved species of Peronospora primosa Pe:1, pe:2, pe:3, pe:4, pe:5, pe:6, pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15, pe:17 (see Table 1). The alpha-WOTF 27 allele also confers complete resistance to at least officially approved species of Peronospora farinosa Pe:16 and Pe:18 when homozygously present in spinach plants. Furthermore, the alpha-WOTF 27 allele confers moderate resistance to the race Pfs:10 of Peronospora farinosa when homozygously present in spinach plants.
Resistance of spinach plants to one or more races of downy mildew can be determined by using a seedling test. The seedling test is defined herein as a test in which spinach plants are planted in trays containing growth medium, and fertilized twice a week after the occurrence of the seedlings. At the first stage of the true leaves, the concentration is about 2.5X10 5 Per ml of a sporangium suspension of a pathogenic micro-species of the Peronospora farinosa or isolate to be tested. Each race was tested for 30 plants. The inoculated plants were placed in a dew chamber at 18℃and 100% relative humidity for 24 hours and then moved to a growth chamber at 18℃for 12 hours photoperiod for 6 days. After 6 days, plants were returned to the exposure chamber for 24 hours to induce sporulation and disease response was then scored.
As used herein, a plant is fully resistant to a trionyx sp.sp.curvatus when the plant does not exhibit symptoms in the seedling test described herein.
As used herein, plants are moderately resistant to the scutellarin micro-species when they exhibit only symptoms of chlorosis or sporulation in the seedling test described herein occur only at the cotyledonary tips.
As used herein, a plant is susceptible to isolates of a downy mildew race when the plant not only exhibits symptoms of chlorosis in the seedling test described herein, or when sporulation occurs in an area greater than just the cotyledonary tip.
Another aspect of the invention relates to a spinach plant comprising an alpha-WOLF 27 allele of the invention, a representative sample of its seed being deposited with NCIMB under accession number NCIMB 43668.
In another embodiment, the plant of the invention comprising an α -WOLF27 allele is an agronomically elite spinach plant. In the context of the present invention, an agronomically elite spinach plant is a plant with a genotype leading to the accumulation of distinguishable and desirable agronomic traits, which allows the producer to harvest a commercially interesting product, preferably a plant of an inbred line or hybrid comprising an alpha-WOTF 27 allele.
As used herein, a plant of an inbred line is a plant of a plant population produced by three or more rounds of selfing or backcrossing; or the plant is doubled haploid. Inbred lines may, for example, be a stock line used to produce commercial hybrids.
As used herein, a hybrid plant is a plant produced by crossing between two different plants having different genotypes. More particularly, the hybrid plant is the result of a cross between two different inbred plants, such hybrid plants may be, for example, F 1 Plants of the hybrid variety.
Plants carrying the heterozygous form of the alpha-WOTF 27 allele may further comprise a beta-WOTF 0 allele, such as found in the variety Virofbay, wherein the beta-WOTF 0 allele does not confer any resistance to downy mildew. However, plants heterozygous for the α -WOLF27 allele may also contain an allele of the α/β -WOLF gene that does provide resistance to downy mildew. Preferably, such an allele will complement the α -WOLF27 allele such that the spinach plant will be at least moderately resistant to one or more other micro-species that do not provide resistance to the α -WOLF27 allele. Most preferably, the other allele of the alpha/beta-WOTF gene complements the alpha-WOTF 27 allele, rendering the plant resistant to the race Pe 1 to Pe 19 of Peronospora farinosa. In one embodiment, such plants are agronomically elite plants.
Alternatively, the resistance profile of plants carrying the α -WOLF27 allele is complemented by a resistance conferring allele that is a completely different gene. Examples of such genes are for example DMR1 as described in US8,354,570, DMR6 as described in US9,121,029 and p10 as described in US10,226,016.
Thus, the present invention relates to a spinach plant carrying the alpha-WOTF 27 allele and further comprising a genetic determinant leading to resistance against the race Pe 1 to Pe 19 of Peronospora crassa. The genetic determinant may be another resistance conferring alpha/beta-WOTF allele, or a resistance conferring allele that is entirely different.
The invention further relates to propagation material comprising the alpha-WOTF 27 allele. In one embodiment, the propagation material is suitable for sexual reproduction. Such propagation material includes, for example, microspores, pollen, ovaries, ovules, embryo sacs, and egg cells. In another embodiment, the propagation material is suitable for vegetative propagation. Such propagation material includes, for example, cuttings, roots, stems, cells, protoplasts, and tissue cultures of regenerable cells. Plant parts suitable for the preparation of tissue cultures are, in particular, leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, root tips, anthers, flowers, seeds and stems.
The invention also relates to cells of a spinach plant comprising an alpha-WOTF 27 allele. Such cells may be in isolated form, or may be part of an intact plant or part thereof, and then still constitute the cells of the invention, as such cells contain an alpha-WOLF 27 allele that confers resistance to downy mildew. Each cell of the plant of the invention carries genetic information conferring resistance to downy mildew. Such cells of the invention may also be regenerable cells, which can be used to regenerate new plants comprising the alleles of the invention.
Another aspect of the invention relates to a method of preparing a hybrid spinach seed, comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and/or the second parent spinach plant comprises an alpha-WOTF 27 allele. In a particular embodiment, the first and/or second parent plant is a plant of an inbred line as defined herein.
The invention further relates to a hybrid spinach plant grown from seeds produced by crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and/or the second parent spinach plant comprises an alpha-WOLF 27 allele.
Genomic DNA or coding DNA sequences of at least a portion of the WOLF gene in the spinach plant genome may be determined using any suitable molecular biological method known in the art, including but not limited to (genomic) PCR amplification followed by Sanger sequencing, whole genome sequencing, transcriptome sequencing, sequence specific target capture and then next generation sequencing (e.g., using Integrated DNA Technologies)Target capture system), specific amplification of the LRR domain-containing gene sequence (e.g., using the RenSeq method, such as U.S. patent application 14/627116 and Jupe et al, 2013, plant j.76: 530-544) and then sequenced, etc.
In one embodiment, the invention relates to a method of identifying a plant carrying an α -WOLF27 allele comprising determining a DNA sequence encoding an LRR domain as defined herein.
In another embodiment of the method, the LRR domain of the α -WOLF27 allele is determined by amplifying the genomic DNA region of the LRR domain using a primer pair. The forward primer is preferably a primer having the sequence of SEQ ID NO:4, and the reverse primer is preferably a nucleic acid molecule having the sequence of SEQ ID NO:5, and a nucleic acid molecule of the sequence of 5.
Another aspect of the invention relates to a method of producing a spinach plant comprising resistance to downy mildew, comprising: (a) Crossing a plant comprising an alpha-WOLF 27 allele with another plant; (b) Optionally performing one or more rounds of selfing and/or hybridization; (c) Plants containing the alpha-WOTF 27 allele are optionally selected after each round of selfing or crossing.
Plants comprising the α -WOLF27 allele can be selected by determining the presence of the DNA sequence of the NBS-LRR domain of the allele, which sequence hybridizes with SEQ ID NO:9 has 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity.
In another embodiment, plants comprising the alpha-WOTF 27 allele can be selected by determining the presence of the coding sequence for the entire allele.
Alternatively, the presence of the α -WOLF27 allele can be phenotypically determined by assaying plants in a disease test, such as the test described herein.
The invention also relates to the use of spinach plants carrying the alpha-WOTF 27 allele for conferring resistance against Peronospora farinosa in breeding.
The invention also relates to a breeding method for growing spinach plants carrying the alpha-WOLF 27 allele of the invention, wherein a germplasm comprising said allele is used. Seeds capable of growing into plants comprising the allele of the invention and representing germplasm are deposited with NCIMB under accession number NCIMB 43668.
In another aspect, the invention relates to a method of producing a spinach plant comprising an alpha-WOLF 27 allele, the method comprising: (a) Crossing a plant comprising an allele with another plant; (b) Optionally selecting a plant comprising said allele in F1; (c) Optionally backcrossing the resulting F1 with a preferred parent and selecting plants having said allele in BC1F 1; (d) Optionally performing one or more additional rounds of selfing, crossing and/or backcrossing, and subsequently selecting a plant comprising the allele or exhibiting a resistance profile corresponding to the allele. The invention also includes spinach plants produced by the method.
The invention also relates to harvested leaves of the spinach plants of the invention, to food products comprising harvested leaves of the spinach plants of the invention, in natural or processed form.
Spinach leaves are sold in packaging forms, including but not limited to pre-packaged spinach leaves or salad processed to contain the leaves. Such packages are prepared, for example, in U.S. patent No. 5,523,136, which provides packaging films and packages made from such packaging films, including such packages containing leaf products, and methods of making and using such packaging films and packages, which are suitable for use with the spinach leaves of the present invention. Thus, the present invention includes the use and methods of making and using the leaves of the spinach plants of the invention, as well as the leaves derived from the spinach plants of the invention.
The invention further relates to a container comprising one or more plants of the invention, or one or more spinach plants derived from the plants of the invention, for harvesting leaves from plants in a growing medium in a domestic environment. In this way, the consumer can pick very fresh leaves for salad when the plant is in a state ready for harvesting.
The invention also relates to the use of a spinach plant, representative seed of which was deposited with the NCIMB under accession number NCIMB 43668, for the production of a spinach plant comprising an alpha-WOLF 27 allele.
In another embodiment, the spinach plant is a hybrid, doubled haploid or inbred spinach plant.
Spinach plants of the invention may heterozygously or homozygously comprise the alpha-WOTF 27 allele.
Another aspect of the invention is the use of a cell comprising an alpha-WOTF 27 allele in the production of a spinach plant exhibiting resistance to Peronospora farinosa.
The present invention relates to an allele designated alpha-WOTF 27, which confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 of Peronospora farinosa when homozygously present in spinach plants. In particular, the alpha-WOTF 27 allele confers complete resistance to at least the race Peronospora crassa Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in spinach plants. More particularly, the alpha-WOTF 27 allele confers complete resistance to at least the Saprolegnia parasitica cultivars Pe:1, pe:2, pe:3, pe:4, pe:5, pe:6, pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15, pe:16, pe:17 and Pe:18 and moderate resistance to the Saprolegnia parasitica cultivars Pe:10 when homozygously present in spinach plants. In all three cases, the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity.
The invention also relates to an allele designated alpha-WOTF 27, which confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17 when homozygously present in spinach plants; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10; wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 99.5% sequence identity.
The invention also relates to an allele designated alpha-WOTF 27, which confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17 when homozygously present in spinach plants; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10; wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10, and wherein the DNA sequence of the LRR domain has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to the DNA sequence of SEQ ID NO:9 has at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
The invention also relates to an allele designated alpha-WOTF 27, which confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17 when homozygously present in spinach plants; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10; wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the DNA sequence of the LRR domain hybridizes in increasing order of preference to the DNA sequence of SEQ ID NO:9 has at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
The invention also relates to a spinach plant comprising an allele designated α -WOTF 27, said allele conferring complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in the spinach plant. In particular, the alpha-WOTF 27 allele confers complete resistance to at least the race Peronospora crassa Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in spinach plants. More particularly, the alpha-WOTF 27 allele confers complete resistance to at least the Saprolegnia parasitica cultivars Pe:1, pe:2, pe:3, pe:4, pe:5, pe:6, pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15, pe:16, pe:17 and Pe:18 and moderate resistance to the Saprolegnia parasitica cultivars Pe:10 when homozygously present in spinach plants. In all three cases, the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Preferably, such spinach plants are agronomically sound spinach plants.
The invention also relates to a spinach plant comprising an allele designated α -WOTF 27, which allele confers complete resistance to at least the famomyces lanuginosus minispecies Pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15 and Pe:17 when homozygously present in the spinach plant; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10; wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 99.8% sequence identity. Preferably, the spinach plant is an agronomically sound spinach plant.
The invention also relates to a spinach plant comprising an allele designated α -WOTF 27, which allele confers complete resistance to at least the famomyces lanuginosus minispecies Pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15 and Pe:17 when homozygously present in the spinach plant; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10; wherein the protein encoded by the allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity, and wherein the DNA sequence of the LRR domain is in increasing order of preference to the DNA sequence of SEQ ID NO:9 has at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Preferably, such spinach plants are agronomically sound spinach plants.
The invention also relates to a spinach plant comprising an allele designated α -WOTF 27, said allele conferring complete resistance to at least the famomyces lanuginosus minispecies Pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15 and Pe:17 when homozygously present in the spinach plant; or to confer complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15 and Pe 17; or conferring complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17 and Pe 18 and moderate resistance to the race Pe 10 of Peronospora, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the DNA sequence of the LRR domain hybridizes in increasing order of preference to the DNA sequence of SEQ ID NO:9 has at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity. Preferably, such spinach plants are agronomically sound spinach plants.
The invention is further described by the following numbered paragraphs:
1. an agronomically sound spinach plant comprising alleles conferring resistance to at least one species of downy mildew when present in a spinach plant and encoding a polypeptide sequence which in increasing order of preference hybridizes to a polypeptide sequence comprising the amino acid sequence of SEQ ID NO:13, a protein having at least 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity; wherein the protein comprises in its amino acid sequence: a) SEQ ID NO:1, b) SEQ ID NO:2, and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
2. The agronomically sound spinach plant of paragraph 1, wherein the allele encodes a protein that confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in the spinach plant.
3. The agronomically sound spinach plant of paragraph 1, wherein the allele encodes a protein that confers complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in the spinach plant.
4. The agronomically elite spinach plant of paragraph 1, wherein the allele coding confers complete resistance to at least the race Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 16, pe 17, pe 18 and moderate resistance to at least the race Pe 10 of Peronospora when homozygously present in the spinach plant.
5. An agronomically sound spinach plant comprising alleles which when homozygously present in the spinach plant encode conferring complete resistance to at least the species peronospora rosea Pe:1, pe:2, pe:3, pe:4, pe:5, pe:6, pe:7, pe:8, pe:9, pe:11, pe:12, pe:13, pe:14, pe:15, pe:17, wherein the nucleotide sequence of the allele hybridizes with SEQ ID NO:12 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
6. An agronomically sound spinach plant according to any of paragraphs 1 to 5 wherein a representative sample of seeds from which plants comprising said allele can be grown is deposited with the NCIMB under accession number NCIMB 43668.
7. The agronomically elite spinach plant according to any one of paragraphs 1 to 6, wherein the agronomically elite spinach is a hybrid or inbred plant.
8. A propagation material capable of developing into an agronomically sound spinach plant of any one of paragraphs 1 to 7, and wherein the propagation material comprises microspores, pollen, ovaries, ovules, embryos, embryo sacs, egg cells, cuttings, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, cells or tissue cultures thereof.
9. A cell of an agronomically sound spinach plant of any of paragraphs 1 to 7.
10. A method of producing an F1 hybrid spinach seed comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first parent spinach plant and/or the second parent spinach plant is an agronomically elite spinach plant of any one of paragraphs 1 to 7.
11. The method of paragraph 10, wherein the first and/or second parent plant is a plant of an inbred line.
12. An F1 hybrid spinach plant grown from a seed produced by the method of paragraph 10 or 11, wherein said F1 hybrid plant carries an allele which, when present in the spinach plant, confers resistance to at least one race of downy mildew, and encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:13, a CC-NBS-LRR protein having at least 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity; wherein the protein comprises in its amino acid sequence: (a) SEQ ID NO:1, (b) SEQ ID NO:2, and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
13. A method of producing a spinach plant that exhibits resistance to downy mildew, comprising: (a) Crossing the agronomically sound spinach plant of any one of paragraphs 1 to 7 with another spinach plant; (b) Optionally performing one or more rounds of selfing and/or hybridization; (c) Plants comprising the allele are optionally selected after crossing or one or more rounds of selfing and/or crossing.
14. The method of paragraph 13, wherein the method comprises making an optional selection and the selection of plants comprising alleles expressing a protein comprises determining the presence of an allele according to a method comprising any one or more of: determining the presence of a genomic nucleotide sequence in the genome of a plant, wherein said sequence hybridizes in increasing order of preference to SEQ ID NO:11 has at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity, or determines the presence of a nucleotide sequence in a plant, wherein the sequence hybridizes in increasing order of preference to SEQ ID NO:12 has at least 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity, or determines the presence of an LRR domain that hybridizes in increasing order of preference to SEQ ID NO:9 has at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
15. The method of paragraphs 13 or 14, wherein the method comprises performing an optional one or more rounds of selfing and/or crossing and optional selection, and the selection of plants comprising alleles expressing a protein comprises determining the presence of an allele according to a method comprising any one or more of: determining the presence of a genomic nucleotide sequence in the genome of a plant, wherein said sequence hybridizes in increasing order of preference to SEQ ID NO:11 has at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity, or determines the presence of a nucleotide sequence in a plant, wherein the sequence hybridizes in increasing order of preference to SEQ ID NO:12 has at least 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity, or determines the presence of an LRR domain that hybridizes in increasing order of preference to SEQ ID NO:9 has 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
16. A method of producing an F1 hybrid spinach seed comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first parent spinach plant and/or the second parent spinach plant is an agronomically sound spinach plant of any of paragraphs 1 to 7.
Resistance information
TABLE 1
Resistance profile conferred by the α -WOLF27 allele when homozygously present in spinach plants. "-" indicates complete resistance to a particular downy mildew race; "(-)" indicates moderate resistance to a particular downy mildew race; "+" indicates that the allele does not confer resistance and would result in a plant carrying only the α -WOLF27 allele being completely susceptible to a particular downy mildew race; "nt" means that the isolate has not been tested.
Preservation information
Seeds of plants comprising in their genome the α -WOLF27 allele of the invention were deposited with NCIMB Ltd (national industry, collection of food and marine microorganisms), ferguson building of uk, aberbutyl AB21 9YA Craibstone Estate,Bucksburn (Ferguson Building, craibstone Estate, bucksburn, aberdeen AB21 9ya, uk) under accession number NCIMB 43668 on 10/9 of 2020. The preservation was performed according to terms of the budapest treaty. All restrictions on the deposit will be removed after the patent is granted and the deposit is intended to meet the requirements of 37CFR ≡1.801-1.809. After patent authorization, the deposit will be irrevocably and released to the public without limitation or condition. The preservation will be kept at the holding institution for 30 years, or 5 years after the last request, or the expiration date of the patent, whichever is longer, and replaced as necessary during that time.
Sequence information
Table 2. Sequence information.
/>
/>
/>
/>
/>
/>
/>
/>
The invention will be further illustrated in the following examples, which are for illustrative purposes only and are not intended to limit the invention in any way.
Examples
Example 1
Testing resistance to Peronospora farinosa in spinach plants
Resistance to downy mildew infection was determined using a differential set as described by Irish et al (2008; phytopathol.98:894-900). Spinach plants of the invention were sown in trays containing Scotts Redi-Earth medium together with spinach plants from different other genotypes (see Table 3) and fertilized twice weekly with Osmocote Peter's (13-13-13) fertilizer (Scotts) after emergence of seedlings. Plants and methods of making the sameSporangia suspension of stock species of sporangium (2.5X10) inoculated with spread downy mildew during the first true leaf stage 5 /ml). In this way, 4 officially approved pathogenic micro-organisms were tested.
The inoculated plants were placed in a dew chamber at 18 ℃ with 100% relative humidity for 24 hours and then moved to a growth chamber at 18 ℃ for 12 hours photoperiod for 6 days. After 6 days, plants were returned to the exposure chamber for 24 hours to induce sporulation and disease response was scored.
Plants used for this particular test were scored as resistant, moderately resistant or susceptible based on symptoms of chlorosis and signs of sporulation of the pathogen on cotyledons and true leaves as described by Irish et al (2007;Plant Dis.91:1392-1396). Plants that did not show signs of chlorosis and sporulation were considered resistant in this particular test. Resistant plants are re-inoculated to assess whether the plants initially scored as resistant have escaped infection or whether they are indeed resistant. Plants that showed only symptoms of chlorosis or sporulation that appeared only at the cotyledon tips were scored as moderately resistant. Plants showing more symptoms than these downy mildew infections were scored as susceptible.
Table 1 shows the resistance of plants carrying the alpha-WOTF 27 allele to each of these pathogenic races. Table 3 shows the differential set of spinach downy mildew races and the resistance of various spinach varieties (hybrids) to each of these pathogenic races. Susceptibility is noted as "+" (indicating successful infection by the fungus, sporulation occurs across cotyledons), and resistance is noted as "-" (no sporulation on cotyledons). The moderate resistance response is indicated by "(-)" which in practice means a small level of infection (either only the symptoms of chlorosis in the differential seedling test or sporulation only at the cotyledon tips).
Table 3:
example 2
Amplification of LRR domain coding regions
Isolated genomic DNA of spinach plants containing the alpha-WOTF 27 allele (a representative sample of their seeds was deposited with NCIMB under accession number NCIMB 43668) was used for the Polymerase Chain Reaction (PCR) using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 4) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pairs amplify the LRR domain coding region of the α -WOLF gene and are designed to selectively amplify portions of the WOLF gene but not other CC-NBS-LRR protein coding genes.
Using a polypeptide having the sequence of SEQ ID NO:4 and SEQ ID NO:5, the PCR conditions for amplifying the LRR domain coding region of the alpha-WOLF gene were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):
at 95℃for 3 minutes (initial denaturation step)
-40 amplification cycles, each cycle consisting of: denaturation at 95℃for 30 seconds, annealing at 60℃for 30 seconds, and extension at 72℃for 30 seconds
At 72℃for 2 minutes (final extension step)
The isolated genomic DNA of the variety Virofbay spinach plant containing the beta-WOTF 0 allele was used for the Polymerase Chain Reaction (PCR) using forward primer TCACGTGGGTTGTGTTGT (SEQ ID NO: 6) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pairs amplify the LRR domain coding region of the β -WOLF gene and are designed to selectively amplify portions of the WOLF gene but not other CC-NBS-LRR protein coding genes.
Using a polypeptide having the sequence of SEQ ID NO:5 and SEQ ID NO:6, the PCR conditions for amplifying the LRR domain coding region of the beta-WOLF gene were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):
at 95℃for 3 minutes (initial denaturation step)
-40 amplification cycles, each cycle consisting of: denaturation at 95℃for 30 seconds, annealing at 58℃for 50 seconds and extension at 72℃for 50 seconds
At 72℃for 2 minutes (final extension step)
The PCR products were visualized on agarose gels (not shown) and DNA was purified from the PCR reaction. The sequence of the PCR product is then determined using methods well known in the art.
Consists of a polypeptide having the sequence of SEQ ID NO:4 and SEQ ID NO:5 and the DNA sequence of the LRR domain of the α -WOLF27 allele amplified by the primer in table 2 is set forth in SEQ ID NO: 9.
Consists of a polypeptide having the sequence of SEQ ID NO:5 and SEQ ID NO:6 in table 2 with the DNA sequence of the LRR domain of the β -WOLF 0 allele as set forth in SEQ ID NO: 7.
Finally, the obtained sequence was translated into the corresponding amino acid sequence of the LRR domain, SEQ ID NO:10 and SEQ ID NO:8 (see also Table 2).
If the PCR products were sequenced using SMRT sequencing (Pacific Biosciences), the PCR primers and PCR conditions were different.
The following standard amplified sequences were added to the forward primer: GCAGTCGAACATGTAGCTGACTCAGGTCAC.
The following standard amplified sequences were added to the reverse primer: TGGATCACTTGTGCAAGCATCACATCGTAG.
Example 3
Introduction of alpha-WOLF 27 allele in plants not carrying the allele
Spinach plants containing the alpha-WOTF 27 allele (a representative seed sample of which was deposited with NCIMB under accession number NCIMB 43668) were crossed with plants of the variety Virofbay carrying the beta-WOTF 0 allele to obtain the F1 generation. Subsequently, the F1 plants were selfed to obtain F2 populations.
Resistance of plants of the F2 population to Peronospora farinosa Pe 14, pe 15 and Pe 17 was determined as described in example 1.
Genomic DNA of each plant of the same F2 population was isolated and used for two different Polymerase Chain Reactions (PCR). The first PCR reaction was performed using primers for amplifying the LRR domain of the α -WOLF allele and the second PCR reaction was performed using primers for amplifying the LRR domain of the β -WOLF allele, both as described in example 2.
The PCR products were visualized on agarose gels (not shown), indicating that about 75% of plants contained the α -WOLF fragment, while the remaining about 25% of plants contained only the β -WOLF fragment. Plants containing only the beta-WOLF fragment were fully correlated with plants scored as susceptible to Pe:14, pe:15 and Pe: 17.
The DNA from the PCR reaction was purified and the sequence of the PCR product was then determined. The α -WOLFPCR product produced a sequence corresponding to SEQ ID NO:9, the genomic sequence of the LRR domain of the α -WOLF27 allele. The β -WOLFPCR product produced a sequence corresponding to SEQ ID NO:7, the genomic sequence of the LRR domain of the β -WOLF 0 allele.
Sequence listing
<110> Rake Wang seedling group Co
<120> downy mildew resistance in spinach
<130> L/P171535PC01/JED
<140>
<141> 2021-11-01
<160> 16
<170> BiSSAP 1.3.6
<210> 1
<211> 9
<212> PRT
<213> spinach (Spinacia oleracea)
<220>
<223> motif
<400> 1
Met Ala Glu Ile Gly Tyr Ser Val Cys
1 5
<210> 2
<211> 6
<212> PRT
<213> spinach
<220>
<223> motif
<400> 2
Lys Trp Met Cys Leu Arg
1 5
<210> 3
<211> 8
<212> PRT
<213> spinach
<220>
<223> motif
<400> 3
His Val Gly Cys Val Val Asp Arg
1 5
<210> 4
<211> 20
<212> DNA
<213> spinach
<220>
<223> Forward primer LRR Domain (. Alpha.)
<400> 4
acaagtggat gtgtcttagg 20
<210> 5
<211> 19
<212> DNA
<213> spinach
<220>
<223> reverse primer LRR Domain (. Alpha.)
<400> 5
ttcgccctca tcttcctgg 19
<210> 6
<211> 18
<212> DNA
<213> spinach
<220>
<223> Forward primer LRR Domain (. Beta.)
<400> 6
tcacgtgggt tgtgttgt 18
<210> 7
<211> 1597
<212> DNA
<213> spinach
<220>
<223> amplicon of LRR domain of beta-WOLF 0 allele (Viroflay)
<400> 7
tcacgtgggt tgtgttgtcg atagagatcc agaaatagtc tttttatgta gcaataagat 60
tcgttcgtat attagcggtc gctgcataaa gaatccggtg gattcacaaa tagacaactg 120
gatgtgcctt agggtgttgg acttgtcaga ttcatgtgtt aaagatttgt ctgattcaat 180
aggtaagctg ctgcacttaa ggtatcttaa cctctcttct aatataaagt tggagataat 240
ccctgatgca attacaagac tgcataactt gcagacacta cttttagaag attgcagaag 300
tttaaaggag ttgccaaaag atttttgcaa attggtcaaa ctgaggcact tggaattaca 360
gggttgtcat gatttgattg gtatgtcatt tggaatggat aagctaacta gtcttagaat 420
actaccaaac attgtggtgg gtaggaagga acaaagtgtt gatgatgagc tgaaagccct 480
aaaaggcctc accgagataa aaggctccat tgatatcaca atctattcaa aatatagaag 540
agttgaaggc atgaatggca caggaggagg agctgggtat ttgaagagca tgaaacatct 600
cacgggggtt aatattacat ttgatgaagg tggatgtgtt aaccctgaag ctgtgtattt 660
gaagagcatg aaacatctca cgagggttat tattatattt gattataaag gtggatgtgt 720
taaccctgaa gctgtgttgg caaccctaga gccaccttca aatatcaaga ggttagagat 780
gtggcattac agtggtacaa caattccagt atggggaaga gcagagatta attgggcaat 840
ctccctctca catcttgtcg acatcacgct tgaagattgt tacaatttgc aggagatgcc 900
agtgctgagt aaactgcctc atttgaaatc actggaactt acagagttgg ataacttaga 960
gtacatggag agtagaagca gcagcagtag cagtgacaca gaagcagcaa caccagaatt 1020
accaacattc ttcccttccc ttgaaaaact tacactttgg cgtctggaca agttgaaggg 1080
ttttgggaac aggagatcga gtagttttcc ccgcctctct aaattggaaa tctggaaatg 1140
tccagatcta acgtcatttc cttcttgtcc aagccttgaa gagttggaat tgaaagaaaa 1200
caatgaagcg ttgcaaataa tagtaaaaat aacaacaaca agaggtaaag aagaaaaaga 1260
agaagacaag aatgctggtg ttggaaattc acaagatgat gacaatgtca aattatggaa 1320
ggtggaaata gacaatctgg gttatctcaa atcactgccc acaaattgtc tgactcacct 1380
cgaccttaca ataagtgatt ccaaggaggg ggagggtgaa tgggaagttg gggatgcatt 1440
tcagaagtgt gtatcttctt tgagaagcct caccataatc ggaaatcacg gaataaataa 1500
agtgaagaga ctgtctggaa gaacagggtt ggagcatttc actctgttgg aatcactcaa 1560
actttcagat atagaagacc aggaagatga gggcgaa 1597
<210> 8
<211> 532
<212> PRT
<213> spinach
<220>
<223> amino acid sequence encoded by an amplicon of the LRR domain of βwolf0 (virofly)
<400> 8
His Val Gly Cys Val Val Asp Arg Asp Pro Glu Ile Val Phe Leu Cys
1 5 10 15
Ser Asn Lys Ile Arg Ser Tyr Ile Ser Gly Arg Cys Ile Lys Asn Pro
20 25 30
Val Asp Ser Gln Ile Asp Asn Trp Met Cys Leu Arg Val Leu Asp Leu
35 40 45
Ser Asp Ser Cys Val Lys Asp Leu Ser Asp Ser Ile Gly Lys Leu Leu
50 55 60
His Leu Arg Tyr Leu Asn Leu Ser Ser Asn Ile Lys Leu Glu Ile Ile
65 70 75 80
Pro Asp Ala Ile Thr Arg Leu His Asn Leu Gln Thr Leu Leu Leu Glu
85 90 95
Asp Cys Arg Ser Leu Lys Glu Leu Pro Lys Asp Phe Cys Lys Leu Val
100 105 110
Lys Leu Arg His Leu Glu Leu Gln Gly Cys His Asp Leu Ile Gly Met
115 120 125
Ser Phe Gly Met Asp Lys Leu Thr Ser Leu Arg Ile Leu Pro Asn Ile
130 135 140
Val Val Gly Arg Lys Glu Gln Ser Val Asp Asp Glu Leu Lys Ala Leu
145 150 155 160
Lys Gly Leu Thr Glu Ile Lys Gly Ser Ile Asp Ile Thr Ile Tyr Ser
165 170 175
Lys Tyr Arg Arg Val Glu Gly Met Asn Gly Thr Gly Gly Gly Ala Gly
180 185 190
Tyr Leu Lys Ser Met Lys His Leu Thr Gly Val Asn Ile Thr Phe Asp
195 200 205
Glu Gly Gly Cys Val Asn Pro Glu Ala Val Tyr Leu Lys Ser Met Lys
210 215 220
His Leu Thr Arg Val Ile Ile Ile Phe Asp Tyr Lys Gly Gly Cys Val
225 230 235 240
Asn Pro Glu Ala Val Leu Ala Thr Leu Glu Pro Pro Ser Asn Ile Lys
245 250 255
Arg Leu Glu Met Trp His Tyr Ser Gly Thr Thr Ile Pro Val Trp Gly
260 265 270
Arg Ala Glu Ile Asn Trp Ala Ile Ser Leu Ser His Leu Val Asp Ile
275 280 285
Thr Leu Glu Asp Cys Tyr Asn Leu Gln Glu Met Pro Val Leu Ser Lys
290 295 300
Leu Pro His Leu Lys Ser Leu Glu Leu Thr Glu Leu Asp Asn Leu Glu
305 310 315 320
Tyr Met Glu Ser Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala Ala
325 330 335
Thr Pro Glu Leu Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr Leu
340 345 350
Trp Arg Leu Asp Lys Leu Lys Gly Phe Gly Asn Arg Arg Ser Ser Ser
355 360 365
Phe Pro Arg Leu Ser Lys Leu Glu Ile Trp Lys Cys Pro Asp Leu Thr
370 375 380
Ser Phe Pro Ser Cys Pro Ser Leu Glu Glu Leu Glu Leu Lys Glu Asn
385 390 395 400
Asn Glu Ala Leu Gln Ile Ile Val Lys Ile Thr Thr Thr Arg Gly Lys
405 410 415
Glu Glu Lys Glu Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln Asp
420 425 430
Asp Asp Asn Val Lys Leu Trp Lys Val Glu Ile Asp Asn Leu Gly Tyr
435 440 445
Leu Lys Ser Leu Pro Thr Asn Cys Leu Thr His Leu Asp Leu Thr Ile
450 455 460
Ser Asp Ser Lys Glu Gly Glu Gly Glu Trp Glu Val Gly Asp Ala Phe
465 470 475 480
Gln Lys Cys Val Ser Ser Leu Arg Ser Leu Thr Ile Ile Gly Asn His
485 490 495
Gly Ile Asn Lys Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu His
500 505 510
Phe Thr Leu Leu Glu Ser Leu Lys Leu Ser Asp Ile Glu Asp Gln Glu
515 520 525
Asp Glu Gly Glu
530
<210> 9
<211> 1392
<212> DNA
<213> spinach
<220>
<223> amplicon of LRR domain of alpha-WOLF 27 allele
<400> 9
tggatgtgtc ttaggatgtt ggacttgtca aggccggatg ttaaaaattt gcctaattca 60
ataggtaaat tgttgcactt gaggtatctt aacctgtctt gtaatgatga tctgttgata 120
ctccctgatg caattacaag actgcataat ttgcagacac tgcttttaaa agattgcgga 180
agtttaaagg agttgccaaa agatttttgc aaattggtca aactgagaca cttggattta 240
aggtattgtt ggcgtttgat tggtatgcca ttgggaatgg atatgctaac tagtcttaga 300
gtactgccat actttgtggt gggtaggaag aaacaaagtg ttgatgatga gctgaaagcc 360
cttaaaggcc tcaccgagat aaaaggctcc attaatatca aaatctgtga aaattataga 420
atagttgaag gcatgaatga cacaggagga gctgggtatt tgaagagcat gaaacatctc 480
acgggggttg atattacatt tgatggtgga tgtgttaacc ctgaagctgt gttggaaacc 540
ctagagccac cttcaaatat caagaggtta tctatagata attacgatgg tacaacaatt 600
ccagtatggg gaagagcaga gattaattgg gcaatctccc tctcacatct tgtcgacatt 660
tggttttgtg gttgtagtaa tttgcaggag atgccagtgc tgagtaaact gcctcatttg 720
aaatcactga atctttttaa gttttgtaag ttagagtaca tggagagtag aagcagcagc 780
agtagcagtg acacagaagc agcaacacca gaattaccaa cattcttccc ttcccttgaa 840
aaacttacac tttggtatct ggaaaagttg aagggtttgg ggaacaggag atcgagtagt 900
tttccccgcc tctctgaatt ggaaatctgg gaatgcccag atctaacgtg gtttcctcct 960
tgtccaagcc ttaaaacgtt gaaattggaa aaaaacaatg aagcgttgca aataatagta 1020
aaaataacaa caacaagagg taaagaagaa aaagaagaag acaagaatgc tggtgttgga 1080
aattcacaag atgatgacaa tgtcaaatta cggaaggcgg aaatagacaa tctgggttat 1140
ctcaaatcac tgcccacaaa ttgtctgact cacctcgaca ttacaataag agattccaag 1200
gagggggagg gtgaatggga agttggggag gcatttcaga agtgtgtatc ttctttgaga 1260
aagctcagca taatcggaaa tcacggaata aataaagtga agagactgtc tggaagaaca 1320
gggttggagc atttcactct gttggactca ctcaaatttt caaagataga agaccaggaa 1380
gatgagggcg aa 1392
<210> 10
<211> 464
<212> PRT
<213> spinach
<220>
<223> amino acid sequence encoded by amplicon of LRR domain of α -WOLF27
<400> 10
Trp Met Cys Leu Arg Met Leu Asp Leu Ser Arg Pro Asp Val Lys Asn
1 5 10 15
Leu Pro Asn Ser Ile Gly Lys Leu Leu His Leu Arg Tyr Leu Asn Leu
20 25 30
Ser Cys Asn Asp Asp Leu Leu Ile Leu Pro Asp Ala Ile Thr Arg Leu
35 40 45
His Asn Leu Gln Thr Leu Leu Leu Lys Asp Cys Gly Ser Leu Lys Glu
50 55 60
Leu Pro Lys Asp Phe Cys Lys Leu Val Lys Leu Arg His Leu Asp Leu
65 70 75 80
Arg Tyr Cys Trp Arg Leu Ile Gly Met Pro Leu Gly Met Asp Met Leu
85 90 95
Thr Ser Leu Arg Val Leu Pro Tyr Phe Val Val Gly Arg Lys Lys Gln
100 105 110
Ser Val Asp Asp Glu Leu Lys Ala Leu Lys Gly Leu Thr Glu Ile Lys
115 120 125
Gly Ser Ile Asn Ile Lys Ile Cys Glu Asn Tyr Arg Ile Val Glu Gly
130 135 140
Met Asn Asp Thr Gly Gly Ala Gly Tyr Leu Lys Ser Met Lys His Leu
145 150 155 160
Thr Gly Val Asp Ile Thr Phe Asp Gly Gly Cys Val Asn Pro Glu Ala
165 170 175
Val Leu Glu Thr Leu Glu Pro Pro Ser Asn Ile Lys Arg Leu Ser Ile
180 185 190
Asp Asn Tyr Asp Gly Thr Thr Ile Pro Val Trp Gly Arg Ala Glu Ile
195 200 205
Asn Trp Ala Ile Ser Leu Ser His Leu Val Asp Ile Trp Phe Cys Gly
210 215 220
Cys Ser Asn Leu Gln Glu Met Pro Val Leu Ser Lys Leu Pro His Leu
225 230 235 240
Lys Ser Leu Asn Leu Phe Lys Phe Cys Lys Leu Glu Tyr Met Glu Ser
245 250 255
Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala Ala Thr Pro Glu Leu
260 265 270
Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr Leu Trp Tyr Leu Glu
275 280 285
Lys Leu Lys Gly Leu Gly Asn Arg Arg Ser Ser Ser Phe Pro Arg Leu
290 295 300
Ser Glu Leu Glu Ile Trp Glu Cys Pro Asp Leu Thr Trp Phe Pro Pro
305 310 315 320
Cys Pro Ser Leu Lys Thr Leu Lys Leu Glu Lys Asn Asn Glu Ala Leu
325 330 335
Gln Ile Ile Val Lys Ile Thr Thr Thr Arg Gly Lys Glu Glu Lys Glu
340 345 350
Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln Asp Asp Asp Asn Val
355 360 365
Lys Leu Arg Lys Ala Glu Ile Asp Asn Leu Gly Tyr Leu Lys Ser Leu
370 375 380
Pro Thr Asn Cys Leu Thr His Leu Asp Ile Thr Ile Arg Asp Ser Lys
385 390 395 400
Glu Gly Glu Gly Glu Trp Glu Val Gly Glu Ala Phe Gln Lys Cys Val
405 410 415
Ser Ser Leu Arg Lys Leu Ser Ile Ile Gly Asn His Gly Ile Asn Lys
420 425 430
Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu His Phe Thr Leu Leu
435 440 445
Asp Ser Leu Lys Phe Ser Lys Ile Glu Asp Gln Glu Asp Glu Gly Glu
450 455 460
<210> 11
<211> 7978
<212> DNA
<213> spinach
<220>
<223> genomic DNA sequence of alpha-WOTF 27 allele
<400> 11
gttctgtttt ttatggcaca gatatccctc atttgcagct ctacttctac aaacatcttt 60
cattctttcg ttttcctttt gattcatgta acagttgaac cttctttcat gactgatata 120
gaatcaggca gctacttcac tacttctatg ttgatcttat tttgtaataa actttgatag 180
attgaataaa ggttgtttgc agtgacttct taagatgtga ttagaagtcc ataatcactt 240
taaggtagtt tttctttaca tgattaaggt ttttccgagg cctttctatt gctttgttgg 300
ttactgtcat gacatatggt ttttctttgc ttcttatatc atatggtcct cactcaattt 360
tttaatataa agtttctcat tggttgacta taatacgtta tagcacctta taatatttta 420
tttaatatac aattttatgt attttacctt tttcatattt tttcgtgatc taccttctca 480
tatgagctac actaatttgg tagctgttta tgcaaatctt gtaccaacgg ttggctattt 540
gctcaaattt tttttttttt ttttcgagct agtcatttta tgatcattga agtttgctct 600
tatattatca tttatgtatt ttaccttttt tacatttttt tcgtgatcta cctgctcata 660
tgagccacac taatttggta gctgcttata caattcttgt atcaacggtt ggctacttgt 720
tcaaatattt ttattttttt acgagtaagt cattttatga tcattgaagt tgctctaata 780
ttatcatgga cctattaacg catgaataat taactcggta ggaattagtt tcaaaataaa 840
attcccctca caaaaaaaaa aaaaaaaaaa aaaaaaaaaa tcagaaaacc aaccttctcc 900
agtttactgt tgtctaaagc caaagagcat ggaattttcc agtaatcgca gaccccaaat 960
tctcttctcc aatcgtccct gtcaatttca gcaattgaat caatcgttga ttttaggatt 1020
tgccgccaaa aaaatgaaaa atccatgaat tttagggttc aaatttgatc cgtaattggg 1080
aaaattttca gcaattgatc ttccaaatca ttcatacttg tttccagact gcaaatgaaa 1140
ggtgcgaact ttatactgca ttttgatttt ccattactgt aatttattaa gatgaactgc 1200
aatttgcaat tgttttattc gactactcat ctttaaatca aattgctaaa ttgctagcta 1260
attttcttat catattgcca aaaatttgtt gcttaaatga ttccatttct ctaattattt 1320
ttgttttatt ggtagataaa taattaaata tcagccccat taattgaata ttcaaaggaa 1380
atgtatggtc caaaaatggc gtttaatagt caatgccgtg ttttatgggg tggtggagta 1440
ctatatgact gtgtgtggac ttggagaaga ctagagagta ttgattatca aaatatggac 1500
cctgaaaatg aaaatgaaaa tgatgttttt acactttaaa atcgtcaaga aacaacaatc 1560
ctctttagca atagtattta cacgcgttat ttgcacggac ttcaatgcaa atagtataaa 1620
tttacagtca aagttttcat tctaaagcgt aaataacttt catgaatgga ggacggtagt 1680
ataagtataa cgttatggcc taccattttc ttatcatatt cacataaatt tgttgctaaa 1740
agttgtttta cttggctaaa atacttttgt tcttattggc agataaacat cagtccatta 1800
ttggccaact tgaacatata cctccaaaca ataatcaata atgtcgatta tgaagtttgt 1860
gaatgcaatt tattatcact ttcatttata aaatgactac ttgattaaca catacaatat 1920
tacctttctc caaacaccct ttcaattctg cttaatcttg ttttctcatc atctcttcat 1980
ctttctgaaa acacaaccca atggccgaaa tcggatactc ggtttgtgcg aaactcatcg 2040
aagtgattgg cagtgagctg atcaaagaga tttgcgacac atggggttac aaatctcttc 2100
ttgaggacct caacaaaact gtattgacgg tcaggaacgt tctcattcag gccggggtga 2160
tgcgggagct tactagtgaa caacaaggtt tcattgcaga ccttaaagat gttgtttatg 2220
atgctgatga cttgttcgac aagttactca ctcgtgctga gcgaaaacag attgatggaa 2280
acgaaatctc tgaaaaggta cgtcgtttct tttcctctag taacaagatc ggtcaagctt 2340
actacatgtc tcgtaaggtt aaggaaatta agaagcagtt ggatgaaatt gttgataggc 2400
atacaaaatt tgggtttagt gctgagttta tacctgtttg tagggaaagg gggaacgaga 2460
gggaaacacg ttcatatata gatgtcaaga atattcttgg gagggataaa gataagaatg 2520
atatcataga taggttgctt aatcgtaatg ataatgaagc ttgtagtttc ctgaccatag 2580
tgggagcggg aggattggga aaaactgctc ttgcccaact tgtgttcaat gatgaaaggg 2640
tcaaaattga gtttcatgat ttgaggtatt gggtttgtgt ctctgatcaa gatgggggcc 2700
aatttgatgt gaaagaaatc ctttgtaaga ttttagaggt ggttactaag gagaaagttg 2760
ataatagttc cgcattggaa ttggtacaaa gccaatttca agagaagtta agaggaaaga 2820
agtacttcct tgttcttgat gatgtatgga acgaggatcg tgagaagtgg tttaaattgg 2880
aagagttgtt aatgttgggt caagggggaa gcaaggttgt agtgaccgca cgttcagaga 2940
agacagcaaa tgtcataggg aaaagacatt tttatacact ggaatgtttg tcgccagatt 3000
attcatggag cttatttgaa atgtcggctt ttcagaaagg gcatgagcag gaaaaccatg 3060
acgaactagt tgatattggg aaaaagattg ttgaaaaatg ttataacaat ccacttgcta 3120
taacggtggt aggaagtctt ctttatggag aggagataag taagtggcgg tcatttgaaa 3180
tgagtgagtt ggccaaaatt ggcaatgggg ataataagat tttgtcgata ttgaagctca 3240
gttactacaa tcttgcaaac tctttgaaga gttgttttag ttattgtgca gtatttccca 3300
aggatcataa aatagagaag gagatgttga ttgacctttg gatagcacaa ggatatgttg 3360
tgccgttgga tggtggtcaa agtatagaag atgctgccga ggaacatttt gtaattttat 3420
tacggagatg tttctttcaa gatgtagtga aggatgtata cggtgatgtt gattctgtta 3480
aaatccacga cttgatgcac gatgtcgccc aagaagtggg gagggaggaa atatgtgtag 3540
tgaatgctaa tacaaagaac ttgggtgata aaatccgtca tgtacatggt gatgtcaata 3600
gatatgcaca aagagtctct ctgtgtagcc ataagattcg ttcgtatatt ggtggtaatt 3660
gtgaaaaacg ttgggtggat acactaatag acaactggat gtgtcttagg atgttggact 3720
tgtcaaggcc ggatgttaaa aatttgccta attcaatagg taaattgttg cacttgaggt 3780
atcttaacct gtcttgtaat gatgatctgt tgatactccc tgatgcaatt acaagactgc 3840
ataatttgca gacactgctt ttaaaagatt gcggaagttt aaaggagttg ccaaaagatt 3900
tttgcaaatt ggtcaaactg agacacttgg atttaaggta ttgttggcgt ttgattggta 3960
tgccattggg aatggatatg ctaactagtc ttagagtact gccatacttt gtggtgggta 4020
ggaagaaaca aagtgttgat gatgagctga aagcccttaa aggcctcacc gagataaaag 4080
gctccattaa tatcaaaatc tgtgaaaatt atagaatagt tgaaggcatg aatgacacag 4140
gaggagctgg gtatttgaag agcatgaaac atctcacggg ggttgatatt acatttgatg 4200
gtggatgtgt taaccctgaa gctgtgttgg aaaccctaga gccaccttca aatatcaaga 4260
ggttatctat agataattac gatggtacaa caattccagt atggggaaga gcagagatta 4320
attgggcaat ctccctctca catcttgtcg acatttggtt ttgtggttgt agtaatttgc 4380
aggagatgcc agtgctgagt aaactgcctc atttgaaatc actgaatctt tttaagtttt 4440
gtaagttaga gtacatggag agtagaagca gcagcagtag cagtgacaca gaagcagcaa 4500
caccagaatt accaacattc ttcccttccc ttgaaaaact tacactttgg tatctggaaa 4560
agttgaaggg tttggggaac aggagatcga gtagttttcc ccgcctctct gaattggaaa 4620
tctgggaatg cccagatcta acgtggtttc ctccttgtcc aagccttaaa acgttgaaat 4680
tggaaaaaaa caatgaagcg ttgcaaataa tagtaaaaat aacaacaaca agaggtaaag 4740
aagaaaaaga agaagacaag aatgctggtg ttggaaattc acaagatgat gacaatgtca 4800
aattacggaa ggcggaaata gacaatctgg gttatctcaa atcactgccc acaaattgtc 4860
tgactcacct cgacattaca ataagagatt ccaaggaggg ggagggtgaa tgggaagttg 4920
gggaggcatt tcagaagtgt gtatcttctt tgagaaagct cagcataatc ggaaatcacg 4980
gaataaataa agtgaagaga ctgtctggaa gaacagggtt ggagcatttc actctgttgg 5040
actcactcaa attttcaaag atagaagacc aggaagatga gggcgaagac aacatcatat 5100
tctggaaatc ctttcctcaa aacctccgca gtttggaaat taaaggctct tgcaaaatga 5160
caagtttgcc catggggatg cagtacttaa cctccctcca aaccctccat ctatcatatt 5220
gtgatgaatt gaattccctt ccagaatgga taagcagctt atcatctctt caatccctgt 5280
tcatatacaa ttgtccagcc ctgaaatcac taccagaagc aatgaagaac ctcacctccc 5340
ttcagagact tgagatacag cattgtccag acctagctga aagatgcaga aaacccaacg 5400
gggaggacta tcccaaaatt caacacatcc ccaaaattgt aagtcattgc agaaagtaat 5460
ttattcattt atatttattt tatgcttaga atgatatacg cagtcgtcct ttggtttcca 5520
atcttgaatt tggtttttgt tttctttctt tgtttcttta ttcaacacca gtccatttat 5580
gattgattca ttaaaaaaag gatggagttt tatggatttg aagaagacaa cgaattgaga 5640
ttcctggggt tttttttttc gttggggttg gttttcatgt atatgttgct gattaaatac 5700
cagactgatg atgatgatgt gtttatgggt tttaaatcag attaaatata tgggaaatgt 5760
aagttaattg gggatgcaca taaggtgttt gatgaaatgt ctatgagaaa tgttgtttct 5820
tggacttaga atgatataca ctgtcgtcct ttggtttcca atcttacatt tggtttgtgt 5880
tttcttagtt tgtttcttta atcaacacca gcccattttt tttaaactac ctgcaactac 5940
taattttcat ttaccctgta tctcaggaaa tatggtagta attctcattt actcaacact 6000
agcttgatcc tgaacgcagc caaccttcag gttagaatcc gccttactca tccttttgtc 6060
atgcattgtt ttaagttgtt ttgcttgctt gtgtaatcat aattcatagt atacgattca 6120
tcattcacta tgtctacagg caagatattg gaattgttca cgattccctg aagtttcttt 6180
gtttttgttg ataccaccat attgcagctt atagtgacta agttaatgaa tgtttccaaa 6240
aaattagtca tataaattct tcttctctct ctattacata aactcttttt ctctttctaa 6300
cttatcatgt tcatgcctaa aacttataca tgctcacatc attgttcgtt tgagctgact 6360
tacttctgta agagagctat ctagttaaca actcttgtaa ctttttattt gctagtcaga 6420
acatggattg gtgcaagcat gggaatttgc taacactcta ccaaatcgat tggagtttgg 6480
acttagtttc accagaagcc atacccggac acttactggg gactgtcaac aaagccgcat 6540
tgtgatgtac ttggatgttt cacgtgcctg aggtgcgagt tacttggaag ggaagcggtt 6600
tatttaattg ttttcctaag tagattttgc ttacaagctt ttacttttca cttgaaaggg 6660
tttttcttgt tttaagcttt tcgaattaga gttttcggtt gcattaagag tagtcgtatt 6720
agtcttttac ctaaggaaga ctcttttttg taattttcag actatgcaat tcaagttttc 6780
gagtgttttc ttgcttgtgt gattgtgagt tggtgaattc gtctttcata cattttgaga 6840
ttatcagaag ctttatgctc caccggtagt ctagtacctt ttctgttact gtacgtgcag 6900
ggaagtaatc tggtaccttc tatatatatg gaaaaacata cattatacat tatgcaaaat 6960
tcttacaggt tagttacttc ctggaacttc atttacactt tgtttttttt gttccattcc 7020
ctcggaagac tattccctct gagaaatatg taatgaactt ctgtatgttg ctgtttggtt 7080
cctgttttaa tcttcaattt tcttgtatag ttacagctgc atttacaatg aagtttaagc 7140
agacactctc tttatatagt gcttctttct ggagcaccgt tgagctgtct gtggttgatc 7200
accatctgct gccgagagat tcagcaatcg cgtgtttgat caggtaaaag tttttatgtc 7260
aatgtgtttt tttttccgtt tgatcaattt atgtctgtat tcagattctt atcttcttac 7320
agtagcataa cacattgttt ctttcattta tgtaaactgt ttcaagatta cagagatgta 7380
tgcttcagtc gacattgatg ataacttaag atagcattcc tacaacagtt gcaggcgcat 7440
tctaactccg gcaattctag ttaggcaaga ggagcattgc caatacctgc cacctctggg 7500
atttactata ccagggttga agtttatgga agacaccagc tatgcacaag ccttcaaggg 7560
gtcatcctac ataacaagtt gaaccaacca attgcttgtt ggttcagtgg taattggagc 7620
tgaatttggt agggatggcc catgttcgat ccccacaaca acaattggga ggggactgga 7680
acctatccac acgaactccg ccctgaatcc ggattagtcc taagggtgaa cggggtgcta 7740
acaccaaaaa aaaaaaacat aacaagttga accaaacata ctttgtttga attgaagatt 7800
tagtgatttc atttgatcga ttgagatgtc ttattataag cgtatatgct cttggatttg 7860
gccacttagg tgttgtttga caattggtca ttaactcgct tttatatttt cttttctctt 7920
aggaaaggtg atcctgataa tttatattgg aacacttttt ttttctctca ctagcttt 7978
<210> 12
<211> 3450
<212> DNA
<213> spinach
<220>
<223> coding sequence for alpha-WOLF 27 allele
<400> 12
atggccgaaa tcggatactc ggtttgtgcg aaactcatcg aagtgattgg cagtgagctg 60
atcaaagaga tttgcgacac atggggttac aaatctcttc ttgaggacct caacaaaact 120
gtattgacgg tcaggaacgt tctcattcag gccggggtga tgcgggagct tactagtgaa 180
caacaaggtt tcattgcaga ccttaaagat gttgtttatg atgctgatga cttgttcgac 240
aagttactca ctcgtgctga gcgaaaacag attgatggaa acgaaatctc tgaaaaggta 300
cgtcgtttct tttcctctag taacaagatc ggtcaagctt actacatgtc tcgtaaggtt 360
aaggaaatta agaagcagtt ggatgaaatt gttgataggc atacaaaatt tgggtttagt 420
gctgagttta tacctgtttg tagggaaagg gggaacgaga gggaaacacg ttcatatata 480
gatgtcaaga atattcttgg gagggataaa gataagaatg atatcataga taggttgctt 540
aatcgtaatg ataatgaagc ttgtagtttc ctgaccatag tgggagcggg aggattggga 600
aaaactgctc ttgcccaact tgtgttcaat gatgaaaggg tcaaaattga gtttcatgat 660
ttgaggtatt gggtttgtgt ctctgatcaa gatgggggcc aatttgatgt gaaagaaatc 720
ctttgtaaga ttttagaggt ggttactaag gagaaagttg ataatagttc cgcattggaa 780
ttggtacaaa gccaatttca agagaagtta agaggaaaga agtacttcct tgttcttgat 840
gatgtatgga acgaggatcg tgagaagtgg tttaaattgg aagagttgtt aatgttgggt 900
caagggggaa gcaaggttgt agtgaccgca cgttcagaga agacagcaaa tgtcataggg 960
aaaagacatt tttatacact ggaatgtttg tcgccagatt attcatggag cttatttgaa 1020
atgtcggctt ttcagaaagg gcatgagcag gaaaaccatg acgaactagt tgatattggg 1080
aaaaagattg ttgaaaaatg ttataacaat ccacttgcta taacggtggt aggaagtctt 1140
ctttatggag aggagataag taagtggcgg tcatttgaaa tgagtgagtt ggccaaaatt 1200
ggcaatgggg ataataagat tttgtcgata ttgaagctca gttactacaa tcttgcaaac 1260
tctttgaaga gttgttttag ttattgtgca gtatttccca aggatcataa aatagagaag 1320
gagatgttga ttgacctttg gatagcacaa ggatatgttg tgccgttgga tggtggtcaa 1380
agtatagaag atgctgccga ggaacatttt gtaattttat tacggagatg tttctttcaa 1440
gatgtagtga aggatgtata cggtgatgtt gattctgtta aaatccacga cttgatgcac 1500
gatgtcgccc aagaagtggg gagggaggaa atatgtgtag tgaatgctaa tacaaagaac 1560
ttgggtgata aaatccgtca tgtacatggt gatgtcaata gatatgcaca aagagtctct 1620
ctgtgtagcc ataagattcg ttcgtatatt ggtggtaatt gtgaaaaacg ttgggtggat 1680
acactaatag acaactggat gtgtcttagg atgttggact tgtcaaggcc ggatgttaaa 1740
aatttgccta attcaatagg taaattgttg cacttgaggt atcttaacct gtcttgtaat 1800
gatgatctgt tgatactccc tgatgcaatt acaagactgc ataatttgca gacactgctt 1860
ttaaaagatt gcggaagttt aaaggagttg ccaaaagatt tttgcaaatt ggtcaaactg 1920
agacacttgg atttaaggta ttgttggcgt ttgattggta tgccattggg aatggatatg 1980
ctaactagtc ttagagtact gccatacttt gtggtgggta ggaagaaaca aagtgttgat 2040
gatgagctga aagcccttaa aggcctcacc gagataaaag gctccattaa tatcaaaatc 2100
tgtgaaaatt atagaatagt tgaaggcatg aatgacacag gaggagctgg gtatttgaag 2160
agcatgaaac atctcacggg ggttgatatt acatttgatg gtggatgtgt taaccctgaa 2220
gctgtgttgg aaaccctaga gccaccttca aatatcaaga ggttatctat agataattac 2280
gatggtacaa caattccagt atggggaaga gcagagatta attgggcaat ctccctctca 2340
catcttgtcg acatttggtt ttgtggttgt agtaatttgc aggagatgcc agtgctgagt 2400
aaactgcctc atttgaaatc actgaatctt tttaagtttt gtaagttaga gtacatggag 2460
agtagaagca gcagcagtag cagtgacaca gaagcagcaa caccagaatt accaacattc 2520
ttcccttccc ttgaaaaact tacactttgg tatctggaaa agttgaaggg tttggggaac 2580
aggagatcga gtagttttcc ccgcctctct gaattggaaa tctgggaatg cccagatcta 2640
acgtggtttc ctccttgtcc aagccttaaa acgttgaaat tggaaaaaaa caatgaagcg 2700
ttgcaaataa tagtaaaaat aacaacaaca agaggtaaag aagaaaaaga agaagacaag 2760
aatgctggtg ttggaaattc acaagatgat gacaatgtca aattacggaa ggcggaaata 2820
gacaatctgg gttatctcaa atcactgccc acaaattgtc tgactcacct cgacattaca 2880
ataagagatt ccaaggaggg ggagggtgaa tgggaagttg gggaggcatt tcagaagtgt 2940
gtatcttctt tgagaaagct cagcataatc ggaaatcacg gaataaataa agtgaagaga 3000
ctgtctggaa gaacagggtt ggagcatttc actctgttgg actcactcaa attttcaaag 3060
atagaagacc aggaagatga gggcgaagac aacatcatat tctggaaatc ctttcctcaa 3120
aacctccgca gtttggaaat taaaggctct tgcaaaatga caagtttgcc catggggatg 3180
cagtacttaa cctccctcca aaccctccat ctatcatatt gtgatgaatt gaattccctt 3240
ccagaatgga taagcagctt atcatctctt caatccctgt tcatatacaa ttgtccagcc 3300
ctgaaatcac taccagaagc aatgaagaac ctcacctccc ttcagagact tgagatacag 3360
cattgtccag acctagctga aagatgcaga aaacccaacg gggaggacta tcccaaaatt 3420
caacacatcc ccaaaattga aatatggtag 3450
<210> 13
<211> 1149
<212> PRT
<213> spinach
<220>
<223> amino acid sequence of alpha-WOTF 27 allele
<400> 13
Met Ala Glu Ile Gly Tyr Ser Val Cys Ala Lys Leu Ile Glu Val Ile
1 5 10 15
Gly Ser Glu Leu Ile Lys Glu Ile Cys Asp Thr Trp Gly Tyr Lys Ser
20 25 30
Leu Leu Glu Asp Leu Asn Lys Thr Val Leu Thr Val Arg Asn Val Leu
35 40 45
Ile Gln Ala Gly Val Met Arg Glu Leu Thr Ser Glu Gln Gln Gly Phe
50 55 60
Ile Ala Asp Leu Lys Asp Val Val Tyr Asp Ala Asp Asp Leu Phe Asp
65 70 75 80
Lys Leu Leu Thr Arg Ala Glu Arg Lys Gln Ile Asp Gly Asn Glu Ile
85 90 95
Ser Glu Lys Val Arg Arg Phe Phe Ser Ser Ser Asn Lys Ile Gly Gln
100 105 110
Ala Tyr Tyr Met Ser Arg Lys Val Lys Glu Ile Lys Lys Gln Leu Asp
115 120 125
Glu Ile Val Asp Arg His Thr Lys Phe Gly Phe Ser Ala Glu Phe Ile
130 135 140
Pro Val Cys Arg Glu Arg Gly Asn Glu Arg Glu Thr Arg Ser Tyr Ile
145 150 155 160
Asp Val Lys Asn Ile Leu Gly Arg Asp Lys Asp Lys Asn Asp Ile Ile
165 170 175
Asp Arg Leu Leu Asn Arg Asn Asp Asn Glu Ala Cys Ser Phe Leu Thr
180 185 190
Ile Val Gly Ala Gly Gly Leu Gly Lys Thr Ala Leu Ala Gln Leu Val
195 200 205
Phe Asn Asp Glu Arg Val Lys Ile Glu Phe His Asp Leu Arg Tyr Trp
210 215 220
Val Cys Val Ser Asp Gln Asp Gly Gly Gln Phe Asp Val Lys Glu Ile
225 230 235 240
Leu Cys Lys Ile Leu Glu Val Val Thr Lys Glu Lys Val Asp Asn Ser
245 250 255
Ser Ala Leu Glu Leu Val Gln Ser Gln Phe Gln Glu Lys Leu Arg Gly
260 265 270
Lys Lys Tyr Phe Leu Val Leu Asp Asp Val Trp Asn Glu Asp Arg Glu
275 280 285
Lys Trp Phe Lys Leu Glu Glu Leu Leu Met Leu Gly Gln Gly Gly Ser
290 295 300
Lys Val Val Val Thr Ala Arg Ser Glu Lys Thr Ala Asn Val Ile Gly
305 310 315 320
Lys Arg His Phe Tyr Thr Leu Glu Cys Leu Ser Pro Asp Tyr Ser Trp
325 330 335
Ser Leu Phe Glu Met Ser Ala Phe Gln Lys Gly His Glu Gln Glu Asn
340 345 350
His Asp Glu Leu Val Asp Ile Gly Lys Lys Ile Val Glu Lys Cys Tyr
355 360 365
Asn Asn Pro Leu Ala Ile Thr Val Val Gly Ser Leu Leu Tyr Gly Glu
370 375 380
Glu Ile Ser Lys Trp Arg Ser Phe Glu Met Ser Glu Leu Ala Lys Ile
385 390 395 400
Gly Asn Gly Asp Asn Lys Ile Leu Ser Ile Leu Lys Leu Ser Tyr Tyr
405 410 415
Asn Leu Ala Asn Ser Leu Lys Ser Cys Phe Ser Tyr Cys Ala Val Phe
420 425 430
Pro Lys Asp His Lys Ile Glu Lys Glu Met Leu Ile Asp Leu Trp Ile
435 440 445
Ala Gln Gly Tyr Val Val Pro Leu Asp Gly Gly Gln Ser Ile Glu Asp
450 455 460
Ala Ala Glu Glu His Phe Val Ile Leu Leu Arg Arg Cys Phe Phe Gln
465 470 475 480
Asp Val Val Lys Asp Val Tyr Gly Asp Val Asp Ser Val Lys Ile His
485 490 495
Asp Leu Met His Asp Val Ala Gln Glu Val Gly Arg Glu Glu Ile Cys
500 505 510
Val Val Asn Ala Asn Thr Lys Asn Leu Gly Asp Lys Ile Arg His Val
515 520 525
His Gly Asp Val Asn Arg Tyr Ala Gln Arg Val Ser Leu Cys Ser His
530 535 540
Lys Ile Arg Ser Tyr Ile Gly Gly Asn Cys Glu Lys Arg Trp Val Asp
545 550 555 560
Thr Leu Ile Asp Asn Trp Met Cys Leu Arg Met Leu Asp Leu Ser Arg
565 570 575
Pro Asp Val Lys Asn Leu Pro Asn Ser Ile Gly Lys Leu Leu His Leu
580 585 590
Arg Tyr Leu Asn Leu Ser Cys Asn Asp Asp Leu Leu Ile Leu Pro Asp
595 600 605
Ala Ile Thr Arg Leu His Asn Leu Gln Thr Leu Leu Leu Lys Asp Cys
610 615 620
Gly Ser Leu Lys Glu Leu Pro Lys Asp Phe Cys Lys Leu Val Lys Leu
625 630 635 640
Arg His Leu Asp Leu Arg Tyr Cys Trp Arg Leu Ile Gly Met Pro Leu
645 650 655
Gly Met Asp Met Leu Thr Ser Leu Arg Val Leu Pro Tyr Phe Val Val
660 665 670
Gly Arg Lys Lys Gln Ser Val Asp Asp Glu Leu Lys Ala Leu Lys Gly
675 680 685
Leu Thr Glu Ile Lys Gly Ser Ile Asn Ile Lys Ile Cys Glu Asn Tyr
690 695 700
Arg Ile Val Glu Gly Met Asn Asp Thr Gly Gly Ala Gly Tyr Leu Lys
705 710 715 720
Ser Met Lys His Leu Thr Gly Val Asp Ile Thr Phe Asp Gly Gly Cys
725 730 735
Val Asn Pro Glu Ala Val Leu Glu Thr Leu Glu Pro Pro Ser Asn Ile
740 745 750
Lys Arg Leu Ser Ile Asp Asn Tyr Asp Gly Thr Thr Ile Pro Val Trp
755 760 765
Gly Arg Ala Glu Ile Asn Trp Ala Ile Ser Leu Ser His Leu Val Asp
770 775 780
Ile Trp Phe Cys Gly Cys Ser Asn Leu Gln Glu Met Pro Val Leu Ser
785 790 795 800
Lys Leu Pro His Leu Lys Ser Leu Asn Leu Phe Lys Phe Cys Lys Leu
805 810 815
Glu Tyr Met Glu Ser Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala
820 825 830
Ala Thr Pro Glu Leu Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr
835 840 845
Leu Trp Tyr Leu Glu Lys Leu Lys Gly Leu Gly Asn Arg Arg Ser Ser
850 855 860
Ser Phe Pro Arg Leu Ser Glu Leu Glu Ile Trp Glu Cys Pro Asp Leu
865 870 875 880
Thr Trp Phe Pro Pro Cys Pro Ser Leu Lys Thr Leu Lys Leu Glu Lys
885 890 895
Asn Asn Glu Ala Leu Gln Ile Ile Val Lys Ile Thr Thr Thr Arg Gly
900 905 910
Lys Glu Glu Lys Glu Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln
915 920 925
Asp Asp Asp Asn Val Lys Leu Arg Lys Ala Glu Ile Asp Asn Leu Gly
930 935 940
Tyr Leu Lys Ser Leu Pro Thr Asn Cys Leu Thr His Leu Asp Ile Thr
945 950 955 960
Ile Arg Asp Ser Lys Glu Gly Glu Gly Glu Trp Glu Val Gly Glu Ala
965 970 975
Phe Gln Lys Cys Val Ser Ser Leu Arg Lys Leu Ser Ile Ile Gly Asn
980 985 990
His Gly Ile Asn Lys Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu
995 1000 1005
His Phe Thr Leu Leu Asp Ser Leu Lys Phe Ser Lys Ile Glu Asp Gln
1010 1015 1020
Glu Asp Glu Gly Glu Asp Asn Ile Ile Phe Trp Lys Ser Phe Pro Gln
1025 1030 1035 1040
Asn Leu Arg Ser Leu Glu Ile Lys Gly Ser Cys Lys Met Thr Ser Leu
1045 1050 1055
Pro Met Gly Met Gln Tyr Leu Thr Ser Leu Gln Thr Leu His Leu Ser
1060 1065 1070
Tyr Cys Asp Glu Leu Asn Ser Leu Pro Glu Trp Ile Ser Ser Leu Ser
1075 1080 1085
Ser Leu Gln Ser Leu Phe Ile Tyr Asn Cys Pro Ala Leu Lys Ser Leu
1090 1095 1100
Pro Glu Ala Met Lys Asn Leu Thr Ser Leu Gln Arg Leu Glu Ile Gln
1105 1110 1115 1120
His Cys Pro Asp Leu Ala Glu Arg Cys Arg Lys Pro Asn Gly Glu Asp
1125 1130 1135
Tyr Pro Lys Ile Gln His Ile Pro Lys Ile Glu Ile Trp
1140 1145
<210> 14
<211> 9
<212> PRT
<213> spinach
<220>
<223> motif
<400> 14
Asp Gln Glu Asp Glu Gly Glu Asp Asn
1 5
<210> 15
<211> 30
<212> DNA
<213> spinach
<220>
<223> Standard amplified sequence Forward primer
<400> 15
gcagtcgaac atgtagctga ctcaggtcac 30
<210> 16
<211> 30
<212> DNA
<213> spinach
<220>
<223> Standard amplified sequence reverse primer
<400> 16
tggatcactt gtgcaagcat cacatcgtag 30

Claims (18)

1. An allele designated α -WOLF27 that confers resistance to at least one race of downy mildew (Peronospora effusa), wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) A motif "MAEIGYSVC" at its N-terminus; and b) motif "KWMCLR"; and wherein the LRR domain of the protein hybridizes in increasing order of preference to SEQ ID NO:10 has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity.
2. The allele of claim 1, wherein the DNA sequence of the LRR domain hybridizes in increasing order of preference to SEQ ID NO:9 has at least 95%, 95.5%, 96%, 96.5%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
3. The allele according to claim 1 or 2, wherein said allele confers complete resistance to at least the race Pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 of downy mildew when homozygously present in a spinach plant.
4. The allele according to any one of claims 1 to 3, wherein the allele confers complete resistance to at least the race of downy mildew Pe 1, pe 2, pe 3, pe 4, pe 5, pe 6, pe 7, pe 8, pe 9, pe 11, pe 12, pe 13, pe 14, pe 15, pe 17 when homozygously present in a spinach plant.
5. Spinach plant comprising an allele according to any of claims 1 to 4, which is capable of growing into a representative sample of the seed of a plant comprising said allele deposited with the NCIMB under accession number NCIMB 43668.
6. The spinach plant of claim 5, wherein said plant is an agronomically elite plant.
7. The spinach plant of claim 6, wherein said agronomically elite plant is a hybrid or inbred line.
8. The spinach plant of claim 7, further comprising a genetic determinant resulting in resistance to the race pe1 to pe17 of the species peronospora cheilis.
9. Propagation material capable of developing into and/or derived from a spinach plant as defined in any one of claims 5 to 8, wherein the propagation material comprises an allele as defined in any one of claims 1 to 4 and wherein the propagation material is selected from microspores, pollen, ovaries, ovules, embryos, embryo sacs, egg cells, cuttings, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, cells or tissue cultures thereof.
10. A cell of a spinach plant comprising an allele according to any one of claims 1 to 4.
11. A method of producing hybrid spinach seed comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first parent spinach plant comprises an allele according to any one of claims 1-4.
12. The method of claim 11, wherein the first and/or second parent is a plant of an inbred line.
13. A hybrid spinach plant grown from seed produced by the method of claim 11 or claim 12.
14. A method for identifying a spinach plant carrying an allele according to any one of claims 1 to 4, comprising determining the presence of an LRR domain as defined in claim 1 by determining the nucleotide sequence thereof or a part thereof in the plant, wherein said sequence hybridizes with SEQ ID NO:9 has 95%, 95.5%, 96%, 96.5%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity.
15. The method of claim 14, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a primer having the sequence of SEQ ID NO:4, and a nucleic acid molecule of the sequence of 4.
16. The method of claim 14, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the reverse primer is a primer having the sequence of SEQ ID NO:5, and a nucleic acid molecule of the sequence of 5.
17. A method of producing a spinach plant that exhibits resistance to downy mildew, comprising:
(a) Crossing a plant comprising the allele of any one of claims 1 or 2 with another plant;
(b) Optionally performing one or more rounds of selfing and/or hybridization;
(c) Selecting a plant comprising the allele of any one of claims 1 to 4 after one or more rounds of selfing and/or crossing.
18. The method of claim 17, wherein selecting a plant comprising an allele comprises determining the presence of an allele according to the method of any one of claims 14 to 16.
CN202180073985.9A 2020-10-30 2021-11-01 Downy mildew resistance in spinach Pending CN116744787A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EPPCT/EP2020/080597 2020-10-30
US17/085,860 2020-10-30
US17/085,860 US11473102B2 (en) 2020-10-30 2020-10-30 Peronospora resistance in Spinacia oleracea
PCT/EP2021/080275 WO2022090543A1 (en) 2020-10-30 2021-11-01 Peronospora resistance in spinacia oleracea

Publications (1)

Publication Number Publication Date
CN116744787A true CN116744787A (en) 2023-09-12

Family

ID=81378833

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180073985.9A Pending CN116744787A (en) 2020-10-30 2021-11-01 Downy mildew resistance in spinach

Country Status (2)

Country Link
US (1) US11473102B2 (en)
CN (1) CN116744787A (en)

Family Cites Families (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005028651A1 (en) 2003-09-25 2005-03-31 Queensland University Of Technology Banana resistance genes and uses thereof
US20050183150A1 (en) 2004-02-13 2005-08-18 Rebecca Torisky Method for regenerating and transforming St. Augustinegrass from embryogenic callus
WO2007051483A1 (en) 2005-11-01 2007-05-10 Universiteit Utrecht Holding B.V. Disease resistant plants
WO2008092505A1 (en) 2007-02-01 2008-08-07 Enza Zaden Beheer B.V. Disease resistant plants
US7935865B2 (en) 2008-05-30 2011-05-03 Seminis Vegetable Seeds, Inc. Spinach line SMB66-1082F
US7939718B2 (en) 2008-05-30 2011-05-10 Seminis Vegetable Seeds, Inc. Spinach line OMB66-1101M
US7935868B2 (en) 2008-07-29 2011-05-03 Seminis Vegetable Seeds, Inc. Spinach line MSA66-1119M
NL2005279C2 (en) 2010-08-26 2012-02-28 Rijk Zwaan Zaadteelt En Zaadhandel Bv Multileaf spinach.
US9265275B2 (en) 2010-11-11 2016-02-23 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Spinach line SP6504
US8735659B2 (en) 2011-08-26 2014-05-27 Seminis Vegetable Seeds, Inc. Spinach hybrid RX 06681616 and parents thereof
US9485954B2 (en) 2011-08-30 2016-11-08 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Spinach hybrid 51-324
EP2586294A1 (en) 2011-10-31 2013-05-01 Rijk Zwaan Zaadteelt en Zaadhandel B.V. Peronospora resistance in Spinacia oleracea
US9370161B2 (en) 2012-08-29 2016-06-21 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-331 RZ
US9320247B2 (en) 2012-08-29 2016-04-26 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-336 RZ
US9351472B2 (en) 2012-08-29 2016-05-31 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-707 RZ
US9307739B2 (en) 2012-08-29 2016-04-12 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-335 RZ
US9357740B2 (en) 2012-08-29 2016-06-07 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-333 RZ
US9370162B2 (en) 2012-08-29 2016-06-21 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Hybrid spinach variety 51-332 RZ
DE102013010026A1 (en) 2013-06-17 2014-12-18 Kws Saat Ag Resistance gene against Rizomania
US10258002B2 (en) 2013-09-13 2019-04-16 Nunhems B.V. Spinach plants that are resistant to downy mildew
US10258001B2 (en) 2013-09-13 2019-04-16 Nunhems B.V. Spinach plants that are resistant to downy mildew
AU2014221305B2 (en) 2013-09-13 2019-09-19 Nunhems B.V. Spinach plants that are resistant to downy mildew
AU2014320398B2 (en) 2013-09-13 2020-09-10 Nunhems B.V. Spinach plants that are resistant to downy mildew
WO2015036378A1 (en) 2013-09-13 2015-03-19 Nunhems B.V. Spinach plants that are resistant to downy mildew
NZ630628A (en) 2013-10-08 2015-04-24 Seminis Vegetable Seeds Inc Methods and compositions for peronospora resistance in spinach
NZ630710A (en) 2014-02-27 2016-03-31 Seminis Vegetable Seeds Inc Compositions and methods for peronospora resistance in spinach
WO2015171603A1 (en) 2014-05-06 2015-11-12 Two Blades Foundation Methods for producing plants with enhanced resistance to oomycete pathogens
US10226014B2 (en) 2015-11-10 2019-03-12 Pop Vriend Research B.V. Peronospora resistance in spinacia sp
US10226015B2 (en) 2015-11-10 2019-03-12 Pop Vriend Research B.V. Peronospora resistance in Spinacia sp
WO2018059653A1 (en) 2016-09-30 2018-04-05 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Peronospora resistance in spinacia oleracea
US9402363B1 (en) 2015-11-20 2016-08-02 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Peronospora resistance in spinacia oleracea
US10226016B2 (en) 2016-05-13 2019-03-12 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Non R-gene mediated resistance
WO2018059718A1 (en) 2016-09-30 2018-04-05 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Peronospora resistance in spinacia oleracea
WO2018059651A1 (en) 2016-09-30 2018-04-05 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Method for modifying the resistance profile of spinacia oleracea to downy mildew
US10633670B2 (en) 2017-09-29 2020-04-28 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Method for modifying the resistance profile of spinacia oleracea to downy mildew

Also Published As

Publication number Publication date
US11473102B2 (en) 2022-10-18
US20220135995A1 (en) 2022-05-05

Similar Documents

Publication Publication Date Title
US10638688B2 (en) Peronospora resistance in spinacia oleracea
CN109862782B (en) Downy mildew resistance of spinach
CN110022677B (en) Downy mildew resistance of spinach
CN113573576B (en) Downy mildew resistance in spinach
US20230257763A1 (en) Peronospora resistance in spinacia oleracea
CN116507200A (en) Downy mildew resistance in spinach
CN116744787A (en) Downy mildew resistance in spinach
US20230383306A1 (en) Peronospora resistance in spinacia oleracea
US20230329169A1 (en) Peronospora resistance in spinacia oleracea
EP4236678A1 (en) Peronospora resistance in spinacia oleracea
AU2021368002A1 (en) Peronospora resistance in spinacia oleracea
US10674688B2 (en) Peronospora resistance in spinacia oleracea
WO2023208632A1 (en) Peronospora resistance in spinacia oleracea

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination