CN116732239A - Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus - Google Patents
Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus Download PDFInfo
- Publication number
- CN116732239A CN116732239A CN202211560033.2A CN202211560033A CN116732239A CN 116732239 A CN116732239 A CN 116732239A CN 202211560033 A CN202211560033 A CN 202211560033A CN 116732239 A CN116732239 A CN 116732239A
- Authority
- CN
- China
- Prior art keywords
- primer
- probe
- novel variant
- seq
- disease virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 70
- 241000702626 Infectious bursal disease virus Species 0.000 title claims abstract description 67
- 238000003753 real-time PCR Methods 0.000 title claims abstract description 32
- 238000001514 detection method Methods 0.000 title claims abstract description 23
- 238000003752 polymerase chain reaction Methods 0.000 title description 10
- 238000000034 method Methods 0.000 claims abstract description 20
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 6
- 230000003321 amplification Effects 0.000 claims description 26
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 26
- 238000006243 chemical reaction Methods 0.000 claims description 18
- 238000012360 testing method Methods 0.000 claims description 6
- 239000013641 positive control Substances 0.000 claims description 4
- 238000010791 quenching Methods 0.000 claims description 4
- 230000000171 quenching effect Effects 0.000 claims description 4
- 239000013642 negative control Substances 0.000 claims description 2
- 238000002360 preparation method Methods 0.000 claims description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 10
- 241000287828 Gallus gallus Species 0.000 description 10
- 241000700605 Viruses Species 0.000 description 10
- 235000013330 chicken meat Nutrition 0.000 description 9
- 201000010099 disease Diseases 0.000 description 8
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 8
- 238000002474 experimental method Methods 0.000 description 7
- 239000000203 mixture Substances 0.000 description 7
- 230000035945 sensitivity Effects 0.000 description 7
- 238000010839 reverse transcription Methods 0.000 description 6
- 239000000463 material Substances 0.000 description 4
- 208000027312 Bursal disease Diseases 0.000 description 3
- 238000011529 RT qPCR Methods 0.000 description 3
- 230000007918 pathogenicity Effects 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 241000712461 unidentified influenza virus Species 0.000 description 3
- 241000271566 Aves Species 0.000 description 2
- 241000711404 Avian avulavirus 1 Species 0.000 description 2
- 241000702628 Birnaviridae Species 0.000 description 2
- 241001260012 Bursa Species 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 241000701047 Gallid alphaherpesvirus 2 Species 0.000 description 2
- 206010062016 Immunosuppression Diseases 0.000 description 2
- 101150093578 VP2 gene Proteins 0.000 description 2
- 210000001669 bursa of fabricius Anatomy 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 230000001506 immunosuppresive effect Effects 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000002458 infectious effect Effects 0.000 description 2
- 238000013081 phylogenetic analysis Methods 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 235000013594 poultry meat Nutrition 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000003757 reverse transcription PCR Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 206010003694 Atrophy Diseases 0.000 description 1
- 206010006811 Bursitis Diseases 0.000 description 1
- 101710132601 Capsid protein Proteins 0.000 description 1
- 101710197658 Capsid protein VP1 Proteins 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 208000002979 Influenza in Birds Diseases 0.000 description 1
- 208000006758 Marek Disease Diseases 0.000 description 1
- 206010028851 Necrosis Diseases 0.000 description 1
- 206010029164 Nephrotic syndrome Diseases 0.000 description 1
- 208000010359 Newcastle Disease Diseases 0.000 description 1
- 108010076039 Polyproteins Proteins 0.000 description 1
- 101710118046 RNA-directed RNA polymerase Proteins 0.000 description 1
- 108020005202 Viral DNA Proteins 0.000 description 1
- 108020000999 Viral RNA Proteins 0.000 description 1
- 101710108545 Viral protein 1 Proteins 0.000 description 1
- 230000010530 Virus Neutralization Effects 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 230000000890 antigenic effect Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000037444 atrophy Effects 0.000 description 1
- 206010064097 avian influenza Diseases 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 125000003178 carboxy group Chemical group [H]OC(*)=O 0.000 description 1
- 230000001413 cellular effect Effects 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000013599 cloning vector Substances 0.000 description 1
- 230000034994 death Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 238000012631 diagnostic technique Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 244000144992 flock Species 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 238000012817 gel-diffusion technique Methods 0.000 description 1
- 230000028993 immune response Effects 0.000 description 1
- 208000026278 immune system disease Diseases 0.000 description 1
- 208000017169 kidney disease Diseases 0.000 description 1
- 210000004698 lymphocyte Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000017074 necrotic cell death Effects 0.000 description 1
- 208000009928 nephrosis Diseases 0.000 description 1
- 231100001027 nephrosis Toxicity 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 230000009528 severe injury Effects 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application provides a fluorescent quantitative PCR detection primer, a probe and a kit for a novel variant strain of infectious bursal disease virus, wherein the primer comprises an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2. The probe sequence is shown as SEQ ID NO. 3. The primer and the probe can be used for rapidly, accurately and specifically amplifying and diagnosing the novel variant strain of the IBDV, and the method has simple procedures and can effectively monitor the epidemic situation of the novel variant strain of the IBDV.
Description
Technical Field
The application belongs to the technical field of virus detection, and particularly relates to a fluorescent quantitative PCR detection primer, a probe and a kit for a novel variant strain of infectious bursal disease virus.
Background
Infectious bursal disease (Infectious bursal disease, IBD) is an acute, highly contagious disease in young chickens caused by Infectious Bursal Disease Virus (IBDV). IBD not only causes death of chicken flocks, but also causes immunosuppression of chickens, resulting in reduced level of immune response in organisms and complications or secondary other diseases, which are one of the main epidemic diseases endangering the poultry industry in China, characterized by bursitis, necrosis, atrophy and severe damage of bursa of Fabricius lymphocytes, thereby causing immune dysfunction in chickens and reducing the intensity of response of organisms to vaccines. IBDV is a genus of Birnaviridae (Birnaviridae) and its genome consists of two segments A and B (Dobos, P., et al 1979.Biophysical and biochemical characterization of 5animal viruses with bisegmented double-strapped RNA genome. Journal of Virology,32 (2), 593-605). Large ORF full length 3036bp in genome A segment encodes a multimeric protein NH of about 108kDa 2 pVP2-VP4-VP3-COOH, hydrolyzed by VP4 into pVP2, VP4 and VP3 proteins, the small ORF encodes VP5 protein (Kibeng, F., et al 1997. Information bursal disease virus polyprotein processing does not involve cellular proteins. Arches of Virology,142 (12), 2401-2419). The size of the B segment of the genome is 2.8kb, and the VP1 protein of about 90kDa is encoded. The serotype I of IBDV strains can be divided into classical, variant and supervirulent strains according to the pathogenicity and antigenic differences of IBDV (Cosgrove, A.S.,1962.An Apparently New Disease of Chickens:Avian Nephrosis.Avian Diseases,6 (3), 385-389). However, recently a new variant of IBDV, different from the earlier variant, has shown a tendency to be popular in China (Xu, A., et al 2019.Phylogenetic analyses and pathogenicity of a variant infectious bursal disease virus strain isolated in China virus Research, 276) and infected chickens have no obvious appearance symptoms, but the central immune organ bursa of Fabricius of the chickens are severely atrophic, which results in serious immunosuppression and reduced productivity of the chickens, and presents a new threat to the poultry industry. Conventional diagnostic methods in IBD laboratories include virus neutralization experiments, RT-PCR, agarose gel diffusion experiments, and ELISA experiments. These methods are relatively complex and are directed to new strainsThe development of new rapid, efficient and simple diagnostic techniques for identifying IBDV strains within a population is an urgent need.
Disclosure of Invention
The application aims to solve the problems in the prior art and provide a primer, a probe and a kit for detecting the infectious bursal disease virus novel variant by fluorescent quantitative PCR, and the primer and the probe can be used for rapidly, accurately and specifically amplifying and diagnosing the IBDV novel variant, have simple procedures and can effectively monitor the epidemic situation of the IBDV novel variant.
In order to achieve the technical purpose, the application adopts the following technical scheme:
in a first aspect, the application provides a fluorescent quantitative PCR primer for a novel variant strain of infectious bursal disease virus, wherein the primer comprises an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2.
In a second aspect, the application provides a probe matched with the primer for fluorescent quantitative PCR detection of a novel variant strain of infectious bursal disease virus, and the sequence of the probe is shown as SEQ ID NO. 3.
Further, the 3 'end of the probe is combined with a fluorescence quenching group, and the 5' end is combined with a fluorescence reporting group.
Preferably, the fluorescence quenching group is BHQ-1, and the fluorescence reporting group is FAM.
In a third aspect, the application provides the use of the above-mentioned primers and/or probes in the preparation of a fluorescent quantitative PCR detection product for a novel variant of infectious bursal disease virus.
Further, the detection product comprises a kit and test paper.
In a fourth aspect, the application provides a fluorescent quantitative PCR detection kit for a novel variant strain of infectious bursal disease virus, comprising the primer and the probe.
In a fifth aspect, the application provides a fluorescent quantitative PCR test paper for detecting a novel variant strain of infectious bursal disease virus, comprising the primer and the probe.
In a sixth aspect, the application provides a method for identifying a novel variant of infectious bursal disease virus for non-diagnostic purposes, comprising:
(1) Preparing a negative control, a positive control and a PCR reaction system of a sample to be detected, wherein primer probes used in the PCR reaction system are respectively a primer shown as SEQ ID NO. 1 and SEQ ID NO. 2 and a probe shown as SEQ ID NO. 3;
(2) Amplifying a PCR reaction system;
(3) According to the amplification curve of the PCR reaction system, the novel variant strain of the infectious bursal disease virus in the sample to be detected is judged by the following steps:
the IBDV novel variant was positive when the amplification curve was present and the CT value was less than 35, and the IBDV novel variant was negative when the CT value was greater than 35.
Compared with the prior art, the application has the following beneficial effects: the application designs the fluorescent quantitative PCR detection primer and the probe aiming at the novel IBDV mutant, and the novel IBDV mutant is detected by adopting the primer and the probe, has higher specificity and sensitivity, and can be used for rapidly and conveniently detecting various clinical samples of the novel IBDV mutant.
Drawings
FIG. 1 is a quantitative PCR identification map for a plurality of sets of primers and probes designed in example 1.
FIG. 2 shows the fluorescent quantitative PCR amplification curve of example 1, wherein curve 1 shows the detection results of the novel variant primers and probes of IBDV, and curve 2 shows the detection results of the universal primers and probes of IBDV.
FIG. 3 shows the results of the specific assay of example 2, wherein curve 1 is the amplification curve of a sample of IBDV novel variant positive disease material; curves 2-7 are amplification curves for IBDV classical strain, IBDV variant strain, IBDV supervirulent strain, newcastle disease virus, marek's disease virus and avian influenza virus, respectively.
FIG. 4 shows the sensitivity test results of example 3, wherein the copy numbers represented by curves 1 to 8 are 1.32X10 respectively 8 、1.32×10 7 、1.32×10 6 、1.32×10 5 、1.32×10 4 、1.32×10 3 、1.32×10 2 、1.32×10 1 copies/μL。
Detailed Description
In the description of the present application, it is to be noted that the specific conditions are not specified in the examples, and the description is performed under the conventional conditions or the conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The application will now be described in further detail with reference to the drawings and to specific examples, which are given by way of illustration and not limitation.
Example 1
Method for detecting IBDV novel variant by fluorescent quantitative PCR
Screening of first primers and probes
The inventors have compared in detail the genomic VP2 gene sequences of the novel variant IBDV GD-IBDV-2020, isolated from a broiler farm in Guangdong, and identified by genes and literature: xu, A., et al 2019.Phylogenetic analyses and pathogenicity of a variant infectious bursal disease virus strain isolated in virus Research,276. The reported variants are identical to those of the classical IBDV strain F52/70 (GenBank accession number: HG 974565), the variant IBDV strain SHG19 (GenBank accession number: MH 879092) and the super-strong IBDV strain OKYM (GenBank accession number: D49706), and designed a number of sets of primers and probes which may be used for fluorescent quantitative PCR of the novel variant IBDV, the specific sequences of these sets of primers and probes being as follows:
primer 1 and probe:
Forward primer:CACAGTACAAGACAGGTG(SEQ ID NO:1)
Reverse primer:CAAGGTTTTGGATGCTGG(SEQ ID NO:2)
Probe:ACAATCACACTGTTCTCAGCCAAC(SEQ ID NO:3)
primer number 2 and probe:
Forward primer:TGTACTGGGCGCCACAATCT(SEQ ID NO:4)
Reverse primer:GCTGGTCGGAATCACAAGGT(SEQ ID NO:5)
Probe:AACAATGGGCTGACGGCCGG(SEQ ID NO:6)
primer No. 3 and probe:
Forward primer:GTGGCAACTATCCAGGAGCC(SEQ ID NO:7)
Reverse primer:AACAACGGATCCTTTTGCCA(SEQ ID NO:8)
Probe:CGTCCCGTCACGCTAGTGGC(SEQ ID NO:9)
primer No. 4 and probe:
Forward primer:TGTGTTCAAAACCAGCATCCA(SEQ ID NO:10)
Reverse primer:GCAGCTACAGCTCTGGTGAT(SEQ ID NO:11)
Probe:ACCTTGTACTGGGCGCCACA(SEQ ID NO:12)
primer 5 and probe:
Forward primer:TGTGTTCAAAACCAGCATCCAA(SEQ ID NO:13)
Reverse primer:GGTTATCTCGCTGGTCGGAA(SEQ ID NO:14)
Probe:AACAATGGGCTGACGGCCGG(SEQ ID NO:15)
the specific method is as follows:
1) Extracting RNA of a sample to be detected: 200. Mu.L of PBS buffer (pH 7.4) ground strain GD-IBDV-2020 bursa tissue grinding fluid, template RNA (RNA of novel variant IBDV) was extracted using AxyPrep humoral virus DNA/RNA miniprep kit (Cat No. AP-MN-BF-VNA-250), and stored at 70 ℃.
2) Reverse transcription system and process: using PrimeScript TM RT Master Mix (Perfect Real Time) (TaKaRa Code: RR 036Q) reverse transcription kit, the reaction system was 20. Mu.L system, and the following procedure was performed: 16. Mu.L of RNA was mixed with 4. Mu.L of RT premix, reacted at 37℃for 15min, then rapidly placed on ice for 2min, and the reverse transcription product was stored at-20℃as template for the subsequent experiments.
3) Quantitative PCR reaction system: 20. Mu.L of a system reaction system was prepared using THUNDERBIRD Probe qPCR Mix (Code No. QPS-101, QPS-101T) quantitative PCR kit, primers No. 1 to No. 5 and probes, respectively, and the specific composition information was as shown in Table 1 below:
TABLE 1 information on the components of PCR reaction System
| Sequence number | Component (A) | Volume of |
| 1 | THUNDERBIRD Probe qPCR Mix | 10μl |
| 2 | Forward Primer(20μM) | 0.2ul |
| 3 | Reverse Primer(20μM) | 0.2ul |
| 4 | Probe | 0.1ul |
| 5 | 50×ROX reference dye | 0.04μl |
| 6 | Template | 2ul |
| 7 | RNaseFreeH 2 O | Make up to 20 mu L |
Amplification conditions: the PCR tube is placed on an ABI 7500Fast quantitative PCR instrument for amplification reaction, and the amplification conditions are as follows: pre-denaturation at 95 ℃ for 20s; the amplification method can be completed within 40 minutes after 40 cycles of 95 ℃,3s,60 ℃ and 40 s.
4) And (3) result judgment: the amplification curve appears and the CT value is less than 35, namely the novel variant strain of IBDV is positive. The amplification curve CT value smaller than 35 is judged to be positive, and the CT value larger than 35 is judged to be negative beyond the sensitivity of the method. The identification results are shown in FIG. 1, wherein 1 represents a probe primer No. 1, 2 represents a probe primer No. 1, 3 represents a probe primer No. 3, 4 represents a probe primer No. 4, and 5 represents a probe primer No. 5 in FIG. 1. And finally screening to obtain the primer number 1 and the probe for subsequent experiments.
The second part uses the primer and probe screened in the first part to identify the new variant IBDV
Further using primer 1 and probe to make subsequent fluorescent quantitative PCR amplification experiment, and quickly and accurately identifying IBDV new variant strain by means of amplification curve.
The published IBDV universal fluorescent quantitative PCR primer and probe are also cited for detection comparison of samples (Wang Yongjiang, et al 2009. Real-time fluorescent quantitative RT-PCR detection method of chicken infectious bursal disease virus is established, chinese Protect veterinarian journal, 31 (1): 4). The primer and probe sequences are as follows:
SEQ ID NO:16：GAGCCTTCTGATGCCAACAAC；
SEQ ID NO:17：CAAATTGTAGGTCGAGGTCTCTGA；
SEQ ID NO:18：FAM-CGGCGTCCATTCCGGACGAC-BHQ。
the specific fluorescent quantitative PCR method comprises the following steps:
1) Extracting RNA of a sample to be detected: 200. Mu.L PBS buffer (pH 7.4) ground strain GD-IBDV-2020 bursa tissue grinder, 100mg kidney disease material (whether the disease material is unknown to be infected with virus) and PBS buffer, template RNA (RNA of novel variants of IBDV) was extracted using AxyPrep humoral viral DNA/RNA minikit (Cat No. AP-MN-BF-VNA-250), stored at 70 ℃.
2) Reverse transcription system and process: using PrimeScript TM RT Master Mix(Perfect Real Time) (TaKaRa Code: RR 036Q) reverse transcription kit, the reaction system is 20 μl system, and the method specifically comprises the following steps: 16. Mu.L of RNA was mixed with 4. Mu.L of RT premix, reacted at 37℃for 15min, then rapidly placed on ice for 2min, and the reverse transcription product was stored at-20℃as template for the subsequent experiments.
3) Quantitative PCR reaction system: using a THUNDERBIRD Probe qPCR Mix (Code No. QPS-101, QPS-101T) quantitative PCR kit, the reaction system was a 20. Mu.L system, and the specific composition information is shown in Table 2 below:
TABLE 2 information on the components of PCR reaction System
Amplification conditions: the PCR tube is placed on an ABI 7500Fast quantitative PCR instrument for amplification reaction, and the amplification conditions are as follows: pre-denaturation at 95 ℃ for 20s; the amplification method can be completed within 40 minutes after 40 cycles of 95 ℃,4s,60 ℃ and 40 s.
4) And (3) result judgment: the amplification curve appears and the CT value is less than 35, namely the novel variant strain of IBDV is positive. The amplification curve CT value smaller than 35 is judged to be positive, and the CT value larger than 35 is judged to be negative beyond the sensitivity of the method. The results are shown in Table 3 and FIG. 2.
TABLE 3 detection results of samples to be examined
Example 2
Specific detection of novel variants of IBDV by primers and probes
The presence of the disease material of the novel variant of IBDV was used as positive control, and the specific detection of the virus solutions of the classical IBDV strain F52/70, the classical IBDV strain SHG19, the super-virulent IBDV strain OKYM, the newcastle disease virus NDV, the Marek disease virus MDV and the avian influenza virus H9N2 was carried out, using the fluorescent quantitative PCR method of the second part of example 1 with primers and probes (SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO: 3), and the detection results are shown in FIG. 3, wherein the novel variant of IBDV, the classical 2-IBDV strain, the 3-IBDV strain, the super-virulent 4-IBDV strain, the 5-newcastle disease virus, the 6-Marek disease virus and the 7-avian influenza virus were shown in FIG. 3. The results of the detection are shown in FIG. 3, which shows that the detection has no amplification curve except the positive control of the novel variant IBDV strain and has good specificity.
Example 3
Sensitivity test of primers and probes for novel variants of IBDV
The DNA of the novel variant strain GD-IBDV-2020 was used as a template, SEQ ID NO. 1-2 was used as a primer, and amplification was performed according to the fluorescent quantitative PCR method described in example 1 to obtain a 114bp amplification product (the sequence of the amplification product was shown as SEQ ID NO. 19), which was ligated to the cloning vector pMD19-T (Dalianbao bioengineering Co., ltd.) to prepare a standard positive plasmid (pMD-VP 2) containing the VP2 gene. The pMD-VP2 concentration was determined to be 1.32X10 9 copies/μL。
Positive plasmid pMD-VP2 was diluted 10-fold in incremental steps with sterilized double distilled water as a template, 2. Mu.L of each dilution was used as a template, and the amplification curve was observed by the fluorescent quantitative PCR method described in example 1, and the sensitivity was calculated from the highest dilution of the amount of template used for the occurrence of the positive expected curve. As shown in FIG. 4, the minimum detection amount was 13.2 copies/. Mu.L, and the sensitivity was good.
The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims.
Claims (9)
1. The novel variant fluorescent quantitative PCR primer for infectious bursal disease virus is characterized in that: the primer comprises an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2.
2.A probe matched with the primer of claim 1 for fluorescent quantitative PCR detection of a novel variant of infectious bursal disease virus, characterized in that: the probe sequence is shown as SEQ ID NO. 3.
3. The probe of claim 2, wherein: the 3 'end of the probe is combined with a fluorescence quenching group, and the 5' end of the probe is combined with a fluorescence reporting group.
4. A probe according to claim 3, wherein: the fluorescence quenching group is BHQ-1, and the fluorescence reporting group is FAM.
5. Use of the primer of claim 1 and/or the probe of any one of claims 2 to 4 for the preparation of a product for fluorescent quantitative PCR detection of a novel variant of infectious bursal disease virus.
6. Use according to claim 5, characterized in that: the detection product comprises a kit and test paper.
7. A fluorescent quantitative PCR detection kit for a novel variant strain of infectious bursal disease virus is characterized in that: comprising the primer according to claim 1 and the probe according to any one of claims 2 to 4.
8. The utility model provides a novel variant fluorescence quantitative PCR test paper of infectious bursal disease virus which characterized in that: comprising the primer according to claim 1 and the probe according to any one of claims 2 to 4.
9. A method for identifying a novel variant of infectious bursal disease virus for non-diagnostic purposes, comprising: comprising the following steps:
(1) Preparing a negative control, a positive control and a PCR reaction system of a sample to be detected, wherein primer probes used in the PCR reaction system are respectively a primer shown as SEQ ID NO. 1 and SEQ ID NO. 2 and a probe shown as SEQ ID NO. 3;
(2) Amplifying a PCR reaction system;
(3) According to the amplification curve of the PCR reaction system, the novel variant strain of the infectious bursal disease virus in the sample to be detected is judged by the following steps:
the amplification curve is shown, the CT value is smaller than 35, the novel variant strain of IBDV is positive, and the CT value is larger than 35, the novel variant strain of IBDV is negative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211560033.2A CN116732239A (en) | 2022-12-07 | 2022-12-07 | Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211560033.2A CN116732239A (en) | 2022-12-07 | 2022-12-07 | Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116732239A true CN116732239A (en) | 2023-09-12 |
Family
ID=87903200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211560033.2A Pending CN116732239A (en) | 2022-12-07 | 2022-12-07 | Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116732239A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1666608A1 (en) * | 2004-11-05 | 2006-06-07 | Universiti Putra Malaysia | Method for detecting and distinguishing infectious bursal disease virus (IBDV) strains by fluorescence-based real time RT-PCR |
| WO2010126351A1 (en) * | 2009-04-30 | 2010-11-04 | Universiti Putra Malaysia | Molecular differentiation of infectious bursal disease virus (ibdv) strains |
-
2022
- 2022-12-07 CN CN202211560033.2A patent/CN116732239A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1666608A1 (en) * | 2004-11-05 | 2006-06-07 | Universiti Putra Malaysia | Method for detecting and distinguishing infectious bursal disease virus (IBDV) strains by fluorescence-based real time RT-PCR |
| WO2010126351A1 (en) * | 2009-04-30 | 2010-11-04 | Universiti Putra Malaysia | Molecular differentiation of infectious bursal disease virus (ibdv) strains |
Non-Patent Citations (3)
| Title |
|---|
| AHUI XU: ""Phylogenetic analyses and pathogenicity of a variant infectious bursal disease virus strain isolated in China"", 《VIRUS RESEARCH》, 3 December 2019 (2019-12-03), pages 1 - 9 * |
| 中国医学创新杂志社编: "《实用临床诊疗—检测学》", 31 October 2013, 北京：科学技术文献出版社, pages: 288 - 289 * |
| 佚名: "GenBank: MN485882.1", 《NCBI》, 4 April 2020 (2020-04-04) * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Otto et al. | Detection of avian rotaviruses of groups A, D, F and G in diseased chickens and turkeys from Europe and Bangladesh | |
| CN106811551A (en) | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method | |
| CN108950068B (en) | Kit for identifying and detecting QX-type strains of chicken infectious bronchitis viruses | |
| CN109055615B (en) | Multiple PCR primer set, kit and method for detecting A, B, J and K subgroup avian leukosis viruses | |
| Peters et al. | Real-time RT-PCR differentiation and quantitation of infectious bursal disease virus strains using dual-labeled fluorescent probes | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| Aydin et al. | A pilot study on feline astrovirus and feline panleukopenia virus in shelter cats in Erzurum, Turkey | |
| CN112322789B (en) | Nested PCR (polymerase chain reaction) kit and method for detecting double RNA (ribonucleic acid) viruses of micropterus salmoides | |
| CN112301168A (en) | TaqMan real-time fluorescent quantitative RT-PCR kit and method for detecting double RNA viruses of micropterus salmoides | |
| CN112063760A (en) | Primer probe combination and kit for simultaneously detecting duck circovirus, duck plague virus and duck type 3 adenovirus | |
| Mittal et al. | Detection of infectious bursal disease virus in field outbreaks in broiler chickens by reverse transcription-polymerase chain reaction | |
| CN116479174A (en) | Dual TB Green real-time fluorescent quantitative PCR (polymerase chain reaction) universal primer group for identifying avian adenovirus DAdV-3 and FAdV-4 and kit thereof | |
| CN116769965A (en) | Primer for genotyping detection of infectious bronchitis virus and application thereof | |
| CN116732239A (en) | Fluorescent quantitative PCR (polymerase chain reaction) detection primer, probe and kit for novel variant strain of infectious bursal disease virus | |
| CN112899406A (en) | Nucleic acid composition, kit and detection method for detecting feline digestive tract infectious pathogens | |
| CN109182597B (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting avian adenovirus group I, II and III and detection method thereof | |
| KR20190122633A (en) | Primers for LAMP based detection of Marek's disease virus in poultry and its use | |
| KR20190122635A (en) | Primers for LAMP based detection of Infectious bursal disease virus in poultry and its use | |
| CN111218526B (en) | PCR primer pair and probe for rapidly identifying I subgroup serum 11 type avian adenovirus and application thereof | |
| CN117737298B (en) | Multiplex PCR primer, detection reagent, method and application for identifying avian infectious bronchitis viruses with different genotypes simultaneously | |
| CN114592088B (en) | Multiplex PCR (polymerase chain reaction) kit for detecting or distinguishing 4 different genotypes of avian reovirus and application thereof | |
| CN107151710B (en) | Double-labeled probe real-time fluorescence PCR method for rapidly identifying and detecting serum type 4 avian adenovirus | |
| CN116804234A (en) | Composition for detecting MDV, ALV and REV, detection method and application | |
| CN118406798A (en) | Method for identifying Marek's disease viruses of different serotypes, composition and kit thereof | |
| CN115725781A (en) | High-resolution melting curve kit for rapidly identifying IBDV (infectious bursal disease Virus) super virulent strain, novel variant strain and attenuated vaccine strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |