CN116687932B - Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate - Google Patents

Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate Download PDF

Info

Publication number
CN116687932B
CN116687932B CN202210183739.5A CN202210183739A CN116687932B CN 116687932 B CN116687932 B CN 116687932B CN 202210183739 A CN202210183739 A CN 202210183739A CN 116687932 B CN116687932 B CN 116687932B
Authority
CN
China
Prior art keywords
compound
pharmaceutical composition
pharmaceutically acceptable
formula
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210183739.5A
Other languages
Chinese (zh)
Other versions
CN116687932A (en
Inventor
钟武
胡志红
王曼丽
王倩然
曹瑞源
李松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Academy of Military Medical Sciences AMMS of PLA
Original Assignee
Academy of Military Medical Sciences AMMS of PLA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Academy of Military Medical Sciences AMMS of PLA filed Critical Academy of Military Medical Sciences AMMS of PLA
Priority to CN202210183739.5A priority Critical patent/CN116687932B/en
Publication of CN116687932A publication Critical patent/CN116687932A/en
Application granted granted Critical
Publication of CN116687932B publication Critical patent/CN116687932B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to the medical use of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate, its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, in particular for the treatment of diseases or infections caused by viruses of the order bunyavirales.

Description

Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate
Technical Field
The present invention relates to the medical use of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate (Isobutyric acid 3-carbamoyl-5-fluoro-pyrazin-2-yloxymethyl ester), its geometrical isomers, pharmaceutically acceptable salts, solvates or hydrates, in particular for the treatment of diseases or infections caused by viruses of the order bunyaviridae, such as the crimia-congo hemorrhagic fever virus (CCHFV).
Background
Crimia-Congo hemorrhagic fever (CCHF), an acute infectious disease widely prevalent in Africa, asia, europe and the like, is mainly characterized by fever, gastrointestinal bleeding, epistaxis, hematemesis, shock, and has a mortality rate of up to 50%, and the CCHF pathogenic pathogen is Crimia-Congo hemorrhagic fever virus (CCHFV). The Crimedes-Congo hemorrhagic fever virus belongs to the order Bunyavirales, the family of Coronaviridae (Nairoviridae), the genus Coronairus (Orthonirovirus) tick-borne viruses. The clinical symptoms of CCHF patients are extensive, and the typical course of the disease goes through four phases: incubation, pre-bleeding, bleeding and recovery. The latency period is related to factors such as contact route, viral load and the like; after the incubation period, the pre-bleeding stage is manifested as fever, and when the patient enters the bleeding stage, the patient is accompanied with symptoms such as severe headache, nausea, diarrhea, muscle soreness, photophobia and the like, the body can sequentially suffer from petechiae, large-area petechia and massive bleeding, and 9-50% of cases die in the stage. In addition to these characterizations, studies have also found that CCHF is associated with severe lesions of the liver, nervous system, respiratory system, and heart, along with the onset of disease. There is no drug or vaccine against Crimedes-Congo hemorrhagic fever on the market at present, which seriously threatens human health.
Disclosure of Invention
The structural formula of the (3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate (hereinafter referred to as a compound shown in the formula I or a compound I) is shown in the formula I,
the inventors have surprisingly found that the compound ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate of formula I is capable of inhibiting replication of crimia-congo hemorrhagic fever virus in cells, reducing viral nucleic acid load level of crimia-congo hemorrhagic fever virus infected cells at micromolar concentration, and has a remarkable protective effect on crimia-congo hemorrhagic fever virus infected mice, and can be used for treating diseases caused by crimia-congo hemorrhagic fever virus, such as simple infection, fever, headache, muscle pain, vomiting, gastrointestinal bleeding, epistaxis, hematemesis, shock, etc.
The invention relates to the use of a compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof for the manufacture of a medicament for the treatment of a disease or infection caused by a virus of the order bunyaviridae.
The invention also relates to application of the compound shown in the formula I, geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof in preparing medicaments serving as bunyaviridae virus inhibitors.
The invention also relates to the use of a compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof in the manufacture of a medicament for inhibiting replication or propagation of a virus of the order bunyaviridae in a cell, such as a mammalian cell.
The invention also relates to the use of a pharmaceutical composition comprising a compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof in the manufacture of a medicament for the treatment of a disease or infection caused by a virus of the order bunyaviridae.
The invention also relates to application of the pharmaceutical composition in preparing medicines serving as bunyaviridae virus inhibitors, wherein the pharmaceutical composition comprises a compound shown in a formula I, a geometric isomer, a pharmaceutically acceptable salt, a solvate or hydrate of the compound.
The invention also relates to the use of a pharmaceutical composition comprising a compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, for the manufacture of a medicament for inhibiting replication or propagation of a virus of the order bunyaviridae in a cell, such as a mammalian cell.
The invention also relates to the application of the compound shown in the formula I, the geometrical isomer or the pharmaceutically acceptable salt and/or solvate and/or hydrate thereof in preparing medicines for treating hemorrhagic fever (including simple infection, fever, headache, muscle pain, vomiting, gastrointestinal bleeding, epistaxis, hematemesis, shock and the like).
The present invention also relates to a method for the treatment and/or prophylaxis of a disease or infection in a mammal in need thereof, which comprises administering to the mammal in need thereof a therapeutically and/or prophylactically effective amount of said pharmaceutical composition comprising said compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof or said compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, wherein said disease or infection comprises a disease or infection caused by a virus of the order bunyaviridae.
The present invention also relates to a method of inhibiting replication or reproduction of a bunyaviridae order virus in a mammal in need thereof, which comprises administering to the mammal in need thereof a therapeutically and/or prophylactically effective amount of the pharmaceutical composition comprising the compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof or the compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof.
The invention also relates to the use of a pharmaceutical composition comprising a compound of formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof, for the manufacture of a medicament for the treatment of a disease or infection caused by bunyavirus, in particular crinitia-congo hemorrhagic fever virus (e.g. simple infection, fever, headache, muscle pain, vomiting, gastrointestinal bleeding, epistaxis, hematemesis, shock, etc.).
The invention also relates to a compound shown in the formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, which is used for treating diseases or infections caused by bunyaviridae.
The invention also relates to a compound shown in the formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof, which is used as a bunyaviridae order virus inhibitor.
The invention also relates to compounds of formula I, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof, or hydrates thereof, for use in inhibiting replication or propagation of a virus of the order bunyaviridae in a cell, such as a mammalian cell.
The invention also relates to a pharmaceutical composition for treating diseases or infections caused by viruses of the order bunyaviridae, wherein the pharmaceutical composition comprises the compound shown in the formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof or a hydrate thereof.
The invention also relates to a pharmaceutical composition which is used as a bunyaviridae virus inhibitor, wherein the pharmaceutical composition comprises a compound shown in a formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof and/or a solvate thereof and/or a hydrate thereof.
The invention also relates to a pharmaceutical composition for inhibiting replication or reproduction of a virus of the order bunyaviridae in a cell, such as a mammalian cell, wherein the pharmaceutical composition comprises a compound of formula I, a geometric isomer thereof, a pharmaceutically acceptable salt thereof and/or a solvate thereof and/or a hydrate thereof.
In certain embodiments, pharmaceutically acceptable salts of the compounds of formula I of the present invention include inorganic or organic acid salts thereof, as well as inorganic or organic base salts, and the present invention relates to all forms of the foregoing salts, including, but not limited to: sodium, potassium, calcium, lithium, meglumine, hydrochloride, hydrobromide, hydrogen, hydrochloride, nitrate, sulfate, bisulfate, phosphate, hydrogen phosphate, acetate, propionate, butyrate, oxalate, trimethylacetate, adipate, alginate, lactate, citrate, tartrate, succinate, maleate, fumarate, picrate, aspartate, gluconate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, pamoate and the like.
In certain embodiments, the pharmaceutical compositions of the present invention further comprise a pharmaceutically acceptable carrier or adjuvant.
In certain embodiments, the pharmaceutical composition of the present invention is a solid formulation, an injection, an external formulation, a spray, a liquid formulation, or a compound formulation.
In certain embodiments, the bunyaviridae virus of the invention is a virus of the family endoviridae.
In certain embodiments, the bunyaviridae of the invention are orthoinner virosis viruses.
In certain embodiments, the bunyaviridae order virus of the present invention is a crimia-congo hemorrhagic fever virus (CCHFV).
In certain embodiments, the bunyaviridae-caused disease described herein is a bunyaviridae-caused hemorrhagic fever.
In certain embodiments, the bunyaviridae virus-caused disease described herein is hemorrhagic fever caused by a virus of the family endoviridae.
In certain embodiments, the bunyaviridae-caused disease is hemorrhagic fever caused by orthoinner rovirus.
In certain embodiments, the disease caused by a virus of the order bunyaviridae is hemorrhagic fever caused by crimia-congo hemorrhagic fever virus.
In certain embodiments, the disease caused by a virus of the order bunyaviridae is a simple infection, fever, headache, muscle pain, vomiting, gastrointestinal bleeding, epistaxis, hematemesis, or shock caused by a virus of the order bunyaviridae.
In certain embodiments, the disease caused by a virus of the order bunyaviridae of the invention is crimia-congo hemorrhagic fever.
In certain embodiments, the disease caused by a virus of the order bunyaviridae is a disease caused by crimia-congo hemorrhagic fever virus.
In certain embodiments, the mammal of the invention includes bovine, equine, ovine, porcine, canine, feline, rodent, primate, e.g., human, cat, dog, or pig.
In the present invention, the term "therapeutically effective amount" or "prophylactically effective amount" refers to an amount sufficient to treat or prevent a patient's disease but low enough to avoid serious side effects (at a reasonable benefit/risk ratio) within the scope of sound medical judgment. The therapeutically effective amount of the compound will vary depending upon factors such as the particular compound selected (e.g., taking into account potency, effectiveness and half-life of the compound), the route of administration selected, the disease being treated, the severity of the disease being treated, the age, size, weight and physical condition of the patient being treated, the medical history of the patient being treated, the duration of treatment, the nature of concurrent therapy, the desired therapeutic effect, etc., but can still be routinely determined by one of skill in the art.
It should be further noted that the specific dosage and method of use of the compound of formula I, its geometric isomer, its pharmaceutically acceptable salt, its solvate or its hydrate for different patients depends on a number of factors including the age, weight, sex, natural health, nutritional status, activity intensity of the drug, administration time, metabolic rate, severity of the disorder and subjective judgment of the diagnosing physician. Here, a dosage of between 0.001 and 1000mg/kg body weight/day is preferably used.
The pharmaceutical compositions of the present invention may be prepared in various forms according to different routes of administration.
According to the invention, the pharmaceutical composition may be administered in any of the following ways: oral, spray inhalation, rectal, nasal, buccal, vaginal, topical, parenteral, such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal and intracranial injection or infusion, or by means of an explanted reservoir. Among them, oral, intraperitoneal or intravenous administration is preferable.
When administered orally, the compounds of formula I, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof, or hydrates thereof may be formulated in any orally acceptable dosage form, including, but not limited to, tablets, capsules, aqueous solutions or suspensions. Among these, carriers commonly used for tablets include lactose and corn starch, and lubricants such as magnesium stearate may also be added. Diluents commonly used in capsule formulations include lactose and dried corn starch. Aqueous suspension formulations are usually prepared by mixing the active ingredient with suitable emulsifying and suspending agents. If desired, some sweetener, flavoring agent or coloring agent may be added to the above oral preparation.
When administered rectally, the compounds of formula I, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof or hydrates thereof are generally prepared in the form of suppositories which are prepared by mixing the medicament with a suitable non-irritating excipient. The excipient assumes a solid state at room temperature and melts to release the drug at rectal temperature. Such excipients include cocoa butter, beeswax and polyethylene glycols.
When the compound shown in the formula I, the geometrical isomer, the pharmaceutically acceptable salt, the solvate or the hydrate thereof are prepared into different local administration preparation forms according to different affected surfaces or organs, particularly when the compound is used for treating the affected surfaces or organs which are easy to achieve by local external application, such as eyes, skin or lower intestinal nervous diseases, and the specific description is as follows:
when topically applied to the eye, the compound of formula I, its geometric isomer, its pharmaceutically acceptable salt, its solvate or its hydrate may be formulated as a micronized suspension or solution in which the carrier is isotonic sterile saline of a certain pH, optionally with a preservative such as benzyl chloride alkoxide. In addition, for ophthalmic use, the compounds may also be formulated as ointments, such as petrolatum.
When topically applied to the skin, the compounds of formula I, geometric isomers thereof, pharmaceutically acceptable salts thereof, solvates thereof, or hydrates thereof may be formulated in the form of suitable ointments, lotions, or creams, with the active ingredient suspended or dissolved in one or more carriers. Carriers that can be used with ointments herein include, but are not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; carriers that can be used in lotions or creams include, but are not limited to: mineral oil, sorbitan monostearate, tween 60, cetyl esters wax, hexadecene aryl alcohol, 2-octyldodecanol, benzyl alcohol and water.
When the compound of formula I, its geometric isomer, its pharmaceutically acceptable salt, its solvate or its hydrate is topically applied to the lower intestinal tract, it may be formulated into rectal suppository formulation or suitable enema formulation as described above, and topical transdermal patch may be used.
The compound of formula I, its geometric isomer, its pharmaceutically acceptable salt, its solvate or its hydrate may also be administered in the form of a sterile injectable preparation, including a sterile injectable aqueous or oleaginous suspension, or a sterile injectable solution. Among the carriers and solvents that can be used are water, ringer's solution and isotonic sodium chloride solution. In addition, the sterilized fixed oils may also be used as solvents or suspending media, such as mono-or diglycerides.
The medicaments of the various formulations can be prepared according to the conventional method in the pharmaceutical field.
Drawings
FIG. 1 shows the in vitro anti-CCHFV effect of compound I, wherein A shows the primary screening result of compound I against CCHFV; b shows EC of Compound I 50 CC (CC) 50 ；
Figure 2 shows that compound I is effective in inhibiting CCHFV infection in vivo, wherein a shows the mice weight change profile and survival; b shows the detection result of the virus copy number in the mouse tissue; c shows that EIDD-2801 fails to inhibit CCHFV infection in vivo;
figure 3 shows that low doses of compound I are effective in inhibiting CCHFV infection in vivo, where a shows the mice weight change profile and survival; b shows the detection result of the virus copy number in the mouse tissue;
figure 4 shows that delayed administration of compound I is effective in inhibiting CCHFV infection in vivo, wherein a shows the mice weight change profile and survival; b shows the detection result of the virus copy number in the mouse tissue; c shows pathological changes of the liver and spleen of the mice;
FIG. 5 shows Compound I 1 H-NMR spectrum;
FIG. 6 shows Compound I 13 C-NMR spectrum;
figure 7 shows HRMS spectra of compound I.
Detailed Description
The following examples are illustrative of preferred embodiments of the invention and are not intended to limit the invention in any way.
The compound I used in the following examples (compound of formula I, ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate) was synthesized by the following method.
T-705 (1.57 g,10 mmol) was dissolved in anhydrous acetonitrile (10 mL) under nitrogen, and after stirring the solution at room temperature for 15min, three were added dropwiseEthylamine (3.03 g,30 mmol) and the reaction solution was cooled to-20℃and then bromomethyl isobutyrate (3.41 g,25 mmol) was added dropwise. After the reaction solution was continuously reacted at-20℃for 24 hours, the reaction solution was poured into cold water (100 mL), the mixture was extracted three times with methylene chloride, and the combined organic phases were washed twice with 1N hydrochloric acid, saturated sodium bicarbonate solution, and saturated sodium chloride solution, respectively, and dried over sodium sulfate overnight. Concentrating the dried organic phase to dryness, mixing the organic phase with silica gel, and separating and purifying by Flash column chromatography (eluting with dichloromethane/methanol) to obtain the target product compound I. 1 H-NMR(400MHz，CDCl 3 )：δ(ppm)8.19(d，J＝8.0Hz，1H，pyrazine H)，7.37(brs，1H，CONH 2 )，6.21(s，2H，CH 2 )，6.18-6.05(brs，1H，CONH 2 )，2.58(dt，J＝14.0，7.0Hz，1H，CH)，1.16(d，J＝4.0Hz，6H，CH3). 13 C-NMR(100MHz，CDCl 3 )δ176.09(O＝C-O)，163.08(O＝C-NH 2 )，154.90(C-F， 1 J C-F ＝247Hz)，154.50(C-F， 4 J C-F ＝2Hz)，132.19(C-C-F，J C-C-F ＝41Hz)，129.20(C-F， 3 J C-F ＝7Hz)，82.83(CH 2 )，33.88(CH)，8.72(CH 3 ).HRMS(ESI + )m/z[M+H] + calculated for C 10 H 12 FN 3 O 4 ：258.0885；found：258.0893.HRMS(ESI + )m/z[M+Na] + calculated for C 10 H 12 FN 3 NaO 4 ：280.0710；found：280.0713.
Compound I 1 H-NMR、 13 The C-NMR and HRMS are generally shown in FIGS. 5-7.
Example 1: compound I experiments to reduce the nucleic acid load of crimia-congo hemorrhagic fever virus
All CCHFV infection experiments were performed in BLS-3 laboratories.
1. Materials and methods
1.1 test compound: compound I was prepared as a 100mM stock solution in DMSO. The experiment was performed by diluting the cell culture solution (MEM medium containing 2% FBS) to a concentration required for the experiment.
1.2 cells: vero E6 cells (ATCC No. 1586) were African green monkey kidney cells, which were maintained by passage from the institute of Marhan virus, academy of sciences of China.
1.3 virus: the CCHFV YL16070 isolate (GenBank accession number: KY 354082) was isolated and subcultured by the institute of Kadsura virus, academy of sciences of China.
1.4 reagents, laboratory supplies and instruments:
1.4.1 reagents: minimal Eagle's Medium (MEM), manufactured by GIBCO corporation, U.S.A.; fetal bovine serum, a product of GIBCO company, usa; sodium bicarbonate, national drug group product; penicillin, streptomycin, and kanamycin: are all North China pharmaceutical factory products.
1.4.2 laboratory supplies and instruments: culture flasks, corning corporation, usa; culture plate 96-well plate, product of Corning company, usa; a carbon dioxide incubator, a product of Thermo company, usa;
1.4.3 preparation of cell culture solution and reagents: MEM culture medium 100ml: contains fetal bovine serum (fetal bovine serum, FBS) 10%, penicillin, streptomycin and kanamycin 100U/ml each, naHCO 3 5%. Cell digest: 0.25% pancreatin, formulated with Hanks solution, 0.02% edta.
1.5. The experimental method comprises the following steps:
1.5.1 Vero E6 cell culture: adding 0.25% pancreatin into a culture bottle with overgrown cells, digesting for 5min at 0.1ml,0.02%EDTA 5ml,37 ℃, discarding the digestive juice, adding the culture solution, gently blowing, and carrying out passage 1:3 for 3 days to overgrow for the toxicity test and inhibition test of the compound I.
1.5.2 cytotoxicity experiments
Detection of cytotoxicity by Compound I was determined using the CCK-8 kit (Beyotime). The method comprises the following specific steps:
(1) inoculation of about 2X 10 in 96 well plates 4 Each Vero-E6 (ATCC) cell was cultured at 37℃for 8 hours.
(2) The stock solution of compound I was diluted to the drug use concentration with a cell culture solution (MEM medium containing 2% fbs), the medium in the 96-well plate was discarded, 100 μl of the cell culture solution containing compound I was added to the cells, and three wells were made for each concentration. Note that negative controls (cell wells with corresponding concentrations of DMSO without compound I) and blank controls (no cells, DMSO and cell culture only) were set. After the completion of the addition, the cells were cultured at 37℃for 24 hours.
(3) To the wells to be tested, 20. Mu.L of CCK-8 solution (Beyotidme) was added, gently mixed, without generating air bubbles, and incubation was continued for 2 hours at 37 ℃. OD450 was read on a microplate reader and cell activity was calculated:
cell activity (%) = (a (compound I treated group) -a (blank))/(a (negative control) -a (blank)) ×100%
1.5.3 antiviral experiments:
(1) vero E6 cells were seeded into 48-well plates, approximately 6 x 10 per well 4 Cells were tested the next day. mu.L of the cell culture medium containing the corresponding concentration of Compound I was added to the cell plate, the cells were pretreated for 1 hour, then 20. Mu.L of diluted virus (MOI=0.01) was added, and incubated in an incubator for 1 hour. Then the virus culture solution is discarded, uninfected residual virus is washed off by PBS, then the cell culture solution containing the compound I with the corresponding concentration is added, and then the mixture is placed at 37 ℃ and 5% CO 2 The incubator continues to incubate for 72h, and the cell control group is added with cell culture medium with final concentration of 0.5% DMSO.
(2) RNA extraction was performed using a kit (TaKaRa MiniBEST Viral RNA/DNA Extraction Kit, cat 9766) from TaKaRa, as follows:
1) 100. Mu.L of the supernatant of the test plate was added to the nuclease-free EP tube, and then 321. Mu.L of lysate (100. Mu.L of PBS, 200. Mu.L of buffer VGB, 20. Mu.L of protease K, 1. Mu.L of carrier RNA) was added to each well, and the mixture was digested at 56℃for 30 minutes;
2) Adding 200 mu L of absolute ethyl alcohol into the obtained mixed solution, and uniformly mixing;
3) Transferring the mixed solution into a centrifugal column without RNase, centrifuging at 12000rpm for 15s, and discarding the waste liquid;
4) Adding 500 mu L Buffer RW1, centrifuging at 12000rpm for 15s, and discarding the waste liquid;
5) Adding 650 mu L Buffer RW2, centrifuging at 12000rpm for 15s, and discarding the waste liquid;
6) Adding 650 μL Buffer RW2, centrifuging at 12000rpm for 2min, and discarding the waste liquid;
7) Exchanging a new 2ml collecting tube without RNase, centrifuging at 12000rpm for 1min, and drying the centrifugal column;
8) A fresh 1.5ml collection tube was replaced, 30. Mu.l of RNase-free water was added to each tube, and the mixture was centrifuged at 12000rpm for 2min to obtain an eluate containing the corresponding RNA.
(3) RNA reverse transcription, the steps are as follows:
the experiment was carried out using a reverse transcription kit (PrimeScript, manufactured by TaKaRa Co., ltd TM RT reagent Kit with gDNA Eraser, cat# RR 047Q) were subjected to RNA reverse transcription. First, gDNA removal is performed: RNA samples from each experimental group were collected and 3. Mu.L of RNA was subjected to reverse transcription, respectively. To each experimental group RNA was added 2. Mu.l of 5X gDNA Eraser Buffer, the reaction system was made up to 10. Mu.l with RNase Free water, and the mixture was thoroughly mixed and the gDNA which was possibly present in the sample was removed in a water bath at 42℃for 2 minutes. Reverse transcription is then performed: adding proper amount of enzyme, primer Mix and reaction buffer solution into the obtained sample, supplementing the volume to 20 μl with RNase Free water, carrying out water bath reaction at 37 ℃ for 15min, and then adding into water at 85 ℃ for 5s, so as to obtain cDNA through transcription.
(4) Real-time PCR. The fluorescent quantitative PCR was performed by mixing the reaction system with TB Green Premix (Takara, cat#RR820A) and performing amplification reaction and reading on a StepOne Plus Real-time PCR instrument (brand: ABI). The copy number of the original virus liquid per milliliter is calculated. The method comprises the following steps:
1) Firstly, establishing a standard substance: plasmid pMT-S was diluted to 5X 10 8 ，5×10 7 ，5×10 6 ，5×10 5 ，5×10 4 ，5×10 3 And 5X 10 2 COPies/. Mu.L. Taking 2 mu L of standard substance or cDNA template for qPCR reaction;
2) The primer sequences used during the experiment are as follows (all expressed in 5 '-3') direction:
S-qF：TCAAGTGGAGGAAGGACATAGG
S-qR：TCCACATGTTCACGGCTCACTGGG
3) The reaction procedure was as follows:
pre-denaturation: 95 ℃ for 5 minutes;
cycle parameters: 95℃for 15 seconds, 54℃for 15 seconds, 72℃for 30 seconds. For a total of 40 cycles.
2. Results
2.1 toxicity of Compound I on Vero E6 cells
Cytotoxicity results show that CC of Compound I 50 242.50. Mu.M (Table 1).
TABLE 1 cytotoxicity test results of Compound I
2.2 antiviral Activity of Compound I
The results of the antiviral experiments showed that compound I was able to significantly inhibit replication of viral genome in CCHFV YL16070 strain virus-infected supernatant at effective concentrations (table 2).
TABLE 2 evaluation results of the effect of Compound I on CCHFV YL16070 strain
2.3 calculation of EC thereof 50 And CC 50
The formula: cell activity (%) = (a (drug-treated group) -a (blank control))/(a (negative control) -a (blank control)) ×100%
At a multiplicity of viral infection moi=0.01:
the antiviral effect of compound I on the CCHFV YL16070 strain is:
EC 50 ＝8.08μM，CC 50 ＝101.4μM，SI＝12.55。
in the primary drug screening, infected cells were stained with IFA. The results show that compound I significantly inhibited CCHFV infection at 20 μm in vitro (a in fig. 1). Calculated EC of Compound I 50 The value was 8.08.+ -. 2.47. Mu.M, CC 50 The value was 101.4. Mu.M and SI was 12.55 (B in FIG. 1).
Example 2: compound I experiments to protect mice infected with crimia-congo hemorrhagic fever virus from death
2.1 in vivo Experimental design
Type I IFN receptor knockdown using C57BL/6J background was used in all animal experimentsExcept (IFNAR) -/- ) And (3) a mouse. Male or female mice of 12-18 weeks of age are infected with CCHFV (3000 or 5000 TCID by intraperitoneal Injection (IP) 50 ). Mice were dosed IP with different doses of compound I or EIDD-2801 (available from hjohnsony biotechnology company under the designation BCP 32744), 1 time a day, and control groups were given similar solvent injections. Mice were monitored daily for body weight and clinical symptoms. When mice lost more than 20% of their body weight, were unresponsive to tactile stimuli, they were euthanized with isoflurane anesthetics when crawling was difficult. After the control group died, the drug-treated group mice were sacrificed and the mouse organ tissues (liver, spleen) were collected for further viral load determination and pathological analysis.
2.2 experimental results
IFNAR -/- Each mouse was injected intraperitoneally with 3000 TCID 50 CCHFV. The dosage of the compound I injected into the abdominal cavity of the mice is 300mg/kg, and the physiological saline is injected into the abdominal cavity of the mice in the control group. The administration was continued for 8 days from the day of challenge once daily. The results showed that the control group showed severe weight loss, whereas the compound I treated group showed only slight weight loss or weight fluctuation (a in fig. 2). The control group had a mortality of 80% (6/8) on day 7, whereas the compound I treated group showed 100% protection (a in fig. 2). The viral load of the liver and spleen was reduced by about 5log10 copies/g RNA (P < 0.001) following treatment with 300mg/kg compound I (FIG. 2B). Compound I at a dose of 150mg/kg had a similar effect. EIDD-2801 failed to inhibit CCHFV infection in vivo (C in fig. 2). The results of the viral copy number in the tissues of the CCHFV infected mice of this experiment are shown in Table 3.
TABLE 3 copy number of virus in tissue of CCHFV infected mice (Copies/g tisssue)
To characterize the protective effect of compound I in more detail, the viral infection dose was increased to 5000 TCID 50 While reducing the drug dosage. And 3000 TCID 50 The control group had a survival rate of 14% (1/7) (A in FIG. 3) similar at the time of virus infection. Compound I at 150mg/kg or moreThe low dose of 75mg/kg effectively protects mice from weight loss, and the survival rate of the mice is 100%. Viral load detection showed that both doses of compound I treatment significantly reduced CCHFV replication in the liver and spleen (B in fig. 3). Thus, low dose (75 mg/kg) of Compound I effectively protects IFNAR -/- Mice were protected from fatal CCHFV challenge. The results of the viral copy number in the tissues of the CCHFV infected mice of this experiment are shown in Table 4.
TABLE 4 copy number of virus in tissue of CCHFV infected mice (Copies/g tisssue)
To assess whether compound I also provided effective protection by delayed treatment, compound I (150 mg/kg) was administered 24 or 48 hours after CCHFV challenge mice once daily until the end of the experiment. For the 24 hour treatment group, compound I completely protected mice from fatal CCHFV infection (a in fig. 4). The average liver and spleen viral load of compound I treated mice was also significantly reduced (B in fig. 4). However, when the administration time was 48 hours after challenge, the survival rate of the compound I-treated group was 71% (5/7) (a in fig. 4). The mice tissues of the compound I treated group all had significantly reduced viral copy number at 48 hours (B in fig. 4). These data demonstrate that compound I, administered 24 hours later, has complete protection in CCHFV infected mice at a dose of 150 mg/kg. The results of the viral copy number in the tissues of the CCHFV infected mice of this experiment are shown in Table 5.
TABLE 5 viral copy number (Copies/g tisssue) in tissue of CCHFV infected mice
Pathological observations were made on liver and spleen tissues of control and 24h drug-treated mice. Histopathological analysis showed that liver and spleen lesions were evident in the control group (C in FIG. 4). The liver of CCHFV-infected mice developed extensive coagulative necrosis, surrounding fibroblast proliferation, multifocal punctate necrosis of hepatocytes, and edema (C in fig. 4). In addition, liver sinus mononuclear/lymphocyte infiltration was significantly increased. Spleen white and red marrow of infected mice were blurred and spleen sinus mononuclear cells were significantly increased (C in fig. 4). The compound I treatment group only has a small amount of hepatic cell necrosis, the inflammatory reaction is slight, and the structures of spleen white marrow and red marrow are normal and clear. Also, in the control group, the CCHFV NP protein abundant in the liver and spleen was detected by IFA, whereas in the compound I treated group, the viral protein was barely detected (C in fig. 4). Thus, compound I is effective in protecting mice from viral infection and tissue damage.
In conclusion, the compound I can effectively inhibit the Crimedes-Congo hemorrhagic fever virus (CCHFV), can effectively treat diseases caused by the Crimedes-Congo hemorrhagic fever virus (CCHFV) infection, and can remarkably improve the survival rate after infection.
SEQUENCE LISTING
<110> military medical institute of the military academy of China's civil liberation army
Medical use of <120> ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate
<130> IDC220073
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 1
tcaagtggag gaaggacata gg 22
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 2
tccacatgtt cacggctcac tggg 24

Claims (22)

1. The use of a compound of formula I or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of a disease or infection caused by a Crimedes-Congo hemorrhagic fever virus, wherein the disease caused by a Crimedes-Congo hemorrhagic fever virus is Crimedes-Congo hemorrhagic fever virus,
2. use of a pharmaceutical composition comprising a compound of formula I or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment of a disease or infection caused by a Critiferam-Congo hemorrhagic fever virus,
3. the use of claim 2, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or adjuvant.
4. The use of claim 2 or 3, wherein the pharmaceutical composition is a solid formulation or a liquid formulation.
5. The use of claim 2 or 3, wherein the pharmaceutical composition is an injection, an external preparation or a spray.
6. The use of claim 2 or 3, wherein the pharmaceutical composition is a compound formulation.
7. Use of a pharmaceutical composition comprising a compound of formula I or a pharmaceutically acceptable salt thereof,
8. the use of claim 7, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or adjuvant.
9. The use of claim 7 or 8, wherein the pharmaceutical composition is a solid formulation or a liquid formulation.
10. The use of claim 7 or 8, wherein the pharmaceutical composition is an injection, an external preparation or a spray.
11. The use of claim 7 or 8, wherein the pharmaceutical composition is a compound formulation.
12. Use of a pharmaceutical composition comprising a compound of formula I or a pharmaceutically acceptable salt thereof,
13. the use of claim 12, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or adjuvant.
14. The use of claim 12 or 13, wherein the pharmaceutical composition is a solid formulation or a liquid formulation.
15. The use of claim 12 or 13, wherein the pharmaceutical composition is an injection, an external preparation or a spray.
16. The use of claim 12 or 13, wherein the pharmaceutical composition is a compound formulation.
17. The use of claim 12, wherein the cell is a mammalian cell.
18. The use of a compound of formula I or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for use as a Crimepiria-Congo hemorrhagic fever virus inhibitor,
19. the use of a compound of formula I or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for inhibiting replication or propagation of Crimedes-Congo hemorrhagic fever virus in a cell,
20. the use of claim 19, wherein the cell is a mammalian cell.
21. The use of claim 17 or 20, wherein the mammal is a bovine, equine, ovine, porcine, canine, feline, rodent, or primate.
22. The use of claim 17 or 20, wherein the mammal is a human, cat, dog or pig.
CN202210183739.5A 2022-02-25 2022-02-25 Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate Active CN116687932B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210183739.5A CN116687932B (en) 2022-02-25 2022-02-25 Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210183739.5A CN116687932B (en) 2022-02-25 2022-02-25 Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate

Publications (2)

Publication Number Publication Date
CN116687932A CN116687932A (en) 2023-09-05
CN116687932B true CN116687932B (en) 2024-03-29

Family

ID=87843821

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210183739.5A Active CN116687932B (en) 2022-02-25 2022-02-25 Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate

Country Status (1)

Country Link
CN (1) CN116687932B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102617491A (en) * 2011-07-01 2012-08-01 中国人民解放军军事医学科学院毒物药物研究所 3-oxo-3,4-dihydro-2-pyrazinecarboxamide derivative, medicinal composition thereof and preparation method and application of 3-oxo-3,4-dihydro-2-pyrazinecarboxamide derivative
CN102850282A (en) * 2011-07-01 2013-01-02 中国人民解放军军事医学科学院毒物药物研究所 Preparation method and purpose of 3-alkoxy-substituent-2-pyrazinyl formamide compounds
CN115925640A (en) * 2021-08-23 2023-04-07 中国人民解放军军事科学院军事医学研究院 ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate and preparation method and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102617491A (en) * 2011-07-01 2012-08-01 中国人民解放军军事医学科学院毒物药物研究所 3-oxo-3,4-dihydro-2-pyrazinecarboxamide derivative, medicinal composition thereof and preparation method and application of 3-oxo-3,4-dihydro-2-pyrazinecarboxamide derivative
CN102850282A (en) * 2011-07-01 2013-01-02 中国人民解放军军事医学科学院毒物药物研究所 Preparation method and purpose of 3-alkoxy-substituent-2-pyrazinyl formamide compounds
CN115925640A (en) * 2021-08-23 2023-04-07 中国人民解放军军事科学院军事医学研究院 ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate and preparation method and application thereof

Also Published As

Publication number Publication date
CN116687932A (en) 2023-09-05

Similar Documents

Publication Publication Date Title
CN111557939B (en) Use of favipiravir for the treatment of coronavirus infections
US11919923B2 (en) Antiviral application of nucleoside analog or combination formulation containing nucleoside analog
TWI805952B (en) Application of substituted aminopropionate compounds in the treatment of SARS-CoV-2 infection
CN111743899B (en) Application of nitazoxanide and its active form tizoxanide in preparing medicine for treating SARS-CoV-2 infection
CN111803483B (en) Application of benzoate compound in treating SARS-CoV-2 infection
CN111803491A (en) Application of artemisinin compound in treatment of coronavirus infection
WO2022017431A1 (en) Application of benflumetol and derivatives thereof in treatment of coronavirus infection
KR100950428B1 (en) Diarylheptanoid for viral inhibitor
CN116687932B (en) Medical application of ((3-carbamoyl-5-fluoropyrazin-2-yl) oxy) methyl isobutyrate
CN111374985A (en) Medical application of phenazopyridine hydrochloride
WO2021174741A1 (en) Application of dimethyl berbamine compound in inhibition of sars-cov-2
WO2020216349A1 (en) Enterovirus inhibitor
CN118103044A (en) Use of ritonavir for treating SARS-CoV-2 infection
CN118373765A (en) Coronavirus inhibitors and uses thereof
EA046990B1 (en) USE OF SUBSTITUTED AMINOPROPIONATE COMPOUNDS IN THE TREATMENT OF SARS-COV-2 INFECTION
CN118541355A (en) Solid forms of a compound, methods of preparation and uses thereof
KR20090127072A (en) A new diaryl hepatonoid and use of the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant